WO2002068629A2 - Dna constructs for cytoplasmic and mithochondrial expression and methods of making and using same - Google Patents

Abstract

The present invention provides compositions for and methods of delivering heterologous nucleic acid sequences to cells of an individual. Through the use of mitochondrial promoters, the expression of desired polypeptides within the cells of treated individuals is enhanced. The present invention further provides compositions and methods for treating or immunizing individuals against pathogens. Finally, the present invention provides compositions and methods for treating individuals by administering desired heterologous nucleic acid sequences using gene therapy.

Description

DNA CONSTRUCTS FOR CYTOPLASMIC AND MITOCHONDRIAL EXPRESSION AND METHODS OF MAKING AND USING SAME

This application claims priority from a copending provisional application serial number 60/260,427, filed on January 09, 2001, the entire disclosure of which is hereby incorporated by reference.

BACKGROUND OF THE INVENTION

The invention relates generally to delivery vehicles, and more particularly, to nucleic acid vectors useful for delivering a selected moiety to host cells.

Methods for delivering polypeptides to eukaryotic cells by administration of plasmid DNA encoding these peptides have been described using a variety of protocols. The majority of these methods rely on cellular mechanisms which first transport the plasmid DNA to the nucleus in order to obtain transcription by RNA polymerase. The transcribed mRNA must then be transported out of the nucleus to the cytoplasm in order to be translated.

The current plasmid DNA compositions are faced by a number of limitations. One such limitation is the relatively small number of plasmid molecules that become localized to the nucleus following their entry into the cell. It has been estimated that only 0.1 to 1% of transfected DNA molecules make their way into the nucleus; the remainder are confined to the cytosol where they are degraded. Once in the nucleus, other constraints to expression exist. First, the DNA must be transcribed into messenger RNA. The transcribed mRNA must then be transported into the cytoplasm via an exosome in order to be translated, yet transport of RNA is impeded by nuclear RNAases associated with the exosome. See, e.g., Decker et al, "The exosome: a veritable RNA processing machine", Curr. Biol, 8(7):R238-240 (1998). It has recently been presented that approximately 95% of all nuclear transcribed RNA is degraded in the nucleus and is therefore not available for transport (Decker et al., Curr Biol., 8(7): R238-240, 1998). Molecules available for transport can also be detained in the nucleus by other mechanisms, e.g., by association with the spliceosome complexes involved in removing introns from eukaryotic mRNA. These factors constitute barriers that together significantly impact the efficiency of expression of exogenously supplied DNA.

Thus, there is a need for compositions and methods which avoid the limitations in prior art plasmid DNA delivery of a heterologous nucleic acid sequence, by increasing transcription and/or translation of the products encoded by the heterologous nucleic acid sequence.

SUMMARY OF THE INVENTION

In one aspect, the present invention provides a nucleic acid molecule for delivering a heterologous nucleic acid sequence to the cytoplasm and/or mitochondria of a eukaryotic cell. The heterologous nucleic acid sequences are designed to be transcribed in the cytoplasm. This nucleic acid molecule is composed of, at a minimum, a mitochondrial promoter operably linked to a heterologous nucleic acid sequence, wherein the mitochondrial promoter directs expression of the nucleic acid sequence in the cytoplasm and/or mitochondria of a host cell.

In one embodiment, the nucleic acid molecule further contains a polyadenine sequence of adenine residues of sufficient length to provide mRNA expression of the heterologous nucleic acid sequence. Preferably, the molecule also contains a polyadenylation signal. In another embodiment, the nucleic acid molecule further contains a Shine-Dalgarno sequence, and, optionally, means for directing the molecule to the mitochondria. In yet another embodiment, the DNA molecule further contains a Kozak sequence.

In another aspect, the invention provides a host cell containing a nucleic acid molecule of the invention.

In yet another aspect, the invention further provides a composition containing a nucleic acid molecule of the invention and a physiologically compatible carrier. In still another aspect, the invention provides a method of expressing a heterologous nucleic acid sequence in the cytoplasm of a host cell in vitro, ex vivo or in vivo by delivering a DNA molecule of the invention to the cell. In one embodiment, the method involves delivering a DNA molecule containing a polyadenine sequence of sufficient length to provide mRNA expression of the heterologous nucleic acid sequence and a Kozak sequence, and expressing the sequences in the presence of an mRNA capping enzyme or co-expressing with an mRNA capping enzyme. In another embodiment, a heterologous nucleic acid sequence of the invention is co-expressed with a mitochondrial RNA polymerase, preferably without a functional mitochondrial targeting sequence.

In still a further aspect, the invention provides a method of expressing a heterologous nucleic acid sequence in the mitochondria of a host cell in vitro, ex vivo or in vivo. The method involves delivering a DNA molecule of the invention containing a mitochondrial promoter, a Shine-Dalgarno sequence, and a polyadenine sequence of sufficient length to provide mRNA expression of the heterologous nucleic acid sequence. In one embodiment, the DNA molecule also includes a Kozak sequence and co-expresses the molecule with or in the presence of a capping enzyme.

In yet a further aspect, the invention provides a method of inducing an immune response in a human or non-human animal against a selected antigen. The method involves delivering a DNA molecule of the invention in which the heterologous nucleic acid sequence expresses an antigen which induces an immune response.

In still a further aspect, the invention provides a method of treating a human or non-human animal by delivering a nucleic acid molecule of the invention in which the heterologous nucleic acid sequence expresses a biologically active molecule which provides a therapeutic benefit to said animal.

Still other aspects and advantages of the invention will be apparent from the detailed description of the invention. BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1. Illustrates the cloning plasmid pNASSβ into which the minimal and maximal human mitochondrial promoters were cloned, as described in Example 1.

DETAILED DESCRIPTION OF THE INVENTION

Advantageously, by avoiding the requirement for nuclear localization followed by nucleocytoplasmic export, and by promoting cytoplasmic and mitochondrial expression, the nucleic acid molecules of the invention permit enhanced expression of sequences carried on the nucleic acid molecules of the invention. Further, by utilizing the mitochondrial promoter which is ubiquitous and constitutively active in eukaryotic cells, the constructs of the invention avoid the down-regulation which is observed in different tissues with other selected promoters. Thus, the present invention provides DNA molecules containing heterologous nucleic acid sequences which express immunogenic or biologically active RNA, peptides or proteins. The invention further provides compositions and host cells containing these molecules, as well as methods of delivering the nucleic acid molecules of the invention to host cells.

I. The Nucleic Acid Molecule of The Invention

A nucleic acid molecule of the invention contains a heterologous nucleic acid sequence operably linked to a mitochondrial promoter which directs transcription thereof in a host cell. The nucleic acid molecule of the invention may be in the form of any genetic element which will carry the components described herein and deliver them to a cell. Examples of suitable genetic elements include plasmids (most preferably in DNA form), viruses, cosmids, episomes, phage, transposons, chromosomes, and the like. Most preferably, the nucleic acid molecule of the invention is a DNA plasmid. For convenience, the specification refers to DNA molecules or DNA plasmids. However, one of skill in the art will understand that the other genetic elements may be substituted therefor.

In the context of the nucleic acid molecule of the invention, "heterologous nucleic acid sequence" refers to a nucleic acid sequence which is heterologous to the mitochondrial promoter. The nucleic acid sequence may be heterologous or non- heterologous to the host cell and other elements in the molecule. "Operably linked" sequences may be either contiguous with the heterologous nucleic acid sequence or may act in trans, or at a distance to control expression of the heterologous nucleic acid sequence.

A. Mitochondrial Promoter Sequences

The nucleic acid molecules of the invention may contain one or more (i.e., a bi- or multi-cistronic construct) mitochondrial promoters. These promoters are selected from among the minimal heavy strand mitochondrial promoter; the minimal light strand mitochondrial promoter; the maximal heavy strand mitochondrial promoter; the maximal light strand mitochondrial promoter; and a combination of heavy strand and light strand promoters selected from among those listed above.

The mitochondrial promoter may be comprised of the human heavy strand promoter and/or the human light strand promoter; both as described in Chang and Clayton, Cell, 36: 635-643 (1984) see, Fig. 8

The heavy strand promoter is located within SEQ ID NO: 1: 5'-GAACCAACCAAACCCCAAAGACA - 3' and the light strand promoter is located within SEQ ID NO:2

5'-CCCACTGACAATTTTCACGTATGGCGGTTTTCTATTTTAAACTTT - 3'.

Optionally, these promoters may be modified, if needed or desired, including allelic or polymorphic variants. Alternatively, any functional mitochondrial promoters may be selected, including mitochondrial promoters derived from other eukaryotic species, including plants.

