WO2002072892A9 - Methods and apparatus for analyzing polynucleotide sequences by asynchronous base extension - Google Patents

Methods and apparatus for analyzing polynucleotide sequences by asynchronous base extension

Info

Publication number
WO2002072892A9
WO2002072892A9 PCT/US2002/008187 US0208187W WO02072892A9 WO 2002072892 A9 WO2002072892 A9 WO 2002072892A9 US 0208187 W US0208187 W US 0208187W WO 02072892 A9 WO02072892 A9 WO 02072892A9
Authority
WO
WIPO (PCT)
Prior art keywords
primer
nucleotide
substrate
nucleotides
labeled
Prior art date
Application number
PCT/US2002/008187
Other languages
French (fr)
Other versions
WO2002072892A1 (en
Inventor
Stephen Quake
Ido Braslavsky
Benedict Hebert
Emil Kartalov
Original Assignee
California Inst Of Techn
Stephen Quake
Ido Braslavsky
Benedict Hebert
Emil Kartalov
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by California Inst Of Techn, Stephen Quake, Ido Braslavsky, Benedict Hebert, Emil Kartalov filed Critical California Inst Of Techn
Priority to JP2002571942A priority Critical patent/JP2004523243A/en
Priority to EP02726651A priority patent/EP1368497A4/en
Priority to CA002440754A priority patent/CA2440754A1/en
Publication of WO2002072892A1 publication Critical patent/WO2002072892A1/en
Publication of WO2002072892A9 publication Critical patent/WO2002072892A9/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00Preparation of compounds containing saccharide radicals
    • C12P19/26Preparation of nitrogen-containing carbohydrates
    • C12P19/28N-glycosides
    • C12P19/30Nucleotides
    • C12P19/34Polynucleotides, e.g. nucleic acids, oligoribonucleotides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6827Hybridisation assays for detection of mutation or polymorphism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6858Allele-specific amplification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869Methods for sequencing
    • C12Q1/6874Methods for sequencing involving nucleic acid arrays, e.g. sequencing by hybridisation

