WO2004031382A1 - Novel method of constructing monoclonal antibody - Google Patents

Abstract

It is intended to obtain hybridoma cells with the use of mouse lymph node cells and provide a process for producing a monoclonal antibody. Namely, a process for producing a mouse monoclonal antibody characterized by comprising the following steps (a) to (d): (a) the step of mixing an antigen with an oligonucleotide containing an unmethylated cytosine-guanine dinucleotide motif; (b) the step of priming a mouse by administering, at least into the food pad of the mouse, the mixture of the antigen with the oligonucleotide containing the unmethylated cytosine-guanine dinucleotide motif; (c) the step of separating a lymph nod from the mouse and fusing cells originating in the lymph nod with myeloma cells to give hybridomas; and (d) culturing the thus obtained hybridomas and harvesting an antibody from the culture supernatant.

Description

 Detail

 Method for producing a novel monoclonal antibody

 The present invention relates to a method for producing a mouse monoclonal antibody, a method for producing a hybridoma that produces an antibody having reactivity to a specific antigen, and a method for inducing an immune response to a specific antigen in mice.

Background art

Conventionally, to obtain an antibody, a method has been used in which an antigen is injected into an animal such as a rabbit, and the target antibody is purified from a mixture of a plurality of antibodies contained in the serum. With this method, it was difficult to obtain only the target antibody efficiently and in large quantities. In 1975, Keller et al. Developed a method for producing a monoclonal antibody for cell fusion, and it was possible to obtain a large amount of only the desired antibody efficiently (Kohler, G. et al., Nature, Vol. 256, pp. 495, 1975). In general, mouse monoclonal antibodies are prepared by mixing the antigen with complete Freund's adjuvant (FCA), subcutaneously or intraperitoneally, and using spleen-derived cells for cell fusion ( Cheap W

Higashi et al., “Introduction to Single-Clone Antibody Experimental Procedures”, Kodansha Scientific, January 1991, p.48-53; John E. Coligan, “Current Protocols in Immunology”, Current Protocols, 1991, UNIT 2.5, pi — 17). In this case, multiple boosters must be performed after the first immunization to raise the antibody titer and obtain the desired antibody of IgG type, and the immunization must be performed for at least one month. (Ando et al., “Introduction to Single-Clone Antibody Experimental Procedures”, Kodansha Scientific, January 1991, p. 3). When the spleen is used for cell fusion, the probability of obtaining a hybridoma producing the desired antibody is not high even if the cell fusion is performed.

In rats, the first dose is administered into the photonode, and the lymph node-derived cells are used for cell fusion with Mie-mouth, a hybrid to produce the desired antibody. It is generally known that one horse can be obtained with high efficiency. However, since no method has been established in mice to surely enlarge the lymph node by immunization, it is a common practice to use the spleen for cell fusion. Also, the efficiency of monoclonal antibody production is greatly affected by the nature of the antigen. The conventional method for producing monoclonal antibodies in mice is once In some cases, the desired antibody cannot be obtained by cell fusion.In such a case, it is necessary to try cell fusion multiple times by changing conditions such as the immunization period and the amount of antigen. There was an inefficiency in terms (John E. Coligan, ¹ Current Protocols in Immunology, "Current Protocols, 1991, UNIT 2.5, P16). For such antigens for which antibody production is difficult, it has been desired to establish a method for obtaining the desired antibody without trial and error.

 Oligonucleotides containing the unmethylated cytosine-guanidine dinucleotide motif (CpG oligonucleotides) are frequently found in Bacteria-derived DNA, It is known that vertebrates exhibit a leukocyte activating effect (Krieg A, Nature, 374, 546-549, 1995). Unmethylated cytosine-guanine dinucleotide motifs are common in bacterial DNA, but are rare in vertebrate DNA, and the vertebrate immune system is associated with unmethylated cytosine-guanidine dinucleotides. It is thought to have evolved to recognize DNA containing the motif as a sign of infection.

CpG oligonucleotides are being studied for use as adjuvants, and optimization of sequences to enhance immunostimulatory effects has been studied (international studies). Published 9 6/0 2 5 No. 55 pan fret, International Publication No. 98/41010 Pan fret, International publication No. 98/18810 pan fret, International Published No. 996-61 No. 6 Pamphlet). CpG oligonucleotide is also commercially available as an adjuvant for producing antibodies in mice. The manual for commercial products states that cell fusion uses the spleen, and that intravenous administration is not recommended because it does not have any beneficial effects. (“ImmunEasy ^™ Mouse Adjuvant Handbook”, QIAGEN, January 2001, p.8_10).

The problem to be solved by the invention,

 If cell fusion using lymph node-derived cells becomes possible in mice, it would be possible to obtain monoclonal antibodies with high efficiency and in a short period of time, and efficiently even for antigens for which antibody production is difficult. Be expected. However, it is possible to reliably enlarge the lymph node with a normal amount of antigen and irrespective of the type of antigen, and an immunization method that enables cell fusion using lymph node-derived cells has been established. Had not been done.

Means for solving the problem

The present invention has been made to solve the above-mentioned problems in the prior art. By conducting initial research and using the CpG oligonucleotide as an adjuvant and performing the first immunization in the mouse peptide, the mouse is always irrespective of the type of antigen. It has been found that the lymph node can be enlarged and cell fusion using lymph node-derived cells can be performed.

