WO2003014382A2 - Device for analyzing nucleic acid - Google Patents

Abstract

The invention relates to a device for analyzing at least one analyte from a sample. The inventive device comprises a support (1) with a surface (2) on which at least one predefined analytical zone (3) and at least one predefined control zone (4) are arranged. At least one first binding partner which specifically binds to at least one analyte is immobilized in the predefined analytical zone (3). At least one further binding partner is disposed in the at least one control zone (4) and allows at least one control for determining the quality of analysis.

Description

Device for analyzing nucleic acid

The invention relates to a device for analyzing at least one nucleic acid sequence, a method for amplifying nucleic acid sequences, a method for identifying nucleic acid sequences, an oligonucleotide primer and an analysis kit according to the features in the preambles of claims 1, 24, 28, 30 and 31 and the use of the device or the analysis kit according to claims 32 to 35.

A large number of diseases are caused by bacterial infections, including periodontitis, in particular periodontitis, an inflammatory disease of all parts of the periodontium caused by bacterial deposits with progressive loss of supporting tissue. Periodontitis is a common problem that affects a large percentage of the population. The disease can usually be treated well using antibiotics. Recently, however, the frequent and sometimes untargeted use of antibiotics to treat various diseases has led to an increase in the development of resistance in many bacteria. Furthermore, a delayed bacteriological finding first requires broad-spectrum antibiotic therapy, which means more side effects for the patient and is more expensive. In addition, by taking a non-specific antibiotic therapy, further therapeutic measures may be necessary, which consequently results in reduced effectiveness, a protracted course of the disease and an inefficient one

Exploitation of the resources that are already limited in the health system means. For these reasons, the correct bacteriological finding is decisive for the targeted therapy. The identification of the pathogenic genus or type of bacteria leads both to the optimization of the diagnosis and to the targeted use of the corresponding antibiotic. The time factor in diagnosing also plays an important role in the course of the disease. Extensive diagnostic tests, which can only be carried out in specially equipped laboratories, and a slow and inaccurate diagnosis, on the one hand lead to economic damage due to the effort of highly qualified personnel for the laboratory at high costs, and on the other hand through the untargeted therapy of the disease. It tries therefore the methods for the identification of bacterial genera and

to make types as simple and as quick as possible and still ensure the results are correct. In the worst case, indistinct and thus not meaningful analysis results require the sampling to be repeated, including their re-analysis, and thus increase the costs and the time required. In order to avoid these occurrences, various solutions have been proposed in the prior art. So serve z. B. microscopic examinations for quick analysis. They allow an assessment according to physiological characteristics such as shape, size, pseudocellular structures, staining behavior, the presence of flagella or a capsule and spore formation. One application for assessing morphological features is that, as shown for example in WO 93/25903 A, morphological changes in polymorphonuclear

Leukocytes from dental patients after incubation with Porphyromonas gingivalis with polymorphonuclear leukocytes from healthy people are compared and analyzed. However, these examination methods have the disadvantage that bacterial species with similar physiological characteristics can only be roughly classified. The assignment of bacteria with similar physiological characteristics also depends on the laboratory technician concerned and this only enables a very imprecise analysis of the types of bacteria.

Microbiological examinations enable the detection of physiological features with indicator media that e.g. B. indicate a change in pH, an exact determination of the type or type of bacteria. The disadvantage that can be seen in microbiological analysis systems is that only live germs are to be detected, which requires careful sampling and a corresponding sample transport, and furthermore that the analysis takes several days to weeks.

Serological tests can detect protein components from bacteria that react with antibodies. The use of monoclonal antibodies enables the detection of individual types and types of bacteria. Antibody-coupled enzyme reactions enable detection. Such an identification system consists in that, as shown for example in US Pat. No. 4,741,999 A, the use of monoclonal antibodies serves for the detection and determination of the concentration of certain microorganisms relating to the etiology of human periodontal diseases. In particular, a monoclonal antibody is specifically described for an antigen from Actinobacillus actinomycetemco-mitans. Actinobacillus actinomycetemcomitans mostly occurs in juvenile periodontitis. However, the serological systems have the disadvantage that only a few epitopes of an antigen can be detected with monoclonal antibodies.

The number of available antibodies is therefore limited to certain types of bacteria.

In order to overcome this disadvantage, a wide variety of systems have been proposed in the prior art. Nucleic acid tests are the most modern and safest methods to analyze species-specific bacteria DNA molecules. One distinguishes between Detection methods directly from the test material and methods with previous amplification. The intermediate amplification increases the sensitivity of the method and also enables the detection of small quantities of DNA, regardless of their vitality.

For example, WO 00/52203 A describes a method for identifying bacteria which describes the amplification of part of the 23S rDNA using the primer 5 'GCGATTTCYGAAYGGGGRAACCC-3' and the primer 5'-TTCGCCTTTCCCTCACGGTACT-3 '. The amplificate is hybridized with various oligonucleotides on a nylon membrane. This method allows the identification of at least 8 types of bacteria in one test, the bacteria being selected from a group comprising bacteria such as Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, Enterococcus spp., Klebsiella spp., Enterobacter spp., Proteus spp., Pneumococci and coagulase include negative staphylococci. However, this system has the disadvantage that the 23S rDNA is variable and therefore suitable primary sequences for the bacterial genera and species to be analyzed have to be found in a few consensus areas to identify the bacterial genera and species. This in turn limits the number of types of bacteria that can be analyzed.

To overcome this disadvantage, the following system is proposed in the prior art. So z. B. from DE 199 44 168 AI known a method, which is a method for the genus-specific detection and species identification of bacteria of the genera Helicobacter and Wolinella, which on the multiplication of a special gene fragment for coding the 16S rRNA and its further analysis based, describes. By using special new oligonucleotide primers of about 18 base pairs in length for the method, which are characterized in that they hybridize in two newly described consensus sequences for the 16S rRNA gene, amplification products only arise when bacteria of the genus Helicobacter or Wolinella in the sample are included. If the result is positive, the resulting amplification product is analyzed by DNA sequencing. The species present is identified by sequence comparison. Alternatively, a restriction analysis of the amplification product in the sense of an RFLP (restriction fragment length polymorphism) can be used for the species identification. From the band pattern, it is concluded that species are present. The main disadvantage of this system is that direct sequencing takes a long time and is expensive, and that RFLP does identify sequence variations but not many types of bacteria can be distinguished. Another disadvantage is that the oligonucleotide primers only find complementary sequences in the genera Helicobacter and Wolinella, and therefore can only detect and analyze these two genera.

Another disadvantage that can be seen in all of these systems is that there are no controls to verify the quality of the various analyzes.

The object of the invention is therefore to provide a possibility for reproducible, quick and simple analysis of nucleic acid sequences. It is also a subtask of the

Invention to enable identification of bacterial species associated with periodontitis.

The object of the invention is achieved by the device according to the features in the characterizing part of claim 1. The advantage of this device is that for the analysis of various analytes there are control systems on the device which go through the same process steps as the specific binding partners for the analyte and thus the user has the possibility of the quality of the analysis result via these without additional expenditure of time Assess or improve control systems. This is particularly advantageous if the individual process steps for the analysis of several people are possibly carried out at different locations and these do not communicate with each other. Unclear results can be traced back to possible sources of error. Another advantage is that the process costs using the device are hardly or not increased compared to processes without controls. It is furthermore advantageous that in the event that the device is archived for subsequent checks or later evaluations, the species-specific, amplified and hybridized analytes can be archived together with the quality controls, so that the process sequence can be checked at any time and the evaluation with consistent quality can be repeated.

Furthermore, a further development according to claim 2 proves to be advantageous, according to which the possibility of immobilizing the binding partners on different carriers makes the acquisition of processing and evaluation devices for only one type of carrier obsolete and thus the costs for the analysis are significantly reduced because both already Existing processing and analysis devices can be used as well as multiple devices when purchasing new devices. An embodiment according to claim 3 proves to be advantageous because a large number of different analytes can be detected with the same device without having to adapt the device. Another advantage is that, due to the diversity of the device, no special training of the personnel to be carried out is required for the various analytes, and thus a large number of analytes can be evaluated by only one person. It has also proven to be advantageous that several analytes can be evaluated simultaneously on one device.