Definitions

  • the present invention relates to novel methods and apparatus for analyzing polynucleotide sequences with high sensitivity and parallelism.
  • electrophoretic and non-electrophoretic methods include slab gel electrophoresis, capillary electrophoresis, microfabricated capillary arrays, and free solution electrophoresis. All these methods rely on the Sanger method in which polynucleotide chain elongation inhibitors are incorporated into the polynucleotide strands which are then separated according to their sizes, usually on a polyacrylamide gel. These methods are the common means for analyzing polynucleotide sequences nowadays.
  • the process is time-consuming, requires large amount of target polynucleotides and reaction reagents, and has limited ability to read long sequences that are inherent in the gel electrophoresis methods.
  • the non-electrophoretic methods include pyrosequencing, sequencing by hybridization, massively parallel signature sequencing, and sequencing by mass spectrometry. These methods also have a number of disadvantages. For example, they usually require synchronization of the polynucleotide templates which inevitably decay with each cycle of sequencing reaction.
  • the present invention provides methods for analyzing the sequence of a target polynucleotide.
  • the methods include the steps of (a) providing a primed target polynucleotide immobilized to a surface of a substrate; wherein the target polynucleotide is attached to the surface with single molecule resolution; (b) In the presence of a polymerase, adding a first fluorescently labeled nucleotide to the surface of the substrate under conditions whereby the first nucleotide attaches to the primer, if a complementary nucleotide is present to serve as template in the target polynucleotide; (c) determining presence or absence of a fluorescence signal on the surface where the target polynucleotide is immobilized, the presence of a signal indicating that the first nucleotide was incorporated into the primer, and hence the identity of the complementary base that served as a template in the target polynucleotide; and (d) repeating steps (b)-(c)
  • a plurality of different primed target polynucleotides are immobilized to different portions of the substrate.
  • steps (b)-(c) are performed at least four times with four different types of labeled nucleotides.
  • steps (b)-(c) are performed until the identity of each base in the target polynucleotide has been identified.
  • all ingredients are present simultaneously and a continues monitoring of the incorporation is facilitated.
  • the presence or absence of a fluorescence signal is determined with total internal reflection fluorescence (TIRF) microscopy.
  • the target polynucleotide is primed with a fluorescently labeled primer (e.g., with Cy5 or Cy3).
  • a fluorescently labeled primer e.g., with Cy5 or Cy3
  • Some methods of the invention employ nucleotides that are labeled with Cy3 or Cy5.
  • a fused silica or glass slide is used.
  • the substrate surface is coated with a polyelectrolyte multilayer (PEM).
  • PEM polyelectrolyte multilayer
  • the PEM can be terminated with a polyanion, which helps to repel nucleotides from the surface and reduce non-specific binding to the surface.
  • the polyanion can bear pendant carboxylic acid groups.
  • the target polynucleotide is biotinylated, and the substrate surface is coated with streptavidin. Often the surface is coated with biotin prior to coating with streptavidin.
  • the surface is coated with a polyelectrolyte multilayer (PEM) terminated with carboxylic acid groups prior to attachment of biotin.
  • the invention provides apparatus for carrying out the methods of the invention.
  • the apparatus contain (a) a flow cell which houses a substrate for immobilizing target polynucleotide(s) with single molecule resolution; (b) an inlet port and an outlet port in fluid communication with the flow cell for flowing fluids into and through the flow cell; (c) a light source for illuminating the surface of the substrate; and
  • a detection system for detecting a signal from said surface (d) a detection system for detecting a signal from said surface.
  • Some of the apparatus are microfabricated.
  • the substrate is a microfabricated synthesis channel.
  • Figure 1 shows schematically immobilization of a primed polynucleotide and incorporation of labeled nucleotides.
  • Figure 2 shows schematically the optical setup of a detection system for total internal reflection microscopy.
  • Figure 3 shows results which indicate that streptavidin is required for immobilizing the polynucleotide template in an exemplified embodiment.
  • Figure 4 shows results which indicate that DNA polymerase incorporating labeled nucleotide into the immobilized primer is visualized with single molecule resolution.
  • Figure 5 shows incorporation of multiple labeled nucleotides in a bulk experiment in solution, using biotin-labeled 7G oligonucleotide template (SEQ ID NO:l) and p7G primer (SEQ ID NO:2).
  • Figure 6 shows low background signal from free nucleotides in solution and detection of signals from incorporated nucleotides.
  • Figure 7 shows results from experiments and simulation of multiple bleaching.
  • Figure 8 shows dynamics of incorporation of labeled nucleotides into the immobilized primer.
  • Figure 9 shows multiple incorporation events of labeled nucleotides over a period of time.
  • Figure 10 shows statistics of incorporation of labeled nucleotides over a period of time.
  • Figure 11 shows correlation between location of labeled primer and location of incorporation of labeled nucleotides.
  • Figure 12 shows correlation graphs for incorporation of two labeled nucleotides, using a 6TA6GC oligonucleotide template (SEQ ID NO: 6) and a p7G primer (SEQ ID NO:2). Partial sequences of the template, 5'- GccccccAtttttt - 3' (SEQ ID NO:7), and the extended product, 5' - aaaaaaUggggggC (SEQ ID NO:8), are also shown in the Figure.
  • Figure 13 shows detection of fluorescence resonance energy transfer (FRET) when two different labels are incorporated into the same primer.
  • the polynucleotide template used here is the 7G7A oligonucleotide (SEQ ID NO:5), but only part of the sequence, 5' - AttctttGcttcttAttctttGcttcttAttctttG - 3' (SEQ ID NO:9), is shown in the Figure.
  • Figure 14 shows correlation of single molecule FRET signals over a period of time.
  • Figure 15 shows the expected signals from an experiment in which two colors, donor and acceptor, are incorporated one after the another. Partial sequences of the template, 5'- GccccccAtttttt - 3' (SEQ ID NO:7), and the extended product, 5' - aaaaaUggggggC (SEQ H) NO: 8), are also shown in the Figure.
  • the present invention provides methods and apparatus for analyzing polynucleotides with high sensitivity, parallelism, and long read frames.
  • the invention is predicated in part on visualization of incorporation of labeled nucleotides into immobilized polynucleotide template molecules in a time resolved manner with single molecule resolution. As each of the immobilized template molecules is read individually, no synchronization is needed between the different molecules. Instead, with methods of the present invention, asynchronous base extension is sufficient for analyzing a target polynucleotide sequence.
  • single molecule resolution was achieved by immobilizing the template molecules at very low concentration to a surface of a substrate, coating the surface to create surface chemistry that facilitates template attachment and reduces background noise, and imaging nucleotide incorporation with total internal reflection fluorescence microscopy.
  • Analysis with single molecule resolution provides the advantage of monitoring the individual properties of different molecules. It allows identification of properties of an individual molecule that can not be revealed by bulk measurements in which a large number of molecules are measured together. Furthermore, to determine kinetics, bulk measurements require synchronization of the molecules or system state, while in single molecule analysis there is no need for synchronization.
  • the polynucleotides suitable for analysis with the invention can be DNA or RNA.
  • the analysis can be for sequence analysis, DNA fingerprinting, polymorphism identification, or gene expression measurement.
  • the methods can also be used to analyze activities of other biomacromolecules such as RNA translation and protein assembly.
  • the method entails immobilization of primed polynucleotide templates to the surface of a solid substrate (e.g., a glass slide).
  • the templates are pre-hybridized to a labeled primer (e.g., with a fluorescent dye) so that their location on the surface can be imaged with single molecule sensitivity.
  • An evanescent light field is set up at the surface in order to image the fluorescently labeled polynucleotide molecules.
  • the evanescent field is also used to image fluorescently labeled nucleotide triphosphates (dNTPs or NTPs) upon their incorporation into the immobilized primer when a polymerase is present.
  • dNTPs or NTPs fluorescently labeled nucleotide triphosphates
  • Methods of the present invention find various applications in polynucleotide sequence analysis.
  • a static approach is employed. Such an approach involves adding just one type of labeled nucleotide to the extension reaction at any given time. The signal is incorporated into the primer if the next template residue in the target polynucleotide is the complementary type. Otherwise, a different type of labeled nucleotide is used until the correct residue is incorporated.
  • a dynamic approach is employed. In these methods, all four types of nucleotides (at least one type labeled) are simultaneously present in the reaction, and incorporation of the signals into the primer is monitored dynamically. For example, incorporated signals are imaged continuously, preferably at a rate faster than the rate at which the nucleotides are incorporated into the primer.
  • TIR fluorescence microscopy Preferably, visualization of the templates or incorporated nucleotides are realized with total internal reflection (TIR) fluorescence microscopy.
  • the excitation light e.g., a laser beam
  • the excitation zone illuminates only a small volume of liquid close to the substrate (excitation zone). Signals from free nucleotides in solution that are not present in the excitation zone are not detected. Signals from free nucleotides that diffuse into the excitation zone appear as a broad band background because the free nucleotides move quickly across the excitation zone.
  • the fluorescence signals are removed by photob leaching or by chemical means after one or more rounds of incorporation.
  • the methods can also employ micro fluidic means to control flow of reaction reagents. In such methods, labeled nucleotides and other reaction reagents can be exchanged in a fast and economic way.
  • concentrations of nucleotides and/or other reaction reagents can be alternated at different time points of the analysis. This could lead to increased incorporation rate and sensitivity of the analysis. For example, when all four types of nucleotides are simultaneously present in the reaction to monitor dynamic incorporation of nucleotides, concentrations of the nucleotides can be alternated between ⁇ M range and sub-nM range. This leads to both better visualization of the signals when low concentrations of nucleotides are present, and increased polymerization rate when higher concentrations of nucleotides are present.
  • the rate at which the concentrations can be alternated can be as high as a few tens of Hertz. Alternating concentrations of nucleotides is also beneficial to improving signal visualization and polymerization rate in the static approach of sequence analysis.
  • free nucleotides (as well as other reaction reagents in solution) can be flown out using a microfluidic device. This will leave a much lower concentration of free nucleotide when the signals are visualized.
  • an additional washing step can be employed to further reduce the free nucleotide concentration before the signals are imaged.
  • polynucleotide sequence analysis is accomplished by using four different fluorescent labels on the four nucleotide triphosphates. Incorporated signals are imaged and then photobleached before the next incorporation cycle. Runs of identical bases (e.g., AAAAA) can be identified by, e.g., monitoring the intensity of the signal so that the number of fluorophores at the emitting spot can be determined. Further, signals due to fluorescence resonance energy transfer (FRET) can be detected from individual DNA strands when two different type of fluorescent dyes are incorporated into the same DNA. Such signals are useful to determine sequence information of the immobilized template polynucleotide.
  • FRET fluorescence resonance energy transfer
  • multiple types of labeled nucleotides can be added at the same time for the extension reactions.
  • one type of labeled nucleotide is added at a step, and each extension cycle may comprise four such steps in order to observe the incorporation of a complementary nucleotide.
  • less than all four dNTPs are labeled.
  • the analysis can have only two of the nucleotides labeled.
  • the incorporation/extension reaction is performed with multiple copies of the template polynucleotide.
  • one immobilized template molecule can be used repeatedly, by denaturing the extended molecule, removing the newly synthesized strand, annealing a new primer, and then repeating the experiment in situ with fresh reagents.
  • the present invention is also useful to obtain partial sequence information of a target polynucleotide, e.g., by using only two or three labeled nucleotide species.
  • the relative positions of two or three nucleotide species in the sequence in conjunction with known sequence databases can facilitate determination of the identity of the target sequence, i.e., whether it is identical or related to a known sequence. Such an approach is useful, for example, in determining gene expressions by sequencing cDNA libraries.
  • the present methods avoid many of the problems observed with the prior art sequencing methods.
  • the methods are highly parallel since many molecules are analyzed simultaneously and in high density (e.g., one template molecule per ⁇ lO ⁇ m of surface area).
  • many different polynucleotides can be sequenced or genotyped on a single substrate surface simultaneously.
  • stepwise addition of nucleotides is unnecessary in some methods, as all four nucleotides can be added simultaneously. Rather, sequence information is produced continuously as polymerases continually incorporate all four nucleotides into growing polynucleotide chains.
  • the methods are also extremely sensitive because information obtained from only a single copy of the template molecule is needed in order to determine its sequence.
  • Releasing the extension product from the polynucleotide template, e.g., by denaturing and annealing the template with a different primer provides the opportunity to read again the same template molecule with different sets of nucleotides (e.g., different combinations of two types of labeled nucleotide and two types of unlabeled nucleotides).
  • a “base” or “base-type” refers to a particular type of nucleoside base. Typical bases include adenine, cytosine, guanine, uracil, or thymine bases where the type refers to the subpopulation of nucleotides having that base within a population of nucleotide triphosphates bearing different bases. Other rarer bases or analogs can be substituted such as xanthine or hypoxanthine or methylated cytosine.
  • “Complements a region of the target nucleic acid downstream of the region to be sequenced” in the context of sequencing or genotyping refers to the fact that the primers are extended in a 3 ' direction by a polymerase. Therefore the primer binds to a subsequence of the target 3' (downstream) to the target sequence that is to be determined as the 3' end of the primer is extended.
  • Genotyping is a determination of allelic content of a target polynucleotide without necessarily determining the sequence content of the entire polynucleotide. It is a subset of sequencing. For example the identification of single nucleotide polymorphisms by determination of single base differences between two known forms of an allele is a form of sequencing that does not require all the target polynucleotide to be sequenced.
  • Immobilizing refers to the attachment of a target nucleic acid or polymerase to a solid support by a means that prevents its release in a reaction solution.
  • the means can be covalent bonding or ionic bonding or hydrophobic bonding.
  • Nucleoside includes natural nucleosides, including ribonucleosides and 2'- deoxyribonucleosides, as well as nucleoside analogs having modified bases or sugar backbones.
  • nucleic acid or “nucleic acid molecule” refer to a deoxyribonucleotide or ribonucleotide polymer in either single- or double-stranded form, and unless otherwise limited, can encompass known analogs of natural nucleotides that can function in a similar manner as naturally occurring nucleotides. Unless otherwise noted, “nucleic acid” and “polynucleotide” are used interchangeably.
  • Oligonucleotide or “polynucleotide” refers to a molecule comprised of a plurality of deoxyribonucleotides or nucleoside subunits.
  • the linkage between the nucleoside subunits can be provided by phosphates, phosphonates, phosphoramidates, phosphorothioates, or the like, or by nonphosphate groups as are known in the art, such as peptide-type linkages utilized in peptide nucleic acids (PNAs).
  • PNAs peptide nucleic acids
  • the linking groups can be chiral or achiral.
  • the ohgonucleotides or polynucleotides can range in length from 2 nucleoside subunits to hundreds or thousands of nucleoside subunits.
  • ohgonucleotides are preferably 5 to 100 subunits in length, and more preferably, 5 to 60 subunits in length, the length of polynucleotides can be much greater (e.g., up to 100 kb). (...if a whole chromosome is targeted...Thought 1 OOkb will be already nice..) ["e.g.” means it is not exclusive. Also, “100 Mb” probably does not make practical sense]
  • Optical reader or “detection system” refers to a device that can detect and record light emitted from the labeled dNTP (or NTP) or immobilized polynucleotide template (and/or primer) molecules.
  • primer refers to an oligonucleotide, whether occurring naturally as in a purified restriction digest or produced synthetically, which is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product which is complementary to a nucleic acid strand is induced, (i.e., in the presence of nucleotides and an inducing agent such as DNA polymerase and at a suitable temperature, buffer and pH).
  • the primer is preferably single stranded for maximum efficiency in amplification, but can alternatively be double stranded. If double stranded, the primer is first treated to separate its strands before being used to prepare extension products.
  • the primer is an oligodeoxyribonucleotide.
  • the primer must be sufficiently long to prime the synthesis of extension products in the presence of the inducing agent. The exact lengths of the primers depend on many factors, including temperature, source of primer and the use of the method.
  • a primer is selected to be "substantially" complementary to a strand of specific sequence of the template.
  • a primer must be sufficiently complementary to hybridize with a template strand for primer elongation to occur.
  • a primer sequence need not reflect the exact sequence of the template.
  • a non-complementary nucleotide fragment can be attached to the 5' end of the primer, with the remainder of the primer sequence being substantially complementary to the strand.
  • Non-complementary bases or longer sequences can be interspersed into the primer, provided that the primer sequence has sufficient complementarity with the sequence of the template to hybridize and thereby form a template primer complex for synthesis of the extension product of the primer.
  • the use of random primer is used in some cases. For example, when the terminal sequence of the target or template polynucleotide is not known, random primer combinations can be used.
  • probe refers to an oligonucleotide (i.e., a sequence of nucleotides), whether occurring naturally as in a purified restriction digest or produced synthetically, recombinantly or by PCR amplification, which is capable of hybridizing to another oligonucleotide of interest.
  • a probe can be single-stranded or double-stranded. Probes are useful in the detection, identification and isolation of particular gene sequences.
  • any probe used in the present invention can be labeled with any "reporter molecule,” so that is detectable in any detection system, including, but not limited to fluorescent, enzyme (e.g., ELISA, as well as enzyme-based histochemical assays), radioactive, quantum dots, and luminescent systems. It is not intended that the present invention be limited to any particular detection system or label.
  • Single molecule configuration refers to an array of molecules on a solid support where members of the array are present as an individual molecule located in a defined location. The members can be the same or different.
  • Single molecule resolution refers to the ability of a system to resolve one molecule from another.
  • the detection limit is in the order of a micron. This implies that the distance between two identical molecules to be resolved is at least few microns apart.
  • Specific hybridization refers to the binding, duplexing, or hybridizing of a molecule only to a particular nucleotide sequence under stringent conditions.
  • Stringent conditions are conditions under which a probe can hybridize to its target subsequence, but to no other sequences.
  • Stringent conditions are sequence-dependent and are different in different circumstances. Longer sequences hybridize specifically at higher temperatures.
  • stringent conditions are selected to be about 5° C lower than the thermal melting point (T m ) for the specific sequence at a defined ionic strength and pH.
  • T m is the temperature (under defined ionic strength, pH, and nucleic acid concentration) at which 50% of the probes complementary to the target sequence hybridize to the target sequence at equilibrium.
  • stringent conditions include a salt concentration of at least about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes (e.g., 10 to 50 nucleotides).
  • Stringent conditions can also be achieved with the addition of destabilizing agents such as formamide or tetraalkyl ammonium salts.
  • destabilizing agents such as formamide or tetraalkyl ammonium salts.
  • 5X SSPE 750 mM NaCl, 50 mM Na Phosphate, 5 mM EDTA, pH 7.4
  • a temperature of 25-30°C are suitable for allele-specific probe hybridizations.
  • template refers to a polynucleotide of which the sequence is to be analyzed. In some cases “template” is sought to be sorted out from other polynucleotide sequences.
  • substantially single-stranded template is polynucleotide that is either completely single-stranded (having no double-stranded areas) or single-stranded except for a proportionately small area of double-stranded polynucleotide (such as the area defined by a hybridized primer or the area defined by intramolecular bonding).
  • Substantially double-stranded template is polynucleotide that is either completely double-stranded (having no single-stranded region) or double-stranded except for a proportionately small area of single-stranded polynucleotide.
  • the target or template polynucleotide to be analyzed is immobilized to the surface of a solid substrate (e.g., a fused silica slide) at single molecule resolution.
  • the polynucleotide is pre- hybridized to a labeled primer.
  • a DNA or RNA polymerase, four different types of nucleotide triphosphates (NTPs or dNTPs, depending on the template and polymerase used), and other reaction reagents are then applied to the immobilized polynucleotide. At least one type of the nucleotides are fluorescently labeled.
  • the labels are preferably different for different NTPs.
  • TIR fluorescent microscopy incorporation of the labeled nucleotide into a target or template polynucleotide is detected by imaging fluorescence signal from the immobilized polynucleotide with single molecule resolution.
  • all four labeled NTPs are present simultaneously.
  • the polymerase continues to move along the target polynucleotide, the polynucleotide sequence is read from the order of the incorporated labels.
  • the target polynucleotide is not critical and can come from a variety of standard sources. It can be mRNA, ribosomal RNA, genomic DNA or cDNA. They can comprise naturally occurring and or non-naturally occurring nucleotides. Templates suitable for analysis according to the present invention can have various sizes. For example, the template can have a length of 100 bp, 200 bp, 500 bp, 1 kb, 3 kb, 10 kb, or 20 kb and so on. When the target is from a biological source, there are a variety of known procedures for extracting polynucleotide and optionally amplified to a concentration convenient for genotyping or sequence work. Polynucleotide can be obtained from any living cell of a person, animal or plant. Humans, pathogenic microbes and viruses are particularly interesting sources.
  • PCR polymerase chain reaction
  • amplification methods known in the art include ligase chain reaction (see EP 320,308), or methods disclosed in Kricka et al., 1995, Molecular Probing, Blotting, and Sequencing, Chap. 1 and Table IX, Academic Press, New York.
  • Primers in combination with polymerases are used to sequence target polynucleotide.
  • Primer length is selected to provide for hybridization to complementary template polynucleotide.
  • the primers will generally be at least 10 bp in length, usually between 15 and 30 bp in length. If part of the template sequence is known, a specific primer can be constructed and hybridized to the template. Alternatively, if sequence of the template is completely unknown, the primers can bind to synthetic oligonucleotide adaptors joined to the ends of target polynucleotide by a ligase.
  • the primer is labeled.
  • the labeled primer When hybridized to the immobilized template, the labeled primer facilitates imaging location of the template.
  • the primer can be labeled with a fluorescent label (e.g., Cy5).
  • the label used to label the primer is different from the labels on the nucleotides in the subsequent extension reactions.
  • the primers can be synthetically made using conventional nucleic acid synthesis technology.
  • the primers can be conveniently synthesized on an automated DNA synthesizer, e.g. an Applied Biosystems, Inc. (Foster City, Calif.) model 392 or 394 DNA/RNA Synthesizer, using standard chemistries, such as phosphoramidite chemistry, e.g. disclosed in the following references: Beaucage and Iyer, Tetrahedron, 48: 2223-2311 (1992); Molko et al, U.S. Pat. No. 4,980,460; Koster et al, U.S. Pat. No. 4,725,677; Caruthers et al, U.S. Pat. Nos.
  • Primer annealing is performed under conditions which are stringent enough to achieve sequence specificity yet sufficiently permissive to allow formation of stable hybrids at an acceptable rate.
  • the temperature and length of time required for primer annealing depend upon several factors including the base composition, length and concentration of the primer, and the nature of the solvent used, e.g., the concentration of DMSO, formamide, or glycerol, and counter ions such as magnesium.
  • hybridization with synthetic polynucleotides is carried out at a temperature that is approximately 5 to 10°C below the melting temperature of the target-primer hybrid in the annealing solvent.
  • the annealing temperature is in the range of 55 to 75°C. and the primer concentration is approximately 0.2 ⁇ M.
  • Other conditions of primer annealing are provided in the Examples below. Under these preferred conditions, the annealing reaction can be complete in only a few seconds.
  • the template or target polynucleotide molecules are provided as single molecule arrays immobilized to the surface of a solid substrate.
  • the substrate can be glass, silica, plastic or any other conventionally non-reactive material that will not create significant noise or background for the fluorescent detection methods.
  • Substrate surface to which the template polynucleotides are to be immobilized can also be the internal surface of a flow cell in a microfluidic apparatus, e.g., a microfabricated synthesis channel of the apparatus as described in the PCT application of Quake et al. (WO 01/32930; which is incorporated herein by reference).
  • the solid support is made from fused silica slide (e.g., a fused silica glass slide from Esco, Cat. R130110). Compared to other support materials (e.g., a regular glass slide), fused silica has very low auto- fluorescence.
  • fused silica slide e.g., a fused silica glass slide from Esco, Cat. R130110.
  • fused silica has very low auto- fluorescence.
  • the template or target polynucleotides are immobilized to the substrate surface with single molecule resolution.
  • single molecule resolution is achieved by using very low concentration of the polynucleotide in the immobilization reaction. For example, a 10 pM concentration for a 80-mer polynucleotide template allows attachment of the polynucleotide to the surface of a silica slide at single molecule resolution (see Example 1). Template immobilization with single molecule resolution can also be verified by measuring bleach pattern of the fluorescently labeled templates (see Example 5).
  • the templates are hybridized to the primers first and then immobilized to the surface. In some methods, the templates are immobilized to the surface prior to hybridization to the primer. In still some methods, the primers are immobilized to the surface, and the templates are attached to the substrates through hybridization to the primers. In still some methods, the polymerase is immobilized to the surface.
  • the immobilization can be achieved through direct or indirect bonding of the templates to the surface.
  • the bonding can be by covalent linkage. See, Joos et al., Analytical Biochemistry 247:96-101, 1997; Oroskar et al., Clin. Chem 42:1547-1555, 1996; and Khandjian, Mole. Bio. Rep. 11:107-115, 1986.
  • the bonding can also be through non-covalent linkage.
  • Biotin-streptavidin (Taylor et al., J. Phys. D. Appl. Phys.
  • the surface can be biotinylated first, and then parts of the four binding sites of streptavidin can be used to anchor the protein to the surface, leaving the other sites free to bind the biotinylated template (see, Taylor et al., J. Phys. D. Appl. Phys. 24:1443, 1991).
  • Such treatment leads to a high density of streptavidin on the surface of the substrate, allowing a correspondingly high density of template coverage.
  • Surface density of the template molecules can be controlled by adjusting concentration of the template which is applied to the surface. Reagents for biotinylating a surface can be obtained, for example, from Vector laboratories.
  • biotinylation can be performed with BLCPA: EZ-Link Biotin LC-PEO-Amine (Pierce, Cat. 21347).
  • labeled streptavidin e.g., with a fluorescent label
  • very low concentration e.g., in the ⁇ M, nM or pM range
  • This facilitates immobilization of the template with single molecule resolution. It also allows monitoring of spots on the substrate to which the template molecules are attached, and subsequent nucleotide incorporation events. While diverse polynucleotide templates can be each immobilized to and sequenced in a separate substrate, multiple templates can also be analyzed on a single substrate.
  • the templates are attached at different locations on the substrate. This can be accomplished by a variety of different methods, including hybridization of primer capture sequences to ohgonucleotides immobilized at different points on the substrate, and sequential activation of different points down the substrate towards template immobilization.
  • Primers with two domains, a priming domain and a capture domain can be used to anchor templates to the substrate.
  • the priming domain is complementary to the target template.
  • the capture domain is present on the non-extended side of the priming sequence. It is not complementary to the target template, but rather to a specific oligonucleotide sequence present on the substrate.
  • the target templates can be separately hybridized with their primers, or (if the priming sequences are different) simultaneously hybridized in the same solution. Incubation of the primer/template duplexes with the substrate under hybridization conditions allows attachment of each template to a unique spot. Multiple substrates can be charged with templates in this fashion simultaneously.
  • Another method for attaching multiple templates to the surface of a single substrate is to sequentially activate portions of the substrate and attach template to them. Activation of the substrate can be achieved by either optical or electrical means. Optical illumination can be used to initiate a photochemical deprotection reaction that allows attachment of the template to the surface (see, e.g., U.S. Patent Nos. 5,599,695, 5,831,070, and 5,959,837).
  • the substrate surface can be derivitized with "caged biotin", a commercially available derivative of biotin that becomes capable of binding to avidin only after being exposed to light.
  • Templates can then be attached by exposure of a site to light, filling the channel with avidin solution, washing, and then flowing biotinylated template into the channel.
  • Another variation is to prepare avidinylated substrate and a template with a primer with a caged biotin moiety; the template can then be immobilized by flowing into the channel and illumination of the solution above a desired area.
  • Activated template/primer duplexes are then attached to the first wall they diffused to, yielding a diffusion limited spot.
  • Electrical means can also be used to direct template to specific locations on a substrate. By positively charging one electrode in the channel and negatively charging the others, a field gradient can be created which drives the template to a single electrode, where it can attach (see, e.g., U.S.
  • Patent Nos. 5,632,957, 6,051,380, and 6,071,394) can be achieved by electrochemically activating regions of the surface and changing the voltage applied to the electrodes. Patterning of particular chemicals, include proteins and DNA is possible with a stamp method, in which a microfabricated plastic stamp is pressed on the surface (see, e.g., Lopez et al., J. Amer. Chem. Soc. 115:10774-81, 1993). Different templates can also be attached to the surface randomly as the reading of each individual is independent from the others.
  • surface of the substrate is pretreated to create surface chemistry that facilitates attachment of the polynucleotide templates and subsequent synthesis reactions.
  • the surface chemistry also reduces the background from non specific attachment of free labeled nucleotide to the surface of the substrate.
  • the surface is coated with a polyelectrolyte multilayer (PEM).
  • PEM polyelectrolyte multilayer
  • non-PEM based surface chemistry can be created prior to template attachment.
  • the substrate surface is coated with a polyelectrolyte multilayer (PEM).
  • Attachment of templates to PEM-coated surface can be accomplished by light- directed spatial attachment (see, e.g., U.S. Patent Nos. 5,599,695, 5,831,070, and 5,959,837).
  • the templates can be attached to PEM-coated surface entire chemically (see below for detail).
  • PEM formation has been described in Decher et al. (Thin Solid Films, 210:831-835, 1992). PEM formation proceeds by the sequential addition of polycations and polyanions, which are polymers with many positive or negative charges, respectively. Upon addition of a polycation to a negatively-charged surface, the polycation deposits on the surface, forming a thin polymer layer and reversing the surface charge. Similarly, a polyanion deposited on a positively charged surface forms a thin layer of polymer and leaves a negatively charged surface.
  • a substrate with PEM for immobilizing polynucleotide is provided in PCT publication WO 01/32930. Detailed procedures are also disclosed in the Examples below. Briefly, the surface of the substrate (e.g., a glass cover slip) is cleaned with a RCA solution. After cleaning, the substrate is coated with a polyelectrolyte multilayer (PEM). Following biotinylation of the carboxylic acid groups, streptavidin is then applied to generate a surface capable of capturing biotinylated molecules. Biotinylated polynucleotide templates are then added to the coated glass cover slip for attachment.
  • PEM polyelectrolyte multilayer
  • the surface chemistry thus created provides various advantages for the methods of the present invention, because it generates a strong negatively-charged surface which repels the negatively-charged nucleotides.
  • a polyelectrolyte multilayer terminated with carboxylic acid-bearing polymer is easy to attach polynucleotide to because carboxylic acids are good targets for covalent bond formation.
  • the attached template is active for extension by polymerases - most probably, the repulsion of like charges prevents the template from "laying down" on the surface.
  • the negative charge repels the fluorescent nucleotides, and nonspecific binding is low.
  • the attachment scheme described here is easy to generalize on. Without modification, the PEM/biotin streptavidin surface that is produced can be used to capture or immobilize any biotinylated molecule. A slight modification can be the use of another capture pair, e.g., substituting digoxygenin (dig) for biotin and labeling the molecule to be immobilized with anti-digoxygenin (anti-dig). Reagents for biotinylation or dig-labeling of amines are all commercially available.
  • dig digoxygenin
  • anti-dig anti-dig
  • chemistry is nearly independent of the surface chemistry of the support.
  • Glass for instance, can support PEMs terminated with either positive or negative polymer, and a wide variety of chemistry for either.
  • other substrates such as silicone, polystyrene, polycarbonate, etc, which are not as strongly charged as glass, can still support PEMs.
  • the charge of the final layer of PEMs on weakly-charged surfaces becomes as high as that of PEMs on strongly-charged surfaces, as long as the PEM has sufficiently-many layers. This means that all the advantages of the glass/PEM ⁇ )iotin/Streptavidin/biotin-DNA surface chemistry can be applied to other substrates.
  • primer extension reactions are performed, e.g., as described in Sambrook, supra; Ausubel, supra; and Hyman, Anal. Biochem., 174, p. 423, 1988.
  • the primer is extended by a polynucleotide polymerase in the presence of a single type of labeled nucleotide.
  • all four types of differently labeled nucleotides are present.
  • a combination of labeled and non-labeled nucleotides are used in the analysis.
  • a label is incorporated into the template/primer complex only if the specific labeled nucleotide added to the reaction is complementary to the nucleotide on the template adjacent the 3' end of the primer.
  • the template is subsequently washed to remove any unincorporated label, and the presence of any incorporated label is determined. As some errors can be caused by the polymerase, the reaction conditions and incubation time should minimize these errors.
  • A. Labeled nucleotides To facilitate detection of nucleotide incorporation, at least one and usually all types of the deoxyribonucleotides (dATP, dTTP, dGTP, dCTP, dUTP/dTTP) or nucleotides (ATP, UTP, GTP, and CTP) are labeled with fluorophores. When more than one type of nucleotides are labeled, a different kind of label can be used to label each different type of nucleotide. However, in some applications, the different types of nucleotides can be labeled with the same kind of labels.
  • the fluorescent label can be selected from any of a number of different moieties.
  • the preferred moiety is a fluorescent group for which detection is quite sensitive.
  • the affinity to the surface could be changed between different dyes. Low affinity to the surface is preferred.
  • Cy3 and Cy5 are used to label the primer or nucleotides in some methods of the invention. However, Cy5 has higher affinity to the surface under certain experimental condition than Cy3.
  • Cy5 is less stable and tends to bleach faster than Cy3. Such property can be of advantage or disadvantage, depending on the circumstances.
  • different sizes of the dyes can also affect efficiency of incorporation of labeled nucleotides.