B. Heterologous nucleic acid sequence

The heterologous nucleic acid sequence may be any nucleic acid which is desirable to deliver to the host cell. The nucleic acid sequence may encode an immunogen or a biologically active molecule. For example, the nucleic acid sequence may encode a peptide, polypeptide or protein which induces an immune response to a selected immunogen. For example, immunogens may be selected from a variety of viral families. Example of desirable viral families against which an immune response would be desirable include, the picornavirus family, which includes the genera rhinoviruses, which are responsible for about 50% of cases of the common cold; the genera entero viruses, which include polioviruses, coxsackieviruses, echoviruses, and human enteroviruses such as hepatitis A virus; and the genera apthoviruses, which are responsible for foot and mouth diseases, primarily in non-human animals. Within the picornavirus family of viruses, target antigens include the NPl, VP2, VP3, VP4, and VPG. Another viral family includes the calcivirus family, which encompasses the Νorwalk group of viruses, which are an important causative agent of epidemic gastroenteritis. Still another viral family desirable for use in targeting antigens for inducing immune responses in humans and non-human animals is the togavirus family, which includes the genera alphavirus, which include Sindbis viruses, RossRiver virus, and Venezuelan, Eastern & Western Equine encephalitis, and rubivirus, including Rubella virus. The flaviviridae family includes dengue, yellow fever, Japanese encephalitis, St. Louis encephalitis and tick borne encephalitis viruses. Other target antigens may be generated from the Hepatitis C or the coronavirus family, which includes a number of non-human viruses such as infectious bronchitis virus (poultry), porcine transmissible gastroenteric virus (pig), porcine hemagglutinating encephalomyelitis virus (pig), feline infectious peritonitis virus (cats), feline enteric coronavirus (cat), canine coronavirus (dog), and human respiratory coronaviruses, which may cause the common cold and/or non-A, B or C hepatitis. Within the coronavirus family, target antigens include the El (also called M or matrix protein), E2 (also called S or Spike protein), E3 (also called HE or hemagglutin-elterose) glycoprotein (not present in all coronaviruses), or Ν (nucleocapsid). Still other antigens may be targeted against the rhabdovirus family, which includes the genera vesiculovirus (e.g., Vesicular Stomatitis Virus), and the general lyssavirus (e.g., rabies). Within the rhabdovirus family, suitable antigens may be derived from the G protein or the Ν protein. The family filoviridae, which includes hemorrhagic fever viruses such as Marburg and Ebola virus may be a suitable source of antigens. The paramyxovirus family includes parainfluenza Virus Type 1, parainfluenza Virus Type 3, bovine parainfluenza Virus Type 3, rubulavirus (mumps virus, parainfluenza Virus Type 2, parainfluenza virus Type 4, Newcastle disease virus (chickens), rinderpest, morbillivirus, which includes measles and canine distemper, and pneumovirus, which includes respiratory syncytial virus. The influenza virus is classified within the family orthomyxovirus and is a suitable source of antigen (e.g., the HA protein, the Nl protein). The bunyavirus family includes the genera bunyavirus (California encephalitis, La Crosse), phlebovirus (Rift Valley Fever), hantavirus (puremala is a hemahagin fever virus), nairovirus (Nairobi sheep disease) and various unassigned bungaviruses. The arenavirus family provides a source of antigens against

LCM and Lassa fever virus. The reovirus family includes the genera reovirus, rotavirus

(which causes acute gastroenteritis in children), orbiviruses, and cultivirus (Colorado

Tick fever, Lebombo (humans), equine encephalosis, blue tongue). The retrovirus family includes the sub-family oncorivirinal which encompasses such human and veterinary diseases as feline leukemia virus, HTLVI and HTLNπ, lentivirinal (which includes HTV, simian immunodeficiency virus, feline immunodeficiency virus, equine infectious anemia virus, and spumavirinal). The papovavirus family includes the sub-family polyomaviruses (BKU and JCU viruses) and the sub-family papillomavirus (associated with cancers or malignant progression of papilloma). The adenovirus family includes viruses (EX, AD7, ARD, O.B.) which cause respiratory disease and/or enteritis. The parvovirus family feline parvovirus (feline enteritis), feline panleucopeniavirus, canine parvovirus, and porcine parvovirus. The herpesvirus family includes the sub-family alphaherpesviridae, which encompasses the genera simplexvirus (HSVI, HSVII), varicellovirus (pseudorabies, varicella zoster) and the sub-family betaherpesviridae, which includes the genera cytomegalovirus (HCMV, muromegalovirus) and the sub-family gammaherpesviridae, which includes the genera lymphocryptovirus, EBV (Burkitts lymphoma), infectious rhinotracheitis, Marek's disease virus, and rhadinovirus. The pox virus family includes the sub-family chordopoxviridae, which encompasses the genera orthopoxvirus (Variola (Smallpox) and Vaccinia (Cowpox)), parapoxvirus, avipoxvirus, capripoxvirus, leporipoxvirus, suipoxvirus, and the sub-family entomopoxviridae. The hepadnavirus family includes the Hepatitis B virus. One unclassified virus which may be suitable source of antigens is the Hepatitis delta virus.

Still other viral sources may include avian infectious bursal disease virus and porcine respiratory and reproductive syndrome virus. The alphavirus family includes equine arteritis virus and various Encephalitis viruses.

The present invention may also encompass immunogens which are useful to immunize a human or non-human animal against other pathogens including bacteria, fungi, parasitic microorganisms or multicellular parasites which infect human and non- human vertebrates, or from a cancer cell or tumor cell. Examples of bacterial pathogens include pathogenic gram-positive cocci include pneumococci; staphylococci; and streptococci. Pathogenic gram-negative cocci include meningococcus; gonococcus. Pathogenic enteric gram-negative bacilli include enterobacteriaceae; pseudomonas, acinetobacteria and eikenella; melioidosis; salmonella; shigella; haemophilus; moraxella; H. ducreyi (which causes chancroid); brucella; Franisella tularensis (which causes tularemia); yersinia (pasteurella); streptobacillus moniliformis and spirillum; Gram- positive bacilli include listeria monocytogenes; erysipelothrix rhusiopathiae; Corynebacterium diphtheria (diphtheria); cholera; B. anthracis (anthrax); donovanosis (granuloma inguinale); and bartonellosis. Diseases caused by pathogenic anaerobic bacteria include tetanus; botulism; other clostridia; tuberculosis; leprosy; and other mycobacteria. Pathogenic spirochetal diseases include syphilis; treponematoses: yaws, pinta and endemic syphilis; and leptospirosis. Other infections caused by higher pathogen bacteria and pathogenic fungi include actinomycosis; nocardiosis; cryptococcosis, blastomycosis, histoplasmosis and coccidioidomycosis; candidiasis, aspergillosis, and mucormycosis; sporotrichosis; paracoccidiodomycosis, petriellidiosis, torulopsosis, mycetoma and chromomycosis; and dermatophytosis. Rickettsial infections include Typhus fever, Rocky Mountain spotted fever, Q fever, and Rickettsialpox. Examples of mycoplasma and chlamydial infections include: mycoplasma pneumoniae; lymphogranuloma venereum; psittacosis; and perinatal chlamydial infections. Pathogenic eukaryotes encompass pathogenic protozoans and helminths and infections produced thereby include: amebiasis; malaria; leishmaniasis; trypanosomiasis; toxoplasmosis; Pneumocystis carinii; Trichans; Toxoplasma gondii; babesiosis; giardiasis; trichinosis; filariasis; schistosomiasis; nematodes; trematodes or flukes; and cestode (tapeworm) infections.

As another example, the nucleic acid sequence may encode a biologically active molecule, such as an RNA, an enzyme, a polypeptide, protein, or other desired molecule.

Desirable RNA molecules may include tRNA, dsRNA, ribosomal RNA, catalytic RNAs, and antisense RNAs. One example of a useful RNA sequence is a sequence which extinguishes expression of a targeted nucleic acid sequence in the treated animal.

In another embodiment, the nucleic acid molecules of the invention may encode therapeutic molecules, including enzymes, peptides, polypeptides or proteins. Such therapeutic molecules may be useful in the treatment of hyperproliferative conditions, autoimmune diseases and disorders, and for gene therapy (e.g., for amelioration of a condition associated with a defective or deficient gene expression). Examples of suitable molecules are discussed below. As described herein, hyperproliferative conditions include those which are characterized by hyperproliferating cells, as are cancers and psoriasis. To immunize against (or treat) a hyperproliferative disease, a nucleic acid sequence targeted to a polypeptide that is associated with a hyperproliferative disease may be administered to an individual. In certain circumstances, it may be desirable to deliver, via a molecule of the invention, a heterologous nucleic acid sequence encoding an RNA designed to extinguish or inhibit expression of a target polypeptide.

Target polypeptides include those polypeptides which are produced exclusively or at higher levels in hyperproliferative cells as compared to normal cells. Target antigens include polypeptides encoded by oncogenes such as myb, myc, fyn, and the translocation gene bcr/abl, ras, src, P53, neu, trk and EGRF. In addition to oncogene products as target antigens, target polypeptides for anti-cancer treatments and protective regimens include variable regions of antibodies made by B cell lymphomas and variable regions of T cell receptors of T cell lymphomas which, in some embodiments, are also used as target antigens for autoimmune disease. Other tumor-associated polypeptides can be used as target polypeptides such as polypeptides which are found at higher levels in tumor cells including the polypeptide recognized by monoclonal antibody 17-1A and folate binding polypeptides.

Other suitable therapeutic polypeptides and proteins include those which may be useful for treating individuals suffering from autoimmune diseases and disorders by conferring a broad based protective immune response against targets that are associated with autoimmunity including cell receptors and cells which produce "self-directed antibodies. T cell mediated autoimmune diseases include Rheumatoid arthritis (RA), multiple sclerosis (MS), Sjόgren's syndrome, sarcoidosis, insulin dependent diabetes mellitus (EDDM), autoimmune thyroiditis, reactive arthritis, ankylosing spondylitis, scleroderma, polymyositis, dermatomyositis, psoriasis, vasculitis, Wegener's granulomatosis, Crohn's disease and ulcerative colitis.

Each of these diseases is characterized by T cell receptors (TCRs) that bind to endogenous antigens and initiate the inflammatory cascade associated with autoimmune diseases. Administration of the molecule of the invention to deliver immunogens against the variable region of the T cells would elicit an immune response including CTLs to eliminate those T cells. In RA, several specific variable regions of TCRs which are involved in the disease have been characterized. These TCRs include V-3, V-14, V-17 and Vα-17. Thus, delivery of a nucleic acid sequence that encodes at least one of these polypeptides will elicit an immune response that will target T cells involved in RA. In MS, several specific variable regions of TCRs which are involved in the disease have been characterized. These TCRs include N-7 and Vα-10. Thus, delivery of a nucleic acid sequence that encodes at least one of these polypeptides will elicit an immune response that will target T cells involved in MS. In scleroderma, several specific variable regions of TCRs which are involved in the disease have been characterized. These TCRs include V-6, V-8, V-14 and Vα-16, Vα-3C, Vα-7, Vα-14, Vα-15, Vα-16, Vα-28 and Vα-12. Thus, delivery of a nucleic acid molecule that encodes at least one of these polypeptides will elicit an immune response that will target T cells involved in scleroderma.