The development according to claim 4 is advantageous, which provides a control option for the alignment of the device both during the evaluation and after the evaluation. The evaluation device can already recognize the wrong orientation of the wearer. The evaluation can be terminated immediately and thus the costs for this and / or subsequent process steps can be saved.

According to the embodiment according to claim 5, it proves advantageous that the specific binding of the at least first and / or further binding partner to the analyte to which the sample is subjected is verifiable and traceable.

An embodiment according to claim 6 proves to be advantageous, according to which a complex error search can be carried out by specifically detecting an error in the amplification of the analyte

The analysis result can be limited to the amplification step and the entire analysis does not have to be searched for the source of the error.

The embodiment according to claim 7 also proves to be advantageous because mix-ups of samples to be analyzed, which took place before the start of the analysis, can be detected quickly. Furthermore, it proves advantageous that the source from which the at least one analyte originates can be determined, and thus the sample can still be assigned even after the analysis.

The further development according to claim 8 proves to be advantageous, whereby by connecting an at least one further specific binding partner to the analyte to be analyzed as well as to a further binding partner, the analyte to be identified can be detected if an additional further specific binding partner is present for the further analyte. The signal of the analyte to be analyzed results from the difference between the detectable signals. A further development according to claim 9 is also advantageous, wherein the binding of the same specific binding partner to two different analytes, which have a very similar structure, can be demonstrated. By using a further binding partner that is specific only for the one analyte, the presence of another but undesired analyte that also binds to the same binding partner can be identified. Furthermore, it proves advantageous that detection of contamination of the sample with, for example, infectious material is made possible. The analyzing or medical staff can be informed and warned at an early stage, thus minimizing the risk of infection and the possible consequential costs.

An embodiment according to claim 10 is also advantageous, according to which at least a semi-quantitative determination of the analyte in the original sample is made possible because the quantity and quality of the isolation can be determined by adding a precisely defined amount of a substance with behavior similar to that of the analyte.

The further development according to claims 11 and 14 also proves to be advantageous, wherein the intensity of the signal can be compared with a standard and thus an adjustment can be made and the result can be relativized and normalized.

According to claim 12, the application of the specific binding partner to the carrier can be carried out immediately after this step but before the start of the analysis, after which the quality of the analysis can be ensured at a high level by the use of only perfect carriers and thus unnecessary costs by the use be avoided by faulty devices.

An embodiment according to claim 13 proves to be advantageous, according to which a uniform intensity of the signals can be guaranteed when evaluating the analysis and thus results do not falsify the result due to different intensities of the signals.

According to claim 15, the surface of the device can check for unspecific deposits of analytes and thus a signal which arises from an unspecific binding of an analyte and would lead to a wrong result regarding the identification of the analyte. Also advantageous are the developments of the device according to claims 16 and 17, whereby the intensity of the signals resulting from the evaluation is available in various gradations, since too high a concentration of the positive controls would cause the signals to be superimposed, thereby endangering the clarity of the analysis results is. The device can thus be used universally regardless of an expected concentration of the analyte. It is also advantageous that the different concentrations of the binding partners quantify the analytes, such as. B. gene expressions.

A configuration according to claim 18 is also advantageous, according to which the analysis can be carried out with greater certainty by arranging identical binding partners on the carrier in several analysis and / or control areas. Doubtful results in a certain analysis and / or control area can be confirmed or refuted by the result in at least one other analysis and / or control area. A further advantage is that the multiple arrangement of the same positive controls, both in different and in the same concentrations, enables normalization to be carried out within or between different measurements. So z. For example, by calculating a correction factor, the measurements in the analysis areas of a device can be compared with one another on one or more other devices. Of course, the measurements in the analysis areas can also be made on the same

Device can be normalized by calculating a correction factor.

Here, an embodiment according to claim 19 proves advantageous, according to which, for. B. defective spots on the carrier not recognized during the manufacture of the device and / or uneven evaluation conditions over at least one further analysis and / or control area on the device due to the non-adjacent arrangement of the same binding partner in at least one further analysis and / or control area of the wearer can be recognized or compensated.

According to the embodiments in claims 20 and 21, nucleic acid sequences of many different types and types of bacteria can be analyzed simultaneously in any combination and thus a corresponding time saving or increased throughput can be realized in the laboratory.

A further development of the device according to claim 22 is advantageous, with which only an oligonucleotide primer or primer a quality control for various process steps, in particular the amplification, is available. Furthermore, by using at least one of these oligonucleotide sequences, the necessary steps for optimizing the successful amplification can be minimized.

According to claim 23, different target nucleic acid sequences can be analyzed in an advantageous manner using only one oligonucleotide primer or primer pair, because by appropriately selecting the oligonucleotide sequences on the support, amplified target nucleic acid sequences simultaneously have complementary regions and can therefore hybridize.

The object of the invention is also independently achieved by a method according to the features in the characterizing part of claims 24 and 28. The advantage of this is that several target nucleic acid sequences with only one primer sequence, in particular bacterial genera or species associated with periodontitis, can be amplified or identified simultaneously. As a result, the process costs for the laboratory can be reduced and the feasibility of the method can be simplified, since the risk of confusion regarding different oligonucleotide primers for different target nucleic acid sequences is minimized. The process can also be carried out by less experienced people. It is also advantageous that the storage can be simplified and the costs for a laboratory caused thereby can be reduced by reducing the number of different reagents. Due to the greater consumption of a primer, the acquisition costs for chemicals can also be reduced and the larger sales of this primer can reduce the storage time and thus the risk of the same being unusable.

Advantageous further developments of the method for the amplification of at least one target nucleic acid sequence are characterized in claims 25 to 27.

It is advantageous in a further development according to claim 25 that several types of bacteria can be amplified at the same time, thereby saving costs, time and material.

However, the further development according to claim 26 is also advantageous, because by using the gene sequences for the 16S rRNA with only one Primeφaar sequences different Bacterial species can be amplified. The gene sequence for the 16S rRNA has on the one hand highly conserved consensus regions to which the oligonucleotide primers bind and on the other hand gene or species-specific regions in between. The amplification of partial sequences of the genes which encode the 16S rRNA makes the use of many different oligonucleotide primer sequences and the optimization of the amplification conditions for the respective oligonucleotide primer sequence superfluous.

Through the development according to claim 27 can be achieved that the hybridization products, ie. H. the amplificate bound to the complementary oligonucleotide can generate a signal. This increases the degree of automation and thus a

Reduction in personnel costs achieved.

It is also advantageous to carry out the method for identifying at least one target nucleic acid sequence according to claim 29, because the control and the analysis are carried out on only one analysis device and therefore there is no need for complex additional controls in another analysis device.

The object of the invention is also achieved independently by an oligonucleotide primer according to the features in the characterizing part of claim 30. The advantage of this is that amplification products, created by the amplification with this primer or a prime pair formed from them, hybridize to a carrier with a complementary oligonucleotide sequence for at least one positive control and / or target nucleic acid sequence and the resulting signal enables the method and / or quality to be checked identification of the types of bacteria is made possible.

The object of the invention is also achieved independently by an analysis kit according to the features in the characterizing part of claim 31. The advantage of this is that the analysis kit contains both the device and the oligonucleotide primers for the simultaneous amplification of different types of bacteria. At the same time, the analysis result also contains results of the checks carried out during the analysis, so that any errors can be recognized before or with the analysis of the analytes and thus a lengthy research into the causes and, if necessary, a necessary optimization effort can be reduced.

The object of the invention is also independent through the use of the device solved according to the features in the characterizing part of claims 32 and 33. The advantage of this is that analytes of bacterial species associated with periodontitis can be identified and thus an exact analysis of the associated germs can be achieved.

The object of the invention is also achieved independently by using the analysis kit according to the features in the characterizing part of claims 34 and 35. It has proven to be advantageous that a complete set for identifying various types of bacteria or different gene expression patterns is already available through the use of the analysis kit and that the components do not have to be purchased individually and coordinated with one another. A further advantage is that it can quickly detect germs associated with periodontitis, in particular periodontitis, and therefore the consequential costs of a primarily untargeted antibiotic therapy can be prevented.

For a better understanding of the invention, this will be explained in more detail with reference to the following FIG. 1, which shows a device with binding partners, arranged in analysis or control areas in a schematically simplified representation.