  • length of the linker between the dye and the nucleotide can impact efficiency of the incorporation (see, Zhu and Waggoner, Cytometry 28: 206, 1997).
  • fluorophores with their corresponding absorption/emission wavelength indicated in parenthesis, that can be used in the present invention include Cy3 (550/565), Cy5 (650/664), Cy7 (750/770), Rhol23 (507/529), R6G (528/551), BODIPY 576/589 (576/589), BODIPY TR (588/616), Nile Blue (627/660), BODIPY 650/665 (650/665), Sulfo-IRD700 (680/705), NN382 (778/806), Alexa488 (490/520), Tetramethylrhodamine (550/570). and Rodamine X (575/605).
  • the fluorescently labeled nucleotides can be obtained commercially (e.g., from NEN DuPont, Amersham, or BDL). Alternatively, fluorescently labeled nucleotides can also be produced by various fluorescence-labeling techniques, e.g., as described in Kambara et al. (1988) "Optimization of Parameters in a DNA Sequenator Using Fluorescence Detection," Bio/Technol. 6:816-821; Smith et al. (1985) Nucl. Acids Res, 13:2399-2412; and Smith et al. (1986) Nature 321 :674-679. Acyl fluoride of Cy5 cyanine dye can also be synthesized and labeled as described in U.S. Patent No. 6,342,326.
  • Aromatic Molecules 2nd Edition (Academic Press, New York, 1971); Griffiths, Colour and Constitution of Organic Molecules (Academic Press, New York, 1976); Bishop, Ed., Indicators (Pergamon Press, Oxford, 1972); Haugland, Handbook of Fluorescent Probes and Research Chemicals (Molecular Probes, Eugene, 1992) Pringsheim, Fluorescence and Phosphorescence (Interscience Publishers, New York, 1949); and the like.
  • a wavelength which approximates the mean of the various candidate labels' absorption maxima may be used.
  • multiple excitations may be performed, each using a wavelength corresponding to the absorption maximum of a specific label.
  • polymerases can be selected for use in this invention. Preferred polymerases are able to tolerate labels on the nucleobase. For example, some applications of the present invention employ polymerases that have increased ability to incorporate modified, fluorophore-labeled, nucleotides into polynucleotides. Examples of such polymerases, e.g., mutant bacteriophage T4 DNA polymerases, have been described in U.S. Patent No. 5,945,312.
  • RNA polymerase DNA polymerases
  • reverse transcriptase can be used in the primer extension.
  • DNA polymerases are available. Examples of suitable DNA polymerases include, but are not limited to, Sequenase 2.0.RTM., T4 DNA polymerase or the Klenow fragment of
  • DNA polymerase 1 DNA polymerase 1, or Vent polymerase.
  • polymerases which lack 3' — > 5' exonuclease activity can be used (e.g., T7 DNA polymerase (Amersham) or Klenow -exo fragment of DNA polymerase I (New England Biolabs)).
  • T7 DNA polymerase Amersham
  • Klenow -exo fragment of DNA polymerase I New England Biolabs
  • polymerases lacking 3' - 5' exonuclease activity are not used.
  • thermostable polymerases such as TherrnoSequenaseTM (Amersham) or TaquenaseTM (ScienTech, St Louis, MO) are used.
  • the polymerase should have a fidelity (incorporation accuracy) of at least 99% and a processivity (number of nucleotides incorporated before the enzyme dissociates from the DNA) of at least 20 nucleotides, with greater processivity preferred.
  • fidelity incorporase
  • processivity number of nucleotides incorporated before the enzyme dissociates from the DNA
  • examples include T7 DNA polymerase, T5 DNA polymerase, HIV reverse transcriptase, E. coli DNA pol I, T4 DNA polymerase, T7 RNA polymerase, Taq DNA polymerase and E. coli RNA polymerase, Phi29 DNA polymerase.
  • the nucleotides used in the methods should be compatible with the selected polymerase. Procedures for selecting suitable nucleotide and polymerase combinations can be adapted from Ruth et al. (1981) Molecular Pharmacology 20:415-422; Kutateladze, T., et al. (1984) Nuc. Acids Res., 12:1671-1686; Chidgeavadze, Z., et al. (1985) FEBS Letters, 183:275-278.
  • the polymerase can be stored in a separate reservoir and flowed onto the substrates (or into a flow chamber/cell which houses the substrate) prior to each extension reaction cycle.
  • the enzyme can also be stored together with the other reaction agents (e.g., the nucleotide triphosphates).
  • the polymerase can be immobilized onto the surface of the substrate while the polynucleotide template is added to the solution.
  • Chain elongation inhibitors are nucleotide analogues which either are chain terminators which prevent further addition by the polymerase of nucleotides to the 3' end of the chain by becoming incorporated into the chain themselves.
  • the chain elongation inhibitors are dideoxynucleotides.
  • chain elongation inhibitors are incorporated into the growing polynucleotide chain, they should be removed after incorporation of the labeled nucleotide has been detected, in order to allow the sequencing reaction to proceed using different labeled nucleotides.
  • a blocking agent or blocking group can be employed on the 3' moiety of the deoxyribose group of the labeled nucleotide to prevent nonspecific incorporation.
  • the blocking agent should be removable under mild conditions (e.g., photosensitive, weak acid labile, or weak base labile groups), thereby allowing for further elongation of the primer strand with a next synthetic cycle. If the blocking agent also contains the fluorescent label, the dual blocking and labeling functions are achieved without the need for separate reactions for the separate moieties.
  • the labeled nucleotide can be labeled by attachment of a fluorescent dye group to the 3' moiety of the deoxyribose group, and the label is removed by cleaving the fluorescent dye from the nucleotide to generate a 3' hydroxyl group.
  • the fluorescent dye is preferably linked to the deoxyribose by a linker arm which is easily cleaved by chemical or enzymatic means.
  • blocking agents include, among others, light sensitive groups such as 6-nitoveratryloxycarbonyl (NVOC), 2-nitobenzyloxycarbonyl (NBOC), . ⁇ ,. ⁇ - dimethyl-dimethoxybenzyloxycarbonyl (DDZ), 5-bromo-7-nitroindolinyl, o-hydroxy-2- methyl cinnamoyl, 2-oxymethylene anthraquinone, and t-butyl oxycarbonyl (TBOC).
  • NVOC 6-nitoveratryloxycarbonyl
  • NBOC 2-nitobenzyloxycarbonyl
  • DDZ dimethyl-dimethoxybenzyloxycarbonyl
  • TBOC t-butyl oxycarbonyl
  • Other blocking reagents are discussed, e.g., in U.S. Ser. No. 07/492,462; Patchornik (1970) J. Amer. Chem. Soc. 92:6333; and Amit et al. (19
  • nucleotides possessing various labels and blocking groups can be readily synthesized. Labeling moieties are attached at appropriate sites on the nucleotide using chemistry and conditions as described, e.g., in Gait (1984) Oligonucleotide Synthesis: A Practical Approach, IRL Press, Oxford.
  • the reaction mixture for the sequencing comprises an aqueous buffer medium which is optimized for the particular polymerase.
  • the buffer includes a source of monovalent ions, a source of divalent cations and a buffering agent. Any convenient source of monovalent ions, such as KC1, K-acetate, NH 4 -acetate, K-glutamate, NH 4 C1, ammonium sulfate, and the like may be employed, where the amount of monovalent ion source present in the buffer will typically be present in an amount sufficient to provide for a conductivity in a range from about 500 to 20,000, usually from about 1000 to 10,000, and more usually from about 3,000 to 6,000 micromhos.
  • the divalent cation may be magnesium, manganese, zinc and the like, where the cation will typically be magnesium. Any convenient source of magnesium cation may be employed, including MgCl 2 , Mg-acetate, and the like.
  • the amount of Mg ion present in the buffer may range from 0.5 to 20 mM, but will preferably range from about 1 to 12mM, more preferably from 2 to lOmM and will ideally be about 5mM.
  • buffering agents or salts that may be present in the buffer include Tris, Tricine, HEPES, MOPS and the like, where the amount of buffering agent will typically range from about 5 to 150 mM, usually from about 10 to 100 mM, and more usually from about 20 to 50 mM, where in certain preferred embodiments the buffering agent will be present in an amount sufficient to provide a pH ranging from about 6.0 to 9.5, where most preferred is pH 7.6 at 25° C.
  • Other agents which may be present in the buffer medium include chelating agents, such as EDTA, EGTA and the like.
  • the nucleotide on the template adjacent the 3' end of the primer can be identified. Once this has been achieved, the label should be removed before repeating the process to discover the identity of the next nucleotide. Removal of the label can be effected by removal of the labeled nucleotide using a 3'-5' exonuclease and subsequent replacement with an unlabeled nucleotide. Alternatively, the labeling group can be removed from the nucleotide. Release of the fluorescence dye can be achieved if a detachable connection between the nucleotide and the fluorescence molecule is used.
  • disulfide bonds enables one to disconnect the dye by applying a reducing agent like dithiothreitol (DTT).
  • DTT dithiothreitol
  • the label is a fluorescent label
  • Photobleaching can be performed according to methods, e.g., as described in Jacobson et al., "International Workshop on the Application of Fluorescence Photobleaching Techniques to Problems in Cell Biology", Federation Proceedings, 42:72-79, 1973; Okabe et al., J Cell Biol 120:1177-86, 1993; Wedekind et al., J Microsc.
  • chain terminators or 3' blocking groups can be removed by chemical or enzymatic cleavage of the blocking group from the nucleotide. For example, chain terminators are removed with a 3'-5' exonuclease, e.g., exonuclease III. Once the label and terminators/blocking groups have been removed, the cycle is repeated to discover the identity of the next nucleotide.
  • the solid substrate is optionally housed in a flow chamber having an inlet and outlet to allow for renewal of reactants which flow past the immobilized moieties.
  • the flow chamber can be made of plastic or glass and should either be open or transparent in the plane viewed by the microscope or optical reader. Electro-osmotic flow requires a fixed charge on the solid substrate and a voltage gradient (current) passing between two electrodes placed at opposing ends of the solid support. Pressure driven flow can be facilitated by microfluidic device with an external pressure source or by microfluidic peristaltic pump (see, e.g., Unger et al., Science 288: 113-116, 2000).
  • the flow chamber can be divided into multiple channels for separate sequencing. Examples of micro flow chambers are described in Fu et al.
  • the flow chamber contains microfabricated synthesis channels as described in WO01/32930.
  • the polynucleotide templates can be immobilized to the surface of the synthesis channels.
  • These synthesis channels can be in fluid communication with a microfluidic device which controls flow of reaction reagents.
  • Preferred microfluidic devices that can be employed to control flow of reaction reagents in the present invention have been described in WO01/32930.
  • the present invention also provide apparatus for carrying out the methods of the invention.
  • the apparatus usually comprise a flow chamber in which the substrate is housed.
  • the apparatus can optionally contain plumbing devices (e.g., an inlet and an outlet port), a light source, and a detection system described herein.
  • a microfabricated apparatus as described in WO01/32930 is adapted to house the substrate of the present invention.
  • Methods for visualizing single molecules of DNA labeled with an intercalating dye include, e.g., fluorescence microscopy as described in Houseal et al., BiophysicalJournal 56: 507, 1989. While usually signals from a plurality of molecules are to be detected with the sequencing methods of the present invention, fluorescence from single fluorescent dye molecules can also be detected. For example, a number of methods are available for this purpose (see, e.g., Nie et al., Science 266: 1013, 1994; Funatsu et al., Nature 374: 555, 1995; Mertz et al., Optics Letters 20: 2532, 1995; and Unger et al., Biotechniques 27:1008, 1999).
  • the detection system for the signal or label can also depend upon the label used, which can be defined by the chemistry available.
  • a combination of an optical fiber or charged couple device (CCD) can be used in the detection step.
  • CCD charged couple device
  • the matrix is itself transparent to the radiation used, it is possible to have an incident light beam pass through the substrate with the detector located opposite the substrate from the polynucleotides.
  • electromagnetic labels various forms of spectroscopy systems can be used.
  • Various physical orientations for the detection system are available and discussion of important design parameters is provided in the art (e.g., Arndt- Jovin et al, J Cell Biol 101: 1422-33, 1985; and Marriott et al., Biophys J 60: 1374-87, 1991).
  • the single- molecule fluorescence detection of the present invention can be practiced using optical setups including near-field scanning microscopy, far-field confocal microscopy, wide-field epi- illumination, and total internal reflection fluorescence (TIRF) microscopy.
  • optical setups including near-field scanning microscopy, far-field confocal microscopy, wide-field epi- illumination, and total internal reflection fluorescence (TIRF) microscopy.
  • TIRF total internal reflection fluorescence
  • the methods involve detection of laser activated fluorescence using microscope equipped with a camera. It is sometimes referred to as a high-efficiency photon detection system (see, e.g., Nie, et. al., 1994, Probing individual molecules with confocal fluorescence microscopy, Science 266:1018-1019. Other suitable detection systems are discussed in the Examples below.
  • Suitable photon detection systems include, but are not limited to, photodiodes and intensified CCD cameras.
  • an intensified charge couple device (ICCD) camera is used.
  • ICCD intensified charge couple device
  • the use of a ICCD camera to image individual fluorescent dye molecules in a fluid near the surface of the glass slide is advantageous for several reasons.
  • ICCD optical setup it is possible to acquire a sequence of images (movies) of fluorophores.
  • each of the dNTPs or NTPs employed in the methods has a unique fluorophore associated with it, as such, a four-color instrument can be used having four cameras and four excitation lasers.
  • the image could be split to four quarters and imaged by a single camera.
  • the micro-imager of Optical Insights LTD is a simple device that splits the image to four different images in four different spectra just in front of the port of the camera. Illumination with only one laser excitation for the four colors is possible if suitable dyes are used (see, e.g., Rosenblum et al, Nucleic Acids Research
  • the present invention uses total internal reflection fluorescence (TIRF) microscopy for two-dimensional imaging fluorescence detection.
  • TIRF microscopy is well known in the art. See, e.g., Watkins et al., J Biomed Mater Res 11:915-38, 1977; and Axelrod et al., J Microsc, 129:19-28, 1983.
  • TIRF microscopy uses totally internally reflected excitation light. When a laser beam was totally reflected at the interface between a liquid and a solid substrate (e.g., a glass), the excitation light beam penetrates only a short distance into the liquid.
  • the optical field does not end abruptly at the reflective interface, but its intensity falls off exponentially with distance.
  • This surface electromagnetic field called the 'evanescent wave', can selectively excite fluorescent molecules in the liquid near the interface.
  • the thin evanescent optical field at the interface provides low background and enables the detection of single molecules with high signal-to-noise ratio at visible wavelengths (see, M. Tokunaga et al, Biochem. and Biophys. Res. Comm. 235, 47 (1997) and P. Ambrose, Cytometry, 36, 244 (1999)).
  • TIRF microscopy has been used to examine various molecular or cellular activities, e.g., cell/substrate contact regions of primary cultured rat myotubes with acetylcholine receptors labeled by fluorescent alpha-bungarotoxin, and human skin fibroblasts labeled with a membrane-incorporated fluorescent lipid (see, e.g., Thompson et al., Biophys J. 33:435-54, 1981; Axelrod, J. Cell. Biol. 89: 141-5, 1981; and Burghardt et al., Biochemistry 22:979-85, 1983).
  • TIRF examination of cell/surface contacts dramatically reduces background from surface autofluorescence and debris.
  • TIRF has also been combined with fluorescence photobleaching recovery and correlation spectroscopy to measure the chemical kinetic binding rates and surface diffusion constant of fluorescent labeled serum protein binding (at equilibrium) to a surface (see, e.g., Burghardt et al., Biophys J. 33:455-67, 1981); and Thompson et al., Biophys J, 43:103-14, 1983). Additional examples of TIRR detection of single molecules have been described in Vale et.
  • the polymerase rather than the template is immobilized to the surface so the reaction occurs near the surface at all time.
  • a prism-type TIRF geometry for single-molecule imaging as described by Xu and Yeung is used (see, X-H.N. Xu et al., Science, 281, 1650 (1998)).
  • an objective type TIRF is used to provide space above the objective so that a microfluidic device can be used (see, e.g., Tokunaga et al., Biochem Biophy Res Commu 235: 47-53, 1997; Ambrose et al., Cytometry 36:224;1999; and Braslavsky et al, Applied Optics 40:5650, 2001).
  • Total internal reflection can be utilized with high numerical aperture objectives (ranging between 1.4 and 1.65 in aperture), preferentially using an inverted microscope.
  • Single molecule detection can be achieved using flow cytometry where flowing samples are passed through a focused laser with a spatial filter used to define a small volume.
  • US Pat. No. 4,979,824 describes a device for this purpose.
  • US Pat. No. 4,793,705 describes a detection system for identifying individual molecules in a flow train of the particles in a flow cell. It further describes methods of arranging a plurality of lasers, filters and detectors for detecting different fluorescent nucleic acid base-specific labels.
  • US Pat. No. 4,962,037 also describes a method for detecting an ordered train of labeled nucleotides for obtaining DNA and RNA sequences using an exonuclease to cleave the bases.
  • fluorescent excitation is exerted with a Q-switched frequency doubled Nd YAG laser, which has a KHz repetition rate, allowing many samples to be taken per second.
  • a wavelength of 532 nm is ideal for the excitation of rhodamine. It is a standard device that has been used in the single molecule detection scheme (Smith et al, Science 253:1122, 1992).
  • a pulsed laser allows time resolved experiments, which are useful for rejecting extraneous noise.
  • excitation can be performed with a mercury lamp and signals from the incorporated nucleotides can be detected with an CCD camera (see, e.g., Unger et al, Biotechniques 27:1008, 1999).
  • Incorporated signals can be detected by scanning the substrates.
  • the substrates can be scanned simultaneously or serially, depending on the scanning method used.
  • the signals can be scanned using a CCD camera (TE/CCD512SF, Princeton Instruments, Trenton, NJ.) with suitable optics (Ploem, J. S., in Fluorescent and Luminescent Probes for Biological Activity, Mason, T. W., Ed., Academic Press, London, pp. 1-11, 1993), such as described in Yershov et al. (Proc. Natl. Acad. Sci. 93:4913, 1996), or can be imaged by TV monitoring (Khrapko et al., DNA Sequencing 1:375, 1991).
  • the scanning system should be able to reproducibly scan the substrates. Where appropriate, e.g., for a two dimensional substrate where the substrates are localized to positions thereon, the scanning system should positionally define the substrates attached thereon to a reproducible coordinate system. It is important that the positional identification of substrates be repeatable in successive scan steps.
  • Various scanning systems can be employed in the methods and apparatus of the present invention.
  • electro-optical scanning devices described in, e.g., U.S. Pat. No. 5,143,854, are suitable for use with the present invention.
  • the system could exhibit many of the features of photographic scanners, digitizers or even compact disk reading devices.
  • a model no. PM500-A1 x-y translation table manufactured by Newport Corporation can be attached to a detector unit.
  • the x-y translation table is connected to and controlled by an appropriately programmed digital computer such as an IBM PC/AT or AT compatible computer.
  • the detection system can be a model no. R943-02 photomultiplier tube manufactured by Hamamatsu, attached to a preamplifier, e.g., a model no.
  • SR440 manufactured by Stanford Research Systems
  • a photon counter e.g., an SR430 manufactured by Stanford Research System
  • a multichannel detection device e.g., an SR430 manufactured by Stanford Research System
  • a digital signal can usually be preferred, there can be circumstances where analog signals would be advantageous.
  • the stability and reproducibility of the positional localization in scanning determine, to a large extent, the resolution for separating closely positioned polynucleotide clusters on a two dimensional substrate. Since the successive monitoring at a given position depends upon the ability to map the results of a reaction cycle to its effect on a positionally mapped polynucleotides, high resolution scanning is preferred. As the resolution increases, the upper limit to the number of possible polynucleotides which can be sequenced on a single matrix also increases.
  • Crude scanning systems can resolve only on the order of 1000 ⁇ m, refined scanning systems can resolve on the order of 100 ⁇ m, more refined systems can resolve on the order of about 10 ⁇ m, and with optical magnification systems a resolution on the order of 1.0 ⁇ m is available.
  • the limitations on the resolution can be diffraction limited and advantages can arise from using shorter wavelength radiation for fluorescent scanning steps.
  • the time required to fully scan a matrix can increased and a compromise between speed and resolution can be selected.
  • Parallel detection devices which provide high resolution with shorter scan times are applicable where multiple detectors are moved in parallel.
  • the reliability of a signal can be pre-selected by counting photons and continuing to count for a longer period at positions where intensity of signal is lower. Although this decreases scan speed, it can increase reliability of the signal determination.
  • Various signal detection and processing algorithms can be incorporated into the detection system. In some methods, the distribution of signal intensities of pixels across the region of signal are evaluated to determine whether the distribution of intensities corresponds to a time positive signal.
  • incorporation of different types of nucleotides into a primer is detected using different fluorescent labels on the different types of nucleotides.
  • FRET fluorescence resonance energy transfer
  • FRET Fluorescence Resonance Energy Transfer
  • one of the fluorophores has an emission spectrum that overlaps the excitation spectrum of the other fluorophore (acceptor) and transfer of energy takes place from the donor to the acceptor through fluorescence resonance energy transfer.
  • the energy transfer is mediated by dipole-dipole interaction.
  • the donor when excited, its specific emission intensity decreases while the acceptor's specific emission intensity increases, resulting in fluorescence enhancement.
  • Detection of single molecule FRET signal reveals sequence information and facilitates interpretation of the sequencing data. Detection of FRET signal in the present invention can be performed accordingly to various methods described in the art (e.g., US Patent No. 5,776,782). FRET has been used to studying various biological activities of biomacromolecules including polynucleotides. For example, Cooper et al. disclosed fluorescence energy transfer in duplex and branched DNA molecules (Biochemistry 29: 9261-9268, 1990). Lazowski et al. reported highly sensitive detection of hybridization of ohgonucleotides to specific sequences of nucleic acids by FRET (Antisense Nucleic Acid Drug Dev. 10: 97-103, 2000).
  • any of a number of fluorophore combinations can be selected for labeling the nucleotides in the present invention for detection of FRET signals (see for example, Pesce et al,. eds, Fluorescence Spectroscopy, Marcel Dekker, New York, 1971; White et al., Fluorescence Analysis: A practical Approach, Marcel Dekker, New York, 1970; Handbook of Fluorescent Probes and Research Chemicals, 6th Ed, Molecular Probes, Inc., Eugene, Oreg., 1996; which are incorporated by reference).
  • a preferred donor fluorophore is selected that has a substantial spectrum of the acceptor fluorophore.
  • the donor may also be desirable in certain applications that the donor have an excitation maximum near a laser frequency such as Helium-Cadmium 442 nm or Argon 488 nm.
  • a laser frequency such as Helium-Cadmium 442 nm or Argon 488 nm.
  • the use of intense laser light can serve as an effective means to excite the donor fluorophore.
  • the acceptor fluorophore has a substantial overlap of its excitation spectrum with the emission spectrum of the donor fluorophore.
  • the wavelength of the maximum of the emission spectrum of the acceptor moiety is preferably at least 10 nm greater than the wavelength of the maximum of the excitation spectrum of the donor moiety. The emission spectrum of the acceptor fluorophore is shifted compared to the donor spectrum.
  • Suitable donors and acceptors operating on the principle of fluorescence energy transfer include, but are not limited to, 4-acetamido-4'-isothiocyanatostilbene- 2,2'disulfonic acid; acridine and derivatives: acridine, acridine isothiocyanate; 5-(2'- aminoethyl)aminonaphthalene-l-sulfonic acid (EDANS); 4-amino-N-[3- vinylsulfonyl)phenyl]naphthalimide-3,5 disulfonate; N-(4-anilino-l-naphthyl)maleimide; anthranilamide; BODIPY; Brilliant Yellow; coumarin and derivatives: coumarin, 7-amino-4- methylcoumarin (AMC, Coumarin 120),7-amino-4-trifluoromethylcouluarin (Coumaran 151); cyanine dyes; cyanosine
  • TAMRA N,N,N',N'-tetramethyl-6-carboxyrhodamine
  • TRITC tetramethyl rhodamine
  • riboflavin riboflavin; rosolic acid; terbium chelate derivatives; Cy
  • PEI PolyEthylenlmine (Sigma P-3143) (positive charged)
  • PALL Poly(allylamine hydrochloride) (Sigma 283223)
  • PACr Poly(acrylic acid, sodium salt) (Sigma 416045) (negative charged)
  • EDC 9.6mg/ml; 50mM (xlO) l- ⁇ 3-(Dimethylamino)propyl]-3-ethylcarbodiimide, hydrochloride), Activator for the BLCPA (Sigma- 161462)
  • BLCPA EZ-Link Biotin LC-PEO-Amine (Pierce 21347)
  • TKMC (lOmM Tris* HCl, lOmM KC1, lOmM MgCl 2 , 5mM Ca Cl 2 , pH 7.0)
  • EcoPol lOmM Tris» HCl, 5mM MgCl 2 , 7.5 mM DTT pH @ 25°C; buffer come with the polymerase at (xlO) (2)
  • Other materials and reagents include:
  • Nucleotides dTTP, dGTP, dATP, and dCTP-Cy3 at lO ⁇ M concentration
  • Polymerase a) Klenow Polymerase I (5 units/ ⁇ l), New England BioLabs Cat. 21 OS b) Klenow -exo, New England BioLabs Cat. 212S c) TAQ d) Sequenase Hybridization Chamber: Sigma H-1409 Polynucleotide templates and primers:
  • Primer p7G 5'- TAGAACCTCCGTGT - 3' (SEQ ID NO:2); the primer can be labeled with Cy5 or Cy3.
  • the slides was first cleaned with the RCA method as described above and in WO 01/32930. Multilayer of polyallylamine /polyAcrylic were absorbed to the slide.
  • An EZ link connector was then attached to the slides as follows: the slide was dried, scratched with diamond pencil, and then covered with a hybridization chamber. 120 ⁇ l of a mixture of 1:1:8 EDC: BLCPA: MES (50mM EDC, 50mM BLCPA, lOmM MES) was applied to each slide.
  • Cy3-dCTP each of 20-lOOnM were mixed in the ECOPOL buffer. 1 ⁇ l Klenow 210S from stock solution (kept in -20°C) was added to 200 microliters of the nucleotide mixture. 120 ⁇ l of the mixture was then added on each slide. After incubation for 0 to 30 min (for different experiments), the slide was examined with the TIR microscope. Unless otherwise noted, all reactions were performed at room temperature, while the reaction reagents were kept at 4°C or -20°C. The primer/oligonucleotide hybridization reaction was carried out with a thermocycler machine.
  • Single molecule resolution was achieve by using very low concentration of the polynucleotide template which ensured that only one template molecule is attached to a distinct spot on the slide. Single molecule attachment to a distinct is also confirmed by the observation of single bleaching pattern of the attached fluorophores.
  • a concentration of about lOpM of a 80-mer oligonucleotide template was used for immobilizing to the slide. The space between different DNA molecules attached to the surface slide was measured at a few micrometers.
  • the template and incorporation of labeled nucleotides were visualized by fluorescence imaging. Location of the oligonucleotide was monitored by fluorescence from the Cy5 labeled primer (SEQ ID NO:2). Incorporation of nucleotides was detected because the nucleotides were labeled with Cy3. After incorporation, the incorporated labels were illuminated. Illumination of Cy3 was at a wavelength of 532nm. Following a typical time of a few seconds of continued illumination, the signals were bleached, typically in a single step. As shown in Figure 2, imaging of fluorescent signals with single molecule resolution was enabled with surface illumination by total internal reflection (TIR). Ishijima et al.
  • TIR total internal reflection
  • Example 2 Test for Specific Attachment of Template Molecules to Substrate Surface This experiment was performed to determine whether the polynucleotide templates are attached to the surface as desired.
  • Figure 3 shows that streptavidin is required for binding the template to the surface and hence detection of incorporated fluorescence signal.
  • the left panel shows that there is no fluorescence signal when only streptavidin- attached surface but no fluorescent labels were present.
  • the middle panel shows that there is no incorporated fluorescent signals when no streptavidin was present on the surface to attach biotin-labeled oligonucleotide template, even though Cy5-labeled primer was present.
  • the right panel shows that detection of incorporated fluorescent signal when the streptavidin- attached surface, labeled primers, and biotin-labeled oligonucleotide template were present.
  • a bulk extension experiment was performed in a test tube rather than on the surface of a substrate. As shown in Figure 5, the results indicate that the polymerase incorporate all the labeled nucleotides into the correct positions.
  • incorporation of dCTP-Cy3 and a polymerization terminator, ddCTP were detected using a 7G DNA template (a DNA strand having a G residue every 7 bases; SEQ ID NO:l). The annealed primer was extended in the presence of non-labeled dATP, dGTP, dTTP, Cy3-labeled dCTP, and ddCTP.
  • the ratio of Cy3-dCTP and ddCTP was 3:1.
  • the reaction products were separated on a gel, fluorescence excited, and the signals detected, using an automatic sequencer ABI-377. The results reveal that incorporation of Cy3-dCTP did not interfere with further extension of the primer along the 7G oligomer template.
  • Figure 5 shows fluorescence intensity from primer extension products of various lengths which were terminated by incorporation of ddCTP at the different G residues in the 7G oligomer template (SEQ ID NO:l).
  • the first band is the end of the gel and should not be counted as it is in the very beginning of the gel.
  • the full length of the template is 100 residues.
  • the first band (marked “1" in the graph) corresponds to extension products which were terminated by incorporation of non-labeled ddCTP at the second G residue (position 27) and has incorporated Cy3-dCTP at the first G residue (position 20).
  • the tenth band (marked “10" in the graph) represents extension products which were terminated by incorporation of non-labeled ddCTP at the 10th G residue (position 90) and has incorporated Cy3-dCTP at the previous G residue (i.e., positions 20, 27, 34, 41, 48, 55, 62, 69, 76, and 83).
  • the results showed a nice agreement between the expected positions for Cy3 incorporation in the polynucleotide template and the positions of the fluorescence intensity bands.
  • Total internal reflection (TIR) fluorescence microscopy allows detection of real-time incorporation of labeled nucleotide into single immobilized polynucleotide template.
  • This illumination method reduce the background from the sample by illuminating only a thin layer (e.g., in the order of 150nm) near the surface. Even in the presence of free dyes in the solution (up to 50nM), single molecules can be observed.
  • TIR we visualized single molecules of labeled nucleotide bound to DNA in the presence of up to 50nM free dye in solution. Though this concentration is low compared to the concentration needed for a high rate of incorporation of nucleotides by the DNA polymerase, it was sufficient for its operation.
  • the lasers source is shown in Figure 2, the light sources (e.g., laser) are coupled to the surface by prism.
  • the surface is imaged by a regular 1.3NA microscope objective onto an Intensified CCD (Pentamax).
  • a fluorescent filter in the optical way block the laser intensity and allow the fluorescent signals from the dye molecules pass through(Chroma filters).
  • the camera and the shutters for the lasers are controlled by the computer.
  • TIR illumination of polynucleotide-attached slide produced a low background and allowed detection of signals only from immobilized labels.
  • the refraction index of the fused silica glass and the oil beneath the surface is about 1.46.
  • the refraction index of the liquid above the glass is about 1.33 to 1.35.
  • the illumination ray was refracted. If the illumination is very shallow, 70- 75 degree from the surface orthogonal, the refracted light was reflected back and not continued in the liquid phase as the critical angel for total internal reflection is about 65-67 degrees (TetaCitical ⁇ sin "1 (nl/n2)).
  • the illumination process leaves a decay field near the interface which illuminates only about 150 nm into the liquid phase. Fluorophores dyes can be excited by this field. So only the dyes which are near the surface will emit. Furthermore, free labeled nucleotide molecules in the solution will move around due to Brownian motion. The fast movement of these free molecules produces only a smear signal because the integration time is in the order of hundred millisecond. Thus, the total internal reflection illumination leads to a low back ground from the free molecules, and only signals from the immobilized dyes are detected.
  • Figures 6 shows detection of signals from single Cy3 molecule with no free dye in solution versus signals from single Cy3 molecule with background of 15nM Cy3 in solution. Fluorescence image from incorporation of Cy3 labeled nucleotide is shown in the upper panels. The signals tend to bleach in a single step, see the upper graph. When there are free labeled nucleotides in the solution (15nM free dye), the background signal is stronger (lower right panel) than the background signal in the absence of free labeled nucleotides in the solution. But the signal from the incorporated single molecule can still be detected. The ability to detect single molecule in the presence of free dye enables one to follow incorporation of nucleotide into an immobilized DNA template in real time. The upper left panel of Figure 6 showed typical images of single molecules
  • Example 5 Determining Nucleotide Incorporation Based on Correlation of Fluorescence Spots A correlation was observed between the position of the immobilized DNA template on the surface (indicated by the fluorescently labeled primer) and the incorporation of nucleotide to the surface.
  • image of the immobilized DNA which was hybridized to the Cy5 labeled primer was shown in the upper two panels (the middle panel is a magnified image of a small area in the left panel). The small dots in the image represent likely positions of the DNA templates immobilized on the surface.
  • the fluorescence signals were then bleached out by a long radiation (about 1 minute) at 635nm with a lOmW laser diode.
  • ddATP, dCTP-Cy3 and dGTP were used to extend Cy5-labeled primer PMu50Cy5, Cy5 5' - gctggcggatgac - 3 ' (SEQ ID NO:4) along the Mu50 oligonucleotide template (SEQ ID NO 3).
  • Incorporation of ddATP immediately after the incorporation of dCTP-Cy3 terminates the elongation. As shown in the lower right panel, there is no multibleaching.
  • Figure 8 shows a time course of incorporation events during the DNA polymerase reaction.
  • the DNA template and Cy5-labeled primer complex was immobilized to the substrate surface as described above, and its position was imaged.
  • the DNA Polymerase was then added along with the nucleotides of which one was labeled with Cy3.
  • the substrate was imaged every 10 sec, with a 1 sec exposure. Every spot with immobilized DNA template (as indicated by the labeled primer) was monitored as a function of time. A series of small images of these spots were placed along a strip resulting in a movie showing the "activities" at each point.
  • Figure 9 shows the dynamic incorporation events at 8 different spots. The digital information recorded in these movies indicate that repeated incorporation events occurred at various time points. The data also demonstrated the feasibility of monitoring primer extension activities on single DNA molecules.
  • Figure 10 shows a histogram of the number of incorporation events on single spots and a histogram of the time between incorporation events. From the histograms one can see that a few nucleotides were incorporated into single DNA molecules. The low numbers of events in which more then three nucleotides were incorporated indicate that there is some mechanism that prevents high number of incorporation into the DNA under the experimental conditions. The reason could be that photo-damage to the DNA in the surrounding area of the illuminated dye might produce toxic radicals. Changing the reaction conditions and reagents could increase the numbers of incorporated nucleotides dramatically.
  • Example 7 Base-by-base Sequence Analysis This experiment was performed to confirm selectivity of the polymerase and to illustrate feasibility of determining the sequence of a polynucleotide template with base- by-base scheme.
  • Figure 11 shows correlation between primer location and polymerase activity location. The position of each point was determined with a sub pixel resolution. Images for the primer location and the incorporation position were taken first. If there is a correlation between the two, there is a pick in the correlation graph. Otherwise no pick was observed. As shown in the figure, the two images correlate with each other. Results demonstrating base-by-base analysis of the sequence of a immobilized template at single molecule resolution is shown in Figure 12.
  • a 6TA6GC oligonucleotide template (SEQ ID NO:6) was immobilized to the fused silica slide.
  • a Cy3- labeled p7G primer (SEQ ID NO:2) was annealed to the template. As illustrated in the
  • the primer was first extended up to the A residue with non-labeled dATP nucleotides. Then, dUTP-Cy3 nucleotide was incorporated and imaged. Images taken at this time show high correlation (see the upper left correlation graph). After bleaching the dyes, dCTP-Cy3 was applied to the sample. Images taken at this time show low correlation (see the lower left correlation graph). Thereafter, non-labeled dGTP was added to fill the CCCCC gap till the G residue in the sequence. At this time, incorporation of a dCTP-Cy3 nucleotide was examined again.
  • Example 8 Fluorescence Resonance Energy Transfer
  • FRET fluorescence resonance energy transfer
  • two fluorescent labels were used (Cy5 and Cy3), and FRET from dUTP-Cy3 (donor) to dCTP-Cy5 (acceptor) was examined at the single molecule level as shown in Figure 13.
  • Image of the DNA template with the labeled primer is shown in the left panel.
  • Detection of FRET after incorporation of the two labels is provided in the right image. Correlation between the template location and the incorporation signals is shown in the middle graph.
  • a fluorescence filter detected only the donor (cy3) fluorescence.
  • a filter for the acceptor (Cy5) was placed. With this setup individual spots were examined after incorporation.
  • Figure 15 further indicates that the FRET detection scheme allows measurement of incorporation rate with a nice signal to noise ratio.