In order to treat patients suffering from a T cell mediated autoimmune disease, particularly those for which the variable region of the TCR has yet to be characterized, a biopsy (e.g., synovial or other disease site) can be performed. Samples of the T cells present can be taken and the variable region of those TCRs identified using standard techniques. So-called genetic vaccines can be prepared using this information. B cell mediated autoimmune diseases include Lupus (SLE), Grave's disease, myasthenia gravis, autoimmune hemolytic anemia, autoimmune thrombocytopenia, asthma, cryoglobulinemia, primary biliary sclerosis and pernicious anemia. In order to treat patients suffering from a B cell mediated autoimmune disease, the variable region of the antibodies involved in the autoimmune activity must be identified. A biopsy can be performed and samples of the antibodies present at a site of inflammation can be taken. The variable region of those antibodies can be identified using standard techniques. Thus, in patients to be immunized (e.g., against SLE), their sera can be screened for anti-DNA antibodies and a nucleic acid molecule of the invention can be prepared which includes nucleic acid sequences that encode the variable region of such anti-DNA antibodies found in the sera. Common structural features among the variable regions of both TCRs and antibodies are well known. The DNA sequence encoding a particular TCR or antibody can generally be found following well-known methods such as those described in Kabat, et al., 1987 Sequence of Proteins of Immunological Interest, U.S. Department of Health and Human Services, Bethesda MD, which is incorporated herein by reference. In addition, a general method for cloning functional variable regions from antibodies can be found in Chaudhary et al, Proc. Natl. Acad. Sci., USA, 87:1066 (1990), which is incorporated herein by reference.

Some aspects of the present invention relate to gene therapy; that is, to compositions for and methods of introducing into the cells of an individual nucleic acid molecules comprising exogenous copies of genes which either correspond to defective, missing, non-functioning or partially functioning genes in the individual or which encode therapeutic polypeptides, i.e., polypeptides whose presence in the individual will eliminate a deficiency in the individual and/or whose presence will provide a therapeutic effect on the individual thereby providing a means of delivering the polypeptide alternative to protein administration. Examples of therapeutic nucleic acid sequences include a gene which encodes dystrophin or a functional fragment thereof, cystic fibrosis transmembrane receptor (CFTR), omithine transcarbamylase (OTC), and Factor VHI. Examples of genes encoding therapeutic polypeptides include genes which encode erythropoietin, interferon (α, β, γ), low density lipoprotein (LDL) receptor, very low density lipoprotein receptor (VLDLr), GM-CSF, the interleukins (IL) from IL-1 through EL- 19, particularly, IL-2, IL-4, and IL-12, and toxins such as tumor necrosis factor (TNF). Additionally, genetic constructs which encode single chain antibody components which have biological utility and/or which specifically bind to toxic substances can be administered. In some preferred embodiments, genes encoding IL-2, IL-4, interferon, or TNF are delivered to tumor cells which are either present in the individual or are removed and then reintroduced into an individual.

Still other heterologous nucleic acid sequences may be selected for use in constructs and methods of the invention.

C. Other Vector Elements of the Nucleic Acid Molecule A nucleic acid molecule containing these minimum components (i.e., the mitochondrial promoter and heterologous nucleic acid sequence) is useful when expression of an enzyme, protein, polypeptide, or other proteinaceous product from the heterologous nucleic acid sequence is not required or desired. In other embodiments, e.g., where expression from the heterologous nucleic acid sequence is desired, an polyadenine sequence is provided on the nucleic acid molecule 3' to the heterologous nucleic acid sequence. This polyadenine sequence may be located immediately downstream of the nucleic acid sequence. Alternatively, there may be intervening sequences, e.g., spacers, an intron, polyadenylation signals, a processing enzyme, or the like. Suitably, the nucleic acid molecule of the invention is provided with a sufficient number of adenine residues in order to enable RNA expression of the encoded product. The number of adenine residues can be readily determined by one of skill in the art. However, as a guideline, a nucleic acid molecule of the invention may contain about 20 to about 150 adenines, preferably, about 30 to about 70 adenine residues, more preferably, about 30 to about 50 adenine residues, and most preferably, about 35 adenine residues. However, one of skill in the art can readily select fewer adenines or more adenines. As used herein, "polyadenine sequence" or "polyadenine tract" means a string of adenine residues carried on the nucleic acid molecule of the invention. It may be desirable to include a polyadenylation signal in the nucleic acid molecules as well as a polyadenine sequence or tract. While a polyadenylation signal triggers the addition of adenine residues at the 3' end of mRNAs only in the nucleus and not in the cytoplasm, eucaryotic translation machinery recognizes a polyadenylation signal in combination with a polyadenine sequence in mRNAs to be translated, resulting in greater translation efficiency. Typically, such polyadenylation signals are located 5' to the adenine residues. However, the present invention is not limited to the location of the polyadenylation signal or the reason for its inclusion. A polyadenylation sequence may include splice donor and acceptor sites. The polyadenylation sequence generally is inserted following the heterologous nucleic acid sequences. In a bicistronic plasmid, there will be a polyadenine sequence located 3' to each coding sequence. More preferably, there will be a polyadenylation signal, followed by a polyadenine tract, located at the extreme 3' end of each 3' UTR. Most suitably, the polyadenylation signal is derived from a viral, mammalian, or other source. A variety of polyadenylation signals are well known in the art and may be readily selected for inclusion in the construct of the invention. For example, the bovine growth hormone (BGH) polyadenylation signal (see, U.S. Patent 5,122,458) is a preferred polyadenylation signal for use in constructs of the invention. As another example, the SV40 polyadenylation signal may be used.

The nucleic acid molecule of the invention may further contain a transcription terminator, which is suitably located 3' to the polyadenine sequences. Suitable transcription terminators may be readily selected from among bacterial terminators (Mermalaeva et al., "Prediction of transcription terminators in bacterial genomes", J. Mol Biol, 301(l):27-33 (2000); Henkin, "Transcription termination control in bacteria", Curr. Opin. Microbiol, 3(2): 149-153 (2000); Kim and Lee, "Function of the repeated sequence in the 3' flanking region of the Escherichia coli rnpB gene on transcription termination and RNA processing", FEBS Lett, 407(3):353-356 (1997), bacteriophage terminators (see, e.g., Honigman, "Cloning and characterization of a transcription termination signal in bacteriophage lambda unresponsive to the N gene product", Gene, 13(3): 299-309 (1981); mitochondrial terminators (Wang and Shadel, Proc. Natl. Acad. Sci. USA, 96(14): 8046-8051 (1999) viral terminators (see, e.g., Petitclerc et al., "The effect of various introns and transcription terminators on the efficiency of expression vectors in various cultured cell lines and in the mammary gland of transgenic mice", J. Biotechnol., 40(3):169-178 (1995), a pause site terminator (Enriquez-Harris et al, EMBO J., 10(7): 1833-1842 (1991)), a ribonucleolytic cleavage site (Claverie-Martin et al., J. Biol. Chem., 272(21): 13823-13828 (1997)), as well as an autocatalytic ribozyme site, such as are found within Group A introns, Group 1 introns (Cech, "Conserved sequences and structures of group 1 introns: building an active site for RNA catalysis - a review", Gene, 73:259-271 (1988)), and Delta ribozymes (Lai, "The molecular biology of hepatitis delta virus, Annu Rev Biochem., 64:259-286 (1995)).

In one desirable embodiment, the nucleic acid molecule of the invention contains a ribonucleolytic cleavage site followed by a pause site terminator. Typically, the cleavage site and pause site are separated by a spacer of about 20 to 200 nt in length. However, larger or smaller spacers may be utilized.

1. Sequences for Cytoplasmic Expression In order to achieve cytoplasmic expression of the heterologous nucleic acid sequence in a nucleic acid molecule of the invention when an mRNA capping enzyme is co-expressed or otherwise provided, the nucleic acid molecule of the invention contains a Kozak sequence. Typically, this sequence is typically located at -6 to +1, with reference to the start codon (ATG) of the heterologous nucleic acid sequence. See, e.g., M. Kozak, Nucleic Acids Res., 12(2):867-872 (1954), which identifies a consensus sequence, SEQ ID NO:3: CC(A/G)CC[AUG](G) for eukaryotic translations initiation sites.

In addition, a nucleic acid molecule of the invention may contain sequences which facilitate cytoplasmic translation, e.g., sequences which permit recognition of the heterologous nucleic acid sequences by the ribosomal RNA. Such sequences may include an internal ribozyme expression signal (IRES), which permits translation of a "cap-less" message in the cytoplasm. The IRES is encoded within the coding strand, usually within a 5' untranslated region before the translation start site (ATG). See, e.g., Robertson et al., RNA, 5(9): 1167-1179 (1999).

In addition to including an IRES, efficiency of cytoplasmic translation according to the invention may be further increased by co-expressing or otherwise providing a picornavirus (e.g., a poliovirus) protease, which clips the native ribosomal cap binding protein. In the presence of such a viral protease, ribosomes lose their affinity for capped cellular mRNAs, and since cellular mRNAs do not have an IRES, cellular mRNAs are at a relative disadvantage for translation compared to the messages of the invention which contain an IRES.

Other sequences may be readily selected which increase the efficiency of cytoplasmic translation of the constructs of the invention. For example, a picornavirus ribosomal cap binding protein protease may be used. Such picornavirus proteases, include, e.g., poliovirus protease (Tahara et al, "Two forms of purified m7G-cap binding protein with different effects on capped mRNA translation in extracts of uninfected and poliovirus-infected HeLa cells", J. Biol. Chem., 256(15):7691-7694 (1981). These picornavirus proteases may be more desirable in constructs in which the nucleic acid molecule will be used to induce an immune response (or cell death), because in certain circumstances they may enhance such a response. In certain embodiments, it may be desirable to place the picornavirus protease under the control of a relatively weak promoter such as, the adeno-associated virus (AAV) inverted terminal repeats (ITRs).