1 shows a device for analyzing at least one analyte. This device comprises a carrier 1, preferably in the form of a plate, with a surface 2 on which a plurality of analysis areas 3 and a number of control areas 4 are arranged. However, it is of course possible that in a minimal version only one analysis or control area 3, 4 or that an analysis area 3 and several control areas 4 or vice versa are arranged.

Alternative embodiments of the device are carrier 1 in a platelet-shaped configuration, with two recesses being formed on its surface, such as, for. B. Chambersli- des.

Another embodiment of the carrier 1 are microtitre plates according to dimensions in accordance with the recommendations of the SBS (Society of Biomolecular Screening).

The analysis area (s) 3 and / or the control area (s) 4 can be arranged on the surface 2 of the carrier 1 at any predetermined position.

A silanized glass support can preferably be used as the support 1. But it is it is also possible to form the carrier 1 from plastic, stone, metal, etc. or carriers which have been surface-treated with aldehyde, aminosilane, streptavidin, biotin, thiol, magnetic materials can also be used.

It should be mentioned at this point that FIG. 1 shows only one example of the device according to the invention. Other shapes, such as e.g. B. a cube, a ball, or other cross-sections of the platelet-shaped formation, such as square, round, etc., can be used for the device.

For example, possible at least approximately spherical devices with several analysis or To provide control areas 3,4 superficially, these devices subsequently being placed in a liquid sample solution to be analyzed. If necessary, these devices designed in this way can be provided with a layer of a magnetic material, so that the devices can be easily removed from the sample solution after the target nucleic acids have been bound.

However, the device is preferably in the form of a plate and the sample (s) to be examined is or are applied to this device.

Furthermore, it is possible to provide the device with at least one cover layer on at least one of the surfaces 2 of the carrier 1 in order to protect the underlying surface 2 from unintended external influences, e.g. from scratches and thus destruction of surface areas. This cover layer can also be arranged to be at least partially removable.

The device according to the invention can be used for the analysis of many different analytes. In the following, the terms nucleic acid, nucleic acid sequence and target nucleic acid sequence can be selected by a term from a group comprising nucleic acids, such as e.g. DNA, RNA, PNA (peptide nucleic acids), proteins, e.g. Antibodies, epitopes, antigens, scaffold proteins, fusion proteins, in particular recombinant

Fusion proteins, signal proteins, transmitters, enzymes, substrates, hormones, peptides, lipids, carbohydrates, such as mono-, di-, oligo- and polysaccharides, and their modified forms, etc., can optionally be replaced. Naturally, the term oligonucleotide can of course also be extended to include first or further binding partners, the binding partner being a molecule selected from a group comprising nucleic acids, such as eg DNA, RNA, PNA (peptide nucleic acids), proteins, such as, for example, antibodies, epitopes, antigens, scaffold proteins, fusion proteins, in particular recombinant fusion proteins, signal proteins, transmitters, enzymes, substrates, hormones, peptides, lipids, carbohydrates, such as, for example, mono -, Di-, oligo- and polysaccharides, and their modified forms, etc., can represent.

The device according to the invention is preferably used in the analysis of analytes, in particular nucleic acids of bacterial species, in particular of those associated with periodontitis. Although the following description is restricted to this embodiment of the device, it should be noted, however, that the device can also be used for other analytes and nucleic acid sequences, and the following statements are therefore not to be understood as limiting the scope of protection.

The invention also includes the amplification of the target nucleic acid sequence using a primer or Primeφaares and their hybridization to oligonucleotides in the analysis or. Control areas 3.4.

Furthermore, the device can be taken by various precautions, such as. B. Recesses in the surface can also be used directly for the amplification of nucleic acid sequences. In this case, the device can, at least in some areas, include a device for increasing the temperature, e.g. comprise a heating layer, e.g. To enable temperature change programs.

The, in particular different, oligonucleotides complementary to the target nucleic acid sequence and / or to the positive controls can preferably be attached to the support 1 in the analysis or control areas 3, 4 using a nanoplotter by piezoelectric contactless sample transfer. However, other methods for oligonucleotide distribution can also be used, such as needle printers, ring and pin printers, electro addressing printers, top spoters, etc., or these can also be applied manually. Other methods are of course possible and are known to the person skilled in the art in this field.

The oligonucleotides can be used for the identification of different nucleic acid sequences, in particular of nucleic acid sequences of different types of bacteria. Ideally, the respective oligonucleotide sequence should contain only one bacterial species and their strains hybridize. As can be seen from WO 00/52203 A, several oligonucleotide sequences are sometimes necessary to identify individual bacterial species in order to identify the species specified in this document.

As already mentioned, the invention can preferably be used for the identification of bacteria associated with periodontitis. There are currently around 100 different types of bacteria causing this oral disease. In order to enable the most efficient analysis of such bacteria, the device according to the invention preferably has several, for example 20 different, oligonucleotides therefor. In the analysis areas, 3 oligonucleotides can be used to identify Actinobacillus actinomycetemcomitans, Actinomyces odontolyticus, Actinomyces viscosus, Bacteroides forsythus, Campylobacter concisus, Campylobacter gracilis (Bacteroides gracilis), Campylobacter rec nucleatum, Peptostreptococcus micros, Poφhyromonas gingivalis, Prevotella intermedia, Prevotella nigrescens, Streptococcus constellatus, Streptococcus gordonii, Streptococcus mitis, Treponema denticola and Veillonella parvula can be used.

In a further possible application, oligonucleotides can also be used for the identification of different nucleic acid sequences, in particular of gene expression patterns of different organisms.

The oligonucleotides preferably consist of 10 to 120 nucleotides, but can also consist of 15 to 100 nucleotides, but in particular 20 to 50 nucleotides, for example 33 nucleotides.

The detection of short nucleic acid sequences of amplified DNA is a simple method and can therefore also be carried out on a much larger scale, e.g. to identify viral nucleic acid sequences or gene variations, etc., as described here.

The oligonucleotide sequences are synthesized de novo. The oligonucleotides are modified at at least one end in such a way that they adhere to the support 1 in the analysis or control areas 3, 4, in particular bind chemically via this modified end. For example, the 5 'end can preferably be modified with the amino modifier C6 MMT (6- (4-monomethoxytritylamino) hexyl- (2-cyanoethyl) - (N, N-diisopropyl) phosphoramidite with the following structural formula. NtvITN HC H2CH 2CH 2CH 2CH 2CH

I

0 I [Pr) 2Ϊi - P-OCH2CH2CN

In it MMT means monomethoxytrityl and Pr isopropyl.

Of course, other modifiers can also be used, e.g. Succinyl, DNP (2,4-dinitrophenyl), etc.

However, it is also possible to modify the 3 'end or both the 5' and the 3 'end of the oligonucleotide sequences in such a way that adhesion to the support 1 becomes possible.

In order to be able to apply the oligonucleotides to the analysis or control areas 3, 4, they are used in solution. As a solvent e.g. a Tris-EDTA buffer, or water can be used. Other solvents that can be used are e.g. physiological sodium chloride solution (0.9% NaCl), PBS, alcohol dilutions, Tris buffer, DMSO in a concentration selected from a range with an upper limit of 30%, preferably 25%, in particular 20% and a lower limit of 1% , preferably 2%, especially 5% etc.

The oligonucleotides are added to the solvent in an amount such that they are present in a concentration in the range between 1 nM to 1 mM, for example 10 nM to 500 μM, preferably 100 nM to 500 μM. Concentrations in the

Range between 0.5 uM to 100 uM, in particular 1 uM to 50 uM proven.

The binding partners can be presented in the same or different concentrations in the control areas 4. Binding partners can be applied, which control the orientation of the support 1, e.g. in an evaluation device, e.g. one

Scanner, enable. Furthermore, binding partners for the control areas 4 can be used, which allow an assessment of the quality of an amplification, e.g. PCR and / or hybridization of the analytes can be used.

A specific binding partner, such as a nucleotide sequence or an antibody of a specific organism, is used to demonstrate the sample identity or type or matrix. such as humans, animals or plants, or for a certain variety or breed, such as cattle, sheep, pigs, or birch, palm, fir, etc., immobilized on the carrier 1 in a predefined area. Identification can also be done by adding material to the sample such as. for example, nanoparticles, dyes, etc., which are differentiated at the control areas 4. The identity can also result from a combination of different markers.