Abstract

The invention provides methods and apparatus for analyzing polynucleotide sequences by asynchronous base extension. Some applications of the invention utilize total internal reflection fluorescence microscopy to image polynucleotide molecules at single molecule resolution.

Description

METHODS AND APPARATUS FOR ANALYZING POLYNUCLEOTIDE SEQUENCES BY ASYNCHRONOUS BASE EXTENSION
CROSS-REFERENCES TO RELATED APPLICATIONS This nonprovisional patent application claims the benefit of U.S. Provisional
Patent Application No. 60/275,232, filed March 12, 2001, the disclosure of which is hereby incorporated by reference in its entirety and for all purposes.
TECHNICAL FIELD The present invention relates to novel methods and apparatus for analyzing polynucleotide sequences with high sensitivity and parallelism.
BACKGROUND OF THE INVENTION
Methods for analyzing polynucleotide sequences can be grouped to two major fields: electrophoretic and non-electrophoretic methods. The electrophoretic methods include slab gel electrophoresis, capillary electrophoresis, microfabricated capillary arrays, and free solution electrophoresis. All these methods rely on the Sanger method in which polynucleotide chain elongation inhibitors are incorporated into the polynucleotide strands which are then separated according to their sizes, usually on a polyacrylamide gel. These methods are the common means for analyzing polynucleotide sequences nowadays.
However, the process is time-consuming, requires large amount of target polynucleotides and reaction reagents, and has limited ability to read long sequences that are inherent in the gel electrophoresis methods. The non-electrophoretic methods include pyrosequencing, sequencing by hybridization, massively parallel signature sequencing, and sequencing by mass spectrometry. These methods also have a number of disadvantages. For example, they usually require synchronization of the polynucleotide templates which inevitably decay with each cycle of sequencing reaction.
Thus, there is a need in the art for better methods for analyzing polynucleotide sequences, e.g., methods with high throughput, parallelism, and resolution. The present invention fulfills this and other needs. SUMMARY OF THE INVENTION
In one aspect, the present invention provides methods for analyzing the sequence of a target polynucleotide. The methods include the steps of (a) providing a primed target polynucleotide immobilized to a surface of a substrate; wherein the target polynucleotide is attached to the surface with single molecule resolution; (b) In the presence of a polymerase, adding a first fluorescently labeled nucleotide to the surface of the substrate under conditions whereby the first nucleotide attaches to the primer, if a complementary nucleotide is present to serve as template in the target polynucleotide; (c) determining presence or absence of a fluorescence signal on the surface where the target polynucleotide is immobilized, the presence of a signal indicating that the first nucleotide was incorporated into the primer, and hence the identity of the complementary base that served as a template in the target polynucleotide; and (d) repeating steps (b)-(c) with a further fluorescently labeled nucleotide, the same or different from the first nucleotide, whereby the further nucleotide attaches to the primer or a nucleotide previously incorporated into the primer. In some methods, a plurality of different primed target polynucleotides are immobilized to different portions of the substrate. In some methods, steps (b)-(c) are performed at least four times with four different types of labeled nucleotides. In some methods, steps (b)-(c) are performed until the identity of each base in the target polynucleotide has been identified. In some methods, there is an additional step of removing the signal after step (c). In some methods, all ingredients are present simultaneously and a continues monitoring of the incorporation is facilitated.
In some methods of the invention, the presence or absence of a fluorescence signal is determined with total internal reflection fluorescence (TIRF) microscopy. In some methods, the target polynucleotide is primed with a fluorescently labeled primer (e.g., with Cy5 or Cy3). Some methods of the invention employ nucleotides that are labeled with Cy3 or Cy5.
Various materials can be used to immobilize the target polynucleotides. In some methods, a fused silica or glass slide is used. In some methods, the substrate surface is coated with a polyelectrolyte multilayer (PEM). The PEM can be terminated with a polyanion, which helps to repel nucleotides from the surface and reduce non-specific binding to the surface. The polyanion can bear pendant carboxylic acid groups. In some of these methods, the target polynucleotide is biotinylated, and the substrate surface is coated with streptavidin. Often the surface is coated with biotin prior to coating with streptavidin. In some methods, the surface is coated with a polyelectrolyte multilayer (PEM) terminated with carboxylic acid groups prior to attachment of biotin.
In some methods of the invention, a light source for illuminating the surface of said substrate and a detection system for detecting a signal from said surface are employed. Optionally, an appropriately programmed computer is also employed for recording identity of a nucleotide when the nucleotide becomes incorporated into the immobilized primer. In another aspect, the invention provides apparatus for carrying out the methods of the invention. Typically, the apparatus contain (a) a flow cell which houses a substrate for immobilizing target polynucleotide(s) with single molecule resolution; (b) an inlet port and an outlet port in fluid communication with the flow cell for flowing fluids into and through the flow cell; (c) a light source for illuminating the surface of the substrate; and
(d) a detection system for detecting a signal from said surface. Some of the apparatus are microfabricated. In some of these apparatus, the substrate is a microfabricated synthesis channel. A further understanding of the nature and advantages of the present invention may be realized by reference to the remaining portions of the specification, the figures and claims.
All publications, patents, and patent applications cited herein are hereby expressly incorporated by reference in their entirety and for all purposes to the same extent as if each was so individually denoted.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 shows schematically immobilization of a primed polynucleotide and incorporation of labeled nucleotides.
Figure 2 shows schematically the optical setup of a detection system for total internal reflection microscopy.
Figure 3 shows results which indicate that streptavidin is required for immobilizing the polynucleotide template in an exemplified embodiment.
Figure 4 shows results which indicate that DNA polymerase incorporating labeled nucleotide into the immobilized primer is visualized with single molecule resolution. Figure 5 shows incorporation of multiple labeled nucleotides in a bulk experiment in solution, using biotin-labeled 7G oligonucleotide template (SEQ ID NO:l) and p7G primer (SEQ ID NO:2).
Figure 6 shows low background signal from free nucleotides in solution and detection of signals from incorporated nucleotides.
Figure 7 shows results from experiments and simulation of multiple bleaching.
Figure 8 shows dynamics of incorporation of labeled nucleotides into the immobilized primer.
Figure 9 shows multiple incorporation events of labeled nucleotides over a period of time.
Figure 10 shows statistics of incorporation of labeled nucleotides over a period of time.
Figure 11 shows correlation between location of labeled primer and location of incorporation of labeled nucleotides.
Figure 12 shows correlation graphs for incorporation of two labeled nucleotides, using a 6TA6GC oligonucleotide template (SEQ ID NO: 6) and a p7G primer (SEQ ID NO:2). Partial sequences of the template, 5'- GccccccAtttttt - 3' (SEQ ID NO:7), and the extended product, 5' - aaaaaaUggggggC (SEQ ID NO:8), are also shown in the Figure.
Figure 13 shows detection of fluorescence resonance energy transfer (FRET) when two different labels are incorporated into the same primer. The polynucleotide template used here is the 7G7A oligonucleotide (SEQ ID NO:5), but only part of the sequence, 5' - AttctttGcttcttAttctttGcttcttAttctttG - 3' (SEQ ID NO:9), is shown in the Figure. Figure 14 shows correlation of single molecule FRET signals over a period of time.
Figure 15 shows the expected signals from an experiment in which two colors, donor and acceptor, are incorporated one after the another. Partial sequences of the template, 5'- GccccccAtttttt - 3' (SEQ ID NO:7), and the extended product, 5' - aaaaaaUggggggC (SEQ H) NO: 8), are also shown in the Figure.
DETAILED DESCRIPTION I. Overview
The present invention provides methods and apparatus for analyzing polynucleotides with high sensitivity, parallelism, and long read frames. The invention is predicated in part on visualization of incorporation of labeled nucleotides into immobilized polynucleotide template molecules in a time resolved manner with single molecule resolution. As each of the immobilized template molecules is read individually, no synchronization is needed between the different molecules. Instead, with methods of the present invention, asynchronous base extension is sufficient for analyzing a target polynucleotide sequence.
In some aspects of the invention, single molecule resolution was achieved by immobilizing the template molecules at very low concentration to a surface of a substrate, coating the surface to create surface chemistry that facilitates template attachment and reduces background noise, and imaging nucleotide incorporation with total internal reflection fluorescence microscopy. Analysis with single molecule resolution provides the advantage of monitoring the individual properties of different molecules. It allows identification of properties of an individual molecule that can not be revealed by bulk measurements in which a large number of molecules are measured together. Furthermore, to determine kinetics, bulk measurements require synchronization of the molecules or system state, while in single molecule analysis there is no need for synchronization.
The polynucleotides suitable for analysis with the invention can be DNA or RNA. The analysis can be for sequence analysis, DNA fingerprinting, polymorphism identification, or gene expression measurement. The methods can also be used to analyze activities of other biomacromolecules such as RNA translation and protein assembly. In a preferred embodiment, the method entails immobilization of primed polynucleotide templates to the surface of a solid substrate (e.g., a glass slide). The templates are pre-hybridized to a labeled primer (e.g., with a fluorescent dye) so that their location on the surface can be imaged with single molecule sensitivity. An evanescent light field is set up at the surface in order to image the fluorescently labeled polynucleotide molecules. The evanescent field is also used to image fluorescently labeled nucleotide triphosphates (dNTPs or NTPs) upon their incorporation into the immobilized primer when a polymerase is present.
Methods of the present invention find various applications in polynucleotide sequence analysis. In some applications, a static approach is employed. Such an approach involves adding just one type of labeled nucleotide to the extension reaction at any given time. The signal is incorporated into the primer if the next template residue in the target polynucleotide is the complementary type. Otherwise, a different type of labeled nucleotide is used until the correct residue is incorporated. In other applications, a dynamic approach is employed. In these methods, all four types of nucleotides (at least one type labeled) are simultaneously present in the reaction, and incorporation of the signals into the primer is monitored dynamically. For example, incorporated signals are imaged continuously, preferably at a rate faster than the rate at which the nucleotides are incorporated into the primer.
Preferably, visualization of the templates or incorporated nucleotides are realized with total internal reflection (TIR) fluorescence microscopy. With TIR technology, the excitation light (e.g., a laser beam) illuminates only a small volume of liquid close to the substrate (excitation zone). Signals from free nucleotides in solution that are not present in the excitation zone are not detected. Signals from free nucleotides that diffuse into the excitation zone appear as a broad band background because the free nucleotides move quickly across the excitation zone. Optionally, the fluorescence signals are removed by photob leaching or by chemical means after one or more rounds of incorporation. The methods can also employ micro fluidic means to control flow of reaction reagents. In such methods, labeled nucleotides and other reaction reagents can be exchanged in a fast and economic way.
Further, employing a microfluidic device which allows fast fluid exchange, concentrations of nucleotides and/or other reaction reagents can be alternated at different time points of the analysis. This could lead to increased incorporation rate and sensitivity of the analysis. For example, when all four types of nucleotides are simultaneously present in the reaction to monitor dynamic incorporation of nucleotides, concentrations of the nucleotides can be alternated between μM range and sub-nM range. This leads to both better visualization of the signals when low concentrations of nucleotides are present, and increased polymerization rate when higher concentrations of nucleotides are present. Using a microfluidic device, the rate at which the concentrations can be alternated can be as high as a few tens of Hertz. Alternating concentrations of nucleotides is also beneficial to improving signal visualization and polymerization rate in the static approach of sequence analysis. In this approach, after adding a given type of labeled nucleotide to the immobilized template/primer complex and sufficient time for incorporation, free nucleotides (as well as other reaction reagents in solution) can be flown out using a microfluidic device. This will leave a much lower concentration of free nucleotide when the signals are visualized. Optionally, an additional washing step can be employed to further reduce the free nucleotide concentration before the signals are imaged.
In some methods, polynucleotide sequence analysis is accomplished by using four different fluorescent labels on the four nucleotide triphosphates. Incorporated signals are imaged and then photobleached before the next incorporation cycle. Runs of identical bases (e.g., AAAAA) can be identified by, e.g., monitoring the intensity of the signal so that the number of fluorophores at the emitting spot can be determined. Further, signals due to fluorescence resonance energy transfer (FRET) can be detected from individual DNA strands when two different type of fluorescent dyes are incorporated into the same DNA. Such signals are useful to determine sequence information of the immobilized template polynucleotide. Thus, in some methods, multiple types of labeled nucleotides (e.g., 2 to 4 types each labeled with a different fluorescent dye) can be added at the same time for the extension reactions. In some methods, one type of labeled nucleotide is added at a step, and each extension cycle may comprise four such steps in order to observe the incorporation of a complementary nucleotide. In some methods, less than all four dNTPs are labeled. For example, the analysis can have only two of the nucleotides labeled. By repeating the experiment with different pairs (e.g., AT, AG, AC, TG, TC, GC), the original nucleotide sequence can be delineated. In some methods, the incorporation/extension reaction is performed with multiple copies of the template polynucleotide. Alternatively, one immobilized template molecule can be used repeatedly, by denaturing the extended molecule, removing the newly synthesized strand, annealing a new primer, and then repeating the experiment in situ with fresh reagents.
The present invention is also useful to obtain partial sequence information of a target polynucleotide, e.g., by using only two or three labeled nucleotide species. The relative positions of two or three nucleotide species in the sequence in conjunction with known sequence databases can facilitate determination of the identity of the target sequence, i.e., whether it is identical or related to a known sequence. Such an approach is useful, for example, in determining gene expressions by sequencing cDNA libraries.
The present methods avoid many of the problems observed with the prior art sequencing methods. For example, the methods are highly parallel since many molecules are analyzed simultaneously and in high density (e.g., one template molecule per ~ lOμm of surface area). Thus, many different polynucleotides can be sequenced or genotyped on a single substrate surface simultaneously. In addition, stepwise addition of nucleotides is unnecessary in some methods, as all four nucleotides can be added simultaneously. Rather, sequence information is produced continuously as polymerases continually incorporate all four nucleotides into growing polynucleotide chains. The methods are also extremely sensitive because information obtained from only a single copy of the template molecule is needed in order to determine its sequence. Releasing the extension product from the polynucleotide template, e.g., by denaturing and annealing the template with a different primer provides the opportunity to read again the same template molecule with different sets of nucleotides (e.g., different combinations of two types of labeled nucleotide and two types of unlabeled nucleotides).
II. Definitions Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which this invention pertains. The following references provide one of skill with a general definition of many of the terms used in this invention: Singleton et al, DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY (2d ed. 1994); THE CAMBRIDGE DICTIONARY OF SCIENCE AND TECHNOLOGY (Walker ed., 1988); and Hale & Marham, THE HARPER COLLINS DICTIONARY OF BIOLOGY (1991). Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are described. The following definitions are provided to assist the reader in the practice of the invention. "Array" refers to a solid support having more than one site or location having either a target polynucleotide or a polymerase bound thereto.
A "base" or "base-type" refers to a particular type of nucleoside base. Typical bases include adenine, cytosine, guanine, uracil, or thymine bases where the type refers to the subpopulation of nucleotides having that base within a population of nucleotide triphosphates bearing different bases. Other rarer bases or analogs can be substituted such as xanthine or hypoxanthine or methylated cytosine.
"Complements a region of the target nucleic acid downstream of the region to be sequenced" in the context of sequencing or genotyping refers to the fact that the primers are extended in a 3 ' direction by a polymerase. Therefore the primer binds to a subsequence of the target 3' (downstream) to the target sequence that is to be determined as the 3' end of the primer is extended.
"Genotyping" is a determination of allelic content of a target polynucleotide without necessarily determining the sequence content of the entire polynucleotide. It is a subset of sequencing. For example the identification of single nucleotide polymorphisms by determination of single base differences between two known forms of an allele is a form of sequencing that does not require all the target polynucleotide to be sequenced.
"Immobilizing" refers to the attachment of a target nucleic acid or polymerase to a solid support by a means that prevents its release in a reaction solution. The means can be covalent bonding or ionic bonding or hydrophobic bonding.
"Nucleoside" includes natural nucleosides, including ribonucleosides and 2'- deoxyribonucleosides, as well as nucleoside analogs having modified bases or sugar backbones.
The terms "nucleic acid" or "nucleic acid molecule" refer to a deoxyribonucleotide or ribonucleotide polymer in either single- or double-stranded form, and unless otherwise limited, can encompass known analogs of natural nucleotides that can function in a similar manner as naturally occurring nucleotides. Unless otherwise noted, "nucleic acid" and "polynucleotide" are used interchangeably.
"Oligonucleotide" or "polynucleotide" refers to a molecule comprised of a plurality of deoxyribonucleotides or nucleoside subunits. The linkage between the nucleoside subunits can be provided by phosphates, phosphonates, phosphoramidates, phosphorothioates, or the like, or by nonphosphate groups as are known in the art, such as peptide-type linkages utilized in peptide nucleic acids (PNAs). The linking groups can be chiral or achiral. The ohgonucleotides or polynucleotides can range in length from 2 nucleoside subunits to hundreds or thousands of nucleoside subunits. While ohgonucleotides are preferably 5 to 100 subunits in length, and more preferably, 5 to 60 subunits in length, the length of polynucleotides can be much greater (e.g., up to 100 kb). (...if a whole chromosome is targeted...Thought 1 OOkb will be already nice..) ["e.g." means it is not exclusive. Also, "100 Mb" probably does not make practical sense] "Optical reader" or "detection system" refers to a device that can detect and record light emitted from the labeled dNTP (or NTP) or immobilized polynucleotide template (and/or primer) molecules.
The term "primer" refers to an oligonucleotide, whether occurring naturally as in a purified restriction digest or produced synthetically, which is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product which is complementary to a nucleic acid strand is induced, (i.e., in the presence of nucleotides and an inducing agent such as DNA polymerase and at a suitable temperature, buffer and pH). The primer is preferably single stranded for maximum efficiency in amplification, but can alternatively be double stranded. If double stranded, the primer is first treated to separate its strands before being used to prepare extension products. Preferably, the primer is an oligodeoxyribonucleotide. The primer must be sufficiently long to prime the synthesis of extension products in the presence of the inducing agent. The exact lengths of the primers depend on many factors, including temperature, source of primer and the use of the method.
A primer is selected to be "substantially" complementary to a strand of specific sequence of the template. A primer must be sufficiently complementary to hybridize with a template strand for primer elongation to occur. A primer sequence need not reflect the exact sequence of the template. For example, a non-complementary nucleotide fragment can be attached to the 5' end of the primer, with the remainder of the primer sequence being substantially complementary to the strand. Non-complementary bases or longer sequences can be interspersed into the primer, provided that the primer sequence has sufficient complementarity with the sequence of the template to hybridize and thereby form a template primer complex for synthesis of the extension product of the primer. The use of random primer is used in some cases. For example, when the terminal sequence of the target or template polynucleotide is not known, random primer combinations can be used.
The term "probe" refers to an oligonucleotide (i.e., a sequence of nucleotides), whether occurring naturally as in a purified restriction digest or produced synthetically, recombinantly or by PCR amplification, which is capable of hybridizing to another oligonucleotide of interest. A probe can be single-stranded or double-stranded. Probes are useful in the detection, identification and isolation of particular gene sequences. It is contemplated that any probe used in the present invention can be labeled with any "reporter molecule," so that is detectable in any detection system, including, but not limited to fluorescent, enzyme (e.g., ELISA, as well as enzyme-based histochemical assays), radioactive, quantum dots, and luminescent systems. It is not intended that the present invention be limited to any particular detection system or label.
"Sequencing" refers to the determination of the order and position of bases in a polynucleotide molecule. "Single molecule configuration" refers to an array of molecules on a solid support where members of the array are present as an individual molecule located in a defined location. The members can be the same or different.
"Single molecule resolution" refers to the ability of a system to resolve one molecule from another. For example, in far field optical system the detection limit is in the order of a micron. This implies that the distance between two identical molecules to be resolved is at least few microns apart.
"Specific hybridization" refers to the binding, duplexing, or hybridizing of a molecule only to a particular nucleotide sequence under stringent conditions. Stringent conditions are conditions under which a probe can hybridize to its target subsequence, but to no other sequences. Stringent conditions are sequence-dependent and are different in different circumstances. Longer sequences hybridize specifically at higher temperatures. Generally, stringent conditions are selected to be about 5° C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength, pH, and nucleic acid concentration) at which 50% of the probes complementary to the target sequence hybridize to the target sequence at equilibrium. Typically, stringent conditions include a salt concentration of at least about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes (e.g., 10 to 50 nucleotides). Stringent conditions can also be achieved with the addition of destabilizing agents such as formamide or tetraalkyl ammonium salts. For example, conditions of 5X SSPE (750 mM NaCl, 50 mM Na Phosphate, 5 mM EDTA, pH 7.4) and a temperature of 25-30°C are suitable for allele-specific probe hybridizations. (See Sambrook et al., Molecular Cloning 2001).
The term "template" or "target" refers to a polynucleotide of which the sequence is to be analyzed. In some cases "template" is sought to be sorted out from other polynucleotide sequences. "Substantially single-stranded template" is polynucleotide that is either completely single-stranded (having no double-stranded areas) or single-stranded except for a proportionately small area of double-stranded polynucleotide (such as the area defined by a hybridized primer or the area defined by intramolecular bonding). "Substantially double-stranded template" is polynucleotide that is either completely double-stranded (having no single-stranded region) or double-stranded except for a proportionately small area of single-stranded polynucleotide.
III. Template Preparation and Immobilization A. Introduction
This invention provides novel methods and apparatus to analyze polynucleotide sequences (e.g., sequencing and genotyping). Preferably, the target or template polynucleotide to be analyzed is immobilized to the surface of a solid substrate (e.g., a fused silica slide) at single molecule resolution. Preferably, the polynucleotide is pre- hybridized to a labeled primer. A DNA or RNA polymerase, four different types of nucleotide triphosphates (NTPs or dNTPs, depending on the template and polymerase used), and other reaction reagents are then applied to the immobilized polynucleotide. At least one type of the nucleotides are fluorescently labeled. When more than one type of NTPs are labeled, the labels are preferably different for different NTPs. Using TIR fluorescent microscopy, incorporation of the labeled nucleotide into a target or template polynucleotide is detected by imaging fluorescence signal from the immobilized polynucleotide with single molecule resolution. Preferably, all four labeled NTPs are present simultaneously. As the polymerase continues to move along the target polynucleotide, the polynucleotide sequence is read from the order of the incorporated labels.
B. Target or template polynucleotide
The target polynucleotide is not critical and can come from a variety of standard sources. It can be mRNA, ribosomal RNA, genomic DNA or cDNA. They can comprise naturally occurring and or non-naturally occurring nucleotides. Templates suitable for analysis according to the present invention can have various sizes. For example, the template can have a length of 100 bp, 200 bp, 500 bp, 1 kb, 3 kb, 10 kb, or 20 kb and so on. When the target is from a biological source, there are a variety of known procedures for extracting polynucleotide and optionally amplified to a concentration convenient for genotyping or sequence work. Polynucleotide can be obtained from any living cell of a person, animal or plant. Humans, pathogenic microbes and viruses are particularly interesting sources.
Polynucleotide amplification methods are known in the art. Preferably, the amplification is carried out by polymerase chain reaction (PCR). See, U.S. Pat. Nos. 4,683,202. 4,683,195 and 4,889,818; Gyllenstein et al., 1988, Proc. Natl. Acad. Sci. USA 85: 7652-7656; Ochman et al., 1988, Genetics 120: 621-623; Loh et al., 1989, Science 243: 217- 220; Innis et al., 1990, PCR Protocols, Academic Press, Inc., San Diego, Calif. Other amplification methods known in the art that can be used in the present invention include ligase chain reaction (see EP 320,308), or methods disclosed in Kricka et al., 1995, Molecular Probing, Blotting, and Sequencing, Chap. 1 and Table IX, Academic Press, New York.
C. Primer annealing
Primers in combination with polymerases are used to sequence target polynucleotide. Primer length is selected to provide for hybridization to complementary template polynucleotide. The primers will generally be at least 10 bp in length, usually between 15 and 30 bp in length. If part of the template sequence is known, a specific primer can be constructed and hybridized to the template. Alternatively, if sequence of the template is completely unknown, the primers can bind to synthetic oligonucleotide adaptors joined to the ends of target polynucleotide by a ligase.
In some methods, the primer is labeled. When hybridized to the immobilized template, the labeled primer facilitates imaging location of the template. As exemplified in the Examples below, the primer can be labeled with a fluorescent label (e.g., Cy5). Preferably, the label used to label the primer is different from the labels on the nucleotides in the subsequent extension reactions.
The primers can be synthetically made using conventional nucleic acid synthesis technology. For example, the primers can be conveniently synthesized on an automated DNA synthesizer, e.g. an Applied Biosystems, Inc. (Foster City, Calif.) model 392 or 394 DNA/RNA Synthesizer, using standard chemistries, such as phosphoramidite chemistry, e.g. disclosed in the following references: Beaucage and Iyer, Tetrahedron, 48: 2223-2311 (1992); Molko et al, U.S. Pat. No. 4,980,460; Koster et al, U.S. Pat. No. 4,725,677; Caruthers et al, U.S. Pat. Nos. 4,415,732; 4,458,066; and 4,973,679; and the like. Alternative chemistries, e.g. resulting in non-natural backbone groups, such as phosphorothioate, phosphoramidate, and the like, may also be employed provided that the resulting ohgonucleotides are compatible with the polymerase. The primers can also be ordered commercially from a variety of companies which specialize in custom ohgonucleotides such as Operon Inc (Alameda, California).
Primer annealing is performed under conditions which are stringent enough to achieve sequence specificity yet sufficiently permissive to allow formation of stable hybrids at an acceptable rate. The temperature and length of time required for primer annealing depend upon several factors including the base composition, length and concentration of the primer, and the nature of the solvent used, e.g., the concentration of DMSO, formamide, or glycerol, and counter ions such as magnesium. Typically, hybridization with synthetic polynucleotides is carried out at a temperature that is approximately 5 to 10°C below the melting temperature of the target-primer hybrid in the annealing solvent. In some methods, the annealing temperature is in the range of 55 to 75°C. and the primer concentration is approximately 0.2 μM. Other conditions of primer annealing are provided in the Examples below. Under these preferred conditions, the annealing reaction can be complete in only a few seconds.
D. Immobilization of template polynucleotide
Preferably, the template or target polynucleotide molecules are provided as single molecule arrays immobilized to the surface of a solid substrate. The substrate can be glass, silica, plastic or any other conventionally non-reactive material that will not create significant noise or background for the fluorescent detection methods. Substrate surface to which the template polynucleotides are to be immobilized can also be the internal surface of a flow cell in a microfluidic apparatus, e.g., a microfabricated synthesis channel of the apparatus as described in the PCT application of Quake et al. (WO 01/32930; which is incorporated herein by reference). In some preferred embodiments, the solid support is made from fused silica slide (e.g., a fused silica glass slide from Esco, Cat. R130110). Compared to other support materials (e.g., a regular glass slide), fused silica has very low auto- fluorescence.
In some applications of the present invention, the template or target polynucleotides are immobilized to the substrate surface with single molecule resolution. In such methods, as exemplified in the Examples below, single molecule resolution is achieved by using very low concentration of the polynucleotide in the immobilization reaction. For example, a 10 pM concentration for a 80-mer polynucleotide template allows attachment of the polynucleotide to the surface of a silica slide at single molecule resolution (see Example 1). Template immobilization with single molecule resolution can also be verified by measuring bleach pattern of the fluorescently labeled templates (see Example 5).
In some methods, the templates are hybridized to the primers first and then immobilized to the surface. In some methods, the templates are immobilized to the surface prior to hybridization to the primer. In still some methods, the primers are immobilized to the surface, and the templates are attached to the substrates through hybridization to the primers. In still some methods, the polymerase is immobilized to the surface.
Various methods can be used to immobilize the templates or the primers to the surface of the substrate. The immobilization can be achieved through direct or indirect bonding of the templates to the surface. The bonding can be by covalent linkage. See, Joos et al., Analytical Biochemistry 247:96-101, 1997; Oroskar et al., Clin. Chem 42:1547-1555, 1996; and Khandjian, Mole. Bio. Rep. 11:107-115, 1986. The bonding can also be through non-covalent linkage. For example, Biotin-streptavidin (Taylor et al., J. Phys. D. Appl. Phys. 24:1443, 1991) and digoxigenin and anti-digoxigenin (Smith et al., Science 253: 1122, 1992) are common tools for attaching polynucleotides to surfaces and parallels. Alternatively, the bonding can be achieved by anchoring a hydrophobic chain into a lipidic monolayer or bilayer. When biotin-streptavidin linkage is used to immobilize the templates, the templates are biotinylated, and one surface of the substrates are coated with streptavidin. Since streptavidin is a tetramer, it has four biotin binding sites per molecule. Thus, it can provide linkage between the surface and the template. In order to coat a surface with streptavidin, the surface can be biotinylated first, and then parts of the four binding sites of streptavidin can be used to anchor the protein to the surface, leaving the other sites free to bind the biotinylated template (see, Taylor et al., J. Phys. D. Appl. Phys. 24:1443, 1991). Such treatment leads to a high density of streptavidin on the surface of the substrate, allowing a correspondingly high density of template coverage. Surface density of the template molecules can be controlled by adjusting concentration of the template which is applied to the surface. Reagents for biotinylating a surface can be obtained, for example, from Vector laboratories. Alternatively, biotinylation can be performed with BLCPA: EZ-Link Biotin LC-PEO-Amine (Pierce, Cat. 21347). In some methods, labeled streptavidin (e.g., with a fluorescent label) of very low concentration (e.g., in the μM, nM or pM range) is used to coat the substrate surface prior to template immobilization. This facilitates immobilization of the template with single molecule resolution. It also allows monitoring of spots on the substrate to which the template molecules are attached, and subsequent nucleotide incorporation events. While diverse polynucleotide templates can be each immobilized to and sequenced in a separate substrate, multiple templates can also be analyzed on a single substrate. In the latter scenario, the templates are attached at different locations on the substrate. This can be accomplished by a variety of different methods, including hybridization of primer capture sequences to ohgonucleotides immobilized at different points on the substrate, and sequential activation of different points down the substrate towards template immobilization.
Methods of creation of surfaces with arrays of oligonucleo tides have been described, e.g., in U.S. Patent Nos. 5,744,305, 5,837,832, and 6,077,674. Primers with two domains, a priming domain and a capture domain, can be used to anchor templates to the substrate. The priming domain is complementary to the target template. The capture domain is present on the non-extended side of the priming sequence. It is not complementary to the target template, but rather to a specific oligonucleotide sequence present on the substrate. The target templates can be separately hybridized with their primers, or (if the priming sequences are different) simultaneously hybridized in the same solution. Incubation of the primer/template duplexes with the substrate under hybridization conditions allows attachment of each template to a unique spot. Multiple substrates can be charged with templates in this fashion simultaneously.
Another method for attaching multiple templates to the surface of a single substrate is to sequentially activate portions of the substrate and attach template to them. Activation of the substrate can be achieved by either optical or electrical means. Optical illumination can be used to initiate a photochemical deprotection reaction that allows attachment of the template to the surface (see, e.g., U.S. Patent Nos. 5,599,695, 5,831,070, and 5,959,837). For instance, the substrate surface can be derivitized with "caged biotin", a commercially available derivative of biotin that becomes capable of binding to avidin only after being exposed to light. Templates can then be attached by exposure of a site to light, filling the channel with avidin solution, washing, and then flowing biotinylated template into the channel. Another variation is to prepare avidinylated substrate and a template with a primer with a caged biotin moiety; the template can then be immobilized by flowing into the channel and illumination of the solution above a desired area. Activated template/primer duplexes are then attached to the first wall they diffused to, yielding a diffusion limited spot. Electrical means can also be used to direct template to specific locations on a substrate. By positively charging one electrode in the channel and negatively charging the others, a field gradient can be created which drives the template to a single electrode, where it can attach (see, e.g., U.S. Patent Nos. 5,632,957, 6,051,380, and 6,071,394). Alternatively, it can be achieved by electrochemically activating regions of the surface and changing the voltage applied to the electrodes. Patterning of particular chemicals, include proteins and DNA is possible with a stamp method, in which a microfabricated plastic stamp is pressed on the surface (see, e.g., Lopez et al., J. Amer. Chem. Soc. 115:10774-81, 1993). Different templates can also be attached to the surface randomly as the reading of each individual is independent from the others.
E. Treatment of substrate surface In some applications, surface of the substrate is pretreated to create surface chemistry that facilitates attachment of the polynucleotide templates and subsequent synthesis reactions. The surface chemistry also reduces the background from non specific attachment of free labeled nucleotide to the surface of the substrate.
In some methods, the surface is coated with a polyelectrolyte multilayer (PEM). In some methods, non-PEM based surface chemistry can be created prior to template attachment. Preferably, the substrate surface is coated with a polyelectrolyte multilayer (PEM). Attachment of templates to PEM-coated surface can be accomplished by light- directed spatial attachment (see, e.g., U.S. Patent Nos. 5,599,695, 5,831,070, and 5,959,837). Alternatively, the templates can be attached to PEM-coated surface entire chemically (see below for detail).
PEM formation has been described in Decher et al. (Thin Solid Films, 210:831-835, 1992). PEM formation proceeds by the sequential addition of polycations and polyanions, which are polymers with many positive or negative charges, respectively. Upon addition of a polycation to a negatively-charged surface, the polycation deposits on the surface, forming a thin polymer layer and reversing the surface charge. Similarly, a polyanion deposited on a positively charged surface forms a thin layer of polymer and leaves a negatively charged surface. Alternating exposure to poly(+) and poly(-) generates a polyelectrolyte multilayer structure with a surface charge determined by the last polyelectrolyte added; in the case of incompletely-charged surfaces, multiple-layer deposition also tends to increase surface charge to a well defined and stable level.
An exemplified scheme of coating a substrate with PEM for immobilizing polynucleotide is provided in PCT publication WO 01/32930. Detailed procedures are also disclosed in the Examples below. Briefly, the surface of the substrate (e.g., a glass cover slip) is cleaned with a RCA solution. After cleaning, the substrate is coated with a polyelectrolyte multilayer (PEM). Following biotinylation of the carboxylic acid groups, streptavidin is then applied to generate a surface capable of capturing biotinylated molecules. Biotinylated polynucleotide templates are then added to the coated glass cover slip for attachment. The surface chemistry thus created provides various advantages for the methods of the present invention, because it generates a strong negatively-charged surface which repels the negatively-charged nucleotides. First, a polyelectrolyte multilayer terminated with carboxylic acid-bearing polymer is easy to attach polynucleotide to because carboxylic acids are good targets for covalent bond formation. In addition, the attached template is active for extension by polymerases - most probably, the repulsion of like charges prevents the template from "laying down" on the surface. Finally, the negative charge repels the fluorescent nucleotides, and nonspecific binding is low.
The attachment scheme described here is easy to generalize on. Without modification, the PEM/biotin streptavidin surface that is produced can be used to capture or immobilize any biotinylated molecule. A slight modification can be the use of another capture pair, e.g., substituting digoxygenin (dig) for biotin and labeling the molecule to be immobilized with anti-digoxygenin (anti-dig). Reagents for biotinylation or dig-labeling of amines are all commercially available.
Another generalization is that the chemistry is nearly independent of the surface chemistry of the support. Glass, for instance, can support PEMs terminated with either positive or negative polymer, and a wide variety of chemistry for either. But other substrates such as silicone, polystyrene, polycarbonate, etc, which are not as strongly charged as glass, can still support PEMs. The charge of the final layer of PEMs on weakly-charged surfaces becomes as high as that of PEMs on strongly-charged surfaces, as long as the PEM has sufficiently-many layers. This means that all the advantages of the glass/PEM^)iotin/Streptavidin/biotin-DNA surface chemistry can be applied to other substrates.
IV. Primer Extension Reaction
Once templates are immobilized to the surface of a substrate, primer extension reactions are performed, e.g., as described in Sambrook, supra; Ausubel, supra; and Hyman, Anal. Biochem., 174, p. 423, 1988. In some methods, the primer is extended by a polynucleotide polymerase in the presence of a single type of labeled nucleotide. In other methods, all four types of differently labeled nucleotides are present. In some applications of the present invention, a combination of labeled and non-labeled nucleotides are used in the analysis. A label is incorporated into the template/primer complex only if the specific labeled nucleotide added to the reaction is complementary to the nucleotide on the template adjacent the 3' end of the primer. Optionally, the template is subsequently washed to remove any unincorporated label, and the presence of any incorporated label is determined. As some errors can be caused by the polymerase, the reaction conditions and incubation time should minimize these errors.
A. Labeled nucleotides To facilitate detection of nucleotide incorporation, at least one and usually all types of the deoxyribonucleotides (dATP, dTTP, dGTP, dCTP, dUTP/dTTP) or nucleotides (ATP, UTP, GTP, and CTP) are labeled with fluorophores. When more than one type of nucleotides are labeled, a different kind of label can be used to label each different type of nucleotide. However, in some applications, the different types of nucleotides can be labeled with the same kind of labels.
Various fluorescent labels can be used to label the nucleotides in the present invention. The fluorescent label can be selected from any of a number of different moieties. The preferred moiety is a fluorescent group for which detection is quite sensitive. The affinity to the surface could be changed between different dyes. Low affinity to the surface is preferred. For example, Cy3 and Cy5 are used to label the primer or nucleotides in some methods of the invention. However, Cy5 has higher affinity to the surface under certain experimental condition than Cy3.
Other factors that need to be considered include stability of the dyes. For example, Cy5 is less stable and tends to bleach faster than Cy3. Such property can be of advantage or disadvantage, depending on the circumstances. In addition, different sizes of the dyes can also affect efficiency of incorporation of labeled nucleotides. Further, length of the linker between the dye and the nucleotide can impact efficiency of the incorporation (see, Zhu and Waggoner, Cytometry 28: 206, 1997).
An exemplary list of fluorophores, with their corresponding absorption/emission wavelength indicated in parenthesis, that can be used in the present invention include Cy3 (550/565), Cy5 (650/664), Cy7 (750/770), Rhol23 (507/529), R6G (528/551), BODIPY 576/589 (576/589), BODIPY TR (588/616), Nile Blue (627/660), BODIPY 650/665 (650/665), Sulfo-IRD700 (680/705), NN382 (778/806), Alexa488 (490/520), Tetramethylrhodamine (550/570). and Rodamine X (575/605). The fluorescently labeled nucleotides can be obtained commercially (e.g., from NEN DuPont, Amersham, or BDL). Alternatively, fluorescently labeled nucleotides can also be produced by various fluorescence-labeling techniques, e.g., as described in Kambara et al. (1988) "Optimization of Parameters in a DNA Sequenator Using Fluorescence Detection," Bio/Technol. 6:816-821; Smith et al. (1985) Nucl. Acids Res, 13:2399-2412; and Smith et al. (1986) Nature 321 :674-679. Acyl fluoride of Cy5 cyanine dye can also be synthesized and labeled as described in U.S. Patent No. 6,342,326.
There is a great deal of practical guidance available in the literature for providing an exhaustive list of fluorescent and chromogenic molecules and their relevant optical properties (see, for example, Berlman, Handbook of Fluorescence Spectra of
Aromatic Molecules, 2nd Edition (Academic Press, New York, 1971); Griffiths, Colour and Constitution of Organic Molecules (Academic Press, New York, 1976); Bishop, Ed., Indicators (Pergamon Press, Oxford, 1972); Haugland, Handbook of Fluorescent Probes and Research Chemicals (Molecular Probes, Eugene, 1992) Pringsheim, Fluorescence and Phosphorescence (Interscience Publishers, New York, 1949); and the like. Further, there is extensive guidance in the literature for derivatizing fluorophore and quencher molecules for covalent' attachment via common reactive groups that can be added to a nucleotide, as exemplified by the following references: Haugland (supra); Ullman et al., U.S. Pat. No. 3,996,345; Khanna et al., U.S. Pat. No. 4,351,760. There are many linking moieties and methodologies for attaching fluorophore moieties to nucleotides, as exemplified by the following references: Eckstein, editor, Ohgonucleotides and Analogues: A Practical Approach (IRL Press, Oxford, 1991); Zuckerman et al., Nucleic Acids Research, 15: 5305-5321 (1987) (3' thiol group on oligonucleotide); Sharma et al, Nucleic Acids Research, 19: 3019 (1991) (3' sulfhydryl); Giusti et al, PCR Methods and Applications, 2: 223-227 (1993) and Fung et al, U.S. Pat. No. 4,757,141 (5' phosphoamino group via Aminolink™. II available from Applied Biosystems, Foster City, Calif.) Stabinsky, U.S. Pat. No. 4,739,044 (3* aminoalkylphosphόryl group); Agrawal et al, Tetrahedron Letters, 31: 1543-1546 (1990) (attachment via phosphoramidate linkages); Sproat et al, Nucleic Acids Research, 15: 4837 (1987) (5' mercapto group); Nelson et al, Nucleic Acids Research, 17: 7187-7194 (1989) (31 amino group); and the like.
In instances where a multi-labeling scheme is utilized, a wavelength which approximates the mean of the various candidate labels' absorption maxima may be used. Alternatively, multiple excitations may be performed, each using a wavelength corresponding to the absorption maximum of a specific label.
B. Other reaction reagents 1. Polymerases Many polymerases can be selected for use in this invention. Preferred polymerases are able to tolerate labels on the nucleobase. For example, some applications of the present invention employ polymerases that have increased ability to incorporate modified, fluorophore-labeled, nucleotides into polynucleotides. Examples of such polymerases, e.g., mutant bacteriophage T4 DNA polymerases, have been described in U.S. Patent No. 5,945,312.
Depending on the template, either RNA polymerase, DNA polymerases or reverse transcriptase can be used in the primer extension. For analysis of DNA templates, many DNA polymerases are available. Examples of suitable DNA polymerases include, but are not limited to, Sequenase 2.0.RTM., T4 DNA polymerase or the Klenow fragment of
DNA polymerase 1, or Vent polymerase. In some methods, polymerases which lack 3' — > 5' exonuclease activity can be used (e.g., T7 DNA polymerase (Amersham) or Klenow -exo fragment of DNA polymerase I (New England Biolabs)). In some methods, when it is desired that the polymerase have proof-reading activity, polymerases lacking 3' - 5' exonuclease activity are not used. In some methods, thermostable polymerases such as TherrnoSequenase™ (Amersham) or Taquenase™ (ScienTech, St Louis, MO) are used.
In general, the polymerase should have a fidelity (incorporation accuracy) of at least 99% and a processivity (number of nucleotides incorporated before the enzyme dissociates from the DNA) of at least 20 nucleotides, with greater processivity preferred. Examples include T7 DNA polymerase, T5 DNA polymerase, HIV reverse transcriptase, E. coli DNA pol I, T4 DNA polymerase, T7 RNA polymerase, Taq DNA polymerase and E. coli RNA polymerase, Phi29 DNA polymerase.
The nucleotides used in the methods should be compatible with the selected polymerase. Procedures for selecting suitable nucleotide and polymerase combinations can be adapted from Ruth et al. (1981) Molecular Pharmacology 20:415-422; Kutateladze, T., et al. (1984) Nuc. Acids Res., 12:1671-1686; Chidgeavadze, Z., et al. (1985) FEBS Letters, 183:275-278. The polymerase can be stored in a separate reservoir and flowed onto the substrates (or into a flow chamber/cell which houses the substrate) prior to each extension reaction cycle. The enzyme can also be stored together with the other reaction agents (e.g., the nucleotide triphosphates). Alternatively, the polymerase can be immobilized onto the surface of the substrate while the polynucleotide template is added to the solution.
2. Blocking agents