Additionally or alternatively to the IRES sequences, mRNA capping enzymes or another capping sequence may be co-expressed with the heterologous nucleic acid sequence. Such sequences may be carried on the nucleic acid molecule or co-expressed from a separate molecule or by the host cell. Suitably, the capping enzyme or capping sequence is operably linked to regulatory sequences which direct its expression and which are distinct from the regulatory sequences expressing the heterologous nucleic acid sequence. A preferred viral mRNA capping enzyme is the vaccinia capping enzyme, e.g., Moss et al, Proc. Natl. Acad._Sci. USA, 90(7):2860-2864 (1993) and J. Virol, 74(12):5486-5494 (2000). In another embodiment, it is desirable to include an IRES sequence in the construct of the invention and co-express or otherwise deliver a modified eukaryotic initiation factor (e_F4G protein) in order to increase cytoplasmic translation. eIF4G is a cellular ribosomal cap binding protein which associates with other eukaryotic initiation factors and the ribosome and is involved in the translation process. Truncated e_F4G, which consists of the C-terminal half of the protein, continues to associate with the ribosome, but this truncated complex no longer translates capped mRNA (Sonnenberg et al, Mol Cell. Biol, 29(2):468-477 (2000)). Accordingly, co-expression of truncated eIF4G enhances translation of uncapped IRES - containing message. Alternatively, instead of using a truncated eIF4G protein, the e_F4G protein may be mutated so that the domain which normally recognizes capped mRNAs no longer does so (Tarun and Sachs, Mol. and Cell Biol, 17(12):6876-6886 (Dec. 1997)). Co-expression of modified eIF4G may be advantageous in some applications compared to the use of a picornavirus protease in that modified eIF4G does not cause apoptotic cell death. Desirably, one can co-express a variety of different sequences to increase the efficiency of cytoplasmic transcription. Such sequences can be included on the nucleic acid molecule carrying the heterologous nucleic acid sequence, e.g., in a bicistronic plasmid(s), expressed by the host cell, or a different molecule. Where co-expressed on a different molecule, any suitable genetic element may be utilized for delivery of the co- expressed sequence. Suitable genetic elements include, e.g., plasmids (most preferably in DNA form), viruses, cosmids, episomes, phage, transposons, chromosomes, and the like. Most preferably, the nucleic acid molecule of the invention is a DNA plasmid.

In one embodiment, mitochondrial (mt) RNA polymerase is co-expressed with the heterologous nucleic acid sequence, either from the nucleic acid molecule of the invention, or separately. Typically, the mitochondrial RNA polymerase will be used with the mitochondrial targeting sequence intact. However, it may be desirable to express mtRNA polymerase with the mt targeting sequence deleted or. otherwise modified to increase cytoplasmic transcription (Wang and Shadel, Proc. Natl. Acad. Sci. USA, 96(14):8046-8051 (1999)). For example, the mitochondrial RNA polymerase may be modified to contain a deletion in the mitochondrial targeting sequence, e.g., where expression in the cytoplasm is desirable, but mitochondrial targeting is not desired.

In another embodiment, a mt RNA polymerase specificity factor which increases the affinity of mt RNA polymerase for the mt promoter may be co-expressed, either alone or in combination with the mt RNA polymerase. (Jan and Jaehning, "The yeast mitochondrial RNA polymerase specificity factor, MTF1, is similar to bacterial sigma factors", J. Biol. Chem., 266(33):22671-22677 (1991); Schinkel et al., "Specificity factor of yeast mitochondrial RNA polymerase. Purification and interaction with core RNA polymerase", I. Biol. Chem., 262(26): 12785-12791 (1987)). This mitochondrial RNA polymerase specificity factor has a mitochondrial targeting leader sequence, which can be deleted or left intact, or both.

In one particularly desirable embodiment, a nucleic acid molecule for expressing a heterologous nucleic acid sequence in the cytoplasm of a eukaryotic cell will contain, from 5' to 3', a mitochondrial promoter operably linked to a heterologous nucleic acid sequence, a Kozak sequences, a heterologous sequence to be expressed and a polyadenine sequence of adenine residues of a sufficient length to provide mRNA expression of the heterologous nucleic acid sequence. Optionally, this molecule may further contain a polyadenylation signal located 5' to the polyadenine sequence and/or a terminator sequence located at the extreme 3' end of the molecule. Co-expressed with the heterologous nucleic acid sequence is a capping enzyme, which may be contained on the nucleic acid molecule under the control of a promoter which is preferably different from that which controls expression of the heterologous nucleic acid sequence. However, other nucleic acid molecules of the invention can be readily generated by one of skill in the art, in view of the information provided herein.

2. Sequences for Mitochondrial Expression

In order to achieve mitochondrial expression of the heterologous nucleic acid sequence, a nucleic acid molecule of the invention contains a Shine-Dalgarno sequence, e.g., SEQ ID NO:4: AGGAGG(U) (in the mRNA), located upstream of the message and recognized by the 16S ribosome in prokaryotes and in mitochondria. The Shine-Dalgarno sequence is 6 base pairs in length and is typically located in the range of -16 to +1, with reference to the start codon (ATG) of the heterologous nucleic acid sequence. The Shine-Dalgarno sequence is a tract of six purines. Although AGGAGG (SEQ ID NO:5) is frequently used, 6As (SEQ ID NO:6), 6Gs (SEQ IDNO:7), or combinations thereof may also be utilized.

Where desirable, a nucleic acid molecule of the invention may contain a Shine- Dalgarno sequence followed by a Kozak sequence. The Kozak sequence flanks the ATG, or transcription initiation site. Such a nucleic acid molecule provides the advantage of permitting expression of the heterologous nucleic acid molecule in either the cytoplasm or the mitochondria.

In one particularly desirable embodiment, a nucleic acid molecule for expressing a heterologous nucleic acid sequence in the mitochondria of a eukaryotic cell contains a Shine-Dalgarno sequence; a mitochondrial promoter operably linked to a heterologous nucleic acid sequence, and a polyadenine sequence of sufficient length to provide mRNA expression of the heterologous nucleic acid sequence. More preferably, the construct will include a polyadenylation signal followed by a polyadenine sequence.

The nucleic acid molecule may be provided with sequences which will facilitate targeting of the molecule to the mitochondria. The inclusion of these targeting sequences is particularly desirable where external means of targeting the molecule to the mitochondria such as a gene gun or a mitochondria disruption agent will not be used. Examples of sequences which may be used for targeting the molecule of the invention to the mitochondria include a trafficking signal such as the mitochondrial RNA polymerase, or sequences encoding a protein which is imported into the mitochondria (e.g., during nuclear division) to which the heterologous nucleic acid sequences may be linked.

Still other methods of targeting the nucleic acid molecules of the invention to the mitochondria may be selected. In addition, the molecules of the invention may contain sequences for enhancing expression in both the cytoplasm and the mitochondria, or both native and modified (without mt targeting function) mitochondrial RNA polymerase can be provided. In designing the nucleic acid molecules of the invention, codons within the heterologous nucleic acid sequence to be expressed may be selected taking into consideration whether expression is desired in the cytoplasm, in the mitochondria, or both. For example, it is known that one cytoplasmic stop codon is a tryptophan codon in mitochondria. See, e.g., Zhang and Zubay, Genet. Eng., 13:73-113 (1991); Xia, Genetics, 144(3): 1309-1320 (1996); Tomita et al., Nucleic Acids Res., 27(21):4291-4297 (1999).

3. Multicistronic Nucleic Acid Molecules In a molecule of the invention, the mitochondrial promoter is used for driving expression of the heterologous nucleic acid sequence and one may select a second mitochondrial promoter for driving expression of another product carried on the molecule which is to be co-expressed. In such a molecule, the second mitochondrial promoter may be selected without regard to the selection of the first mitochondrial promoter. For example, if the first mitochondrial (mt) promoter (which is operably linked to a first heterologous nucleic acid sequence) is a heavy strand mt promoter, the second mt promoter may be a light strand mt promoter. In another example, the first and second mt promoters may both be heavy strand, or both be light strand promoters. Other combinations will be readily apparent. Selection of light and heavy strand mt promoters is without limitation as to whether the minimum or maximal promoter strands are selected for the first and/or second promoters.

Alternatively, a molecule of the invention may have a transcription unit in which the promoter driving expression of the product to be co-expressed with the heterologous nucleic acid sequence is a non-mitochondrial promoter. In certain embodiments, high-level constitutive expression will be desired. Examples of useful constitutive promoters include, without limitation, the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV enhancer) (see, e.g., Boshart et al, Cell, 41:521-530 (1985), the SV40 promoter, the dihydrofolate reductase promoter, the β-actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EFlα promoter (Invitrogen). Inducible promoters, regulated by exogenously supplied compounds, are also useful and include, the zinc-inducible sheep metallothionine (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system (International Application WO 98/10088); the ecdysone insect promoter (No et al, Proc. Natl. Acad. Sci. USA, 93:3346-3351 (1996)), the tetracycline-repressible system (Gossen et al, Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992)), the tetracycline-inducible system (Gossen et al, Science, 268:1766-1769 (1995), Harvey et al, Curr. Opin. Chem.

Biol, 2:512-518 (1998)), the RU486-inducible system (Wang etal, Nat. Biotech., 15:239-243 (1997)) and Wang et al, Gene Ther., 4:432-441 (1997)) and the rapamycin-inducible system (Magari et al, I. Clin. Invest., 100:2865-2872 (1997)). Other types of inducible promoters which may be useful in this context are those which are regulated by a specific physiological state, e.g., temperature, acute phase, a particular differentiation state of the cell, or in replicating cells only. Another embodiment of the nucleic acid molecule includes a coding sequence operably linked to a tissue-specific promoter. For instance, if expression in skeletal muscle is desired, a promoter active in muscle should be used. These include the promoters from genes encoding skeletal α-actin, myosin light chain 2A, dystrophin, muscle creatine kinase, as well as synthetic muscle promoters with activities higher than naturally-occurring promoters (see Li et al, Nat. Biotech., 17:241-245 (1999)). Examples of promoters that are tissue-specific are known for liver (albumin, Miyatake et al. I. Virol, 71:5124-32 (1997)); hepatitis B virus core promoter, Sandig et al., Gene Ther., 3:1002-9 (1996)); alpha-fetoprotein (AFP), Arbuthnot et al, Hum. Gene Ther., 7:1503-14 (1996), bone osteocalcin (Stein et al, Mol. Biol. Rep., 24:185-96 (1997)); bone sialoprotein (Chen et al., I. Bone Miner. Res., 11:654-64 (1996)), lymphocytes; CD2 (Hansal et al, J. Immunol, 161:1063-8 (1998)); immunoglobulin heavy chain; T cell receptor α chain, neuronal such as neuron-specific enolase (NSE) promoter (Andersen et al. Cell. Mol. Neurobiol, 13:503-15 (1993)), neurofilament light-chain gene (Piccioli et al., Proc. Natl. Acad. Sci. USA, 88:5611-5 (1991)), and the neuron-specific vgf gene (Piccioli et al, Neuron, 15:373-84 (1995)), among others. In addition, the molecule of the invention may contain common vector elements such as enhancer or intron sequences. Suitable enhancers may be readily selected from, e.g., an immunoglobulin gene, SV40, cytomegalovirus, and the like. Examples of suitable intron sequences include the SV-40 T intron sequence. Selection of these and other common vector elements are within the ability of one of ordinary skill in the art (see, e.g., Sambrook et al, and references cited therein at, e.g., pages 3.18-3.26 and 16.17- 16.27 and Ausubel et al, Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989).