Alternatively, for the detection of samples of different matrices, e.g. from blood, serum, plasma, urine, saliva, faeces, etc., the same label is used for each analyte from the same sample. This is done either by directly marking the

Analytes with a substrate such as e.g. Enzyme, biotin, digoxigenin, radioactive labeling, fluorescent or chemiluminescent labels, chemical substances with a specific spectrum, e.g. Infrared, etc. or by adding a precisely defined molecule, the molecule having different characteristics for each sample of different origins and being clearly identifiable in the further analysis.

The infected host organism can be detected by proving the origin or the source from which viruses originate, for example. This is particularly important when identifying virus strains that affect different host organisms. By immobilizing a binding partner that makes a phylogenetic distinction, e.g. Complementary sequences to the Cytrom B gene, or by immobilizing cytochrome B corresponding antibodies, the different host organisms are detected. Both for the analysis and for the further procedure, it can be decisive from which source this virus was isolated in order to be able to take immediate measures, for example to prevent the pathogen from spreading further.

With a further application it is of great importance whether prions come from the nervous system of cattle or from sheep in order to be able to quarantine the affected farm from which the sick animal comes. By immobilizing the specific binding partner for prions in combination with an individual-specific binding partner, such as short tandem repeats (STR), variable number of tandem repeats (VNTR), single nucleotide polymorphism (SNP), etc., it is proven from which individual the same species the prions come from. In order to be able to rule out cross reactions of a specific binding partner with several analytes, controls for cross reactions are arranged on the device. When very closely related organisms are examined, cross-reactions between specific binding partners and analytes of both species can occur. By using a further specific probe, which is known to bind only to analytes of one type, the cross reaction can thus be detected and the two types can be distinguished from one another. The same principle can also be used for antibodies which bind to two different antigens, a further antibody being present for the second antigen, from which it has been demonstrated that it is a specific binding partner only for the second type.

Specific binding partners for contamination can also be immobilized on the carrier. By applying a specific binding partner for, for example, highly infectious viruses, the presence of these viruses in the sample, which also contains the analyte, can be detected, and medical personnel are therefore warned in good time of potential infection options after receiving the result of the analysis.

The immobilization of a specific binding partner for the isolation control makes it possible to determine the amount of analyte that was lost during the isolation. By adding a precisely defined amount of a substance to the analytes before the sample is purified, the amount lost through the isolation work can be determined. It is important that the added substance is very similar to the analyte in its behavior in order to obtain a representative statement. When adding DNA, care must be taken that the analyte is present in a sample which

DNAse is free.

To check the determination of the quality and quantity of the signal intensification, a specific binding partner is arranged on the carrier 1, which binds a normalization of the intensity of the signal, which is indicated by markings, such as by enzymatic marking, silver coloring or marking with gold particles, by fluorescence or chemiluminescent color substances, biotin, digoxigenin, radioactive labels, etc., are allowed. In order to be able to estimate the amplification factor of silver staining, for example, gold particles are applied to carrier 1 in a defined amount, which then serve as a crystallization point, analogous to the detection system, where, for example, the primer is via a biotin Streptavidin system is labeled with the gold particles. Accordingly, a defined number of binding sites for dendrimer signal amplification or for enzymatic or similarly effective catalytic signal amplification systems are applied to the carrier 1.

In order to determine the quality of the hybridization, a specific binding partner for the hybridization control, which is added, for example, only after the isolation or amplification of the analyte from the sample, is immobilized either parallel to each specific binding partner. On the other hand, a hybridization control can also be available in which the specific binding partner for the analyte and the specific binding partner for the hybridization probe are coupled and are therefore present in the same amounts, the problem of the different ratio of the specific binding partner to the analyte and of the specific one Binding partner to the hybridization probe, if these are available separately, is eliminated.

In order to check the effectiveness of the immobilization of the specific binding partner on the support 1, a label, e.g. a fluorescent or chemiluminescent label is covalently bound. The first determination of the print quality takes place after the immobilization of the specific binding partners on the support 1 and after the hybridization an evaluation is carried out again using the hybridization probe. This procedure enables a separation into control for the printing process and into the control for hybridization.

Another embodiment variant marks the specific binding partner with three different markings, e.g. Fluorescence or chemiluminescence markings that result in different signals during detection. For example, one label is the control for the immobilization of the specific binding partner, the other label is a control for the hybridization and the third label is a control for the detection of the binding of the specific binding partner to the analyte.

Another way to determine the quality of the analysis is through the

Applying a marker control, which is always immobilized in the same concentration on the carrier 1, and thus interassay fluctuations can be detected. Control areas 4 make it possible to compare results that were made on different devices or at different times even when the device has aged in the meantime (for example, the life of a PMT or CCD chip is limited). It can also Results are compared that are made with different parameter settings, such as voltage for the PMT, measurement time for the CCD chip, etc.

Alternatively, a dilution series of the control areas 4 can also be applied so that the measuring function can be determined. This determines the sensitivity, sensitivity, detection limit, linearity or the dynamic range of the measurement function; this enables comparability between different device types. These control areas 4 should of course be used for the markings used in each case. When using substances with a broader spectrum (wavelengths), the quality of the filters and other optical properties can also be compared.

The oligonucleotides for the orientation control can be present in concentrations in the range from 1 μM to 100 μM, in particular in the range from 1 μM to 50 μM, preferably in a concentration of 10 μM. The oligonucleotides for the amplification control can be in a concentration in the range between 0.1 nM to 0.5 mM, for example 1 nM to

100 μM. Concentrations in the range between 5 nM to 50 μM, in particular 10 nM to 10 μM, have also proven to be advantageous. The oligonucleotides for the hybridization control can be present in concentrations in the range between 0.1 nM to 500 μM, for example in the concentration range from 1 nM to 100 μM, in particular from 10 nM to 50 μM. Concentrations in the range between 25 nM to 25 μM, in particular 40 nM to 10 μM, have also proven to be advantageous.

Furthermore, oligonucleotides other than those specified above can be used for the control areas 4, e.g. Oligonucleotides as a positive control with a sequence complementary to the oligonucleotide primer sequence which is used for the amplification of the target nucleic acid sequence or oligonucleotides as a negative control with a sequence of other organisms which do not have the gene for coding the 16S rRNA.

The oligonucleotides can be present in the control areas 4 in dilution series, one concentration per control area 4 being used in each case. For this purpose, it has proven to be advantageous to use a factor selected from a range with a lower limit of 1.5, in particular 1.75, and an upper limit of 10, in particular 5, preferably with a factor of 3, for the concentration of the oligonucleotides Hybridization control and / or a factor selected from a range with a lower limit of 1.25, in particular 1.5, and an upper limit of 10, in particular 5, preferably with a Decrease factor 2 for PCR control between successive concentrations. The highest concentration of the oligonucleotides can be 500 μM, for example 250 μM, in particular 100 μM and preferably 10 μM. A dilution series can comprise 2 to 24 concentrations, for example 3 to 20 concentrations, in particular 4 to 18 concentrations. 5 to 15, in particular 6 to, have also proven advantageous

11, concentrations proved. The positive controls can also be in logarithmic dilution series.

The statements relating to the oligonucleotides for the control areas 4 can of course be appropriately transferred to the oligonucleotides for the analysis areas 3, so that only the corresponding concentrations or concentration ranges are given here. The concentration of the oligonucleotides in the analysis areas 3 are in the range from 100 nM to 1 mM, for example from 1 μM to 500 μM, in particular from 10 μM to 100 μM and preferably from 25 μM to 45 μM.

The oligonucleotides are preferably selected in volumes from a range with a lower limit of 1 pl, in particular 10 pl, preferably 200 pl and with an upper limit of 5 μl, in particular 1 μl, preferably 0.3 μl, per analysis region 3 and / or Control area 4 applied.

The arrangement of the oligonucleotides on the carrier 1 can be predefined. Each oligonucleotide can have an area of 50 to 500 μm in diameter, in particular from 200 to 250 μm.

Preferably, the surface 2 of the device used for the analysis, which e.g. B. can be designed as a slide for microscopy, an area of 0.1 cm ² to 50

9 9 9 9 cm, for example 0.5 cm to 40 cm, preferably 1 cm to 30 cm. As beneficial

Areas in the range between 1.5 cm to 20 cm, in particular 2 cm to 15 cm ^2, have also been found to be 9 9 9.