In some methods, it may be desirable to employ a chain elongation inhibitor in the primer extension reaction (see, e.g., Dower et al., U.S. Patent No. 5,902,723). Chain elongation inhibitors are nucleotide analogues which either are chain terminators which prevent further addition by the polymerase of nucleotides to the 3' end of the chain by becoming incorporated into the chain themselves. In some methods, the chain elongation inhibitors are dideoxynucleotides. Where the chain elongation inhibitors are incorporated into the growing polynucleotide chain, they should be removed after incorporation of the labeled nucleotide has been detected, in order to allow the sequencing reaction to proceed using different labeled nucleotides. Some 3' to 5' exonucleases, e.g., exonuclease III, are able to remove dideoxynucleotides.
Other than chain elongation inhibitors, a blocking agent or blocking group can be employed on the 3' moiety of the deoxyribose group of the labeled nucleotide to prevent nonspecific incorporation. Optimally, the blocking agent should be removable under mild conditions (e.g., photosensitive, weak acid labile, or weak base labile groups), thereby allowing for further elongation of the primer strand with a next synthetic cycle. If the blocking agent also contains the fluorescent label, the dual blocking and labeling functions are achieved without the need for separate reactions for the separate moieties. For example, the labeled nucleotide can be labeled by attachment of a fluorescent dye group to the 3' moiety of the deoxyribose group, and the label is removed by cleaving the fluorescent dye from the nucleotide to generate a 3' hydroxyl group. The fluorescent dye is preferably linked to the deoxyribose by a linker arm which is easily cleaved by chemical or enzymatic means. Examples of blocking agents include, among others, light sensitive groups such as 6-nitoveratryloxycarbonyl (NVOC), 2-nitobenzyloxycarbonyl (NBOC), .α,.α- dimethyl-dimethoxybenzyloxycarbonyl (DDZ), 5-bromo-7-nitroindolinyl, o-hydroxy-2- methyl cinnamoyl, 2-oxymethylene anthraquinone, and t-butyl oxycarbonyl (TBOC). Other blocking reagents are discussed, e.g., in U.S. Ser. No. 07/492,462; Patchornik (1970) J. Amer. Chem. Soc. 92:6333; and Amit et al. (1974) J. Org. Chem. 39:192. Nucleotides possessing various labels and blocking groups can be readily synthesized. Labeling moieties are attached at appropriate sites on the nucleotide using chemistry and conditions as described, e.g., in Gait (1984) Oligonucleotide Synthesis: A Practical Approach, IRL Press, Oxford.
C. Reaction conditions
The reaction mixture for the sequencing comprises an aqueous buffer medium which is optimized for the particular polymerase. In general, the buffer includes a source of monovalent ions, a source of divalent cations and a buffering agent. Any convenient source of monovalent ions, such as KC1, K-acetate, NH4-acetate, K-glutamate, NH4C1, ammonium sulfate, and the like may be employed, where the amount of monovalent ion source present in the buffer will typically be present in an amount sufficient to provide for a conductivity in a range from about 500 to 20,000, usually from about 1000 to 10,000, and more usually from about 3,000 to 6,000 micromhos.
The divalent cation may be magnesium, manganese, zinc and the like, where the cation will typically be magnesium. Any convenient source of magnesium cation may be employed, including MgCl2, Mg-acetate, and the like. The amount of Mg ion present in the buffer may range from 0.5 to 20 mM, but will preferably range from about 1 to 12mM, more preferably from 2 to lOmM and will ideally be about 5mM.
Representative buffering agents or salts that may be present in the buffer include Tris, Tricine, HEPES, MOPS and the like, where the amount of buffering agent will typically range from about 5 to 150 mM, usually from about 10 to 100 mM, and more usually from about 20 to 50 mM, where in certain preferred embodiments the buffering agent will be present in an amount sufficient to provide a pH ranging from about 6.0 to 9.5, where most preferred is pH 7.6 at 25° C. Other agents which may be present in the buffer medium include chelating agents, such as EDTA, EGTA and the like.
D. Removal of labels and blocking group
By repeating the incorporation and label detection steps until incorporation is detected, the nucleotide on the template adjacent the 3' end of the primer can be identified. Once this has been achieved, the label should be removed before repeating the process to discover the identity of the next nucleotide. Removal of the label can be effected by removal of the labeled nucleotide using a 3'-5' exonuclease and subsequent replacement with an unlabeled nucleotide. Alternatively, the labeling group can be removed from the nucleotide. Release of the fluorescence dye can be achieved if a detachable connection between the nucleotide and the fluorescence molecule is used. For example, the use of disulfide bonds enables one to disconnect the dye by applying a reducing agent like dithiothreitol (DTT). In a further alternative, where the label is a fluorescent label, it is possible to neutralize the label by bleaching it with radiation. Photobleaching can be performed according to methods, e.g., as described in Jacobson et al., "International Workshop on the Application of Fluorescence Photobleaching Techniques to Problems in Cell Biology", Federation Proceedings, 42:72-79, 1973; Okabe et al., J Cell Biol 120:1177-86, 1993; Wedekind et al., J Microsc. 176 Pt 1): 23-33, 1994; and Close et al, Radiat Res 53:349-57, 1973. If chain terminators or 3' blocking groups have been used, these should be removed before the next cycle can take place. 3' blocking groups can be removed by chemical or enzymatic cleavage of the blocking group from the nucleotide. For example, chain terminators are removed with a 3'-5' exonuclease, e.g., exonuclease III. Once the label and terminators/blocking groups have been removed, the cycle is repeated to discover the identity of the next nucleotide.
E. Sample housing.
The solid substrate is optionally housed in a flow chamber having an inlet and outlet to allow for renewal of reactants which flow past the immobilized moieties. The flow chamber can be made of plastic or glass and should either be open or transparent in the plane viewed by the microscope or optical reader. Electro-osmotic flow requires a fixed charge on the solid substrate and a voltage gradient (current) passing between two electrodes placed at opposing ends of the solid support. Pressure driven flow can be facilitated by microfluidic device with an external pressure source or by microfluidic peristaltic pump (see, e.g., Unger et al., Science 288: 113-116, 2000). The flow chamber can be divided into multiple channels for separate sequencing. Examples of micro flow chambers are described in Fu et al. (Nat. Biotechnol. (1999) 17:1109) which describe a microfabricated fluorescence-activated cell sorter with 3μm x 4μm channels that utilizes electro-osmotic flow for sorting. Preferably, the flow chamber contains microfabricated synthesis channels as described in WO01/32930. The polynucleotide templates can be immobilized to the surface of the synthesis channels. These synthesis channels can be in fluid communication with a microfluidic device which controls flow of reaction reagents. Preferred microfluidic devices that can be employed to control flow of reaction reagents in the present invention have been described in WO01/32930. The present invention also provide apparatus for carrying out the methods of the invention. Other than the substrate to which the target polynucleotides or primers are attached, the apparatus usually comprise a flow chamber in which the substrate is housed. In addition, the apparatus can optionally contain plumbing devices (e.g., an inlet and an outlet port), a light source, and a detection system described herein. Preferably, a microfabricated apparatus as described in WO01/32930 is adapted to house the substrate of the present invention.
V. Detection of Incorporated Signals A. Detection system in general
Methods for visualizing single molecules of DNA labeled with an intercalating dye include, e.g., fluorescence microscopy as described in Houseal et al., BiophysicalJournal 56: 507, 1989. While usually signals from a plurality of molecules are to be detected with the sequencing methods of the present invention, fluorescence from single fluorescent dye molecules can also be detected. For example, a number of methods are available for this purpose (see, e.g., Nie et al., Science 266: 1013, 1994; Funatsu et al., Nature 374: 555, 1995; Mertz et al., Optics Letters 20: 2532, 1995; and Unger et al., Biotechniques 27:1008, 1999). Even the fluorescent spectrum and lifetime of a single molecule excited-state can be measured (Macklin et al., Science 272: 255, 1996). Standard detectors such as a photomultiplier tube or avalanche photodiode can be used. Full field imaging with a two stage image intensified CCD camera can also used (Funatsu et al., supra). Low noise cooled CCD can also be used to detect single fluorescence molecules (see, e.g., Unger et al., Biotechniques 27: 1008-1013, 1999; and SenSys spec: http ://www .photomet.com/pdfs/datasheets/sensys/ss 1401 e.pdf). The detection system for the signal or label can also depend upon the label used, which can be defined by the chemistry available. For optical signals, a combination of an optical fiber or charged couple device (CCD) can be used in the detection step. In those circumstances where the matrix is itself transparent to the radiation used, it is possible to have an incident light beam pass through the substrate with the detector located opposite the substrate from the polynucleotides. For electromagnetic labels, various forms of spectroscopy systems can be used. Various physical orientations for the detection system are available and discussion of important design parameters is provided in the art (e.g., Arndt- Jovin et al, J Cell Biol 101: 1422-33, 1985; and Marriott et al., Biophys J 60: 1374-87, 1991). Many applications of the invention require the detection of incorporation of fluorescently labeled nucleotides into single template molecules in a solution. The single- molecule fluorescence detection of the present invention can be practiced using optical setups including near-field scanning microscopy, far-field confocal microscopy, wide-field epi- illumination, and total internal reflection fluorescence (TIRF) microscopy. General reviews are available describing this technology, including, e.g., Basche et. al., eds., 1996, Single molecule optical detection, imaging, and spectroscopy, Weinheim: VCM; and Plakhotnik, et. al., Single-molecule spectroscopy, Ann. Rev. Phys, Chem. 48: 181-212. In general, the methods involve detection of laser activated fluorescence using microscope equipped with a camera. It is sometimes referred to as a high-efficiency photon detection system (see, e.g., Nie, et. al., 1994, Probing individual molecules with confocal fluorescence microscopy, Science 266:1018-1019. Other suitable detection systems are discussed in the Examples below.
Suitable photon detection systems include, but are not limited to, photodiodes and intensified CCD cameras. In a preferred embodiment, an intensified charge couple device (ICCD) camera is used. The use of a ICCD camera to image individual fluorescent dye molecules in a fluid near the surface of the glass slide is advantageous for several reasons. With an ICCD optical setup, it is possible to acquire a sequence of images (movies) of fluorophores. In certain aspects, each of the dNTPs or NTPs employed in the methods has a unique fluorophore associated with it, as such, a four-color instrument can be used having four cameras and four excitation lasers. Preferably the image could be split to four quarters and imaged by a single camera. For example, the micro-imager of Optical Insights LTD is a simple device that splits the image to four different images in four different spectra just in front of the port of the camera. Illumination with only one laser excitation for the four colors is possible if suitable dyes are used (see, e.g., Rosenblum et al, Nucleic Acids Research
25:4500, 1997). For example, the BigDyes have single excitation wavelength spectrum and four different emission wavelength spectrums. They can be obtained from Applied Biosystems (see, http://www.appliedbiosystems.com/products/productdetail.cfin?ID=82). Nanocrystals are also found to have a variety of emission wavelengths for a given excitation (see, e.g., U.S. Patent No. 6,309,701 ; and Lacoste et al, Proc. Natl. Acad. Sci. USA 97:
9461-6, 2000). Thus, it is possible to use such optical setup to sequence DNA. In addition, many different DNA molecules spread on a solid support (e.g., a microscope slide) can be imaged and sequenced simultaneously. B. Total internal reflection fluorescence (TIRF) microscopy
In some preferred embodiments, the present invention uses total internal reflection fluorescence (TIRF) microscopy for two-dimensional imaging fluorescence detection. TIRF microscopy is well known in the art. See, e.g., Watkins et al., J Biomed Mater Res 11:915-38, 1977; and Axelrod et al., J Microsc, 129:19-28, 1983. TIRF microscopy uses totally internally reflected excitation light. When a laser beam was totally reflected at the interface between a liquid and a solid substrate (e.g., a glass), the excitation light beam penetrates only a short distance into the liquid. In other words, the optical field does not end abruptly at the reflective interface, but its intensity falls off exponentially with distance. This surface electromagnetic field, called the 'evanescent wave', can selectively excite fluorescent molecules in the liquid near the interface. The thin evanescent optical field at the interface provides low background and enables the detection of single molecules with high signal-to-noise ratio at visible wavelengths (see, M. Tokunaga et al, Biochem. and Biophys. Res. Comm. 235, 47 (1997) and P. Ambrose, Cytometry, 36, 244 (1999)). TIRF microscopy has been used to examine various molecular or cellular activities, e.g., cell/substrate contact regions of primary cultured rat myotubes with acetylcholine receptors labeled by fluorescent alpha-bungarotoxin, and human skin fibroblasts labeled with a membrane-incorporated fluorescent lipid (see, e.g., Thompson et al., Biophys J. 33:435-54, 1981; Axelrod, J. Cell. Biol. 89: 141-5, 1981; and Burghardt et al., Biochemistry 22:979-85, 1983). TIRF examination of cell/surface contacts dramatically reduces background from surface autofluorescence and debris. TIRF has also been combined with fluorescence photobleaching recovery and correlation spectroscopy to measure the chemical kinetic binding rates and surface diffusion constant of fluorescent labeled serum protein binding (at equilibrium) to a surface (see, e.g., Burghardt et al., Biophys J. 33:455-67, 1981); and Thompson et al., Biophys J, 43:103-14, 1983). Additional examples of TIRR detection of single molecules have been described in Vale et. al., 1996, Direct observation of single kinesin molecules moving along microtubules, Nature 380: 451; and Xu et al., 1997, Direct Measurement of Single-Molecule Diffusion and Photodecomposition in Free Solution, Science 275: 1106-1109. The penetration of the field beyond the glass depends on the wavelength and the laser beam angle of incidence. Deeper penetrance is obtained for longer wavelengths and for smaller angles to the surface normal within the limit of a critical angle. In typical assays, fluorophores are detected within about 200 nm from the surface which corresponds to the contour length of about 600 base pairs of DNA. In some embodiments, when longer polynucleotide templates are analyzed, the polymerase rather than the template is immobilized to the surface so the reaction occurs near the surface at all time. In some embodiments, a prism-type TIRF geometry for single-molecule imaging as described by Xu and Yeung is used (see, X-H.N. Xu et al., Science, 281, 1650 (1998)). In some embodiments, an objective type TIRF is used to provide space above the objective so that a microfluidic device can be used (see, e.g., Tokunaga et al., Biochem Biophy Res Commu 235: 47-53, 1997; Ambrose et al., Cytometry 36:224;1999; and Braslavsky et al, Applied Optics 40:5650, 2001).
Total internal reflection can be utilized with high numerical aperture objectives (ranging between 1.4 and 1.65 in aperture), preferentially using an inverted microscope. The numerical aperture of an objective is a function of the max angle that can be collected (or illuminated) with the objective in a given refractive index of the media (i.e., NA=n*sin(tetaMax)). If tetaMax is larger than teta Critic for reflection, some of the illuminated rays will be totally internal reflected. So using the peripheral of a large NA objective one can illuminate the sample with TIR through the objective and use the same objective to collect the fluorescence light. Therefore, the objective plays double roles as a condenser and an imaging objective.
Single molecule detection can be achieved using flow cytometry where flowing samples are passed through a focused laser with a spatial filter used to define a small volume. US Pat. No. 4,979,824 describes a device for this purpose. US Pat. No. 4,793,705 describes a detection system for identifying individual molecules in a flow train of the particles in a flow cell. It further describes methods of arranging a plurality of lasers, filters and detectors for detecting different fluorescent nucleic acid base-specific labels. US Pat. No. 4,962,037 also describes a method for detecting an ordered train of labeled nucleotides for obtaining DNA and RNA sequences using an exonuclease to cleave the bases. Single molecule detection on solid supports is also described in Ishikawa, et al. (1994) Single- molecule detection by laser-induced fluorescence technique with a position-sensitive photon- counting apparatus, Jan. J. Apple. Phys. 33:1571-1576. Ishikawa describes a typical apparatus involving a photon-counting camera system attached to a fluorescence microscope. Lee et al. (Anal. Chem., 66:4142-4149, 1994) describes an apparatus for detecting single molecules in a quartz capillary tube. The selection of lasers is dependent on the label and the quality of light required. Diode, helium neon, argon ion, argon-krypton mixed ion, and double Nd: YAG lasers are useful in this invention. C. Excitation and scanning
In some applications, fluorescent excitation is exerted with a Q-switched frequency doubled Nd YAG laser, which has a KHz repetition rate, allowing many samples to be taken per second. For example, a wavelength of 532 nm is ideal for the excitation of rhodamine. It is a standard device that has been used in the single molecule detection scheme (Smith et al, Science 253:1122, 1992). A pulsed laser allows time resolved experiments, which are useful for rejecting extraneous noise. In some methods, excitation can be performed with a mercury lamp and signals from the incorporated nucleotides can be detected with an CCD camera (see, e.g., Unger et al, Biotechniques 27:1008, 1999). Incorporated signals can be detected by scanning the substrates. The substrates can be scanned simultaneously or serially, depending on the scanning method used. The signals can be scanned using a CCD camera (TE/CCD512SF, Princeton Instruments, Trenton, NJ.) with suitable optics (Ploem, J. S., in Fluorescent and Luminescent Probes for Biological Activity, Mason, T. W., Ed., Academic Press, London, pp. 1-11, 1993), such as described in Yershov et al. (Proc. Natl. Acad. Sci. 93:4913, 1996), or can be imaged by TV monitoring (Khrapko et al., DNA Sequencing 1:375, 1991). The scanning system should be able to reproducibly scan the substrates. Where appropriate, e.g., for a two dimensional substrate where the substrates are localized to positions thereon, the scanning system should positionally define the substrates attached thereon to a reproducible coordinate system. It is important that the positional identification of substrates be repeatable in successive scan steps.
Various scanning systems can be employed in the methods and apparatus of the present invention. For example, electro-optical scanning devices described in, e.g., U.S. Pat. No. 5,143,854, are suitable for use with the present invention. The system could exhibit many of the features of photographic scanners, digitizers or even compact disk reading devices. For example, a model no. PM500-A1 x-y translation table manufactured by Newport Corporation can be attached to a detector unit. The x-y translation table is connected to and controlled by an appropriately programmed digital computer such as an IBM PC/AT or AT compatible computer. The detection system can be a model no. R943-02 photomultiplier tube manufactured by Hamamatsu, attached to a preamplifier, e.g., a model no. SR440 manufactured by Stanford Research Systems, and to a photon counter, e.g., an SR430 manufactured by Stanford Research System, or a multichannel detection device. Although a digital signal can usually be preferred, there can be circumstances where analog signals would be advantageous. The stability and reproducibility of the positional localization in scanning determine, to a large extent, the resolution for separating closely positioned polynucleotide clusters on a two dimensional substrate. Since the successive monitoring at a given position depends upon the ability to map the results of a reaction cycle to its effect on a positionally mapped polynucleotides, high resolution scanning is preferred. As the resolution increases, the upper limit to the number of possible polynucleotides which can be sequenced on a single matrix also increases. Crude scanning systems can resolve only on the order of 1000 μm, refined scanning systems can resolve on the order of 100 μm, more refined systems can resolve on the order of about 10 μm, and with optical magnification systems a resolution on the order of 1.0 μm is available. The limitations on the resolution can be diffraction limited and advantages can arise from using shorter wavelength radiation for fluorescent scanning steps. However, with increased resolution, the time required to fully scan a matrix can increased and a compromise between speed and resolution can be selected. Parallel detection devices which provide high resolution with shorter scan times are applicable where multiple detectors are moved in parallel.
In some applications, resolution often is not so important and sensitivity is emphasized. However, the reliability of a signal can be pre-selected by counting photons and continuing to count for a longer period at positions where intensity of signal is lower. Although this decreases scan speed, it can increase reliability of the signal determination. Various signal detection and processing algorithms can be incorporated into the detection system. In some methods, the distribution of signal intensities of pixels across the region of signal are evaluated to determine whether the distribution of intensities corresponds to a time positive signal.
D. Detection of incorporation of multiple fluorescent labels: FRET
In some aspects of the present application, incorporation of different types of nucleotides into a primer is detected using different fluorescent labels on the different types of nucleotides. When two different labels are incorporated into the primer in close vicinity, signals due to fluorescence resonance energy transfer (FRET) can be detected. FRET is a phenomenon that has been well documented in the literature, e.g., in T. Foster, Modern
Quantum Chemistry, Istanbul Lectures, Part III, 93-137, 1965, Academic Press, New York; and Selvin, "Fluorescence Resonance Energy Transfer," Methods in Enzymology 246: 300- 335, 1995. In FRET, one of the fluorophores (donor) has an emission spectrum that overlaps the excitation spectrum of the other fluorophore (acceptor) and transfer of energy takes place from the donor to the acceptor through fluorescence resonance energy transfer. The energy transfer is mediated by dipole-dipole interaction. Spectroscopically, when the donor is excited, its specific emission intensity decreases while the acceptor's specific emission intensity increases, resulting in fluorescence enhancement. Detection of single molecule FRET signal reveals sequence information and facilitates interpretation of the sequencing data. Detection of FRET signal in the present invention can be performed accordingly to various methods described in the art (e.g., US Patent No. 5,776,782). FRET has been used to studying various biological activities of biomacromolecules including polynucleotides. For example, Cooper et al. disclosed fluorescence energy transfer in duplex and branched DNA molecules (Biochemistry 29: 9261-9268, 1990). Lazowski et al. reported highly sensitive detection of hybridization of ohgonucleotides to specific sequences of nucleic acids by FRET (Antisense Nucleic Acid Drug Dev. 10: 97-103, 2000). Methods for nucleic acid analysis using FRET were also described in US Patent Nos. 6,177,249 and 5,945,283. Efficacy of using FRET to detect multiple nucleotides incorporation into single polynucleotide molecules is also exemplified in Example 8 of the present application.
Any of a number of fluorophore combinations can be selected for labeling the nucleotides in the present invention for detection of FRET signals (see for example, Pesce et al,. eds, Fluorescence Spectroscopy, Marcel Dekker, New York, 1971; White et al., Fluorescence Analysis: A practical Approach, Marcel Dekker, New York, 1970; Handbook of Fluorescent Probes and Research Chemicals, 6th Ed, Molecular Probes, Inc., Eugene, Oreg., 1996; which are incorporated by reference). In general, a preferred donor fluorophore is selected that has a substantial spectrum of the acceptor fluorophore. Furthermore, it may also be desirable in certain applications that the donor have an excitation maximum near a laser frequency such as Helium-Cadmium 442 nm or Argon 488 nm. In such applications the use of intense laser light can serve as an effective means to excite the donor fluorophore. The acceptor fluorophore has a substantial overlap of its excitation spectrum with the emission spectrum of the donor fluorophore. In addition, the wavelength of the maximum of the emission spectrum of the acceptor moiety is preferably at least 10 nm greater than the wavelength of the maximum of the excitation spectrum of the donor moiety. The emission spectrum of the acceptor fluorophore is shifted compared to the donor spectrum.
Suitable donors and acceptors operating on the principle of fluorescence energy transfer (FET) include, but are not limited to, 4-acetamido-4'-isothiocyanatostilbene- 2,2'disulfonic acid; acridine and derivatives: acridine, acridine isothiocyanate; 5-(2'- aminoethyl)aminonaphthalene-l-sulfonic acid (EDANS); 4-amino-N-[3- vinylsulfonyl)phenyl]naphthalimide-3,5 disulfonate; N-(4-anilino-l-naphthyl)maleimide; anthranilamide; BODIPY; Brilliant Yellow; coumarin and derivatives: coumarin, 7-amino-4- methylcoumarin (AMC, Coumarin 120),7-amino-4-trifluoromethylcouluarin (Coumaran 151); cyanine dyes; cyanosine; 4',6-diaminidino-2-phenylindole (DAPI); 5', 5"- dibromopyrogallol-sulfonaphthalein (Bromopyrogallol Red); 7-diethylamino-3-(4'- isothiocyanatophenyl)-4-methylcoumarin; diethylenetriamine pentaacetate; 4,4'- diisothiocyanatodihydro-stilbene-2,2'-disulfonic acid; 4,4'-diisothiocyanatostilbene-2,2'- disulfonic acid; 5-[dimethylamino]naphthalene-l-sulfonyl chloride (DNS, dansylchloride); 4- dimethylaminophenylazophenyl-4'-isothiocyanate (DABITC); eosin and derivatives: eosin, eosin isothiocyanate, erythrosin and derivatives: erythrosin B, erythrosin, isothiocyanate; ethidium; fluorescein and derivatives: 5-carboxyfluorescein (FAM),5-(4,6-dichlorotriazin-2- yl)aminofluorescein (DTAF), 2',7'-dimethoxy-4'5'-dichloro-6-carboxyfluorescein (JOE), fluorescein, fluorescein isothiocyanate, QFITC, (XRITC); fluorescamine; IR144; IR1446; Malachite Green isothiocyanate; 4-methylumbelliferoneortho cresolphthalein; nitrotyrosine; pararosaniline; Phenol Red; B-phycoerythrin; o-phthaldialdehyde; pyrene and derivatives: pyrene, pyrene butyrate, succinimidyl 1 -pyrene; butyrate quantum dots; Reactive Red 4 (Cibacron™ Brilliant Red 3B-A) rhodamine and derivatives: 6-carboxy-X-rhodamine (ROX), 6-carboxyrhodamine (R6G), lissamine rhodamine B sulfonyl chloride rhodamine (Rhod), rhodamine B, rhodamine 123, rhodamine X isothiocyanate, sulforhodamine B, sulforhodamine 101, sulfonyl chloride derivative of sulforhodamine 101 (Texas Red);
N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA); tetramethyl rhodamine; tetramethyl rhodamine isothiocyanate (TRITC); riboflavin; rosolic acid; terbium chelate derivatives; Cy
3; Cy 5; Cy 5.5; Cy 7; IRD 700; IRD 800; La Jolla Blue; phthalo cyanine; and naphthalo cyanine.
***
Many modifications and variations of this invention can be made without departing from its spirit and scope. The specific embodiments described below are for illustration only and are not intended to limit the invention in any way. EXAMPLES
Example 1 Basic Materials and Methods 1. Materials and Reaction Reagents
(1) Solutions and buffers
RCA: H2O:NH4OH:H2O2 (6:4: 1) boiling for an hour.
PEI: PolyEthylenlmine (Sigma P-3143) (positive charged)
PALL: Poly(allylamine hydrochloride) (Sigma 283223) PACr: Poly(acrylic acid, sodium salt) (Sigma 416045) (negative charged)
EDC: 9.6mg/ml; 50mM (xlO) l-{3-(Dimethylamino)propyl]-3-ethylcarbodiimide, hydrochloride), Activator for the BLCPA (Sigma- 161462)
BLCPA: EZ-Link Biotin LC-PEO-Amine (Pierce 21347)
Stock solution 50mM in MES lOniM (21mg/ml) (xlO) Streptavidin plus - lmg/ml in Tris. PROzyme, Code: SA20 (xlO)
Buffers:
MES (N-morpholinoethanesulfonic acid) PH 5.5 IM (lOOx) TRIS lOmM TRIS-MgCl2 lOmM Tris, lOOmM MgCl2 (xl)
TKMC (lOmM Tris* HCl, lOmM KC1, lOmM MgCl2, 5mM Ca Cl2, pH 7.0) EcoPol : lOmM Tris» HCl, 5mM MgCl2 , 7.5 mM DTT pH @ 25°C; buffer come with the polymerase at (xlO) (2) Other materials and reagents
Nucleotides: dTTP, dGTP, dATP, and dCTP-Cy3 at lOμM concentration Polymerase: a) Klenow Polymerase I (5 units/μl), New England BioLabs Cat. 21 OS b) Klenow -exo, New England BioLabs Cat. 212S c) TAQ d) Sequenase Hybridization Chamber: Sigma H-1409 Polynucleotide templates and primers:
7G: Biotin - 5' -tcagtcatca gtcatcagtc atcagtcatc agtcatcagt catcagtcat cagtcatcag tcatcagtca tcagtcatca gtcatcACAC GGAGGTTCTA - 3 ' (SEQ ID NO: 1)
Primer p7G: 5'- TAGAACCTCCGTGT - 3' (SEQ ID NO:2); the primer can be labeled with Cy5 or Cy3.
Mu50: Biotin 5'- ctccagcgtgttttatctctgcgagcataatgcctgcgtcatccgccagc 3' (SEQ ID NO:3) Cy5 labeled primer (PMu50Cy5): Cy5 5' - gctggcggatgac - 3' (SEQ ID NO:4)
7G7A - Biotin-5'- tttGcttcttAttctttGcttcttAttctttGcttcttAttctttGcttcttAttctttGcttcttAttctttGcttcttAttcttACACGGA GGTTCTA - 3' (SEQ ID NO:5) 6TA6CG: Biotin- 5' - ccAttttttGccccccAttttttGccccccAttttttGccccccAttttttGccccccAttttttA-CACGGAGGTTCTA - 3', (SEQ ID NO:6)
2. Substrate treatment and template attachment
A fused silica microscope slide (1 mm thick, 25x75 mm size, Esco Cat. R130110) was used to attach DNA templates. The slides was first cleaned with the RCA method as described above and in WO 01/32930. Multilayer of polyallylamine /polyAcrylic were absorbed to the slide. An EZ link connector was then attached to the slides as follows: the slide was dried, scratched with diamond pencil, and then covered with a hybridization chamber. 120 μl of a mixture of 1:1:8 EDC: BLCPA: MES (50mM EDC, 50mM BLCPA, lOmM MES) was applied to each slide. Following incubation for 20 minutes, 120 μl of Streptavidin Plus diluted to O.lmg/ml was added to the slide. After 20 min of incubation, the slide was washed with 200μl of Tris lOmM. Preparation of lOpM Oligo: the 7G oligonucleotide template (SEQ ID NO:l) was pre-hybridized with Cy5-labeled primer (SEQ ID NO:2) (in stock at 7μM) in TRIS- MgCl2 buffer. The treated slide was examined for contamination with the TIR microscope. 200μl of the oligonucleo tide/primer mixture was applied to each slide. Following incubation for 10 min, the slide was washed with 200μl ml of Tris lOmM. Addition of nucleotides and polymerase: nucleotides dTTP, dATP, dGTP, and
Cy3-dCTP each of 20-lOOnM were mixed in the ECOPOL buffer. 1 μl Klenow 210S from stock solution (kept in -20°C) was added to 200 microliters of the nucleotide mixture. 120μl of the mixture was then added on each slide. After incubation for 0 to 30 min (for different experiments), the slide was examined with the TIR microscope. Unless otherwise noted, all reactions were performed at room temperature, while the reaction reagents were kept at 4°C or -20°C. The primer/oligonucleotide hybridization reaction was carried out with a thermocycler machine.
Single molecule resolution was achieve by using very low concentration of the polynucleotide template which ensured that only one template molecule is attached to a distinct spot on the slide. Single molecule attachment to a distinct is also confirmed by the observation of single bleaching pattern of the attached fluorophores. In the reaction described above, a concentration of about lOpM of a 80-mer oligonucleotide template was used for immobilizing to the slide. The space between different DNA molecules attached to the surface slide was measured at a few micrometers.
3. Imagine with single molecule resolution As illustrate in Figure 1, the single stranded oligonucleotide template (SEQ ID
NO:l) primed with a Cy5 labeled primer sequence (SEQ ID NO:2) was immobilized at a single molecule resolution to the surface of a silica slide using a biotin-streptavidin bond. The surface is coated with polymers on which biotin (EZ link) is tethered. The oligonucleotide template, with a biotin molecule attached to one of its ends, was able to attach to the streptavidin-linked surface. The slide surface was negatively charged which helps to repeal unbound nucleotides The DNA is specifically attached to the surface by its 5' side, meaning that the primer -which the polymerase extends- is away from the surface. The template and incorporation of labeled nucleotides were visualized by fluorescence imaging. Location of the oligonucleotide was monitored by fluorescence from the Cy5 labeled primer (SEQ ID NO:2). Incorporation of nucleotides was detected because the nucleotides were labeled with Cy3. After incorporation, the incorporated labels were illuminated. Illumination of Cy3 was at a wavelength of 532nm. Following a typical time of a few seconds of continued illumination, the signals were bleached, typically in a single step. As shown in Figure 2, imaging of fluorescent signals with single molecule resolution was enabled with surface illumination by total internal reflection (TIR). Ishijima et al. (Cell 92:161-71, 1998) showed that it is possible to observe the fluorescence of single molecules immobilized to a surface in a wet environment even when there are free molecules in the solution. Here, the TIR was facilitated by a dove prism coupling of the laser beam to the silica slide surface. An upright microscope with an immersion oil objective was used to image the surface with an intensified CCD (PentaMax). A filter set (Chroma) was used to reject the illumination frequency and let the fluorescence frequency to reach the ICCD.
Example 2 Test for Specific Attachment of Template Molecules to Substrate Surface This experiment was performed to determine whether the polynucleotide templates are attached to the surface as desired. Figure 3 shows that streptavidin is required for binding the template to the surface and hence detection of incorporated fluorescence signal. The left panel shows that there is no fluorescence signal when only streptavidin- attached surface but no fluorescent labels were present. The middle panel shows that there is no incorporated fluorescent signals when no streptavidin was present on the surface to attach biotin-labeled oligonucleotide template, even though Cy5-labeled primer was present. The right panel shows that detection of incorporated fluorescent signal when the streptavidin- attached surface, labeled primers, and biotin-labeled oligonucleotide template were present.
Example 3. Determining Processivity of DNA Polymerase in the Presence of Labeled Nucleotides
To determine whether the DNA polymerase accurately incorporates labeled nucleotides into the template, a bulk extension experiment was performed in a test tube rather than on the surface of a substrate. As shown in Figure 5, the results indicate that the polymerase incorporate all the labeled nucleotides into the correct positions. In this experiment, incorporation of dCTP-Cy3 and a polymerization terminator, ddCTP, were detected using a 7G DNA template (a DNA strand having a G residue every 7 bases; SEQ ID NO:l). The annealed primer was extended in the presence of non-labeled dATP, dGTP, dTTP, Cy3-labeled dCTP, and ddCTP. The ratio of Cy3-dCTP and ddCTP was 3:1. The reaction products were separated on a gel, fluorescence excited, and the signals detected, using an automatic sequencer ABI-377. The results reveal that incorporation of Cy3-dCTP did not interfere with further extension of the primer along the 7G oligomer template.
Figure 5 shows fluorescence intensity from primer extension products of various lengths which were terminated by incorporation of ddCTP at the different G residues in the 7G oligomer template (SEQ ID NO:l). The first band is the end of the gel and should not be counted as it is in the very beginning of the gel. The full length of the template is 100 residues. The first band (marked "1" in the graph) corresponds to extension products which were terminated by incorporation of non-labeled ddCTP at the second G residue (position 27) and has incorporated Cy3-dCTP at the first G residue (position 20). Similarly, the tenth band (marked "10" in the graph) represents extension products which were terminated by incorporation of non-labeled ddCTP at the 10th G residue (position 90) and has incorporated Cy3-dCTP at the previous G residue (i.e., positions 20, 27, 34, 41, 48, 55, 62, 69, 76, and 83). The results showed a nice agreement between the expected positions for Cy3 incorporation in the polynucleotide template and the positions of the fluorescence intensity bands.
Example 4. Detection of single nucleotide incorporation by TIR
Total internal reflection (TIR) fluorescence microscopy allows detection of real-time incorporation of labeled nucleotide into single immobilized polynucleotide template. This illumination method reduce the background from the sample by illuminating only a thin layer (e.g., in the order of 150nm) near the surface. Even in the presence of free dyes in the solution (up to 50nM), single molecules can be observed. Using TIR, we visualized single molecules of labeled nucleotide bound to DNA in the presence of up to 50nM free dye in solution. Though this concentration is low compared to the concentration needed for a high rate of incorporation of nucleotides by the DNA polymerase, it was sufficient for its operation.
1. Optical setup
The lasers source is shown in Figure 2, the light sources (e.g., laser) are coupled to the surface by prism. The surface is imaged by a regular 1.3NA microscope objective onto an Intensified CCD (Pentamax). A fluorescent filter in the optical way block the laser intensity and allow the fluorescent signals from the dye molecules pass through(Chroma filters). Optionally, the camera and the shutters for the lasers are controlled by the computer.
2. Illumination
As shown in Figure 6, TIR illumination of polynucleotide-attached slide produced a low background and allowed detection of signals only from immobilized labels. The refraction index of the fused silica glass and the oil beneath the surface is about 1.46. The refraction index of the liquid above the glass is about 1.33 to 1.35. At the interface of the glass and the water the illumination ray was refracted. If the illumination is very shallow, 70- 75 degree from the surface orthogonal, the refracted light was reflected back and not continued in the liquid phase as the critical angel for total internal reflection is about 65-67 degrees (TetaCitical^ sin"1(nl/n2)). The illumination process, called evanescent illumination, leaves a decay field near the interface which illuminates only about 150 nm into the liquid phase. Fluorophores dyes can be excited by this field. So only the dyes which are near the surface will emit. Furthermore, free labeled nucleotide molecules in the solution will move around due to Brownian motion. The fast movement of these free molecules produces only a smear signal because the integration time is in the order of hundred millisecond. Thus, the total internal reflection illumination leads to a low back ground from the free molecules, and only signals from the immobilized dyes are detected.
3. Detection of single molecules Figures 6 shows detection of signals from single Cy3 molecule with no free dye in solution versus signals from single Cy3 molecule with background of 15nM Cy3 in solution. Fluorescence image from incorporation of Cy3 labeled nucleotide is shown in the upper panels. The signals tend to bleach in a single step, see the upper graph. When there are free labeled nucleotides in the solution (15nM free dye), the background signal is stronger (lower right panel) than the background signal in the absence of free labeled nucleotides in the solution. But the signal from the incorporated single molecule can still be detected. The ability to detect single molecule in the presence of free dye enables one to follow incorporation of nucleotide into an immobilized DNA template in real time. The upper left panel of Figure 6 showed typical images of single molecules
(see the bright spots). When the intensity of a spot is traced in real time (upper right panel), one can see that it appears (incorporation event or sticking to the surface event) and disappears (bleaching or detaching event). The same results are also illustrated in the middle long thin panel of Figure 6. This panel shows successive images of a small area around the spot that was being traced. The fluorescent signal appeared and disappeared after every few seconds (every frame is a second exposure).
Example 5. Determining Nucleotide Incorporation Based on Correlation of Fluorescence Spots A correlation was observed between the position of the immobilized DNA template on the surface (indicated by the fluorescently labeled primer) and the incorporation of nucleotide to the surface. In Figure 4, image of the immobilized DNA which was hybridized to the Cy5 labeled primer was shown in the upper two panels (the middle panel is a magnified image of a small area in the left panel). The small dots in the image represent likely positions of the DNA templates immobilized on the surface. The fluorescence signals were then bleached out by a long radiation (about 1 minute) at 635nm with a lOmW laser diode. Subsequently, the polymerase and the nucleotides (including the Cy3-labeled dCTP) were added, and the mixture incubated at room temperature for about an hour. After washing, a second image of the surface was taken. This time a new set of fluorescence- labeled points appeared (see lower left two panels). The results indicate that the two sets of fluorescently-labeled points are correlated (see right panel). It is noted that the significant overlap (about 40%) between DNA primer location (Cy5) and dCTP Incorporation location (Cy3) cannot be a random result. Under the concentrations of labeled DNA primers used in the experiment, the probability for this correlation to occur randomly calculated to be about 10"50. Rather, the correlation is due to incorporation of the Cy3 labeled nucleotides into the immobilized, Cy5 labeled primer.
Incorporation of labeled nucleotide into the immobilized template is also demonstrated by the multi-incorporation data shown in Figure 7. When the intensity of the spots in Figure 4 were measured, a multistep bleaching is observed (Figure 7, upper left panel). Simulation of the multiple bleaching is shown in the upper right panel. The results are what should be expected if few molecules are located in the same place up to the optical resolution. This indicates that the polymerase can incorporate a few labeled nucleotides into the same DNA template. In a control experiment, ddATP, dCTP-Cy3 and dGTP were used to extend Cy5-labeled primer PMu50Cy5, Cy5 5' - gctggcggatgac - 3 ' (SEQ ID NO:4) along the Mu50 oligonucleotide template (SEQ ID NO 3). This allows only one Cy3-labeled nucleotide to be incorporated into the primer because the first codon in the template sequence after the primer is CGT. Incorporation of ddATP immediately after the incorporation of dCTP-Cy3 terminates the elongation. As shown in the lower right panel, there is no multibleaching.
It is noted that because the concentration of the DNA template on the surface was so low, it is unlikely that more than one copy of the DNA template were present on each spot. Further, multiple bleaching is not common when the polymerase was not present (data not shown). In particular, there is no correlation between primer location and fluorescence signal from the surface when the polymerase was not present (see, e.g., Figure 13, middle panel).
Example 6. Dynamics of Nucleotide Incorporation
Figure 8 shows a time course of incorporation events during the DNA polymerase reaction. In this experiment, the DNA template and Cy5-labeled primer complex was immobilized to the substrate surface as described above, and its position was imaged. The DNA Polymerase was then added along with the nucleotides of which one was labeled with Cy3.
As indicated in the figure, the substrate was imaged every 10 sec, with a 1 sec exposure. Every spot with immobilized DNA template (as indicated by the labeled primer) was monitored as a function of time. A series of small images of these spots were placed along a strip resulting in a movie showing the "activities" at each point.
Repeated incorporation of nucleotide into the DNA template was shown in Figure 9. Using more dyes will enable us to read the sequence of the DNA directly in an asynchronous manner. Figure 9 shows the dynamic incorporation events at 8 different spots. The digital information recorded in these movies indicate that repeated incorporation events occurred at various time points. The data also demonstrated the feasibility of monitoring primer extension activities on single DNA molecules. Figure 10 shows a histogram of the number of incorporation events on single spots and a histogram of the time between incorporation events. From the histograms one can see that a few nucleotides were incorporated into single DNA molecules. The low numbers of events in which more then three nucleotides were incorporated indicate that there is some mechanism that prevents high number of incorporation into the DNA under the experimental conditions. The reason could be that photo-damage to the DNA in the surrounding area of the illuminated dye might produce toxic radicals. Changing the reaction conditions and reagents could increase the numbers of incorporated nucleotides dramatically.
Example 7 Base-by-base Sequence Analysis This experiment was performed to confirm selectivity of the polymerase and to illustrate feasibility of determining the sequence of a polynucleotide template with base- by-base scheme.
First, fidelity of the polymerase in incorporation was confirmed by analyzing correlation between location of immobilized primer and location of nucleotide incorporation with a correlation graph. Figure 11 shows correlation between primer location and polymerase activity location. The position of each point was determined with a sub pixel resolution. Images for the primer location and the incorporation position were taken first. If there is a correlation between the two, there is a pick in the correlation graph. Otherwise no pick was observed. As shown in the figure, the two images correlate with each other. Results demonstrating base-by-base analysis of the sequence of a immobilized template at single molecule resolution is shown in Figure 12. The data indicated that at least two bases of the template were determined by flowing in and out reagents along with different types of labeled nucleotides (e.g., dCTP-Cy3, dUTP-Cy3, etc.). Here, a 6TA6GC oligonucleotide template (SEQ ID NO:6) was immobilized to the fused silica slide. A Cy3- labeled p7G primer (SEQ ID NO:2) was annealed to the template. As illustrated in the
Figure, the primer was first extended up to the A residue with non-labeled dATP nucleotides. Then, dUTP-Cy3 nucleotide was incorporated and imaged. Images taken at this time show high correlation (see the upper left correlation graph). After bleaching the dyes, dCTP-Cy3 was applied to the sample. Images taken at this time show low correlation (see the lower left correlation graph). Thereafter, non-labeled dGTP was added to fill the CCCCC gap till the G residue in the sequence. At this time, incorporation of a dCTP-Cy3 nucleotide was examined again. This time there was a correlation between the dCTP-cy3 positions and the primer positions in general, and in particular there was a correlation with the position of the incorporated dUTP in the first incorporation cycle. Thereafter, dUTP-Cy3 was added.
Correlation was found between the labeled primer position and signal from dUPT-Cy3, but no correlation was found between the new dUPT-Cy3 positions and the position that has incorporated dUTP in the first incorporation cycle (lower right graph). The interpretation is that not all the primers were extended in the first dUTP incorporation cycle, that those which did not get extended could incorporate dUTP in the second incorporation cycle, and that those which did incorporate dUTP in the first cycle could not incorporate dUTP again in the second cycle. The results indicate that on those spots which have incorporated the first U residue there were also incorporations of a C but not a U residue. Thus, identity of a second base can be determined with the experimental scheme, although the yield for the second base (upper right graph) was not as good as for the first base (upper left graph).
In a control experiment, after filling in with A residues, dCTP-Cy3 (wrong nucleotide for the first base) was added. Correlation between Cy3-labeled primer position and C-Cy3 was low (data not shown). In another control, after filling in the string of A residues, the U residue, G residues, and U-Cy3 (wrong residue for the second base) was added. The correlation observed from the results in this experiment was low (at the noise level; data not shown). Using different oligonucleotide templates, the experiment scheme was repeated for successive incorporations of other combinations of two or more nucleotides (data not shown). The results confirmed correct incorporation of the first labeled nucleotide with high signal-to-noise ratio and subsequent incorporations of more nucleotides with a relatively lower signal-to-noise ratio. Taken together, these data indicate that the observed results (e.g., as shown in Figure 12) are not due to artifacts, but rather demonstrate efficacy of base-by-base analysis of the experimental scheme.
Example 8. Two Color Incorporation: Fluorescence Resonance Energy Transfer This experiment demonstrate incorporation of two different fluorescent labels into the same immobilized polynucleotide template through detection of fluorescence resonance energy transfer (FRET). In this experiment, two fluorescent labels were used (Cy5 and Cy3), and FRET from dUTP-Cy3 (donor) to dCTP-Cy5 (acceptor) was examined at the single molecule level as shown in Figure 13. Image of the DNA template with the labeled primer is shown in the left panel. Detection of FRET after incorporation of the two labels is provided in the right image. Correlation between the template location and the incorporation signals is shown in the middle graph. As indicated, there is a high correlation between the template location and the incorporated nucleotide location. A control experiment was performed in which no polymerase is present. Results from the control experiment produced a low correlation between the template location and location of labeled nucleotides. FRET experiment provides particularly high signal to noise ratio as there is almost no signal from nonspecific incorporation of dyes to the surface. When the two labels were incorporated into a primer at close vicinity, i.e., at a few nanometers apart, a single molecule FRET signal was detected (Figure 14). To detect the FRET signal, the optic setup was altered. A image splitter was added so that the same area was imaged twice(Optical Insights LTD, micro imager device). In one channel, a fluorescence filter detected only the donor (cy3) fluorescence. In the other channel, a filter for the acceptor (Cy5) was placed. With this setup individual spots were examined after incorporation. Figure 15 further indicates that the FRET detection scheme allows measurement of incorporation rate with a nice signal to noise ratio.