These vector elements and the other sequences used in the constructs of the invention may be derived from academic, non-profit (e.g., the American Type Culture Collection, Manassas, Virginia) or commercial sources. Alternatively, the sequences may be produced recombinantly, using genetic engineering techniques, or synthesized using conventional techniques (e.g., Barony and Meπifield, 77ιe Peptides: Analysis, Synthesis & Biology, Academic Press, pp. 3-285 (1980)), with reference to published sequences, including sequences contained in publicly accessible electronic databases. In the following specification, it will be understood that a reference to sequences involves any suitable means of obtaining the referenced sequences.

II. Production of Nucleic Acid Molecule

Conventional techniques may be utilized for construction of the nucleic acid molecules of the invention. See, generally, Sambrook et al, Molecular Cloning: A Laboratory Manual, Second Edition, Eds: Sambrook, Fritsch and Maniatis, Cold Spring Harbor Laboratories, Cold Spring Harbor, New York (1989). Once the desired molecules are engineered, they may be transferred to a host cell by any suitable method. Such methods include, for example, transfection, electroporation, liposome delivery, membrane fusion techniques, high velocity DNA-coated pellets, viral infection and protoplast fusion. Facilitating agents which increase uptake and expression of DNA may also be used. Examples of facilitating agents are described in, e.g., Boutin, U.S. Patent 5,837,533, (complexes comprising a nucleic acid bound to a cationic polyamine having an endosome membrane disruption agent, as well as a variety of optional functionalities); bupivacaine, Weiner et al., U.S. 5,593,972; Gebeyehu et al., U.S. Patent 6,075,012 (cationic lipids and lipophilic compounds for making lipid aggregates for delivery of macromolecules and other compounds into cells); Draper, U.S. Patent 6,086,900 (membrane-penetrating toxin proteins deliver agents to the cytoplasm of target cells); Woo et al., U.S. Patent 6,033,884 and U.S. Patent 5,994,109 (nucleic acid transporter system containing a binding molecule non-covalently bound to the nucleic acid and to which a surface ligand, nuclear ligand and/or lysis agent are bound); Ts'o et al, U.S. Patent 5,995,517 (oligodeoxynucleoside methylphosphonate neoglycopeptide conjugates for tissue specific delivery into cells). Other suitable facilitating agents may be readily selected by one of skill in the art. The host cell itself may be selected from any eukaryotic cell, including insects, and yeast, among others. In one desirable embodiment, the host cell is selected from among mammalian species, and particularly from among human cell types. Suitable cells include, without limitation, cells such as CHO, BHK, MDCK, and various murine cells, e.g., 10T1/2 and WEHI cells, African green monkey cells, suitable primate cells, e.g., VERO, COS1, COS7, BSC1, BSC 40, and BMT 10, and human cells such as WI38, MRC5, A549, human embryonic retinoblast (HER), human embryonic kidney (HEK), human embryonic lung (HEL), TH1080 cells. Other suitable cells may include NIH3T3 cells (subline of 3T3 cells), HepG2 cells (human liver carcinoma cell line), Saos-2 cells (human osteogenic sarcomas cell line), HuH7 cells or HeLa cells (human carcinoma cell line). In a preferred embodiment, appropriate cells include the human embryonic kidney 293T cells (which express the large T antigen) (ATCC). Neither the selection of the mammalian species providing the cells nor the type of mammalian cell is a limitation of this invention. Regardless of how the genetic elements are introduced into the host cell, the cells cultured according to standard methods. See, e.g., Sambrook et al, cited above. A host cell which stably contains one or more of the desired elements (e.g., which co-expresses a capping enzyme) may be prepared using techniques known to those of skill in the art. Such techniques include cDNA, genomic cloning, which is well known and is described in Sambrook et al, cited above, and use of overlapping oligonucleotides in the target sequences, combined with polymerase chain reaction, synthetic methods, and any other suitable methods which provide the desired nucleotide sequence. Introduction of the molecules (as plasmids or another vector element) into the host cell may also be accomplished using techniques known to the skilled artisan and as discussed throughout the specification. In a preferred embodiment, standard transfection techniques are used, e.g., CaPO₄ transfection or electroporation, and/or infection by viral vectors into cell lines such as those described above. Each of the desired sequences stably contained within the host cell may be under the control of regulatory elements, such as those discussed above in connection with the heterologous nucleic acid sequence.

Regardless of the production method utilized, the nucleic acid molecules of the invention may be readily purified from culture using methods known to those of skill in the art. One suitable method involves ultracentrifugation with or without sucrose or affinity chromatography. Conventional techniques may be used to concentrate the resulting nucleic acid molecule.

III. Pharmaceutical and Immunogenic Compositions

In order to facilitate delivery ex vivo or in vivo, the nucleic acid molecule of the invention may be mixed with a suitable physiologically compatible carrier and, optionally, other inert components, i.e., which have no detectable biological effect.

Thus, the compositions of the invention contain nucleic acid molecules of the invention, or mixtures thereof, in an amount of about 1 ng to about 100 mg nucleic acids, and are formulated according to the mode of administration to be used and the desired effect, e.g., immunogenic or therapeutic. In one suitable embodiment, the nucleic acid molecules are the sole active component of the compositions. Examples of suitable inert components in such compositions may include carriers (e.g., water, saline), preservatives, stabilizers (e.g., gelatin and albumin), and the like. For example, in cases where injection is the chosen mode of administration, an isotonic formulation is preferably used. Generally, additives for isotonicity can include sodium chloride, dextrose, mannitol, sorbitol and lactose. In some cases, isotonic solutions such as phosphate buffered saline are preferred. In some embodiments, the compositions of the invention contain molecules which co-express sequences that facilitate or enhance expression of the heterologous nucleic acid sequence in the cytoplasm or mitochondria. Such molecules may encode the capping enzyme, mitochondrial RNA polymerase, or picornavirus protease, or other desirable sequences for co-expression which are discussed herein. Such molecules are generally provided in a ratio of about 1:100 to 100:1, and but most preferably about 1:1 heterologous nucleic acid sequences (carried on nucleic acid molecule) to co-expressed sequence. One of skill in the art can readily adjust this ratio as needed.

In some embodiments, it may be desirable to formulate the compositions of the invention such that they contain the nucleic acid molecules of the invention in a mixture containing other active components. For example, it may be desirable to include a cytokine, e.g., IL-12 (Genetics Institute, Cambridge, MA), in the composition to enhance the immune response. Alternatively, it may be desirable to include an immunosuppressant, e.g., cyclosporin A, where minimization of the immune response is desired. In some embodiments, a vasoconstriction agent is added to the formulation. For example, the nucleic acid molecule of the invention may be formulated into a composition which further contains a co-agent which facilitates uptake of DNA molecules by a cell. Examples of co-agents are described in U.S. Patent No. 5,593,972; U.S. Patent No. 5,739,118 and International Application Serial Number PCT/US94/00899, filed January 26, 1994, which are each incorporated herein by reference. In some embodiments, co-agents may be cationic lipids, including but not limited to, those described in U.S. Patent No. 5,703,055. Examples of other co-agents include growth factors, cytokines and lymphokines such as alpha-interferon, gamma-interferon, platelet derived growth factor (PDGF), tumor necrosis factor (TNF), epidermal growth factor (EGF), IL-1, IL-2, EL-4, IL-6, IL-8, IL-10, IL-12, and IL-18 as well as fibroblast growth factor (FGF), surface active agents such as immune-stimulating complexes (ISCOMS), Freund's incomplete adjuvant, Stimulon™ QS-21 (Aquila Biopharmaceuticals, Inc., Worcester, MA), MPL™ (3-O-deacylated monophosphoryl Lipid A; Corixa, Hamilton, MT), aluminum phosphate, aluminum hydroxide, cobra toxin, saponins, muramyl peptides, quinone analogs and vesicles such as squalane and squalene, and hyaluronic acid (HA). Additionally, CpG oligonucleotides may be included, either as a separate component as described in published International Application WO 96/02555, or incorporated within the nucleic acid molecule for delivering a heterologous nucleic acid sequence. See, published International Application No. WO 97/28259. In some embodiments, an immunomodulating protein may be used as a co-agent. Preferred compositions that facilitate uptake of the DNA molecules of the invention by a cell are selected from the group consisting of: cationic lipids, liposomes and local anesthetics. In some embodiments, multiple co-agents are used.

In another embodiment, the nucleic acid molecule of the invention is formulated with bupivacaine and compounds that display a functional similarity to bupivacaine in order to facilitate uptake of the nucleic acid molecule and, thus, expression of the heterologous nucleic acid sequence. See, e.g., Intemational Application No. WO 98/48780. Bupivacaine-HCl is chemically designated as 2-piperidinecarboxamide, l-butyl-(2,6- dimethylphenyl)monohydro-chloride monohydrate and is widely available commercially for pharmaceutical uses from many sources including Astra Pharmaceutical Products Inc. (Westboro, Mass.) and Sanofi Winthrop Pharmaceuticals (New York, N.Y.). Bupivacaine is commercially formulated with and without methylparaben and with or without epinephrine. Any such formulation may be used. It is commercially available for pharmaceutical use in concentrations of 0.25%, 0.5% and 0.75% which may be used in the present invention. According to the present invention, about 250 μg to about 10 mg of bupivacaine is administered. In some embodiments, about 250 μg to about 7.5 mg is administered. In some embodiments, about 0.50 mg to about 5.0 mg is administered. In some embodiments, about 1.0 mg to about 3.0 mg is administered. In some embodiments about 5.0 mg is administered. Alternative concentrations which elicit desirable effects may be prepared. Alternatively, other local anesthetics may be used as facilitators. Examples of suitable anesthetics include, without limitation, mepivacaine, lidocaine, procaine, carbocaine and methyl bupivacaine, other similarly acting compounds may be used.