A preferred arrangement of the oligonucleotides with a low density enables simple hybridization conditions, such as. B. small temperature fluctuations, homogeneous buffer distribution, etc. and uncomplicated evaluation methods, because an overlap of signals is not normally expected. The oligonucleotides consist of sequences which are complementary to certain partial sequences of the target sequence and / or are complementary to at least one positive control.

The oligonucleotide for the hybridization control serves as proof of quality for the hybridization. For example, a partial sequence of the bacteriophage genome is inserted as a linker sequence at the 3'-end and the 5'-end is modified with the amino modifier C6 MMT mentioned. Any chemical compound which creates the necessary spatial distance and thus avoids any steric hindrances which may occur can also be used as a linker sequence.

The oligonucleotide for the orientation control can be used to determine or determine the orientation of the carrier 1 during the manufacture of the device or in later analysis steps. Furthermore, the orientation control for determining or setting the limits of the field to be evaluated, in particular defined by the analysis and control areas 3, 4, can be used on the carrier 1 and for checking the localization of the reading field. It can preferably be sequence-identical to the oligonucleotide of the hybridization control and additionally bears, for example, a label at the 3 'end, for example digoxigenin, biotin, radioactive labels, such as, for. B. ³³ P, or fluorescent dyes to deliver a well evaluable signal even without hybridization. The orientation control is preferably arranged in two control areas 4, which can be arranged at certain predefined locations on the support 1, for example during the application of these oligonucleotides.

The oligonucleotides for the control areas 4 and for the analysis areas 3 can be arranged in several areas of the device, for example in at least 2 areas, but also in 3, 4, 5, 6, 7, 8, 9 or 10 areas.

Due to the multiple arrangement of the same positive controls, both in different and in the same concentrations, normalization can be carried out within one or between different measurements. So z. B. by calculating a correction factor, the measurements in the analysis areas of a device can be compared with each other on one or more other devices. Of course, the measurements in the analysis areas can also be standardized on the same device by calculating a correction factor. To avoid the problem that you can only measure the signal, but actually only on the analyte concentration A calculation example is of interest in the following, the analyte concentration being linked to the signal strength by a calibration function in a simplified form.

An additional signal can come from a cross-reactant. It follows from this: signal

(Analyte) = calibration function [analyte concentration] + signal (cross-reactants). The signal of a cross reaction always refers to the given analyte and can even originate from several cross reactants.

A simple additive model determines that (signal of the cross-reactants for the analyte a) = sum [Kai * signal (cross-reactant /)], where Kai is a selectivity coefficient which indicates to what extent the cross-reactant i contributes to the signal of the analyte a , This coefficient must be redefined for each combination of analytes.

If you assume a simple linear calibration function in the first approximation and

Neglected cross-reactants, the following equation results: Signal (analyte) = K * analyte concentration + offset. The factor K is made up of a number of factors that result from the individual analysis steps, e.g. K = isolation efficiency * PCR efficiency * hybridization efficiency * labeling efficiency * signal amplification yield * print quality * measurement function

In contrast, it is hoped in gene expression experiments to compensate for the differences resulting from the different efficiencies of the individual steps by forming the ratio between two analyzes carried out under the same conditions, e.g. Signal (analyte (A)) / (analyte (B)) = [K * analyte concentration (A)] / [^ analyte concentration (B)] = analyte concentration (A) / analyte concentration (B).

However, it has been shown in practice that not all differences can be compensated for in this way. By determining the efficiency of the individual steps, more complex models can be created, whereby an improvement in the standardization or quantification is also possible in gene expression experiments.

Since no reference samples are available when using microarrays in genotyping, the control of the individual steps is of the utmost importance. Oligonucleotides such as e.g. B. the orientation control and / or the PCR control and / or orientation control in the same analysis or control area 3.4, as the target nucleic acid sequence are present and by their different labeling such. B. different dye derivatives can be distinguished during the detection.

The oligonucleotides are hybridized with nucleic acid sequences of the target sequence and subsequently generate a signal. Since an oligonucleotide sequence is preferably arranged in several regions on the device, only those hybridized oligonucleotides for which more than one signal can be observed are preferably and positively evaluated, as a result of which the safety and the reproducibility of the result can be improved.

The negative control is a control area 4 on the surface 2 of the support 1, to which no oligonucleotide is bound. This makes it possible to detect non-specific adhesions of various nucleic acid sequences.

The oligonucleotides of the analysis areas 3 and / or control areas 4 are mixed with the hybridization control in a certain ratio before application to the support 1. The ratio of the oligonucleotides to the hybridization control can be in a ratio of 1: 1 to 1: 100. The mixing ratio of 1:10 has proven to be advantageous. The hybridization control serves as a control of the hybridization that has taken place for each individual analysis and / or control area 4. False negative results can be excluded by means of the hybridization control. To differentiate in the later detection, for example, the target nucleic acid sequence can be labeled with a different dye derivative than the hybridization probe sequence, and therefore the signal of the target nucleic acid sequence can be evaluated from the signal of the hybridization probe by z. B. a different color can be distinguished. The hybridization probe is a nucleic acid sequence complementary to the hybridization control and can be labeled, for example, with various dye derivatives such as, for example, Cyl, Cy 2, Cy 3, Cy 4 and / or Cy 5. It is also advantageous that if there is no hybridization with a complementary target nucleic acid sequence, a signal, namely that of the hybridization probe, can be detected, whereby it can be ascertained that the missing signal has not occurred due to an analysis method error.

After the oligonucleotides have been attached in the control or analysis areas 3, 4, the unbound oligonucleotides are removed from the support 1. The unbound Oligonucleotides can be removed by washing the carrier 1 in an SDS solution with a concentration in the range from 0.01% to 2%, in particular in the range from 0.1% to 1%, preferably in a concentration of 0.2% , The detergent remaining on the surface 2 of the carrier 1 is washed with a washing liquid, such as. B. water, PBS, TE, etc. removed. The carrier 1 is dried with air and in a liquid such as.

B. water, NaCl, preferably ethanol and / or PBS, immersed. Hydrogen-releasing reagents such as LiAlH ₄ , Na BtLj, etc. are added to the solution in an amount of 0.001 g to 0.5 g, in particular 0.01 g to 0.25 g, preferably 0.01 g to 0.1 g Volume of 500 ml, preferably 100 ml, in particular 50 ml, added. A volume of 40 ml, in particular 30 ml, has proven to be advantageous. The different washing steps take place at a temperature in a range from 0 ° C. to 100 ° C., in particular from 10 ° C. to 98 ° C., preferably from 20 ° C. to 95 ° C.

In the following, DNA sequences of possible oligonucleotides of the target nucleic acid sequences or the positive controls from 5 'to 3' are listed:

Target organism: Actinobacillus actinomycetemcomitans

SEQ ID No 3 TCGATTTGGGGATTGGGGTTTAGCCCTGGTGCC

Target organism: Actinomyces odontolyticus

SEQ ID No 4 GGCACTAGGTGTGGGGGCCACCCGTGGTTTCTG

Target organism: Actinomyces viscosus

SEQ ID No 5 GGCACTAGGTGTGGGGGGCCTTTTCCGGGTCTT

Target organism: Bacteroides forsythus

SEQ ID No 6 ATTACTAGGAGTTTGCGATATAGTGTAAGCTCT

Target organism: Campylobacter concisus

SEQ ID No 7 TATACTAGTTGTTGCTAAGCTAGTCTTGGCAGT Target organism: Campylobacter gracilis (Bacteroides gracilis)