Claims

WHAT IS CLAIMED IS:
1. A method of analyzing sequence of a target polynucleotide, comprising:
(a) providing a primed target polynucleotide immobilized to a surface of a substrate; wherein the target polynucleotide is attached to the surface with single molecule resolution;
(b) adding a first fluorescently labeled nucleotide to the surface of the substrate under conditions whereby the first nucleotide attaches to the primer, if a complementary nucleotide is present to serve as template in the target polynucleotide;
(c) determining presence or absence of a fluorescence signal on the surface where the target polynucleotide is immobilized, the presence of a signal indicating that the first nucleotide was incorporated into the primer, and hence the identity of the complementary base that served as a template in the target polynucleotide; and
(d) repeating steps (b)-(c) with a further fluorescently labeled nucleotide, the same or different from the first nucleotide, whereby the further nucleotide attaches to the primer or a nucleotide previously incorporated into the primer.
2. The method of claim 1, wherein step (a) comprises providing a plurality of different primed target polynucleotides immobilized to different portions of the substrate.
3. The method of claim 1, wherein steps (b)-(c) are performed at least four times with four different types of labeled nucleotides.
4. The method of claim 1, wherein steps (b)-(c) are performed until the identity of each base in the target polynucleotide has been identified.
5. The method of claim 1, further comprising an additional step of removing the signal after step (c).
6. The method of claim 1 , wherein the presence or absence of a fluorescence signal is determined with total internal reflection fluorescence (TIRF) microscopy.
7. The method of claim 1 , wherein the target polynucleotide is primed with a fluorescently labeled primer.
8. The method of claim 1 , wherein the first and further nucleotide are labeled with the same fluorescent label.
9. The method of claim 1 , wherein said the substrate is a fused silica slide.
10. The method of claim 9, wherein said surface is coated with a polyelectrolyte multilayer (PEM).
11. The method of claim 10, wherein said PEM is terminated with a polyanion.
12. The method of claim 11, wherein said polyanion bears pendant carboxylic acid groups.
13. The method of claim 12, wherein said target polynucleotide is biotinylated, and said surface is coated with streptavidin.
14. The method of claim 13, wherein said surface is coated with biotin prior to coating with streptavidin.
15 . The method of claim 14, wherein said surface is coated with a polyelectrolyte multilayer (PEM) terminated with carboxylic acid groups prior to attachment of biotin.
16. The method of claim 1, wherein said removing or reducing is by photobleaching.
17. The method of claim 1, wherein the substrate is in fluid communication with a microfluidic device, wherein the first and further labeled nucleotides are added to or removed from the substrate through the microfluidic device.
18. The method of claim 17, wherein the microfluidic device comprises (a) a flow cell comprising the substrate; and (b) an inlet port and an outlet port, said inlet port and outlet port being in fluid communication with said flow cell for flowing fluids into and through said flow cell.
19. The method of claim 18, wherein the substrate is a microfabricated synthesis channel.
20. The method of claim 17, furthering comprising a light source to illuminate the surface of said substrate and a detection system to detect a signal from said surface.
21. The method of claim 17, further comprising an appropriately programmed computer for recording identity of a nucleotide when said nucleotide becomes incorporated into the target polynucleotide.
22. A method of analyzing sequence of a target polynucleotide, comprising:
(a) providing a primed target polynucleotide immobilized to a surface of a substrate; wherein the target polynucleotide is attached to the surface with single molecule resolution;
(b) adding four types of nucleotides to the surface of the substrate under conditions whereby nucleotides attach to the primer dynamically, when complementary nucleotides are present in the target polynucleotide; and
(c) monitoring in a time course of incorporation of fluorescent signals into the immobilized primer.
23. The method of claim 22, wherein monitoring of fluorescent signal incorporation into the immobilized primer is by taking images in a time course with monitored with total internal reflection fluorescence microscopy.
24. The method of claim 23, wherein the images are taken at a rate faster than the rate at which nucleotides are incorporated into the primer.
25. The method of claim 23, wherein nucleotide concentrations are low at each time point when an image is taken.
26. The method of claim 25, wherein nucleotide concentrations are alternated by fluid exchange with a microfluidic device.
27. The method of claim 22, wherein all four types of nucleotides are each labeled with a different label.
28. An apparatus for analyzing the sequence of a target polynucleotide, comprising:
(a) a flow cell comprising a substrate for immobilizing the target polynucleotide with single molecule resolution;
(b) an inlet port and an outlet port, said inlet port and outlet port being in fluid communication with said flow cell for flowing fluids into and through said flow cell;
(c) a light source for illuminating the surface of the substrate; and
(d) a detection system for detecting a signal from said surface.
PCT/US2002/008187 2001-03-12 2002-03-12 Methods and apparatus for analyzing polynucleotide sequences by asynchronous base extension WO2002072892A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
JP2002571942A JP2004523243A (en) 2001-03-12 2002-03-12 Method and apparatus for analyzing polynucleotide sequences by asynchronous base extension
EP02726651A EP1368497A4 (en) 2001-03-12 2002-03-12 Methods and apparatus for analyzing polynucleotide sequences by asynchronous base extension
CA002440754A CA2440754A1 (en) 2001-03-12 2002-03-12 Methods and apparatus for analyzing polynucleotide sequences by asynchronous base extension

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US27523201P 2001-03-12 2001-03-12
US60/275,232 2001-03-12

Publications (2)

Publication Number Publication Date
WO2002072892A1 WO2002072892A1 (en) 2002-09-19
WO2002072892A9 true WO2002072892A9 (en) 2004-05-27

Family

ID=23051416

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2002/008187 WO2002072892A1 (en) 2001-03-12 2002-03-12 Methods and apparatus for analyzing polynucleotide sequences by asynchronous base extension

Country Status (5)

Country Link
US (1) US7297518B2 (en)
EP (1) EP1368497A4 (en)
JP (1) JP2004523243A (en)
CA (1) CA2440754A1 (en)
WO (1) WO2002072892A1 (en)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9115163B2 (en) 2007-10-19 2015-08-25 The Trustees Of Columbia University In The City Of New York DNA sequence with non-fluorescent nucleotide reversible terminators and cleavable label modified nucleotide terminators
US9121062B2 (en) 2001-12-04 2015-09-01 Illumina Cambridge Limited Labelled nucleotides
US9121060B2 (en) 2002-08-23 2015-09-01 Illumina Cambridge Limited Modified nucleotides
US9127314B2 (en) 2002-08-23 2015-09-08 Illumina Cambridge Limited Labelled nucleotides
US9133511B2 (en) 2000-10-06 2015-09-15 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US9175342B2 (en) 2007-10-19 2015-11-03 The Trustees Of Columbia University In The City Of New York Synthesis of cleavable fluorescent nucleotides as reversible terminators for DNA sequencing by synthesis
US9243284B2 (en) 2000-12-01 2016-01-26 Life Technologies Corporation Enzymatic nucleic acid synthesis: compositions and methods for inhibiting pyrophosphorolysis
US9469873B2 (en) 2006-09-28 2016-10-18 Illumina, Inc. Compositions and methods for nucleotide sequencing
US9528151B2 (en) 2006-12-01 2016-12-27 The Trustees Of Columbia University In The City Of New York Four-color DNA sequencing by synthesis using cleavable fluorescent nucleotide reversible terminators
US9540689B2 (en) 1998-05-01 2017-01-10 Life Technologies Corporation Method of determining the nucleotide sequence of oligonucleotides and DNA molecules
US9588051B2 (en) 2004-09-17 2017-03-07 Pacific Biosciences Of California, Inc. Apparatus and method for performing nucleic acid analysis