Still other components for inclusion in a composition of the invention will be readily apparent to one of skill in the art. Selection of such components is not a limitation of the present invention.

IV. Delivery to Host Cells

The composition and thus, the nucleic acid molecules of the invention, are well suited for delivery to host cells in vitro for production of a variety of encoded products, e.g., RNA, enzymes, peptides, including polypeptides and proteins. Alternatively, the molecules of the invention are useful for a variety of research uses, and for screening assays, tissue culture. A variety of such uses will be readily apparent to those of skill in the art. In addition, the compositions and nucleic acid molecules of the invention are well suited for ex vivo and in vivo delivery to humans (i.e., medical use) and non-human (i.e., veterinary use) for a variety of indications including immunization or therapy. In a particularly desirable embodiment, the nucleic acid molecule is delivered in the form of a DNA plasmid. Thus, in another embodiment, the nucleic acid molecules of the invention are useful for ex vivo transduction of target cells. Generally, ex vivo therapy involves removal of a population of cells containing the target cells, transduction of the cells in vitro, and then reinfusion of the transduced cells into the human or veterinary patient. Such ex vivo transduction is particularly desirable when the target cells are dendritic cells or macrophages and/or when the heterologous nucleic acid sequence being delivered is highly toxic, e.g., in the case of some genes used in the treatment of cancer. However, one of skill in the art can readily select ex vivo therapy according to the invention, taking into consideration such factors as the type of target cells to be delivered, the molecule to be delivered, the condition being treated, the condition of the patient, and the like. In another embodiment, i.e., for in vivo delivery of the heterologous nucleic acid sequences, any suitable route of administration of the nucleic acid molecule of the invention may be used, including, direct delivery to the target organ, tissue or site, intranasal, inhalation, intravenous, intramuscular, subcutaneous, intradermal, vaginal, rectal, and oral administration. Routes of administration may be combined within the course of repeated therapy or immunization. For example, the gene gun is available commercially, e.g., from PowerJect and may be used according to manufacturer's instructions. The nucleic acid molecule is most desirably delivered in the form of a DNA plasmid. According to some methods of the invention, the nucleic acid molecule of the invention is delivered by a route of administration selected from the group consisting of: intramuscularly, intranasally, intraperitoneally, subcutaneously, intradermally, or topically or by lavage to mucosal tissue selected from the group consisting of vaginal, rectal, nasal, pulmonary, urethral, buccal, sublingual, or any other mucosal route. Preferred routes of administration include intradermal, transdermal, subcutaneous, intraperitoneal, intramuscular, inhalation and oral. Modes of administration include, but are not limited to, intravenous lines, syringes, needleless injectors, and nebulizers and other inhalation devices.

Thus, the invention provides a method of inducing an immune response in a human or non-human animal against a selected antigen by delivering a nucleic acid molecule according to the invention which encodes the antigen.

The invention further provides a method of treating a human or non-human animal by delivering a nucleic acid molecule according to the invention expressing the molecule in a sufficient amount to providing a therapeutic benefit to the animal. The method involves delivering a nucleic acid molecule of the invention to a host cell comprising a mitochondrial promoter operably linked to a heterologous nucleic acid sequence, wherein the mitochondrial promoter directs expression of the nucleic acid sequence in the cytoplasm of a host cell.

According to the present invention, any means suitable for introducing the molecule into the mitochondria may be utilized. In one particularly desirable embodiment, the molecule includes a disruption agent which permits entry of the molecule into the mitochondria and re-sealing of the membrane. In another embodiment, a gene gun may be utilized for mitochondrial targeting.

In some embodiments, it may be desirable to administer separately co-agents useful for uptake of DNA by the host cell either simultaneously, before or after administration of nucleic acid molecules. Such co-agents are discussed in more detail above.

In other embodiments, bupivacaine is co-administered with a pharmaceutical composition of the invention either before, simultaneously with, or after the pharmaceutical composition. More preferably, the nucleic acid of the invention is formulated together with bupivacaine or other local anaesthetic facilitators. For example, in some embodiments about 50 μl to about 2 ml, preferably 50 μl to about 1500 μl and more preferably about 1 ml of 0.5% bupivacaine-HCl and 0.1% methylparaben in an isotonic pharmaceutical carrier. Similarly, in some embodiments, about 50 μl to about 2 ml, preferably 50 μl to about 1500 μl and more preferably about 1 ml of 0.5% bupivacaine-HCl in an isotonic pharmaceutical carrier is administered at the same site as the pharmaceutical composition either before, simultaneously with, or after the vaccine is administered. See, Ciccarelli et al, International Application No. WO 98/48780. In some embodiments of the invention, the individual is first subjected to bupivacaine injection prior to delivery of the pharmaceutical composition of the invention. That is, for example, up to about a week to ten days prior to intramuscular injection of the pharmaceutical composition of the invention, the individual is first injected with bupivacaine. In some embodiments, prior to immunization, the individual is injected with bupivacaine about 1 to 5 days before administration of the pharmaceutical composition. In some embodiments, prior to immunization, the individual is injected with bupivacaine about 24 hrs before administration of the pharmaceutical composition. Alternatively, bupivacaine can be injected either simultaneously, minutes before or after immunization.

In some embodiments, the bupivacaine is administered after administration of the pharmaceutical composition. For example, up to about a week to ten days after administration of the pharmaceutical composition, the individual is injected with bupivacaine. In some embodiments, the individual is injected with bupivacaine about 24 hrs after immunization. In some embodiments, the individual is injected with bupivacaine about 1 to 5 days after vaccination. In some embodiments, the individual is administered bupivacaine up to about a week to ten days after immunization.

Depending upon the route of delivery and the indication for which the molecule of the invention is being delivered, a dose of the nucleic acid molecule may range from about 1 ng to 100 mg. For example, a gene gun usually delivers a dose of about 1 to 10 ng, needle delivery usually delivers about 50 μg to about 3 mg DNA, whereas an oral formulation may contain a higher amount of DNA, e.g., about 1 mg to about 100 mg, or from about 5 mg to about 50 mg, or from about 10 mg to about 20 mg. The dose may be repeated, as needed or desired, daily, weekly, monthly, or at other selected intervals.

Where desired, the compositions of the invention may be co-administered with a molecule containing a co-expressed molecule, e.g., a mRNA capping enzyme, mt specificity factor, mt RNA polymerase, picornavirus protease, a modified eIF4G, eFI4G protein, or other similar sequence. Such sequences may be provided on a separate molecule (e.g., a plasmid) or other suitable genetic element and operably linked to regulatory sequences which direct expression thereof in the host cell. These co-expressed molecules may include the capping enzymes or other capping sequences described herein, as well as a variety of different sequences which increase the efficiency of transcription and/or translation. Such co-expressed molecules may include the mitochondrial RNA polymerase (with or without the mitochondrial targeting sequences), a mitochondrial polymerase specificity factor, a picornavirus ribosomal cap binding protein protease or an eIF4G protein, such as are discussed in more detail above. Other desirable co- expressed molecules may include those which facilitate targeting of the molecule through the use of a trafficking signal such as the mitochondrial RNA polymerase, or sequences encoding a protein which is imported into the mitochondria (e.g., during nuclear division) to which the heterologous nucleic acid sequences may be linked. Yet another co- expressed molecule may include a mitochondria disruption agent (Hoke et αl, J. Biol. Chem., 262(23): 11203-11210 (1988) (gold complexes of bidentate phosphines as inhibitors of mitochondrial function); Ulrich et al, Toxicology, 131(l):33-47 (1998) (disruption of mitochondrial activities by a quinoxalinone anxiolytic and its carboxylic acid metabolite).

V. Examples

The following examples are provided to illustrate the invention and do not limit the scope thereof. One skilled in the art will appreciate that although specific reagents and conditions are outlined in the following examples, modifications can be made which are meant to be encompassed by the spirit and scope of the invention.

Example 1 Generation of Constructs

The heavy and light strand minimal and maximal human mitochondrial promoters were cloned into pNASSβ (HG. 1) obtained from Clontech (Palo Alto, CA). The promoter elements were cloned into the Not I site at nucleotide position 200 of pNASSB. The Not I end was blunted prior to all clonings. The cloned promoters are positioned just upstream from the encoded β-galactosidase gene.

Sequences for the promoter elements were obtained from Chang and Clayton, Cell, 36: 635-643 (1984). The top strand and bottom strand of each promoter were synthesized as oligonucleotides. Oligonucleotides were synthesized by Retrogen (San Diego, CA). The oligonucleotides were cloned into the Not I site using chain reaction cloning (CRC), a directional cloning technique (Pachuk et al, 'Chain reaction cloning: a one-step method for directional ligation of multiple DNA fragments ", Gene, 243: 19-25 (2000); U.S. Patent 6,143,527). The sequences of the oligonucleotides encoding the four human mitochondrial promoters and the CRC primers used to clone the oligonucleotides are listed below.

A cytoplasmic polyadenylation signal and terminator for mitochondrial polymerase (Kruse et al, "Termination of transcription in human mitochondria: identification and purification of a DNA binding protein factor that promotes termination " Cell, 58: 391-397 (1989) was cloned into one subset of vectors, such that there is a vector with a mitochondrial promoter and a cytoplasmic polyadenylation signal and a vector with only the mitochondrial promoter. The top strand and the bottom strand of the cytoplasmic polyadenylation signal were synthesized as oligonucleotides. The oligonucleotides were cloned into the Not I site (located at position 3700 on the pNASSB vector - see FIG. 1). The Not I site was blunted prior to cloning. Cloning was directional using the CRC technique.