SEQ ID No 8 TATACCGGTTGTTGCTGTGCTAGTCACGGCAGT

Target organism: Campylobacter rectus

SEQ ID No 9 TATACTAGTTGTTGCTTCGCTAGTCGAGGCAGT

Target organism: Capnocytophaga gingivalis

SEQ ID No 10 GATACTAGCTGTTTGGCGCAAGCTGAGTGGCTA

Target organism: Eikenella corrodens

SEQ ID No 11 TCGATTAGCTGTTGGGCAACTTGATTGCTTAGT

Target organism: Eubacterium nodatum

SEQ ID No 12 AGCACTAGGTGTCGGGCTCGCAAGAGTTCGGTG

Target organism: Fusobacterium nucleatum

SEQ ID No 13 ATTACTAGGTGTTGGGGGTCGAACCTCAGCGCC

Target organism: Peptostreptococcus micros

SEQ ID No 14 AGTGCTAGGTGTTGGGAGTCAAATCTCGGTGCC

Target organism: Porphyromonas gingivalis

SEQ ID No 15 ATTACTAGGAGTTTGCGATATACCGTCAAGCTT

Target organism: Prevotella intermedia

SEQ ID No 16 GATGCCCGCTGTTAGCGCCTHGCGCTAGCGGCT Target organism: Prevotella nigrescens

SEQ ID No 17 GATGCCCGCCGTTGGCCCTGCCTGCGGCCAAGC

Target organism: Streptococcus constellatus

SEQ ID No 18 AGTGCTAGGTGTTAGGTCCTTTCCGGGACT AG

Target organism: Streptococcus gordonii

SEQ ID No 19 AGTGCTAGGTGTTAGGCCCTTTCCGGGGCTTAG

Target organism: Streptococcus mitis

SEQ ID No 20 AGTGCTAGGTGTTAGACCCTTTCCGGGGTTTAG

Target organism: Treponema denticola

SEQ ID No 21 T ACACTAGGTGTCGGGGC AAGAGCTTCGGTGCC

Target organism: Veillonella parvula

SEQ ID No 22 GGTACTAGGTGTAGGAGGTATCGACCCCTTCTG

PCR control

SEQ ID No 23 TCGACTTGGAGGTTGTGCCCTTGAGGCGTGGCT

Hybridization and orientation control

SEQ ID No 24 ACGTCAGCCACCATTACATCCGGTGAGCAGTCA

hybridization probe

SEQ ID No 25 GACTGCTCACCGGATGTAATGG For the hybridization, single-stranded nucleic acids can be used which are either obtained from double-stranded nucleic acid sequences by denaturation or which have already been produced from single-stranded nucleic acid sequences, advantageously by amplification with a primer gradient. The primer gradient can represent a ratio of the forward primer to the reverse primer of 1: 100, preferably 1:50, in particular 1:10, and leads to an asymmetrical PCR. If only one primer is present during the amplification of the target nucleic acid sequence, single-stranded DNA molecules are produced, which are then available for hybridization on the DNA chip.

The target nucleic acid sequence is DNA or RNA isolated from a biological sample, such as. B. bacterial cells, viruses or eukaryotic cells. Tissue samples (blood cells, biopsies, etc.) and liquid samples (blood, saliva, urine, pleural or peritoneal fluid, etc.) can be used. All methods available can be used to isolate the nucleic acid. It is often desirable to amplify the target nucleic acid sequence before hybridization.

According to the invention, special new oligonucleotide primers of at least 15 base pairs in length, which are characterized in that they have newly defined consensus sequences for the 16S rRNA, were used for the analysis or identification of the above-mentioned types of bacteria

Hybridize gene of the amplified target nucleic acid sequences used.

The DNA sequences of these primers comprise at least 15 nucleotides of the sequences listed below from 5 'to 3'.

forward primer

SEQ ID No 1 GGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACG

reverse primer

SEQ ID No 2 CCCAACAYYTCACGACACGAGCTGACGACAGCCAT

The sequences of the primers and oligonucleotides which are mentioned here are given in the standard IUB / IUPC nucleic acid code. The reverse primer listed above contains the symbol Y. In accordance with the standard terminology for the use of degenerate sequences, Y stands for C and T. Y indicates nucleotide permutations in "wobble" regions of the sequences. The reverse primer is therefore used as a degenerate primer set with C and T as suitable nucleotides for the Inkoφoration provided in the Woobleregions.

The primers, especially the reverse primer, are marked for signal detection. These markings can e.g. B. digoxigenin, biotin, radioactive labels such as ³³ P, fluorescent dyes such as Cy 1, Cy 2, Cy 3, Cy 4, and / or Cy 5, etc. or a combination thereof. Any other marking system can also be used. Of course, this also applies to all the markings mentioned in this description. For example, the nucleotides used for the amplification can already be marked. Of course, the oligonucleotides on the support 1 can also be labeled with digoxigenin, biotin, radioactive labels, such as P, fluorescent dyes, etc. The marked reverse primer is therefore a component of each double-stranded amplicon, as well as the single-stranded amplicon produced by the asymmetric PCR.

These primers can be used to amplify both gram-negative and gram-positive bacteria nucleotide sequences. The amplified nucleic acid sequences can be used directly for the hybridization, which means that purification steps can be saved.

The oligonucleotides on the support 1 form stable hybrid duplex with complementary base pairing with the, in particular amplified, target sequence. In order to achieve a uniform and specific hybridization on the carrier 1, the carrier 1 can be selected over a period of time from a range with a lower limit of 1 minute, in particular 2 minutes and an upper limit of 30 minutes, in particular 20 minutes, preferably 5 Minutes, at a temperature selected from a range with a lower limit of 20 ° C, in particular 30 ° C, and an upper limit of 95 ° C, in particular 75 ° C, preferably at 60 ° C. The labeled amplification products can be in different

Volumes selected from a range with a lower limit of 0.5 μl, in particular 1 μl, and an upper limit of 20 μl, in particular 15 μl, preferably in a volume of 5 μl for hybridization in a solution consisting of sodium citrate and / or NaCl can be used. The applied to the carrier 1 solution with the amplificates can, for. B. with wax, oil, glass plates, etc., are layered over to ensure uniform conditions, such as maintaining a constant temperature and / or a constant air humidity. The incubation can take place at temperatures in a range from 20 ° C. to 75 ° C., in particular from 30 ° C. to 70 ° C., and preferably at 50 ° C. to 60 ° C. for a period of from 1 minute to 4 hours, for example 3 minutes to 3 hours, preferably from 5 minutes to 1 hour, and especially from 10 minutes to 15 minutes. The nucleic acid sequences which do not form a hybrid duplex are washed away under stringent conditions and the hybridized nucleic acid sequences which are analyzed remain on the support 1.

Nucleic acids are denatured by increasing the temperature or lowering the salt concentration of the buffer. Under low stringent conditions, such as low temperature and high salt concentration, duplexes even form which do not have an exactly complementary sequence. This reduces the specificity of hybridization under low stringent conditions. Under highly stringent conditions such as high temperature and low salt concentration in the buffer, the specificity of the hybridization is increased. The unbound target sequences can be removed with a solution consisting of sodium citrate and / or NaCl in a first step at temperatures from 40 ° C. to 75 ° C., in particular from 45 ° C. to 70 ° C. and preferably at 50 ° C. to 60 ° ° C. In a further step, the same solution is used at temperatures to select from a range with a lower limit of 4 ° C., in particular 8 ° C., and an upper limit of 30 ° C., in particular 20

° C washed. Both the hybridization and the subsequent washing steps can be carried out under the same, highly stringent conditions in order to achieve high specificity and thus unambiguous evaluation.

The hybridized nucleic acid sequences can be detected by means of the label which is introduced into the target nucleic acid sequences and or into the oligonucleotides. The markers are preferably already incorporated into the target sequence during the amplification. It can e.g. B. during the PCR labeled primers or labeled nucleotides can be used. Alternatively, the marker can also be attached directly to the target sequence or after amplification, e.g. B. by nick translation or end marking, such as. B. Kinination of the nucleic acid sequence and subsequent ligation of a linker that connects the nucleic acid sequence with the marker. Markings can be detected using spectroscopic, photochemical, biochemical, immunochemical, electrical, optical, chemical or the like methods. The evaluation of the carrier 1 can take place, for example, by measuring the intensity of a certain light wavelength after excitation of a fluorescent molecule with at least approximately, preferably by means of a laser, generated monochromatic light. In this measurement, the location data (coordinates), such as the location and the limits of the reading field, can also be coordinated with the measured intensities depending on the wavelength by means of the oligonucleotides for the orientation control on the read-in carrier 1. The reader used is equipped with two different lasers. The lasers and photomultipliers are matched for the dye derivatives Cy3 and Cy5 used. Operation and software acquisition is part of the device operation. The result of the hybridization is obtained by querying the light intensities measured with the reader in the

Analysis and control areas 3.4.