Families Citing this family (319)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IL131332A (en) 1997-02-12 2003-07-31 Eugene Y Chan Methods and products for analyzing polymers
US6780591B2 (en) 1998-05-01 2004-08-24 Arizona Board Of Regents Method of determining the nucleotide sequence of oligonucleotides and DNA molecules
US7056661B2 (en) 1999-05-19 2006-06-06 Cornell Research Foundation, Inc. Method for sequencing nucleic acid molecules
US7501245B2 (en) 1999-06-28 2009-03-10 Helicos Biosciences Corp. Methods and apparatuses for analyzing polynucleotide sequences
US6982146B1 (en) 1999-08-30 2006-01-03 The United States Of America As Represented By The Department Of Health And Human Services High speed parallel molecular nucleic acid sequencing
US9708358B2 (en) 2000-10-06 2017-07-18 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
AU2002230524A1 (en) 2000-11-16 2002-05-27 California Institute Of Technology Apparatus and methods for conducting assays and high throughput screening
US6794141B2 (en) * 2000-12-22 2004-09-21 Arcturus Bioscience, Inc. Nucleic acid amplification
AU2002231934A1 (en) * 2001-01-30 2002-08-12 Solexa Ltd. Arrayed polynucleotides and their use in genome analysis
AU2002307152A1 (en) 2001-04-06 2002-10-21 California Institute Of Technology Nucleic acid amplification utilizing microfluidic devices
US7668697B2 (en) 2006-02-06 2010-02-23 Andrei Volkov Method for analyzing dynamic detectable events at the single molecule level
DE10143106C1 (en) * 2001-09-03 2002-10-10 Artus Ges Fuer Molekularbiolog Amplifying RNA, useful e.g. for analysis on a microarray, comprises conversion to double-stranded cDNA, strand separation and transcription
WO2003048295A1 (en) 2001-11-30 2003-06-12 Fluidigm Corporation Microfluidic device and methods of using same
US7057026B2 (en) 2001-12-04 2006-06-06 Solexa Limited Labelled nucleotides
AU2003220249A1 (en) * 2002-03-15 2003-09-29 Arcturus Bioscience, Inc. Improved nucleic acid amplification
AU2003224817B2 (en) 2002-04-01 2008-11-06 Fluidigm Corporation Microfluidic particle-analysis systems
US11008359B2 (en) 2002-08-23 2021-05-18 Illumina Cambridge Limited Labelled nucleotides
EP2298448A3 (en) 2002-09-25 2012-05-30 California Institute of Technology Microfluidic large scale integration
WO2004040001A2 (en) 2002-10-02 2004-05-13 California Institute Of Technology Microfluidic nucleic acid analysis
JP2006516410A (en) * 2003-02-03 2006-07-06 ジーイー・ヘルスケア・バイオサイエンス・コーポレイション CDNA amplification for expression profiling
AU2004211920B2 (en) * 2003-02-05 2009-05-14 Global Life Sciences Solutions Usa Llc Solid phase sequencing
WO2004072294A2 (en) * 2003-02-12 2004-08-26 Genizon Svenska Ab Methods and means for nucleic acid sequencing
GB0307403D0 (en) 2003-03-31 2003-05-07 Medical Res Council Selection by compartmentalised screening
GB0307428D0 (en) 2003-03-31 2003-05-07 Medical Res Council Compartmentalised combinatorial chemistry
US20060078893A1 (en) 2004-10-12 2006-04-13 Medical Research Council Compartmentalised combinatorial chemistry by microfluidic control
US7604965B2 (en) 2003-04-03 2009-10-20 Fluidigm Corporation Thermal reaction device and method for using the same
WO2004095008A1 (en) * 2003-04-23 2004-11-04 Olympus Corporation Method for analyzing molecular fluorescence using evanescent illumination
WO2005010159A2 (en) * 2003-07-17 2005-02-03 Children's Hospital Medical Center Rolling circle amplification of micro-rna samples
GB0324456D0 (en) 2003-10-20 2003-11-19 Isis Innovation Parallel DNA sequencing methods
EP1725572B1 (en) 2003-11-05 2017-05-31 AGCT GmbH Macromolecular nucleotide compounds and methods for using the same
US7169560B2 (en) * 2003-11-12 2007-01-30 Helicos Biosciences Corporation Short cycle methods for sequencing polynucleotides
WO2005080605A2 (en) * 2004-02-19 2005-09-01 Helicos Biosciences Corporation Methods and kits for analyzing polynucleotide sequences
US20100216153A1 (en) 2004-02-27 2010-08-26 Helicos Biosciences Corporation Methods for detecting fetal nucleic acids and diagnosing fetal abnormalities
JP2007529758A (en) * 2004-03-19 2007-10-25 ユー.エス. ジェノミクス, インコーポレイテッド Compositions and methods for single molecule detection
US20050221339A1 (en) 2004-03-31 2005-10-06 Medical Research Council Harvard University Compartmentalised screening by microfluidic control
US20050260609A1 (en) * 2004-05-24 2005-11-24 Lapidus Stanley N Methods and devices for sequencing nucleic acids
ATE507305T1 (en) * 2004-05-25 2011-05-15 Helicos Biosciences Corp METHOD FOR NUCLEIC ACID IMMOBILIZATION
US7264934B2 (en) * 2004-06-10 2007-09-04 Ge Healthcare Bio-Sciences Corp. Rapid parallel nucleic acid analysis
CA2567591C (en) * 2004-06-10 2011-08-02 Ge Healthcare Bio-Sciences Corp. Method for nucleic acid sequencing in the absence of divalent metal ion
US7692219B1 (en) 2004-06-25 2010-04-06 University Of Hawaii Ultrasensitive biosensors
US20060012793A1 (en) * 2004-07-19 2006-01-19 Helicos Biosciences Corporation Apparatus and methods for analyzing samples
US7276720B2 (en) 2004-07-19 2007-10-02 Helicos Biosciences Corporation Apparatus and methods for analyzing samples
JP4608697B2 (en) * 2004-08-27 2011-01-12 独立行政法人物質・材料研究機構 DNA base sequence analysis method and base sequence analysis apparatus using field effect device
GB2423819B (en) * 2004-09-17 2008-02-06 Pacific Biosciences California Apparatus and method for analysis of molecules
US7968287B2 (en) 2004-10-08 2011-06-28 Medical Research Council Harvard University In vitro evolution in microfluidic systems
US20060088844A1 (en) * 2004-10-22 2006-04-27 Honeywell International Inc. Real-time PCR microarray based on evanescent wave biosensor
US7429923B2 (en) * 2004-10-22 2008-09-30 Honeywell International Inc. Neuronal sensor networks
EP1817572A2 (en) * 2004-11-16 2007-08-15 Helicos Biosciences Corporation An optical train and method for tirf single molecule detection and analysis
US20060263790A1 (en) * 2005-05-20 2006-11-23 Timothy Harris Methods for improving fidelity in a nucleic acid synthesis reaction
KR100760315B1 (en) 2005-06-27 2007-10-05 전북대학교산학협력단 Single Molecular Detection Method Using Multi-Wavelength TIRF technique and an apparatus therefor
WO2007019422A2 (en) * 2005-08-05 2007-02-15 Helicos Biosciences Corporation Signal pattern compositions and methods
US7666593B2 (en) 2005-08-26 2010-02-23 Helicos Biosciences Corporation Single molecule sequencing of captured nucleic acids
US8831887B2 (en) * 2005-10-12 2014-09-09 The Research Foundation For The State University Of New York Absolute PCR quantification
US7871777B2 (en) * 2005-12-12 2011-01-18 The United States Of America As Represented By The Department Of Health And Human Services Probe for nucleic acid sequencing and methods of use
US8703734B2 (en) 2005-12-12 2014-04-22 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Nanoprobes for detection or modification of molecules
WO2007081385A2 (en) 2006-01-11 2007-07-19 Raindance Technologies, Inc. Microfluidic devices and methods of use in the formation and control of nanoreactors
US7815868B1 (en) 2006-02-28 2010-10-19 Fluidigm Corporation Microfluidic reaction apparatus for high throughput screening
CA2648149A1 (en) 2006-03-31 2007-11-01 Solexa, Inc. Systems and devices for sequence by synthesis analysis
EP2530168B1 (en) 2006-05-11 2015-09-16 Raindance Technologies, Inc. Microfluidic Devices
US9074242B2 (en) 2010-02-12 2015-07-07 Raindance Technologies, Inc. Digital analyte analysis
US9562837B2 (en) 2006-05-11 2017-02-07 Raindance Technologies, Inc. Systems for handling microfludic droplets
AU2007260707A1 (en) * 2006-06-16 2007-12-21 Pacific Biosciences Of California, Inc. Controlled initiation of primer extension
US9012390B2 (en) 2006-08-07 2015-04-21 Raindance Technologies, Inc. Fluorocarbon emulsion stabilizing surfactants
US20080177054A1 (en) * 2006-08-30 2008-07-24 David Evans Automated Parallel Oligonucleotide Synthesis
US20080081330A1 (en) * 2006-09-28 2008-04-03 Helicos Biosciences Corporation Method and devices for analyzing small RNA molecules
CN101669026B (en) 2006-12-14 2014-05-07 生命技术公司 Methods and apparatus for measuring analytes using large scale FET arrays
US11339430B2 (en) 2007-07-10 2022-05-24 Life Technologies Corporation Methods and apparatus for measuring analytes using large scale FET arrays
US8262900B2 (en) 2006-12-14 2012-09-11 Life Technologies Corporation Methods and apparatus for measuring analytes using large scale FET arrays
US8349167B2 (en) 2006-12-14 2013-01-08 Life Technologies Corporation Methods and apparatus for detecting molecular interactions using FET arrays
US8124944B2 (en) * 2007-01-17 2012-02-28 Honeywell International Inc. Microarray reader based on evanescent wave detection and method of reading a microarray
WO2008097841A2 (en) * 2007-02-02 2008-08-14 California Institute Of Technology Surface chemistry and deposition techniques
US8772046B2 (en) 2007-02-06 2014-07-08 Brandeis University Manipulation of fluids and reactions in microfluidic systems
US8592221B2 (en) 2007-04-19 2013-11-26 Brandeis University Manipulation of fluids, fluid components and reactions in microfluidic systems
AU2008282862B2 (en) 2007-07-26 2014-07-31 Pacific Biosciences Of California, Inc. Molecular redundant sequencing
US20100267041A1 (en) * 2007-09-14 2010-10-21 Predictive Biosciences, Inc. Serial analysis of biomarkers for disease diagnosis
EP2201136B1 (en) * 2007-10-01 2017-12-06 Nabsys 2.0 LLC Nanopore sequencing by hybridization of probes to form ternary complexes and variable range alignment
US8617811B2 (en) 2008-01-28 2013-12-31 Complete Genomics, Inc. Methods and compositions for efficient base calling in sequencing reactions
CN101952411B (en) * 2007-12-24 2014-10-29 霍尼韦尔国际公司 A reactor for the quantitative analysis of nucleic acids
MX2010010600A (en) 2008-03-28 2011-03-30 Pacific Biosciences California Inc Compositions and methods for nucleic acid sequencing.
US8470164B2 (en) 2008-06-25 2013-06-25 Life Technologies Corporation Methods and apparatus for measuring analytes using large scale FET arrays
EP4047367A1 (en) 2008-07-18 2022-08-24 Bio-Rad Laboratories, Inc. Method for detecting target analytes with droplet libraries
US8882980B2 (en) 2008-09-03 2014-11-11 Nabsys, Inc. Use of longitudinally displaced nanoscale electrodes for voltage sensing of biomolecules and other analytes in fluidic channels
US8262879B2 (en) 2008-09-03 2012-09-11 Nabsys, Inc. Devices and methods for determining the length of biopolymers and distances between probes bound thereto
US9650668B2 (en) 2008-09-03 2017-05-16 Nabsys 2.0 Llc Use of longitudinally displaced nanoscale electrodes for voltage sensing of biomolecules and other analytes in fluidic channels
US20100137143A1 (en) 2008-10-22 2010-06-03 Ion Torrent Systems Incorporated Methods and apparatus for measuring analytes
US20100301398A1 (en) 2009-05-29 2010-12-02 Ion Torrent Systems Incorporated Methods and apparatus for measuring analytes
US20100203524A1 (en) * 2008-10-31 2010-08-12 Helicos Biosciences Corporation Polymerases and methods of use thereof
EP2389585A2 (en) * 2009-01-22 2011-11-30 Li-Cor, Inc. Single molecule proteomics with dynamic probes
US9778188B2 (en) 2009-03-11 2017-10-03 Industrial Technology Research Institute Apparatus and method for detection and discrimination molecular object
EP3415235A1 (en) 2009-03-23 2018-12-19 Raindance Technologies Inc. Manipulation of microfluidic droplets
US8455260B2 (en) 2009-03-27 2013-06-04 Massachusetts Institute Of Technology Tagged-fragment map assembly
CA2760439A1 (en) 2009-04-30 2010-11-04 Good Start Genetics, Inc. Methods and compositions for evaluating genetic markers
US8246799B2 (en) 2009-05-28 2012-08-21 Nabsys, Inc. Devices and methods for analyzing biomolecules and probes bound thereto
US20120261274A1 (en) 2009-05-29 2012-10-18 Life Technologies Corporation Methods and apparatus for measuring analytes
US8673627B2 (en) 2009-05-29 2014-03-18 Life Technologies Corporation Apparatus and methods for performing electrochemical reactions
US8776573B2 (en) 2009-05-29 2014-07-15 Life Technologies Corporation Methods and apparatus for measuring analytes
JP5338573B2 (en) * 2009-08-31 2013-11-13 ソニー株式会社 Fluorescent image acquisition method, fluorescent image acquisition device, and fluorescent image acquisition program
US20110071033A1 (en) 2009-09-23 2011-03-24 Celmatix, Inc. Methods and devices for assessing infertility and/or egg quality
WO2011042564A1 (en) 2009-10-09 2011-04-14 Universite De Strasbourg Labelled silica-based nanomaterial with enhanced properties and uses thereof
EP2506882A4 (en) 2009-11-30 2017-05-17 Fluidigm Corporation Microfluidic device regeneration
EP2517025B1 (en) 2009-12-23 2019-11-27 Bio-Rad Laboratories, Inc. Methods for reducing the exchange of molecules between droplets
US9539571B2 (en) 2010-01-20 2017-01-10 Honeywell International Inc. Method to increase detection efficiency of real time PCR microarray by quartz material
US10351905B2 (en) 2010-02-12 2019-07-16 Bio-Rad Laboratories, Inc. Digital analyte analysis
US9366632B2 (en) 2010-02-12 2016-06-14 Raindance Technologies, Inc. Digital analyte analysis
US9399797B2 (en) 2010-02-12 2016-07-26 Raindance Technologies, Inc. Digital analyte analysis
CA2790434A1 (en) 2010-02-18 2011-08-25 Anthony P. Shuber Compositions and methods for treating cancer
US9482615B2 (en) 2010-03-15 2016-11-01 Industrial Technology Research Institute Single-molecule detection system and methods
US10787701B2 (en) 2010-04-05 2020-09-29 Prognosys Biosciences, Inc. Spatially encoded biological assays
CA2794522C (en) 2010-04-05 2019-11-26 Prognosys Biosciences, Inc. Spatially encoded biological assays
US20190300945A1 (en) 2010-04-05 2019-10-03 Prognosys Biosciences, Inc. Spatially Encoded Biological Assays
US20110262989A1 (en) 2010-04-21 2011-10-27 Nanomr, Inc. Isolating a target analyte from a body fluid
US8841104B2 (en) 2010-04-21 2014-09-23 Nanomr, Inc. Methods for isolating a target analyte from a heterogeneous sample
US9476812B2 (en) 2010-04-21 2016-10-25 Dna Electronics, Inc. Methods for isolating a target analyte from a heterogeneous sample
WO2011143791A1 (en) 2010-05-20 2011-11-24 Honeywell International Inc. Microarray reader based on evanescent wave detection
US9670243B2 (en) 2010-06-02 2017-06-06 Industrial Technology Research Institute Compositions and methods for sequencing nucleic acids
US8865078B2 (en) 2010-06-11 2014-10-21 Industrial Technology Research Institute Apparatus for single-molecule detection
CN109449171A (en) 2010-06-30 2019-03-08 生命科技公司 For detecting and measuring the transistor circuit of chemical reaction and compound
US8858782B2 (en) 2010-06-30 2014-10-14 Life Technologies Corporation Ion-sensing charge-accumulation circuits and methods
JP5952813B2 (en) 2010-06-30 2016-07-13 ライフ テクノロジーズ コーポレーション Method and apparatus for testing ISFET arrays
US11307166B2 (en) 2010-07-01 2022-04-19 Life Technologies Corporation Column ADC
WO2012006222A1 (en) 2010-07-03 2012-01-12 Life Technologies Corporation Chemically sensitive sensor with lightly doped drains
WO2012036679A1 (en) 2010-09-15 2012-03-22 Life Technologies Corporation Methods and apparatus for measuring analytes
US8796036B2 (en) 2010-09-24 2014-08-05 Life Technologies Corporation Method and system for delta double sampling
US8715933B2 (en) 2010-09-27 2014-05-06 Nabsys, Inc. Assay methods using nicking endonucleases
WO2012045012A2 (en) 2010-09-30 2012-04-05 Raindance Technologies, Inc. Sandwich assays in droplets
US8859201B2 (en) 2010-11-16 2014-10-14 Nabsys, Inc. Methods for sequencing a biomolecule by detecting relative positions of hybridized probes
US9163281B2 (en) 2010-12-23 2015-10-20 Good Start Genetics, Inc. Methods for maintaining the integrity and identification of a nucleic acid template in a multiplex sequencing reaction
WO2012109574A2 (en) 2011-02-11 2012-08-16 Nabsys, Inc. Assay methods using dna binding proteins
EP3412778A1 (en) 2011-02-11 2018-12-12 Raindance Technologies, Inc. Methods for forming mixed droplets
WO2012112804A1 (en) 2011-02-18 2012-08-23 Raindance Technoligies, Inc. Compositions and methods for molecular labeling
EP2694709B1 (en) 2011-04-08 2016-09-14 Prognosys Biosciences, Inc. Peptide constructs and assay systems
GB201106254D0 (en) 2011-04-13 2011-05-25 Frisen Jonas Method and product
WO2012162429A2 (en) 2011-05-23 2012-11-29 The Trustees Of Columbia University In The City Of New York Dna sequencing by synthesis using raman and infrared spectroscopy detection
US8841071B2 (en) 2011-06-02 2014-09-23 Raindance Technologies, Inc. Sample multiplexing
WO2012167142A2 (en) 2011-06-02 2012-12-06 Raindance Technolgies, Inc. Enzyme quantification
WO2012177792A2 (en) 2011-06-24 2012-12-27 Sequenom, Inc. Methods and processes for non-invasive assessment of a genetic variation
US8658430B2 (en) 2011-07-20 2014-02-25 Raindance Technologies, Inc. Manipulating droplet size
ES2639938T5 (en) 2011-09-23 2021-05-07 Illumina Inc Methods and compositions for nucleic acid sequencing
CA2850930A1 (en) 2011-10-03 2013-04-11 Celmatix, Inc. Methods and devices for assessing risk to a putative offspring of developing a condition
US9367663B2 (en) 2011-10-06 2016-06-14 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
WO2013052907A2 (en) 2011-10-06 2013-04-11 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US10196681B2 (en) 2011-10-06 2019-02-05 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US9984198B2 (en) 2011-10-06 2018-05-29 Sequenom, Inc. Reducing sequence read count error in assessment of complex genetic variations
US10424394B2 (en) 2011-10-06 2019-09-24 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
CA2852665A1 (en) 2011-10-17 2013-04-25 Good Start Genetics, Inc. Analysis methods
US9970984B2 (en) 2011-12-01 2018-05-15 Life Technologies Corporation Method and apparatus for identifying defects in a chemical sensor array
US9279154B2 (en) 2011-12-21 2016-03-08 Illumina, Inc. Apparatus and methods for kinetic analysis and determination of nucleic acid sequences
US8821798B2 (en) 2012-01-19 2014-09-02 Life Technologies Corporation Titanium nitride as sensing layer for microwell structure
US8747748B2 (en) 2012-01-19 2014-06-10 Life Technologies Corporation Chemical sensor with conductive cup-shaped sensor surface
JP6431769B2 (en) 2012-01-20 2018-11-28 セクエノム, インコーポレイテッド Diagnostic process including experimental conditions as factors
US20130210659A1 (en) 2012-02-10 2013-08-15 Andrew Watson Molecular diagnostic screening assay
DK3363901T3 (en) 2012-02-17 2021-02-22 Hutchinson Fred Cancer Res Compositions and methods for accurately identifying mutations
EP2817418B1 (en) 2012-02-24 2017-10-11 Raindance Technologies, Inc. Labeling and sample preparation for sequencing
EP2820174B1 (en) 2012-02-27 2019-12-25 The University of North Carolina at Chapel Hill Methods and uses for molecular tags
US8209130B1 (en) 2012-04-04 2012-06-26 Good Start Genetics, Inc. Sequence assembly
US8812422B2 (en) 2012-04-09 2014-08-19 Good Start Genetics, Inc. Variant database
US10227635B2 (en) 2012-04-16 2019-03-12 Molecular Loop Biosolutions, Llc Capture reactions
EP3524693A1 (en) 2012-04-30 2019-08-14 Raindance Technologies, Inc. Digital analyte analysis
EP2844773B1 (en) 2012-05-04 2017-08-16 Boreal Genomics Corp. Biomarker analysis using scodaphoresis
US10504613B2 (en) 2012-12-20 2019-12-10 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US9920361B2 (en) 2012-05-21 2018-03-20 Sequenom, Inc. Methods and compositions for analyzing nucleic acid
US8786331B2 (en) 2012-05-29 2014-07-22 Life Technologies Corporation System for reducing noise in a chemical sensor array
US10497461B2 (en) 2012-06-22 2019-12-03 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US10482994B2 (en) 2012-10-04 2019-11-19 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US9177098B2 (en) 2012-10-17 2015-11-03 Celmatix Inc. Systems and methods for determining the probability of a pregnancy at a selected point in time
US10162800B2 (en) 2012-10-17 2018-12-25 Celmatix Inc. Systems and methods for determining the probability of a pregnancy at a selected point in time
US9836577B2 (en) 2012-12-14 2017-12-05 Celmatix, Inc. Methods and devices for assessing risk of female infertility
US9434940B2 (en) 2012-12-19 2016-09-06 Dna Electronics, Inc. Methods for universal target capture
US9599610B2 (en) 2012-12-19 2017-03-21 Dnae Group Holdings Limited Target capture system
US9804069B2 (en) 2012-12-19 2017-10-31 Dnae Group Holdings Limited Methods for degrading nucleic acid
US9551704B2 (en) 2012-12-19 2017-01-24 Dna Electronics, Inc. Target detection
US9995742B2 (en) 2012-12-19 2018-06-12 Dnae Group Holdings Limited Sample entry
US10000557B2 (en) 2012-12-19 2018-06-19 Dnae Group Holdings Limited Methods for raising antibodies
US9914966B1 (en) 2012-12-20 2018-03-13 Nabsys 2.0 Llc Apparatus and methods for analysis of biomolecules using high frequency alternating current excitation
US9080968B2 (en) 2013-01-04 2015-07-14 Life Technologies Corporation Methods and systems for point of use removal of sacrificial material
US9841398B2 (en) 2013-01-08 2017-12-12 Life Technologies Corporation Methods for manufacturing well structures for low-noise chemical sensors
CN105190656B (en) 2013-01-17 2018-01-16 佩索纳里斯公司 Method and system for genetic analysis
EP2956550B1 (en) 2013-01-18 2020-04-08 Nabsys 2.0 LLC Enhanced probe binding
US20130309666A1 (en) 2013-01-25 2013-11-21 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US8962366B2 (en) 2013-01-28 2015-02-24 Life Technologies Corporation Self-aligned well structures for low-noise chemical sensors
US9303263B2 (en) 2013-03-01 2016-04-05 Vivonics, Inc. Aptamers that bind CD271
US8841217B1 (en) 2013-03-13 2014-09-23 Life Technologies Corporation Chemical sensor with protruded sensor surface
WO2014143158A1 (en) 2013-03-13 2014-09-18 The Broad Institute, Inc. Compositions and methods for labeling of agents
US8963216B2 (en) 2013-03-13 2015-02-24 Life Technologies Corporation Chemical sensor with sidewall spacer sensor surface
US8778609B1 (en) 2013-03-14 2014-07-15 Good Start Genetics, Inc. Methods for analyzing nucleic acids
US9835585B2 (en) 2013-03-15 2017-12-05 Life Technologies Corporation Chemical sensor with protruded sensor surface
WO2014144883A1 (en) 2013-03-15 2014-09-18 The Trustees Of Columbia University In The City Of New York Raman cluster tagged molecules for biological imaging
US20140264472A1 (en) 2013-03-15 2014-09-18 Life Technologies Corporation Chemical sensor with consistent sensor surface areas
US9593373B2 (en) 2013-03-15 2017-03-14 Illumina Cambridge Limited Modified nucleosides or nucleotides
WO2014149779A1 (en) 2013-03-15 2014-09-25 Life Technologies Corporation Chemical device with thin conductive element
US9116117B2 (en) 2013-03-15 2015-08-25 Life Technologies Corporation Chemical sensor with sidewall sensor surface
JP6581074B2 (en) 2013-03-15 2019-09-25 ライフ テクノロジーズ コーポレーション Chemical sensor with consistent sensor surface area
EP4187543A1 (en) 2013-04-03 2023-05-31 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
EP2986762B1 (en) 2013-04-19 2019-11-06 Bio-Rad Laboratories, Inc. Digital analyte analysis
US20140336063A1 (en) 2013-05-09 2014-11-13 Life Technologies Corporation Windowed Sequencing
US9725724B2 (en) 2013-05-16 2017-08-08 Vivonics, Inc. Neutral nucleic acid ligands
CA2910205C (en) 2013-05-24 2023-04-04 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
EP3005200A2 (en) 2013-06-03 2016-04-13 Good Start Genetics, Inc. Methods and systems for storing sequence read data
US10458942B2 (en) 2013-06-10 2019-10-29 Life Technologies Corporation Chemical sensor array having multiple sensors per well
US10622094B2 (en) 2013-06-21 2020-04-14 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US9879313B2 (en) 2013-06-25 2018-01-30 Prognosys Biosciences, Inc. Methods and systems for determining spatial patterns of biological targets in a sample
US9116866B2 (en) 2013-08-21 2015-08-25 Seven Bridges Genomics Inc. Methods and systems for detecting sequence variants
US9898575B2 (en) 2013-08-21 2018-02-20 Seven Bridges Genomics Inc. Methods and systems for aligning sequences
GB2534067B (en) 2013-08-30 2021-07-21 Personalis Inc Methods and systems for genomic analysis
US10351899B2 (en) 2013-09-25 2019-07-16 Bio-ID Diagnostics Inc. Methods for detecting nucleic acid fragments
AU2014324438B2 (en) 2013-09-30 2019-12-05 Seven Bridges Genomics Inc. Methods and system for detecting sequence variants
WO2015051275A1 (en) 2013-10-03 2015-04-09 Personalis, Inc. Methods for analyzing genotypes
CA2925528C (en) 2013-10-04 2023-09-05 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US11901041B2 (en) 2013-10-04 2024-02-13 Bio-Rad Laboratories, Inc. Digital analysis of nucleic acid modification
CA2925111C (en) 2013-10-07 2024-01-16 Sequenom, Inc. Methods and processes for non-invasive assessment of chromosome alterations
US10851414B2 (en) 2013-10-18 2020-12-01 Good Start Genetics, Inc. Methods for determining carrier status
WO2015058120A1 (en) 2013-10-18 2015-04-23 Seven Bridges Genomics Inc. Methods and systems for aligning sequences in the presence of repeating elements
US11041203B2 (en) 2013-10-18 2021-06-22 Molecular Loop Biosolutions, Inc. Methods for assessing a genomic region of a subject
EP3058332B1 (en) 2013-10-18 2019-08-28 Seven Bridges Genomics Inc. Methods and systems for genotyping genetic samples
JP2016533182A (en) 2013-10-18 2016-10-27 セブン ブリッジズ ジェノミクス インコーポレイテッド Methods and systems for identifying disease-induced mutations
WO2015058095A1 (en) 2013-10-18 2015-04-23 Seven Bridges Genomics Inc. Methods and systems for quantifying sequence alignment
US9063914B2 (en) 2013-10-21 2015-06-23 Seven Bridges Genomics Inc. Systems and methods for transcriptome analysis
US9944977B2 (en) 2013-12-12 2018-04-17 Raindance Technologies, Inc. Distinguishing rare variations in a nucleic acid sequence from a sample
US10537889B2 (en) 2013-12-31 2020-01-21 Illumina, Inc. Addressable flow cell using patterned electrodes
EP3090063B1 (en) 2013-12-31 2019-11-06 Bio-Rad Laboratories, Inc. Method for detection of latent retrovirus
CN106068330B (en) 2014-01-10 2020-12-29 七桥基因公司 Systems and methods for using known alleles in read mapping
US9817944B2 (en) 2014-02-11 2017-11-14 Seven Bridges Genomics Inc. Systems and methods for analyzing sequence data
US11053548B2 (en) 2014-05-12 2021-07-06 Good Start Genetics, Inc. Methods for detecting aneuploidy
JP2017526345A (en) 2014-07-17 2017-09-14 セルマティックス, インコーポレイテッド Methods and systems for assessing infertility and related pathologies
US20160034640A1 (en) 2014-07-30 2016-02-04 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
WO2016040446A1 (en) 2014-09-10 2016-03-17 Good Start Genetics, Inc. Methods for selectively suppressing non-target sequences
EP3224595A4 (en) 2014-09-24 2018-06-13 Good Start Genetics, Inc. Process control for increased robustness of genetic assays
US9558321B2 (en) 2014-10-14 2017-01-31 Seven Bridges Genomics Inc. Systems and methods for smart tools in sequence pipelines
EP4026913A1 (en) 2014-10-30 2022-07-13 Personalis, Inc. Methods for using mosaicism in nucleic acids sampled distal to their origin
US10000799B2 (en) 2014-11-04 2018-06-19 Boreal Genomics, Inc. Methods of sequencing with linked fragments
US10077472B2 (en) 2014-12-18 2018-09-18 Life Technologies Corporation High data rate integrated circuit with power management
WO2016100486A1 (en) 2014-12-18 2016-06-23 Life Technologies Corporation High data rate integrated circuit with transmitter configuration
CN111505087A (en) 2014-12-18 2020-08-07 生命科技公司 Method and apparatus for measuring analytes using large scale FET arrays
EP3271480B8 (en) 2015-01-06 2022-09-28 Molecular Loop Biosciences, Inc. Screening for structural variants
WO2016141294A1 (en) 2015-03-05 2016-09-09 Seven Bridges Genomics Inc. Systems and methods for genomic pattern analysis
EP4321627A3 (en) 2015-04-10 2024-04-17 10x Genomics Sweden AB Spatially distinguished, multiplex nucleic acid analysis of biological specimens
US10275567B2 (en) 2015-05-22 2019-04-30 Seven Bridges Genomics Inc. Systems and methods for haplotyping
US10793895B2 (en) 2015-08-24 2020-10-06 Seven Bridges Genomics Inc. Systems and methods for epigenetic analysis
US10584380B2 (en) 2015-09-01 2020-03-10 Seven Bridges Genomics Inc. Systems and methods for mitochondrial analysis
US10724110B2 (en) 2015-09-01 2020-07-28 Seven Bridges Genomics Inc. Systems and methods for analyzing viral nucleic acids
US10647981B1 (en) 2015-09-08 2020-05-12 Bio-Rad Laboratories, Inc. Nucleic acid library generation methods and compositions
US11347704B2 (en) 2015-10-16 2022-05-31 Seven Bridges Genomics Inc. Biological graph or sequence serialization
CN108449995B (en) 2015-11-06 2022-02-01 文塔纳医疗系统公司 Representative diagnosis
US20170199960A1 (en) 2016-01-07 2017-07-13 Seven Bridges Genomics Inc. Systems and methods for adaptive local alignment for graph genomes
US10364468B2 (en) 2016-01-13 2019-07-30 Seven Bridges Genomics Inc. Systems and methods for analyzing circulating tumor DNA
BR112018015034A2 (en) 2016-01-22 2019-02-12 Purdue Research Foundation charged mass marking system
US10460829B2 (en) 2016-01-26 2019-10-29 Seven Bridges Genomics Inc. Systems and methods for encoding genetic variation for a population
US10262102B2 (en) 2016-02-24 2019-04-16 Seven Bridges Genomics Inc. Systems and methods for genotyping with graph reference
JP7064665B2 (en) 2016-03-07 2022-05-11 ファーザー フラナガンズ ボーイズ ホーム ドゥーイング ビジネス アズ ボーイズ タウン ナショナル リサーチ ホスピタル Non-invasive molecular control
JP7086855B2 (en) 2016-03-28 2022-06-20 エヌキャン ジェノミクス, インコーポレイテッド Linked double chain target capture
US10961573B2 (en) 2016-03-28 2021-03-30 Boreal Genomics, Inc. Linked duplex target capture
US11355328B2 (en) 2016-04-13 2022-06-07 Purdue Research Foundation Systems and methods for isolating a target ion in an ion trap using a dual frequency waveform
US20190176153A1 (en) 2016-05-18 2019-06-13 Roche Sequencing Solutions, Inc. Quantitative real time pcr amplification using an electrowetting-based device
US11299783B2 (en) 2016-05-27 2022-04-12 Personalis, Inc. Methods and systems for genetic analysis
CN109415727A (en) 2016-06-13 2019-03-01 格里尔公司 The cell-free nucleic acid of mutation is enriched with for the method for cancer detection
EP3491560A1 (en) 2016-07-27 2019-06-05 Sequenom, Inc. Genetic copy number alteration classifications
US11250931B2 (en) 2016-09-01 2022-02-15 Seven Bridges Genomics Inc. Systems and methods for detecting recombination
US10487358B2 (en) 2016-09-23 2019-11-26 Grail, Inc. Methods of preparing and analyzing cell-free nucleic acid sequencing libraries
CA3040930A1 (en) 2016-11-07 2018-05-11 Grail, Inc. Methods of identifying somatic mutational signatures for early cancer detection
US11268137B2 (en) 2016-12-09 2022-03-08 Boreal Genomics, Inc. Linked ligation
EP3551768B1 (en) 2016-12-12 2024-03-06 Grail, LLC Methods for tagging and amplifying rna template molecules for preparing sequencing libraries
EP3559255A1 (en) 2016-12-23 2019-10-30 Grail, Inc. Methods for high efficiency library preparation using double-stranded adapters
JP7237003B2 (en) 2017-01-24 2023-03-10 セクエノム, インコーポレイテッド Methods and processes for evaluation of gene fragments
WO2018140157A1 (en) * 2017-01-30 2018-08-02 Bio-Rad Laboratories, Inc. Measurements of protein-protein interactions at single molecule level
WO2018183918A1 (en) 2017-03-30 2018-10-04 Grail, Inc. Enhanced ligation in sequencing library preparation
US11584958B2 (en) 2017-03-31 2023-02-21 Grail, Llc Library preparation and use thereof for sequencing based error correction and/or variant identification
WO2018183897A1 (en) 2017-03-31 2018-10-04 Grail, Inc. Higher target capture efficiency using probe extension
EP3610267B1 (en) * 2017-04-13 2022-11-23 European Molecular Biology Laboratory Single-cell imaging mass spectrometry
US20200263170A1 (en) 2017-09-14 2020-08-20 Grail, Inc. Methods for preparing a sequencing library from single-stranded dna
JP2019052932A (en) * 2017-09-14 2019-04-04 国立研究開発法人理化学研究所 Data analyzer, program and recording medium, and data analysis method
WO2019067973A1 (en) 2017-09-28 2019-04-04 Grail, Inc. Enrichment of short nucleic acid fragments in sequencing library preparation
JP7260553B2 (en) 2017-10-06 2023-04-18 ザ・ユニバーシティ・オブ・シカゴ Screening of T lymphocytes against cancer-specific antigens
JP7038209B2 (en) 2017-11-13 2022-03-17 エフ.ホフマン-ラ ロシュ アーゲー Equipment for sample analysis using epitaco electrophoresis
WO2019118925A1 (en) 2017-12-15 2019-06-20 Grail, Inc. Methods for enriching for duplex reads in sequencing and error correction
US20190237161A1 (en) 2017-12-22 2019-08-01 Grail, Inc. Error removal using improved library preparation methods
US11814750B2 (en) 2018-05-31 2023-11-14 Personalis, Inc. Compositions, methods and systems for processing or analyzing multi-species nucleic acid samples
US10801064B2 (en) 2018-05-31 2020-10-13 Personalis, Inc. Compositions, methods and systems for processing or analyzing multi-species nucleic acid samples
US11519033B2 (en) 2018-08-28 2022-12-06 10X Genomics, Inc. Method for transposase-mediated spatial tagging and analyzing genomic DNA in a biological sample
US20210382002A1 (en) 2018-10-12 2021-12-09 Roche Sequencing Solutions, Inc. Detection methods for epitachophoresis workflow automation
US11680261B2 (en) 2018-11-15 2023-06-20 Grail, Inc. Needle-based devices and methods for in vivo diagnostics of disease conditions
CN113286883A (en) 2018-12-18 2021-08-20 格里尔公司 Methods for detecting disease using RNA analysis
US11473136B2 (en) 2019-01-03 2022-10-18 Ncan Genomics, Inc. Linked target capture
US20220081714A1 (en) 2019-01-04 2022-03-17 Northwestern University Storing temporal data into dna
US11649485B2 (en) 2019-01-06 2023-05-16 10X Genomics, Inc. Generating capture probes for spatial analysis
US11926867B2 (en) 2019-01-06 2024-03-12 10X Genomics, Inc. Generating capture probes for spatial analysis
CA3130693A1 (en) 2019-02-19 2020-08-27 Ultima Genomics, Inc. Linkers and methods for optical detection and sequencing
US20220325268A1 (en) 2019-05-14 2022-10-13 Roche Sequencing Solutions, Inc Devices and methods for sample analysis
TW202120693A (en) * 2019-08-21 2021-06-01 美商伊路米納有限公司 Method for detecting polymerase incorporation of nucleotides
WO2021092433A2 (en) 2019-11-08 2021-05-14 10X Genomics, Inc. Enhancing specificity of analyte binding
EP4055185A1 (en) 2019-11-08 2022-09-14 10X Genomics, Inc. Spatially-tagged analyte capture agents for analyte multiplexing
CN114885610A (en) 2019-12-23 2022-08-09 10X基因组学有限公司 Methods for spatial analysis using RNA templated ligation
US11732299B2 (en) 2020-01-21 2023-08-22 10X Genomics, Inc. Spatial assays with perturbed cells
US11702693B2 (en) 2020-01-21 2023-07-18 10X Genomics, Inc. Methods for printing cells and generating arrays of barcoded cells
US11821035B1 (en) 2020-01-29 2023-11-21 10X Genomics, Inc. Compositions and methods of making gene expression libraries
US11898205B2 (en) 2020-02-03 2024-02-13 10X Genomics, Inc. Increasing capture efficiency of spatial assays
US11732300B2 (en) 2020-02-05 2023-08-22 10X Genomics, Inc. Increasing efficiency of spatial analysis in a biological sample
US11835462B2 (en) 2020-02-11 2023-12-05 10X Genomics, Inc. Methods and compositions for partitioning a biological sample
US11807851B1 (en) 2020-02-18 2023-11-07 Ultima Genomics, Inc. Modified polynucleotides and uses thereof
US11891654B2 (en) 2020-02-24 2024-02-06 10X Genomics, Inc. Methods of making gene expression libraries
US11926863B1 (en) 2020-02-27 2024-03-12 10X Genomics, Inc. Solid state single cell method for analyzing fixed biological cells
US11768175B1 (en) 2020-03-04 2023-09-26 10X Genomics, Inc. Electrophoretic methods for spatial analysis
WO2021216708A1 (en) 2020-04-22 2021-10-28 10X Genomics, Inc. Methods for spatial analysis using targeted rna depletion
EP4153775A1 (en) 2020-05-22 2023-03-29 10X Genomics, Inc. Simultaneous spatio-temporal measurement of gene expression and cellular activity
WO2021237087A1 (en) 2020-05-22 2021-11-25 10X Genomics, Inc. Spatial analysis to detect sequence variants
WO2021242834A1 (en) 2020-05-26 2021-12-02 10X Genomics, Inc. Method for resetting an array
EP4025692A2 (en) 2020-06-02 2022-07-13 10X Genomics, Inc. Nucleic acid library methods
CN116249785A (en) 2020-06-02 2023-06-09 10X基因组学有限公司 Space transcriptomics for antigen-receptor
EP4162074B1 (en) 2020-06-08 2024-04-24 10X Genomics, Inc. Methods of determining a surgical margin and methods of use thereof
EP4165207A1 (en) 2020-06-10 2023-04-19 10X Genomics, Inc. Methods for determining a location of an analyte in a biological sample
WO2021263111A1 (en) 2020-06-25 2021-12-30 10X Genomics, Inc. Spatial analysis of dna methylation
US11761038B1 (en) 2020-07-06 2023-09-19 10X Genomics, Inc. Methods for identifying a location of an RNA in a biological sample
US11926822B1 (en) 2020-09-23 2024-03-12 10X Genomics, Inc. Three-dimensional spatial analysis
US11827935B1 (en) 2020-11-19 2023-11-28 10X Genomics, Inc. Methods for spatial analysis using rolling circle amplification and detection probes
WO2022140028A1 (en) 2020-12-21 2022-06-30 10X Genomics, Inc. Methods, compositions, and systems for capturing probes and/or barcodes
EP4308723A1 (en) 2021-03-15 2024-01-24 F. Hoffmann-La Roche AG Targeted next-generation sequencing via anchored primer extension
WO2022198068A1 (en) 2021-03-18 2022-09-22 10X Genomics, Inc. Multiplex capture of gene and protein expression from a biological sample
WO2023034489A1 (en) 2021-09-01 2023-03-09 10X Genomics, Inc. Methods, compositions, and kits for blocking a capture probe on a spatial array
EP4253550A1 (en) 2022-04-01 2023-10-04 GenCC GmbH 6 Co. KG Method for the manufacture of a viral system, a vector system or any transport system for cancer-specific crispr complexes
WO2023218408A1 (en) 2022-05-11 2023-11-16 Freya Biosciences Aps Methods of identifying strains associated with the human female genitourinary tract