The sequences of the promoter oligonucleotides and the CRC oligonucleotides used in the ligation reaction are indicated below. Sequences of the cytoplasmic polyadenylation signal oligonucleotides and the CRC oligonucleotides used to clone these oligos are also indicated below.

HUMAN LIGHT STRAND MAXIMAL PROMOTER:

SEQ ID NO:8: Promoter oligonucleotide A.

5ΑATGTGTTAGTTGGGGGGTGACTGTTAAAAGTGCATACCGCCAAAAGAT AAAATTTGAAATCTG 3'

SEQ ID NO:9: Promoter oligonucleotide B

5'CAGATTTCAAATTTTATCTTTTGGCGGTATGCACTTTTAACAGTCACCCC CCAACTAACACATT 3'

SEQ ID NO: 10: CRC oligonucleotide 5'.

5' CGGAATTGTACCCGCGGCCAATGTGTTAGTTGGGGGGTG 3'

SEQ ID NO: 11 : CRC oligonucleotide 3'. 5'GCCAAAAGATAAAATTTGAAATCTGGGCCGCAATTCCCGGGGATC3'

HUMAN LIGHT STRAND MINIMAL PROMOTER:

SEQ ID NO: 12: Promoter oligonucleotide A. 5' GGGTGACTGTTAAAAGTGCATACCGCCAAAAGATAAAATTTGAA 3'

SEQ ID NO: 13: Promoter oligonucleotide B.

5' TTCAAATTTTATCTTTTGGCGGTATGCACTTTTAACAGTCACCC 3'. SEQ ID NO: 14: CRC oligonucleotide 5'. 5' CGGAATTGTACCCGCGGCCGGGTGACTGTTAAAAGTGC 3'.

SEQ ID NO: 15: CRC oligonucleotide 3.

5' CCGCCAAAAGATAAAATTTGAAGGCCGCAATTCCCGGGG 3^* Human heavy strand maximal promoter:

SEQ ID NO: 16: Promoter oligonucleotide A 5' CACACCGCTGCTAACCCCATACCCCGAACCAACCAAACCCCAAAGACAC

3'

SEQ ID NO: 17: Promoter oligonucleotide B 5' GTGTCTTTGGGGTTTGGTTGGTTCGGGGTATGGGGTTAGCAGCGGTGTG 3'

SEQ ID NO: 18: CRC oligonucleotide 5'

5' GCTGCGGAATTGTACCCGCCACACCGCTGCTAACCCCATAC 3'

SEQ ID NO: 19: CRC oligonucleotide 3'

5' CGAACCAACCAAACCCCAAAGACACGGCCGCAATTCCCGGGGATC 3'

Heavy strand minimal promoter:

SEQ ID NO:20: Promoter oligonucleotide A 5' GAGCCAACCAAACCCCAAAGACA 3'

SEQ ED NO: 21: Promoter oligonucleotide B 5' TGTCTTTGGGGTTTGGTTGGTTC 3'

SEQ ID NO: 22: CRC oligonucleotide 5'

5' GCTGCGGAATTGTACCCGCGAACCAACCAAACCCCAAAG 3'

SEQ ID NO: 23: CRC oligonucleotide 3'

5' CCAACCAAACCCCAAAGACAGGCCGCAATTCCCGGGGATC 3' Cytoplasmic polyadenylation signal:

SEQ ID NO: 24: Polyadenylation oligonucleotide A. 5'AAAAAAAAAAAAAAAAAAAATGTTAAGATGGCAGAGCCCGGTAATCGC 3'

SEQ ID NO: 25: Polyadenylation oligonucleotide B. S'GCGATTACCGGGCTCTGCCATCTTAACATTTTTTTTTTT^^

SEQ ID NO: 26: CRC oligonucleotide 5'

5' CTCGGCCTCGACTCTAGGCGGCCAAAAAAAAAAAAAAAAAAAA 3'

SEQ ID NO: 27: CRC oligonucleotide 3'

5' GATGGCAGAGCCCGGTAATCGCGGCCGCGGGGATCCAGACATGATAAG 3'

Example 2 Expression from Nucleic Acid Molecule The constructs bearing the human light strand minimal and maximal promoter elements, polyadenylation signal and mitochondrial polymerase termination signal were tested for their ability to promote expression in a tissue culture system. The negative control in the experiments was the parental pNASSB vector depicted in FIG. 1. This vector does not contain a promoter and hence the encoded β-galactosidase gene should not be expressed. Expression of β-gal from this vector would be indicative of a cryptic promoter in the backbone. A proprietary vector containing the β-gal gene under the control of the HCMV immediate early promoter was included as a positive control.

Human rhabdomyosarcoma cells, seeded into six-well plates and cultured with DMEM (10% FBS) were transfected with the experimental and control plasmids using lipofectamine (Gibco-BRL) as the transfecting agent. All transfections were done using a total of 2.5 μg DNA per transfection according to the manufacturers directions. At 48 hours post transfection, media was removed from the cells, the cells washed with 1 x PBS and cell lysates harvested in a detergent lysis buffer. Briefly, 500 μl of lysis buffer (300 mM NaCl, 150 mM Tris-Cl pH 7.6, 0.5% Triton X, 0.5% deoxycholate) was added per well and allowed to incubate on cells at 4°C for 60 minutes on a platform rocker. Lysates were aspirated into microfuge tubes and either assayed immediately or stored at -80 °C. Assays were conducted in microtiter plates using a modification of the β- galactosidase assay procedure described in Sambrook et al, "Molecular Cloning: A Laboratory Manual, Second Edition, Eds: Sambrook, Fritsch and Maniatis, Book 3, page 16.66, Cold Spring Harbor Laboratory Press, Cold Spring Harbor New York. The only modification is that the reading was done in kinetic mode at 405 nm as opposed to an endpoint analysis. Kinetic mode readings were taken every minute for 90 minutes. The Vmax of the reaction was divided by the protein concentration of that sample (Vmax/protein concentration) and this value was used as the expression value. The results are as follows: The negative control gave a baseline value of 0.53 (a value indicating no activity). The positive control gave a value of 1.5. The light strand maximal promoter construct gave a value of 1.11. The light strand minimal construct gave a value of 0.82. The results suggest that the light strand promoter constructs are able to drive expression of the downstream reporter gene.

Example 3 Immunization with Nucleic Acid Molecule Carrying HSV gD BALB/c mice are injected with 100 μg of pmtPROgD (plasmid DNA containing the HSV gD2 gene expressed from the mitochondrial light strand or heavy strand promoter) in the quadracep muscle. This pmtPROgD plasmid also contains a kanamycin resistance gene, AAUAAA (SEQ ID NO: 28, cytoplasmic polyadenylation signal), twenty adenine residues, and a mitochondrial terminator sequence. Control mice receive a vector with no insert. Immunizations are repeated two more times at 3 week intervals. Two weeks following the final immunization animals are sedated and blood is removed from animals via cardiac puncture or animals are sacrificed and spleens are removed. Sera is collected from blood samples and tested for the presence of antibodies by ELISA. Single cell cultures of spleen cells are made and tested for lymphoproliferation.

A. ELISA Microtiter (96 well) plates are coated overnight with purified HSV gD protein 0.4 μg ml. Plates are washed 3X with phosphate-buffered saline (PBS) containing 0.05% Tween-20 (PBS/Tw-20) and then blocked for 1 hr (at room temperature) with 4% bovine serum albumin (BSA). Mouse sera are diluted serially in PBS/Tw-20 and 50 μl are added to each well. The plates are incubated at room temperature for 2 hours. Plates are then washed 4X with PBS/Tw-20 and 50μl of a 1 :2000 dilution of peroxidase-conjugated anti- mouse IgG is added. Plates are incubated at room temperature for 1 hr. Plates are washed as above and substrate (3,3',5,5' - tetramethylbenzidine [TMB]-H₂O ). Color is developed for 30 min. And the plate is then read at 450nm on a Emax microplate reader.

B. Lymphoproliferation assay

Lymphoproliferation is performed on single cell spleen cell cultures as described in Kruisebeek, Shevach Proliferative assays for T -cell function (in:Coligan JE, Kruisbeek AM, Margulies DH, Shevach EM, Strober W, editors. Current protocols in immunology. USA: John Wiley and Sons, 1994. P.3.12.1-3.12.14 (1994). Cells from spleen are enriched for CD4⁺ or CD8⁺ T-cells by depleting the alternate subset using the MiniMACS magnetic separation system (Miltenyi Biotic, Auburn, CA). Results are expressed as a mean stimulation index (SI).

Example 4 Cloning of mitochondrial specificity factor (mtTFl) gene

This example illustrates the cloning of mitochondrial RNA polymerase specificity factor (mtTFl). The protein may be co-expressed on the same vector as carries the mt promoter or on a separate vector. Preferably, the mtTFl is co-expressed with the mt promoter and mt RNA polymerase. The gene for the human mitochondrial RNA polymerase specificity factor (mtTFl) is cloned from human rhabdomyosarcoma cells. Oligonucleotide primers for reverse transcription and PCR reactions are chosen based on the published sequence (GenBank accession No. M62810). Cytoplasmic RNA is prepared from these cells and cDNA is prepared using a primer specific for the 3' untranslated region of mtTFl. Following production of the cDNA, both the entire gene and a version of the gene lacking the mitochondrial signal sequence (containing the initial ATG codon, but lacking the next 41 codons) are amplified. These PCR products are then cloned into the TA cloning vector (pCRH; Invitrogen, Carlsbad, CA). The presence of the correct insert in the proper orientation is determined by restriction digestions followed by agarose gel electrophoresis. The genes for the full-length and N-terminal-truncated mtTFA are then transferred to a mammalian expression plasmid containing a kanamycin resistance gene (described in U.S. Patent 5,851,804). The presence of the correct inserts in the proper orientation is determined by restriction digestions followed by agarose gel electrophoresis. Plasmids containing the full-length and N-terminal-truncated versions of mtTFA are then sequenced to confirm the identity of the genes.