Depending on the labeling of the specific binding partner or the analyte, optical, electrical, electrochemical, magnetic, photochemical, photoelectric or enzymatic detection and measurement methods can also be used. These methods can of course also be combined with one another. For example, unlabeled binding partners or analytes can also be detected using surface plasmon resonance technology.

embodiment

The production of a device according to the invention in the form of a DNA chip is described below. The preparation of the DNA chip blank of the carrier 1 takes place at room temperature. All oligonucleotides to be applied are provided in a master plate in 150 μl portions for the nanoplotter. At the same time, this mast plate serves for storage. All DNA oligonucleotides are dissolved in 10% DMSO. 350 pl per oligonucleotide are applied per spot (location of the probe placement on the DNA chip). The resulting spot forms a circular area with a diameter of 300 μm and contains about 10 fmol oligonucleotide for the analysis areas 3 and 1 fmol oligonucleotide for the control areas 4. The orientation control is carried out in a concentration of 100 μM, the hybridization control in a concentration of 0. 8 μM to 80 μM and the PCR control applied in a concentration of 0.1 nM to 100 μM. In the analysis areas 3, the oligonucleotides are applied complementarily to the target sequences in the concentration of 100 μM of the corresponding oligonucleotide and 0.5 μM of the hybridization control. Excess oligonucleotides are washed off the DNA chip by washing for 5 minutes followed by a short swivel) in 0.1% SDS at 60 ° C. Immediately afterwards, the DNA chip is immersed in 94 ° C. warm H ₂ O for 5 minutes. After removing any water drops with an air spray, the DNA chip is completely dried at room temperature. A five-minute immersion bath in 0.01 g NaBH ₄ per 40 ml PBS and 20 ml ethanol completes the process of covalently binding the oligonucleotides to the chip and deactivates unused reactive groups. Before storage, the DNA chip is immersed again in warm H ₂ 0 for 10 seconds and dried with compressed air. Storage is protected from light at 4 ° C.

An example of a possible arrangement of the oligonucleotides is shown below.

However, it is also possible to use any other arrangement variants chosen for the design of the DNA chip.

The oligonucleotides for the positive control for determining the orientation of the support 1 can, for example, at the points of intersection of the first column with the first and last

Row and at the intersection of the last column with the last row. The oligonucleotides for positive controls for hybridization can, for example, be arranged in decreasing concentration in the first column at the intersection with the second row starting from the penultimate row. The oligonucleotides for the positive control for determining the quality of the PCR can, for example, in increasing concentration on

Intersection of the first row with the second column starting at the last column. The negative control can be arranged, for example, beginning at the intersection of the last row with the second column up to the last column. The oligonucleotides complementary to the target sequence are arranged alternately in every second analysis area 3, for example. The analysis areas 3 extend, for example, from

Intersection of the second row with the second column to the intersection of the penultimate row with the last column. The oligonucleotides of the same nucleotide sequence, which are complementary to the target sequence, occur with up to three repetitions in different analysis areas 3.

DNA extraction

Total DNA is isolated from clinical samples. This is done using commercially available kits (e.g. QIAGEN GmbH, Hilden, Germany) in accordance with the manufacturer's instructions. PCR amplification

The amplification of the target nucleic acid sequences can be carried out as described below as an implementation example. 1/10 to 1/1000 of the totally prepared DNA are amplified. For this, 2 ul 10-fold PCR buffer (100 mM Tris-HCl; pH 8.3; 500mM KC1;

15 mM MgCl ₂ and 0.01% gelatin; Sigma), 2 ul 25 mM MgC12 (Sigma); 0.2 μl dNTP's mix (25 mM dATP, dGTP, dCTP, dTTP), forward primer to a final concentration of 0.05 μM and reverse primer to 0.5 μM were added. In addition, Escherichia coli DNA with a final concentration of 10,000 copies of 20 μl and 1 unit Taq polymerase (Sigma) is added and made up to a final volume of 19.5 μl with HO. The DNA, dissolved in one

Volume of 0.5 μl is finally added to the reaction mix. The amplification takes place in a thermal cycler from Perkin Elmer (Gene Amp PCR System 9700). 0.2 ml MicroAmp ^® reaction tubes are used. The temperature steps required for the amplification proceed as follows. The first step is a 5 minute denaturation phase at 94 ° C, followed by 30 cycles with 40 seconds at 94 ° C, 60 seconds at 62 ° C and 40 seconds at 72 ° C. The cycles are followed by an extension phase of 5 minutes at 72 ° C. An amplification product of approximately 300 base pairs is formed, depending on the sequence of the particular type of bacteria amplified. The description of the amplification is not to be seen as restrictive, and alternative amplification conditions can of course also be selected. The amplificate is used directly for hybridization or previously cleaned using commercially available kits (e.g. QIAGEN GmbH, Hilden, Germany) in accordance with the manufacturer's instructions.

hybridization

In order to ensure a uniform and specific hybridization on the DNA chip, the DNA chip for the hybridization is pretreated as follows. A pre-incubation takes place for 10 minutes at 80 ° C and saturated air humidity. During this time, 10 μl of the hybridization solution (1 × SSC (150 mM sodium chloride, 15 mM sodium citrate, pH 7) and 10 fmol / μl hybridization probe) are mixed with 10 μl PCR amplificate in a DNAse-free reaction vessel at room temperature. After the pre-incubation period, the hybridization mixture is pipetted into the hybridization area on the chip and immediately covered with a cover slip. Hybridization takes place during a 20 minute incubation at 50 ° C and saturated air humidity. detection

After the hybridization has taken place, the cover slip is removed and the DNA chip is immediately immersed in a washing solution (1 × SSC (150 mM sodium chloride, 15 mM sodium citrate, pH 7). After briefly swirling, the incubation is carried out at 40 ° C. for 2 minutes Any liquid residues are removed from the chip surface 2 with compressed air. The dry DNA chip can be stored protected from light at room temperature for a few days until evaluation with the reader. The DNA chip is inserted into the scanner (Genepix 4000A from Axon Instrument) and measured by excitation of the Cy3 and Cy5 dye molecules with monochromatic light.

This exemplary embodiment is not to be viewed in a restrictive manner, and the reagents specified therein can of course be contained in concentrations selected from the respective ranges mentioned in the description or alternative reagents for this.

For the sake of order, it should finally be pointed out that, for a better understanding of the structure of the device for analyzing target nucleic acid sequences, these or their constituents have been shown partially to scale and / or enlarged and / or reduced.

The object on which the independent inventive solutions are based can be found in the description.

REFERENCE NUMBERS

Carrier surface Analysis area Control area

Claims

Patent claims

1. An apparatus for analyzing at least one analyte from a sample comprising a support with a surface on which at least one predefinable analysis area and at least one predefinable control area are arranged, wherein at least one first binding partner that is specific to at least one analyte is immobilized in the predefined analysis area binds, characterized in that in the at least one control area (4) at least one further binding partner for at least one control for determining the quality of the analysis is immobilized.

2. Device according to claim 1, characterized in that the carrier is plate-shaped, such as. in the form of a slide, platelet-shaped with depressions, e.g. in the form of chamberslides, or in the form of a microtiter plate according to dimensions in accordance with the recommendations of the SBS (Society of Biomolecular Screening).

3. Device according to claim 1 or 2, characterized in that the at least one analyte and / or the specific binding partner from a group comprising nucleic acids, such as. DNA, RNA, PNA (peptide nucleic acids), proteins, e.g. Antibodies, epitopes, antigens, scaffold proteins, fusion proteins, in particular recombinant fusion proteins, signal proteins, transmitters, enzymes, substrates, hormones, peptides, lipids, carbohydrates, such as e.g. Mono-, di-, oligo- and polysaccharides, and their modified forms is selected.

4. Device according to one of the preceding claims, characterized in that the at least one control for determining the orientation of the carrier (1) in one

Analysis device is formed.

5. Device according to one of the preceding claims, characterized in that the at least one control is designed to detect the binding of the at least one analyte to the first and / or further binding partner.