Family Cites Families (149)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3996345A (en) 1974-08-12 1976-12-07 Syva Company Fluorescence quenching with immunological pairs in immunoassays
JPS5941169B2 (en) * 1975-12-25 1984-10-05 シチズン時計株式会社 Elastomer
US4153855A (en) * 1977-12-16 1979-05-08 The United States Of America As Represented By The Secretary Of The Army Method of making a plate having a pattern of microchannels
US4351760A (en) * 1979-09-07 1982-09-28 Syva Company Novel alkyl substituted fluorescent compounds and polyamino acid conjugates
US4344064A (en) * 1979-12-06 1982-08-10 Western Electric Co., Inc. Article carrying a distinctive mark
US4711955A (en) * 1981-04-17 1987-12-08 Yale University Modified nucleotides and methods of preparing and using same
US5260433A (en) 1982-06-23 1993-11-09 Enzo Diagnostics, Inc. Saccharide specific binding system labeled nucleotides
US4707237A (en) 1982-09-09 1987-11-17 Ciba Corning Diagnostics Corp. System for identification of cells by electrophoresis
US5198540A (en) * 1982-10-28 1993-03-30 Hubert Koster Process for the preparation of oligonucleotides in solution
US4994373A (en) * 1983-01-27 1991-02-19 Enzo Biochem, Inc. Method and structures employing chemically-labelled polynucleotide probes
DE3329892A1 (en) * 1983-08-18 1985-03-07 Köster, Hubert, Prof. Dr., 2000 Hamburg METHOD FOR PRODUCING OLIGONUCLEOTIDES
USRE34069E (en) * 1983-08-18 1992-09-15 Biosyntech Gmbh Process for the preparation of oligonucleotides
US5360523A (en) 1984-03-29 1994-11-01 Li-Cor, Inc. DNA sequencing
US4683195A (en) * 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4683202A (en) * 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4865968A (en) 1985-04-01 1989-09-12 The Salk Institute For Biological Studies DNA sequencing
US4739044A (en) * 1985-06-13 1988-04-19 Amgen Method for derivitization of polynucleotides
US4863849A (en) * 1985-07-18 1989-09-05 New York Medical College Automatable process for sequencing nucleotide
US4757141A (en) * 1985-08-26 1988-07-12 Applied Biosystems, Incorporated Amino-derivatized phosphite and phosphate linking agents, phosphoramidite precursors, and useful conjugates thereof
US5242797A (en) * 1986-03-21 1993-09-07 Myron J. Block Nucleic acid assay method
US4811218A (en) * 1986-06-02 1989-03-07 Applied Biosystems, Inc. Real time scanning electrophoresis apparatus for DNA sequencing
CA1340806C (en) * 1986-07-02 1999-11-02 James Merrill Prober Method, system and reagents for dna sequencing
US4889818A (en) 1986-08-22 1989-12-26 Cetus Corporation Purified thermostable enzyme
US4994372A (en) 1987-01-14 1991-02-19 President And Fellows Of Harvard College DNA sequencing
US5525464A (en) 1987-04-01 1996-06-11 Hyseq, Inc. Method of sequencing by hybridization of oligonucleotide probes
US5202231A (en) 1987-04-01 1993-04-13 Drmanac Radoje T Method of sequencing of genomes by hybridization of oligonucleotide probes
US6270961B1 (en) * 1987-04-01 2001-08-07 Hyseq, Inc. Methods and apparatus for DNA sequencing and DNA identification
US4994368A (en) 1987-07-23 1991-02-19 Syntex (U.S.A.) Inc. Amplification method for polynucleotide assays
US4942124A (en) 1987-08-11 1990-07-17 President And Fellows Of Harvard College Multiplex sequencing
US4793705A (en) 1987-10-07 1988-12-27 The United States Of America As Represented By The United States Department Of Energy Single molecule tracking
US4962037A (en) * 1987-10-07 1990-10-09 United States Of America Method for rapid base sequencing in DNA and RNA
US4971903A (en) 1988-03-25 1990-11-20 Edward Hyman Pyrophosphate-based method and apparatus for sequencing nucleic acids
US4962020A (en) 1988-07-12 1990-10-09 President And Fellows Of Harvard College DNA sequencing
CH679555A5 (en) * 1989-04-11 1992-03-13 Westonbridge Int Ltd
US4979824A (en) 1989-05-26 1990-12-25 Board Of Trustees Of The Leland Stanford Junior University High sensitivity fluorescent single particle and single molecule detection apparatus and method
US5547839A (en) * 1989-06-07 1996-08-20 Affymax Technologies N.V. Sequencing of surface immobilized polymers utilizing microflourescence detection
US6416952B1 (en) * 1989-06-07 2002-07-09 Affymetrix, Inc. Photolithographic and other means for manufacturing arrays
US5143854A (en) * 1989-06-07 1992-09-01 Affymax Technologies N.V. Large scale photolithographic solid phase synthesis of polypeptides and receptor binding screening thereof
US5800992A (en) * 1989-06-07 1998-09-01 Fodor; Stephen P.A. Method of detecting nucleic acids
US6551784B2 (en) * 1989-06-07 2003-04-22 Affymetrix Inc Method of comparing nucleic acid sequences
US6346413B1 (en) * 1989-06-07 2002-02-12 Affymetrix, Inc. Polymer arrays
US5424186A (en) * 1989-06-07 1995-06-13 Affymax Technologies N.V. Very large scale immobilized polymer synthesis
US5744101A (en) * 1989-06-07 1998-04-28 Affymax Technologies N.V. Photolabile nucleoside protecting groups
AU633104B2 (en) * 1989-06-14 1993-01-21 Debiotech S.A. Improved micro-pump
US5112736A (en) 1989-06-14 1992-05-12 University Of Utah Dna sequencing using fluorescence background electroblotting membrane
US5108892A (en) 1989-08-03 1992-04-28 Promega Corporation Method of using a taq dna polymerase without 5'-3'-exonuclease activity
US5096554A (en) 1989-08-07 1992-03-17 Applied Biosystems, Inc. Nucleic acid fractionation by counter-migration capillary electrophoresis
US5302509A (en) * 1989-08-14 1994-04-12 Beckman Instruments, Inc. Method for sequencing polynucleotides
CA2028261C (en) 1989-10-28 1995-01-17 Won Suck Yang Non-invasive method and apparatus for measuring blood glucose concentration
US5171132A (en) 1989-12-27 1992-12-15 Seiko Epson Corporation Two-valve thin plate micropump
US5091652A (en) 1990-01-12 1992-02-25 The Regents Of The University Of California Laser excited confocal microscope fluorescence scanner and method
WO1991011533A1 (en) * 1990-01-26 1991-08-08 E.I. Du Pont De Nemours And Company Method for isolating primer extension products from template-directed dna polymerase reactions
DE4006152A1 (en) * 1990-02-27 1991-08-29 Fraunhofer Ges Forschung MICROMINIATURIZED PUMP
US5096388A (en) 1990-03-22 1992-03-17 The Charles Stark Draper Laboratory, Inc. Microfabricated pump
SE470347B (en) 1990-05-10 1994-01-31 Pharmacia Lkb Biotech Microstructure for fluid flow systems and process for manufacturing such a system
DE69106240T2 (en) 1990-07-02 1995-05-11 Seiko Epson Corp Micropump and method of making a micropump.
DK0834576T3 (en) * 1990-12-06 2002-04-22 Affymetrix Inc A Delaware Corp Detection of nucleic acid sequences
US5529679A (en) 1992-02-28 1996-06-25 Hitachi, Ltd. DNA detector and DNA detection method
US5762876A (en) 1991-03-05 1998-06-09 Molecular Tool, Inc. Automatic genotype determination
US5518900A (en) 1993-01-15 1996-05-21 Molecular Tool, Inc. Method for generating single-stranded DNA molecules
US5167784A (en) 1991-09-04 1992-12-01 Xerox Corporation Sequencing large nucleic acid fragments
DE4143343C2 (en) * 1991-09-11 1994-09-22 Fraunhofer Ges Forschung Microminiaturized, electrostatically operated micromembrane pump
US5265327A (en) 1991-09-13 1993-11-30 Faris Sadeg M Microchannel plate technology
US5405747A (en) * 1991-09-25 1995-04-11 The Regents Of The University Of California Office Of Technology Transfer Method for rapid base sequencing in DNA and RNA with two base labeling
US5674679A (en) * 1991-09-27 1997-10-07 Amersham Life Science, Inc. DNA cycle sequencing
US5756285A (en) 1991-09-27 1998-05-26 Amersham Life Science, Inc. DNA cycle sequencing
US5632957A (en) * 1993-11-01 1997-05-27 Nanogen Molecular biological diagnostic systems including electrodes
US6051380A (en) * 1993-11-01 2000-04-18 Nanogen, Inc. Methods and procedures for molecular biological analysis and diagnostics
US5209834A (en) 1992-03-09 1993-05-11 The United States Of America As Represented By The United States Department Of Energy Ordered transport and identification of particles
GB9208733D0 (en) * 1992-04-22 1992-06-10 Medical Res Council Dna sequencing method
US5304487A (en) * 1992-05-01 1994-04-19 Trustees Of The University Of Pennsylvania Fluid handling in mesoscale analytical devices
DE4220077A1 (en) 1992-06-19 1993-12-23 Bosch Gmbh Robert Micro-pump for delivery of gases - uses working chamber warmed by heating element and controlled by silicon wafer valves.
JPH0622798A (en) 1992-07-07 1994-02-01 Hitachi Ltd Method for determining base sequence
US5306403A (en) 1992-08-24 1994-04-26 Martin Marietta Energy Systems, Inc. Raman-based system for DNA sequencing-mapping and other separations
US5403709A (en) 1992-10-06 1995-04-04 Hybridon, Inc. Method for sequencing synthetic oligonucleotides containing non-phosphodiester internucleotide linkages
AU671820B2 (en) 1993-02-10 1996-09-12 Promega Corporation Non-radioactive DNA sequencing
DE69431719T2 (en) * 1993-06-25 2003-09-18 Affymetrix Inc N D Ges D Staat HYBRIDIZATION AND SEQUENCING OF NUCLEIC ACIDS
DE4326466A1 (en) * 1993-08-06 1995-02-09 Boehringer Mannheim Gmbh Infrared dye-labeled nucleotides and their use in nucleic acid detection
US5659171A (en) * 1993-09-22 1997-08-19 Northrop Grumman Corporation Micro-miniature diaphragm pump for the low pressure pumping of gases
US5610287A (en) 1993-12-06 1997-03-11 Molecular Tool, Inc. Method for immobilizing nucleic acid molecules
CH689836A5 (en) 1994-01-14 1999-12-15 Westonbridge Int Ltd Micropump.
US5654419A (en) 1994-02-01 1997-08-05 The Regents Of The University Of California Fluorescent labels and their use in separations
US5631734A (en) * 1994-02-10 1997-05-20 Affymetrix, Inc. Method and apparatus for detection of fluorescently labeled materials
JP3448090B2 (en) * 1994-02-16 2003-09-16 浜松ホトニクス株式会社 Energy transfer detection method and apparatus
AU1854895A (en) 1994-03-08 1995-09-25 Amersham International Plc Modifying nucleotide analogues
US6287850B1 (en) * 1995-06-07 2001-09-11 Affymetrix, Inc. Bioarray chip reaction apparatus and its manufacture
US6071394A (en) * 1996-09-06 2000-06-06 Nanogen, Inc. Channel-less separation of bioparticles on a bioelectronic chip by dielectrophoresis
US5695934A (en) * 1994-10-13 1997-12-09 Lynx Therapeutics, Inc. Massively parallel sequencing of sorted polynucleotides
US5514256A (en) 1994-10-28 1996-05-07 Battelle Memorial Institute Apparatus for improved DNA sequencing
US5707506A (en) 1994-10-28 1998-01-13 Battelle Memorial Institute Channel plate for DNA sequencing
FR2726286B1 (en) * 1994-10-28 1997-01-17 Genset Sa SOLID PHASE NUCLEIC ACID AMPLIFICATION PROCESS AND REAGENT KIT USEFUL FOR CARRYING OUT SAID PROCESS
US5556790A (en) 1994-12-05 1996-09-17 Pettit; John W. Method for Automated DNA sequencing
US5710628A (en) 1994-12-12 1998-01-20 Visible Genetics Inc. Automated electrophoresis and fluorescence detection apparatus and method
US5786142A (en) 1995-05-30 1998-07-28 Visible Genetics Inc. Electrophoresis and fluorescence detection method
US5599695A (en) * 1995-02-27 1997-02-04 Affymetrix, Inc. Printing molecular library arrays using deprotection agents solely in the vapor phase
US5876187A (en) * 1995-03-09 1999-03-02 University Of Washington Micropumps with fixed valves
US5795782A (en) 1995-03-17 1998-08-18 President & Fellows Of Harvard College Characterization of individual polymer molecules based on monomer-interface interactions
US5750341A (en) 1995-04-17 1998-05-12 Lynx Therapeutics, Inc. DNA sequencing by parallel oligonucleotide extensions
US5675155A (en) 1995-04-26 1997-10-07 Beckman Instruments, Inc. Multicapillary fluorescent detection system
US5861287A (en) * 1995-06-23 1999-01-19 Baylor College Of Medicine Alternative dye-labeled primers for automated DNA sequencing
US5856174A (en) * 1995-06-29 1999-01-05 Affymetrix, Inc. Integrated nucleic acid diagnostic device
US5807679A (en) 1995-07-07 1998-09-15 Myriad Genetics, Inc. Island hopping--a method to sequence rapidly very large fragments of DNA
US5968740A (en) * 1995-07-24 1999-10-19 Affymetrix, Inc. Method of Identifying a Base in a Nucleic Acid
US5733729A (en) 1995-09-14 1998-03-31 Affymetrix, Inc. Computer-aided probability base calling for arrays of nucleic acid probes on chips
US5843655A (en) * 1995-09-18 1998-12-01 Affymetrix, Inc. Methods for testing oligonucleotide arrays
US5776767A (en) 1995-12-12 1998-07-07 Visible Genetics Inc. Virtual DNA sequencer
US5705018A (en) 1995-12-13 1998-01-06 Hartley; Frank T. Micromachined peristaltic pump
ES2162132T3 (en) 1995-12-15 2001-12-16 Amersham Pharm Biotech Inc THERMO-STABLE DNA POLYMERASE FROM THERMOANAEROBACTER THERMOHYDROSULFURICUS AND MUTANT ENZYMES, OF SUPPLIED EXONUCLEASE ACTIVITY SO OBTAINED.
AU710425B2 (en) * 1995-12-18 1999-09-23 Washington University Method for nucleic acid analysis using fluorescence resonance energy transfer
US5795722A (en) 1997-03-18 1998-08-18 Visible Genetics Inc. Method and kit for quantitation and nucleic acid sequencing of nucleic acid analytes in a sample
US5789168A (en) 1996-05-01 1998-08-04 Visible Genetics Inc. Method for amplification and sequencing of nucleic acid polymers
US6361937B1 (en) * 1996-03-19 2002-03-26 Affymetrix, Incorporated Computer-aided nucleic acid sequencing
EP0910664A1 (en) * 1996-04-15 1999-04-28 University Of Southern California Synthesis of fluorophore-labeled dna
DE69706417T2 (en) * 1996-04-19 2002-06-27 Amersham Pharm Biotech Uk Ltd SQUARE DYES AND THEIR USE IN A FLUORESCENCE SEQUENCING PROCESS
US5928906A (en) * 1996-05-09 1999-07-27 Sequenom, Inc. Process for direct sequencing during template amplification
JP2000512744A (en) * 1996-05-16 2000-09-26 アフィメトリックス,インコーポレイテッド System and method for detecting label material
IL127560A0 (en) * 1996-06-14 1999-10-28 Sarnoff Corp Method for polynucleotide sequencing
US5832165A (en) * 1996-08-28 1998-11-03 University Of Utah Research Foundation Composite waveguide for solid phase binding assays
US6020457A (en) * 1996-09-30 2000-02-01 Dendritech Inc. Disulfide-containing dendritic polymers
US5880473A (en) * 1997-07-28 1999-03-09 Applied Imaging, Inc. Multifluor-fluorescence in-situ hybridization (M-FISH) imaging techniques using multiple multiband filters with image registration
US6133436A (en) * 1996-11-06 2000-10-17 Sequenom, Inc. Beads bound to a solid support and to nucleic acids
US6024925A (en) * 1997-01-23 2000-02-15 Sequenom, Inc. Systems and methods for preparing low volume analyte array elements
US6140053A (en) * 1996-11-06 2000-10-31 Sequenom, Inc. DNA sequencing by mass spectrometry via exonuclease degradation
US6017702A (en) * 1996-12-05 2000-01-25 The Perkin-Elmer Corporation Chain-termination type nucleic acid sequencing method including 2'-deoxyuridine-5'-triphosphate
US6511803B1 (en) * 1997-10-10 2003-01-28 President And Fellows Of Harvard College Replica amplification of nucleic acid arrays
US6322968B1 (en) * 1997-11-21 2001-11-27 Orchid Biosciences, Inc. De novo or “universal” sequencing array
DE29806082U1 (en) * 1998-04-02 1998-06-18 Ideal Electronics Inc Cooling device for a central processing unit
DE69928409D1 (en) * 1998-08-19 2005-12-22 Bioventures Inc METHOD FOR DETERMINING POLYNUCLEOTIDE SEQUENCE VARIATIONS
US6221592B1 (en) * 1998-10-20 2001-04-24 Wisconsin Alumi Research Foundation Computer-based methods and systems for sequencing of individual nucleic acid molecules
US6309701B1 (en) * 1998-11-10 2001-10-30 Bio-Pixels Ltd. Fluorescent nanocrystal-labeled microspheres for fluorescence analyses
US6245518B1 (en) * 1998-12-11 2001-06-12 Hyseq, Inc. Polynucleotide arrays and methods of making and using the same
AU2180200A (en) * 1998-12-14 2000-07-03 Li-Cor Inc. A heterogeneous assay for pyrophosphate detection
US6270644B1 (en) * 1999-01-27 2001-08-07 Affymetrix, Inc. Capillary array electrophoresis scanner
EP1163052B1 (en) * 1999-02-23 2010-06-02 Caliper Life Sciences, Inc. Manipulation of microparticles in microfluidic systems
US6585939B1 (en) * 1999-02-26 2003-07-01 Orchid Biosciences, Inc. Microstructures for use in biological assays and reactions
US6403317B1 (en) * 1999-03-26 2002-06-11 Affymetrix, Inc. Electronic detection of hybridization on nucleic acid arrays
US6261775B1 (en) * 1999-04-09 2001-07-17 The Regents Of The University Of California Detection of chromosome copy number changes to distinguish melanocytic nevi from malignant melanoma
US7056661B2 (en) * 1999-05-19 2006-06-06 Cornell Research Foundation, Inc. Method for sequencing nucleic acid molecules
US6225109B1 (en) * 1999-05-27 2001-05-01 Orchid Biosciences, Inc. Genetic analysis device
US6818395B1 (en) * 1999-06-28 2004-11-16 California Institute Of Technology Methods and apparatus for analyzing polynucleotide sequences
US6077674A (en) * 1999-10-27 2000-06-20 Agilent Technologies Inc. Method of producing oligonucleotide arrays with features of high purity
WO2001032930A1 (en) * 1999-11-04 2001-05-10 California Institute Of Technology Methods and apparatuses for analyzing polynucleotide sequences
US6342326B1 (en) * 2000-05-10 2002-01-29 Beckman Coulter, Inc. Synthesis and use of acyl fluorides of cyanine dyes
WO2002004680A2 (en) * 2000-07-07 2002-01-17 Visigen Biotechnologies, Inc. Real-time sequence determination
US6627748B1 (en) * 2000-09-11 2003-09-30 The Trustees Of Columbia University In The City Of New York Combinatorial fluorescence energy transfer tags and their applications for multiplex genetic analyses
ATE356222T1 (en) * 2000-10-06 2007-03-15 Univ Columbia MASSIVE PARALLEL METHOD FOR DECODING DNA AND RNA
US20020115092A1 (en) * 2000-11-08 2002-08-22 The Scripps Research Institute Energy transfer labels with mechanically linked fluorophores
WO2003020902A2 (en) * 2001-08-31 2003-03-13 Datascope Investment Corp. Methods for blocking nonspecific hybridizations of nucleic acid sequences
US6852492B2 (en) * 2001-09-24 2005-02-08 Intel Corporation Nucleic acid sequencing by raman monitoring of uptake of precursors during molecular replication

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9540689B2 (en) 1998-05-01 2017-01-10 Life Technologies Corporation Method of determining the nucleotide sequence of oligonucleotides and DNA molecules
US9133511B2 (en) 2000-10-06 2015-09-15 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US9243284B2 (en) 2000-12-01 2016-01-26 Life Technologies Corporation Enzymatic nucleic acid synthesis: compositions and methods for inhibiting pyrophosphorolysis
US9410200B2 (en) 2001-12-04 2016-08-09 Illumina Cambridge Limited Labelled nucleotides
US9388463B2 (en) 2001-12-04 2016-07-12 Illumina Cambridge Limited Labelled nucleotides
US9121062B2 (en) 2001-12-04 2015-09-01 Illumina Cambridge Limited Labelled nucleotides
US9127314B2 (en) 2002-08-23 2015-09-08 Illumina Cambridge Limited Labelled nucleotides
US9121060B2 (en) 2002-08-23 2015-09-01 Illumina Cambridge Limited Modified nucleotides
US9388464B2 (en) 2002-08-23 2016-07-12 Illumina Cambridge Limited Modified nucleotides
US9410199B2 (en) 2002-08-23 2016-08-09 Illumina Cambridge Limited Labelled nucleotides
US9588051B2 (en) 2004-09-17 2017-03-07 Pacific Biosciences Of California, Inc. Apparatus and method for performing nucleic acid analysis
US9469873B2 (en) 2006-09-28 2016-10-18 Illumina, Inc. Compositions and methods for nucleotide sequencing
US9528151B2 (en) 2006-12-01 2016-12-27 The Trustees Of Columbia University In The City Of New York Four-color DNA sequencing by synthesis using cleavable fluorescent nucleotide reversible terminators
US9175342B2 (en) 2007-10-19 2015-11-03 The Trustees Of Columbia University In The City Of New York Synthesis of cleavable fluorescent nucleotides as reversible terminators for DNA sequencing by synthesis
US9115163B2 (en) 2007-10-19 2015-08-25 The Trustees Of Columbia University In The City Of New York DNA sequence with non-fluorescent nucleotide reversible terminators and cleavable label modified nucleotide terminators

Also Published As

Publication number Publication date
US20020164629A1 (en) 2002-11-07
EP1368497A1 (en) 2003-12-10
CA2440754A1 (en) 2002-09-19
EP1368497A4 (en) 2007-08-15
US7297518B2 (en) 2007-11-20
JP2004523243A (en) 2004-08-05
WO2002072892A1 (en) 2002-09-19

Similar Documents

Publication Publication Date Title
US7297518B2 (en) Methods and apparatus for analyzing polynucleotide sequences by asynchronous base extension
EP1716254B1 (en) Methods for analyzing polynucleotide sequences
US8535881B2 (en) High speed parallel molecular nucleic acid sequencing
US7939256B2 (en) Composition and method for nucleic acid sequencing
US8399196B2 (en) Nucleic acid sequencing methods, kits and reagents
US7414115B2 (en) Length determination of nucleic acid repeat sequences by discontinuous primer extension
US20060024711A1 (en) Methods for nucleic acid amplification and sequence determination
WO2001016375A2 (en) High speed parallel molecular nucleic acid sequencing
US20070031875A1 (en) Signal pattern compositions and methods
US20220073980A1 (en) Sequencing by coalescence
US20070254280A1 (en) Method of Identifying Characteristic of Molecules

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ CZ DE DE DK DK DM DZ EC EE EE ES FI FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PH PL PT RO RU SD SE SG SI SK SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2002726651

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2002571942

Country of ref document: JP

Ref document number: 2440754

Country of ref document: CA

WWP Wipo information: published in national office

Ref document number: 2002726651

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

COP Corrected version of pamphlet

Free format text: PAGES 1/15 - 15/15, DRAWINGS, REPLACED BY NEW PAGES 1/15 -15/15; DUE TO LATE TRANSMITTAL BY THE RECEIVING OFFICE