SEQ ID NO: 29: Reverse Transcription oligo: 5' -TGA-ACA-CAT-CTC-AAT-CTT- CTA-CTT-3'

SEQ ID NO:30: 5' PCR oligo (full-length): 5' -GGA-GCG-ATG-GCG-TTT-CTC- CGA-AGC-3'

SEQ ID NO:31: 5' PCR oligo (N-terminal-truncated): 5' -GCC-GCC-ATG-TCA- TCT-GTC-TTG-GCA-AGT-TGT-CCA-3'

SEQ ID NO: 32: 3'PCR oligo: 5' -tta-aca-ctc-ctc-agc-acg-ata-ttt-3' Example 5 Cloning of the mitochondrial RNA polymerase (mtRPOL) gene

This example illustrates the cloning of mitochondrial RNA polymerase (mtRPOL). The protein may be co-expressed on the same vector as carries the mt specificity factor or on a separate vector. Preferably, the mtRPOL is co-expressed with the mt promoter and mt specificity factor.

The gene for the human mitochondrial RNA polymerase (mtRPOL) is cloned from rhabdomyosarcoma cells. Oligonucleotide primers for reverse transcription and PCR reactions are chosen based on the published sequence (GenBank accession No. U75370). Due to its large size (3725 nucleotides), the gene is amplified in smaller segments and inserted into the backbone vector, 023, in sequential fashion. Each of these shorter sequences is first cloned into the TA cloning vector and sequenced. When the entire mtRPOL gene is assembled, it is then cloned to confirm the sequence.

All publications cited in this specification are incorporated herein by reference herein. While the invention has been described with reference to a particularly preferred embodiment, it will be appreciated that modifications can be made without departing from the spirit of the invention. Such modifications are intended to fall within the scope of the claims.

Claims

WHAT IS CLAIMED IS:

1. A nucleic acid molecule for delivering a heterologous nucleic acid sequence to the cytoplasm of a eukaryotic cell, said molecule comprising: a mitochondrial promoter operably linked to a heterologous nucleic acid sequence, wherein the mitochondrial promoter directs transcription of the nucleic acid sequence in the cytoplasm of a host cell.

2. The nucleic acid molecule according to claim 1, wherein said nucleic acid molecule further comprises a polyadenine sequence of adenine residues of sufficient length to enable mRNA expression of the heterologous nucleic acid sequence.

3. The nucleic acid molecule according to claim 2, wherein the polyadenine sequence comprises 20 to 70 adenine residues.

4. The nucleic acid molecule according to claim 3, wherein the molecule further comprises a polyadenylation signal.

5. The nucleic acid molecule according to claim 1, wherein the molecule further comprises a transcription terminator.

6. The nucleic acid molecule according to claim 5, wherein the transcription terminator is selected from the group consisting of: a bacterial terminator, a mitochondrial promoter, a viral terminator, a pause site terminator, and a ribonucleolytic cleavage site.

7. The nucleic acid molecule according to claim 1, wherein the molecule comprises a ribonucleolytic cleavage site and a pause site terminator.

8. The nucleic acid molecule according to claim 1, wherein the mitochondrial promoter is selected from the group consisting of:

(a) minimal heavy strand mitochondrial promoter;

(b) minimal light strand mitochondrial promoter; (c) maximal heavy strand mitochondrial promoter;

(d) maximal light strand mitochondrial promoter; and

(e) a combination of a heavy strand and light strand promoter selected from among (a) through (d).

9. The nucleic acid molecule according to claim 1, wherein the heterologous nucleic acid sequence encodes an immunogen which induces an immune response.

10. The nucleic acid molecule according to claim 1, wherein the heterologous nucleic acid sequence encodes a biologically active molecule.

11. The nucleic acid molecule according to claim 10, wherein the biologically active molecule is a therapeutic polypeptide or protein.

12. The nucleic acid molecule according to claim 10, wherein the biologically active molecule is an RNA.

13. The nucleic acid molecule according to claim 1, wherein the molecule further comprises an IRES sequence.

14. The nucleic acid molecule according to claim 13, wherein the molecule further comprises a picornavirus protease.

15. The nucleic acid molecule according to claim 14, wherein the picornovirus protease is expressed via a weak promoter.

16. The nucleic acid molecule according to claim 13, wherein the molecule further comprises a sequence encoding truncated EIF4G.

17. The nucleic acid molecule according to claim 1, wherein the molecule further comprises a mitochondrial RNA polymerase and a mitochondrial targeting sequence.

18. The nucleic acid molecule according to claim 17, wherein the molecule further comprises a mitochondrial RNA polymerase lacking the mitochondrial targeting sequence.

19. The nucleic acid molecule according to claim 1, wherein the molecule further comprises a Kozak sequence and the heterologous nucleic acid sequence is expressed in the presence of a capping enzyme.

20. The nucleic acid molecule according to claim 1, wherein the molecule further comprises a capping enzyme.

21. The nucleic acid molecule according to claim 1, wherein the molecule further comprises a Shine-Dalgarno sequence.

22. A nucleic acid molecule for expressing a heterologous nucleic acid sequence in the cytoplasm of a eukaryotic cell, said molecule comprising: a Kozak sequence; a mitochondrial promoter operably linked to a heterologous nucleic acid sequence, wherein said mitochondrial promoter directs expression of the nucleic acid sequence in the cytoplasm of a host cell; and a sufficient amount of adenine residues to provide mRNA expression of the heterologous nucleic acid sequence; wherein said molecule expresses the heterologous nucleic acid sequence in the presence of a capping enzyme.

23. A nucleic acid molecule for expressing a heterologous nucleic acid sequence in mitochondria of a eukaryotic cell, said molecule comprising: a Shine-Dalgarno sequence; a mitochondrial promoter operably linked to a heterologous nucleic acid sequence, wherein said mitochondrial promoter directs expression of the nucleic acid sequence in the cytoplasm of a host cell; means for directing the molecule to the mitochondria; a sufficient amount of adenine residues to provide mRNA expression of the heterologous nucleic acid sequence.

24. A host cell comprising a nucleic acid molecule according to any of claims 1 to 23.

25. A composition comprising a nucleic acid molecule according to any of claims 1 through 23 and a physiologically compatible carrier.

26. The composition according to claim 25, wherein the heterologous nucleic acid sequence encodes an antigen.

27. The composition according to claim 26, further comprising an adjuvant.

28. The composition according to claim 23, wherein the heterologous nucleic acid sequence encodes a biologically active molecule.

29. The composition according to claim 28, wherein the biologically active molecule is selected from the group consisting of RNA, proteins and peptides.

30. A method of delivering a heterologous nucleic acid sequence to the cytoplasm of a host cell, said method comprising the step of: delivering to the host cell a nucleic acid molecule comprising a mitochondrial promoter operably linked to a heterologous nucleic acid sequence, wherein the mitochondrial promoter directs expression of the nucleic acid sequence in the cytoplasm of a host cell.

31. The method according to claim 30, wherein the nucleic acid molecule further comprises a Kozak sequence.

32. The method according to claim 30, wherein the nucleic acid molecule further comprises an IRES sequence.

33. The method according to claim 30, wherein the nucleic acid molecule further comprises a sequence encoding truncated EFI4G.

34. The method according to claim 30, wherein the nucleic acid molecule is a DNA plasmid which is delivered in an amount of 1 ng to 100 mg DNA

35. The method according to claim 30, wherein the method further comprises the step of expressing in the host cell mitochondrial polymerase specificity factor which increases the affinity of mitochondrial RNA polymerase for the mitochondrial promoter.

36. The method according to claim 35, wherein the specificity factor is co-expressed with the mitochondrial RNA polymerase.

37. The method according to claim 30, wherein the nucleic acid molecule comprises an IRES sequence and the method further comprises the step of expressing in the host cell a picornavirus protease.

38. The method according to claim 30, wherein the nucleic acid molecule comprises an IRES sequence and the method further comprises the step of co-expressing in the host cell an eIF4G protein.

39. The method according to claim 30, wherein the method further comprises the step of expressing in the host cell a mitochondrial RNA polymerase.

40. The method according to claim 39, wherein the mitochondrial RNA polymerase is co-expressed in the absence of a targeting sequence.

41. A method of delivering a heterologous nucleic acid sequence in the mitochondria of a host cell, said method comprising the step of: delivering to the host cell a nucleic acid molecule comprising: a Kozak sequence; a mitochondrial promoter operably linked to a heterologous nucleic acid sequence, wherein said mitochondrial promoter directs expression of the nucleic acid sequence in the cytoplasm of a host cell; and a sufficient amount of adenine residues to provide mRNA expression of the heterologous nucleic acid sequence; wherein said molecule expresses the heterologous nucleic acid sequence in the presence of a capping enzyme.

42. A method for expressing a heterologous nucleic acid sequence in the mitochondria of a host cell, said method comprising the step of: delivering to the host cell a nucleic acid molecule comprising: a Shine-Dalgarno sequence; a mitochondrial promoter operably linked to a heterologous nucleic acid sequence, wherein said mitochondrial promoter directs expression of the nucleic acid sequence in the cytoplasm of a host cell; means for directing the molecule to the mitochondria; a sufficient amount of adenine residues to provide mRNA expression of the heterologous nucleic acid sequence.

43. The method according to claim 42, wherein the nucleic acid molecule further comprises a Kozak sequence.

44. A method of inducing an immune response in a human or non-human animal against a selected pathogen, said method comprising the step of delivering a nucleic acid molecule according to any of claims 1 to 23 to the animal, wherein the product expressed by said molecule is an antigen which induces a cell- mediated or humoral immune response against said pathogen.

45. A method of treating a human or non-human animal having, said method comprising the step of delivering a nucleic acid molecule according to any of claims 1 to 23 to the animal, wherein the product expressed by said molecule provides a therapeutic benefit to said animal.

46. The method according to claim 45, wherein said nucleic acid molecule comprises a biologically active molecule.

47. The method according to claim 45, wherein said nucleic acid molecule comprises a nucleic acid sequence which expresses a therapeutic protein or peptide in the treated animal.

48. The method according to claim 45, wherein said heterologous nucleic acid sequence is an RNA which extinguishes a targeted nucleic acid sequence expressed in the animal.