6. Device according to one of the preceding claims, characterized in that the at least one control for determining the quality of the amplification, such as polymerase chain reaction (PCR), ligase chain reaction (LCR), transcription-mediated amplification (TMA), reverse transcriptase PCR (RT-PCR), Q-beta replicase amplification tion, NASBA (nucleic acid sequence-based amplification), single-strand displacement amplification or amplicon vectors.

7. Device according to one of the preceding claims, characterized in that the at least one control for detecting the origin of the sample from which the

Analyte is detected, and / or the at least one analyte is formed.

8. Device according to one of the preceding claims, characterized in that the at least one control is designed to determine cross-reactions of the at least one analyte with a further analyte and / or the at least first and / or the at least one further binding partner.

9. Device according to one of the preceding claims, characterized in that the at least one control for detecting contamination of the sample, from which the at least one analyte is detected, and / or the at least one analyte is formed.

10. Device according to one of the preceding claims, characterized in that the at least one control is designed to demonstrate the efficiency of the isolation of the at least one analyte.

11. Device according to one of the preceding claims, characterized in that the at least one control is designed to determine the intensity gain of the detection signal.

12. Device according to one of the preceding claims, characterized in that the at least one control is designed to determine the immobilization effectiveness of the first and / or further binding partner.

13. Device according to one of the preceding claims, characterized in that the at least one control is designed to demonstrate the efficiency of the marking of the first and / or further binding partner.

14. Device according to one of the preceding claims, characterized in that the at least one control for detecting the sensitivity and linearity of the detecti onsystem (calibration) is formed.

15. Device according to one of the preceding claims, characterized in that at least one negative control is arranged on the carrier (1) in a predetermined area of the surface (2).

16. Device according to one of the preceding claims, characterized in that the at least one analyte and / or the at least one control are present as dilution series with different concentrations, wherein in each case a concentration of the dilution series in a predeterminable analysis or control area (3, 4) is present.

17. Device according to one of the preceding claims, characterized in that the concentrations of the at least one binding partner in the dilution series with a factor selected from a range with a lower limit of 1.5, in particular 2, preferably 3, and an upper limit of 100, especially 30, preferably decrease by a factor of 10.

18. Device according to one of the preceding claims, characterized in that a predetermined concentration of the at least one binding partner and / or the at least further binding partner is present multiple times in different analysis areas (3) or control areas (4) on the carrier (1).

19. Device according to one of the preceding claims, characterized in that several binding partners for the analytes and that at least one further binding partner for the control on the support (1) are arranged in columns and rows, in particular different binding partners for the analytes in adjacent areas and the other binding partners for the controls are arranged in the same and / or in different concentrations in adjacent areas of the columns and rows.

20. Device according to one of the preceding claims, characterized in that several of the first binding partners are arranged in a plurality of analysis areas, the binding partners being selected specifically for at least one bacterium associated with periodontitis, in particular periodontitis.

21. The apparatus according to claim 20, characterized in that the bacterium associated with periodontitis, in particular periodontitis, from a group comprising Actinobacillus actinomycetemcomitans, Actinomyces odontolyticus, Actinomyces viscosus, Bacteroides forsythus, Campylobacter concisus, Campylobacter gracilis (Bacteroides gracilis) , Capnocytophaga gingivalis, Eikenella corrodens, Eubacterium nodatum, Fusobacterium nucleatum, Peptostreptococcus micros, Poφhyromonas gingivalis, Prevotella intermediate, Prevotella nigrescens, Streptococcus constellatus, Streptococcus gordonis parula, or selected streptocella celiac vertebrae, Streptocponcus parula

22. Device according to one of the preceding claims, characterized in that the sequence of the at least one positive control is selected from a group of sequences which can be hybridized with a nucleic acid sequence which consists of at least one oligonucleotide primer consisting of the DNA sequence 5'-AACAGGATTAGATACCCTGGTAGTCC - 3 'and / or an oligonucleotide primer consisting of the DNA sequence 5' - CAYYTCACGACACGAGCTGACGACA - 3 'and / or an oligonucleotide primer consisting of at least 15 consecutive nucleotides of the DNA sequence 5'-GGGGAGCAAACAGGATTAGATACCCTGGTAGTID / or consisting of at least one and 3' 15 consecutive nucleotides of the DNA sequence 5 '- CCCAACAYYTC ACGACACGAGCTGACGACAGCCAT - 3' is amplifiable.

23. Device according to one of the preceding claims, characterized in that the target nucleic acid sequence is selected from sequences which have at least one oligonucleotide primer consisting of the DNA sequence 5 '-AACAGGATTAGATACCCTGGTAGTCC - 3' and / or an oligonucleotide primer consisting of the DNA sequence 5 '- CAYYTCACGACACGAGCTGACGACA - 3' and / or an oligonucleotide primer consisting of at least 15 consecutive nucleotides of the DNA sequence 5'-GGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACG - 3 'and / or an oligonucleotide primer consisting of at least 15 sequential nucleotides

5'- CCCAACAYYTCACGACACGAGCTGACGACAGCCAT - 3 'is amplifiable.

24. Method for amplifying at least one target nucleic acid sequence, in particular by means of polymerase chain reaction (PCR), ligase chain reaction (LCR), transcription-mediated amplification (TMA), reverse transcriptase PCR (RT-PCR), Q-beta replication Kase amplification, single-strand displacement amplification or amplicon vectors, characterized in that for the amplification at least one oligonucleotide primer consisting of the DNA sequence 5'- AACAGGATTAGATACCCTGGTAGTCC - 3 'and / or an oligonucleotide primer consisting of the DNA sequence

5'- CAYYTCACGACACGAGCTGACGACA - 3 'and / or an oligonucleotide primer consisting of at least 15 consecutive nucleotides of the DNA sequence 5'- GGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACG - 3' and / or an oligonucleotide primer consisting of at least 15 DNAGAACACACACACACACACACACACACACACGACAC - AGAC- 5AC ' is used.

25. The method according to claim 25, characterized in that several target nucleic acid sequences for different types of bacteria are amplified simultaneously.

26. The method according to claim 24 or 25, characterized in that a target nucleic acid sequence of the gene for a 16S rRNA of the bacterial species or partial sequences thereof are amplified.

27. The method according to any one of claims 24 to 26, characterized in that for the amplification digoxigenin, biotin, radioactive labels, such as. B. ³³ P, fluorescent dye-labeled oligonucleotide primers or nucleotides and / or labels that are detected with optical, electrical, electrochemical, magnetic, photochemical, photoelectric or enzymatic detection methods can be used.

28. A method for identifying at least one target nucleic acid sequence comprising the steps of sample preparation, amplification, labeling, hybridization of complementary sequences to an oligonucleotide and detection of the hybridization signal, characterized in that amplificates are generated which are amplified using a method according to one of the claims 12 to 15 can be produced.

29. The method according to claim 28, characterized in that the amplificates bind to at least one oligonucleotide for at least one positive control and at least one target nucleic acid sequence on the same support.

30. Oligonucleotide primer with a nucleic acid sequence, characterized in that the nucleic acid sequence is a DNA sequence from a group consisting of the Se- sequences 5'-AACAGGATTAGATACCCTGGTAGTCC - 3 ',

5'- CAYYTCACGACACGAGCTGACGACA - 3 ', from at least 15 consecutive nucleotides of the DNA sequence

5'- GGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACG - 3 'or from at least 15 consecutive nucleotides of the DNA sequence

5'- CCCAACAYYTCACGACACGAGCTGACGACAGCCAT - 3 '.

31. Analysis kit comprising a device for analysis and at least one oligonucleotide primer for the amplification of at least one target nucleic acid sequence, characterized in that the device is formed according to one of claims 1 to 23 and / or the oligonucleotide primer according to claim 30.

32. Use of the device according to one of claims 1 to 23 for the identification of analytes.

33. Use of the device according to one of claims 1 to 23 for the identification of analytes of periodontitis-associated bacterial species and / or for the identification of analytes for the detection of gene expression patterns and / or for the identification of analytes for the detection of single nucleotide polymorphism (SNPs ).

34. Use of the analysis kit according to claim 31 for the identification of analytes.

35. Use of the analysis kit according to claim 31 for the identification of analytes of periodontitis-associated bacterial species and / or for the identification of analytes for the detection of gene expression patterns and / or for the identification of analytes for

Detection of single nucleotide polymorphism (SNPs).