 The present invention provides a mouse monoclonal antibody, characterized in that CpG oligonucleotide is used as an adjuvant and the first immunization is performed in a mouse footnode. It is intended to provide a production method, a method for producing a hybridoma that produces an antibody reactive with a specific antigen, and a method for inducing an immune response to a specific antigen in mice.

Embodiment of the Invention

The method for producing a mouse monoclonal antibody of the present invention comprises the steps of: using an oligonucleotide containing an unmethylated cytosine-guanidine dinucleotide motif as an adjuvant; By using the cells derived from mouse lymph node immunized against a specific antigen by performing in a pad, a hybridoma is obtained by a cell fusion method, and the desired identification is performed. A mouse monoclonal antibody reactive with an antigen is obtained. The method for producing the mouse monoclonal antibody of the present invention is as follows.

(a) mixing the antigen with an oligonucleotide containing a non-methylated cytosine-guanine dinucleotide motif; (a) mixing the antigen with an oligonucleotide described in (a) to (d); (B) administering a mixture of the antigen and an oligonucleotide having a non-methylated cytosine-guanidine dinucleotide motif at least into the footpad; (C) isolating the lymph node from the mouse and fusing the lymph node-derived cells with myeloma cells to obtain a hybridoma; (d) obtaining the hybridoma. A step in which the hybridoma is cultured and the antibody is recovered from the culture supernatant. These steps are described in detail below. The method of the present invention for inducing an immune response against a specific antigen in a mouse is characterized by the following steps (a) and (b): (a) an antigen and a non-methylated cytosine-guanine dinu nu Mixing the oligonucleotide with the oligonucleotide containing the motif; (b) the antigen and the oligonucleotide containing the unmethylated cytosine-guanidine dinucleotide motif; Priming a mouse by administering the mixture with at least the Footnod S. These steps are described in detail below I do.

 The method for inducing an immune response to a specific antigen in a mouse of the present invention can include, in addition to the above steps, (C) a step of confirming that an immune response to a specific antigen has been induced in the mouse. . Here, “inducing an immune response to a specific antigen” means, specifically, inducing the production of an antibody reactive with a specific antigen in a mouse. Induction of the production of an antibody reactive with a specific antigen in a mouse means that a large amount of B cells that produce an antibody reactive with the specific antigen appear in the mouse body. is there.

The method for inducing an immune response against a specific antigen in the mouse of the present invention, which is characterized by the above steps (a) and (b), is particularly effective in stimulating lymph node cells. Within which a large number of B cells that produce antibodies reactive with a specific antigen appear. The result is observed as an enlarged lymph node. The hypertrophy Specifically, Ri per one mouse, it is with any kind of child even Ri rather small by lymph nodes 1 XI 0 ⁷ cells is Ru can get. To confirm that an immune response to a specific antigen was induced in mice, the mouse lymph node enlargement and / or The increase in the antibody titer in the serum against the original may be confirmed. More preferably, it is confirmed by fusing lymph node-derived cells with myeloma cells and obtaining a hybridoma that produces an antibody reactive with a specific antigen.

 A preferred embodiment of the method of the present invention for inducing an immune response against a specific antigen in a mouse is as follows: a method for inducing an immune response to a specific antigen in a mouse to enlarge lymph node, comprising: a) a method characterized by comprising the steps of (a) and (b); (a) mixing an antigen with an oligonucleotide containing a non-methylated cytosine-guanine dinucleotide motif. (B) administering a mixture of the antigen and an oligonucleotide containing an unmethylated cytosine-guanidine dinucleotide motif, at least in the foot knot. First immunization of mice.

The method of inducing an immune response to a specific antigen in the mouse of the present invention to enlarge the lymph node includes the above steps (a) and (b), and also includes the following steps (c) and / or (d) Niyotsu also characterized by; (c) Ri per one mouse, that can 1 XI 0 ⁷ cells also rather small Ri by any one of the lymph nodes in the acquisition this (D) hybridomas that produce antibodies reactive to a specific antigen can be obtained by fusing the obtained lymph node-derived cells with myeloma cells.

 In the method for producing a hybridoma of the present invention, the primary immunization is performed by using an oligonucleotide containing an unmethylated cytosine-guanidine dinucleotide motif as an antigen. It is a standard method in the field of monoclonal antibody production, using cells derived from the lymph node of a mouse immunized against a specific antigen by performing it in a tongue. A hybridoma producing a mouse monoclonal antibody reactive to a desired specific antigen is obtained using a cell fusion method.

The method for producing a hybridoma according to the present invention is characterized by the following steps (a) to (c): (a) an oligonucleotide containing an antigen and a non-methylated cytosine-guanine dinucleotide motif; Mixing the antigen with an oligonucleotide containing at least the antigen and an unmethylated cytosine-guanidine dinucleotide motif; at least a footprint of the antigen. (C) isolating the lymph node from the mouse, and lysing the lymph node-derived cells with myeloma cells. Stage to obtain high pre-doma.

 The method for producing a hybridoma of the present invention is not limited to the above steps.

(d) confirming that the obtained hybridoma produces an antibody against a specific antigen. These steps are described in detail below.

 The steps of characterizing the method for producing a monoclonal antibody, the method for inducing an immune response to a specific antigen in mice, and the method for producing a hybridoma of the present invention are described in detail below.

 Oligonucleotides containing a non-methylated ditocin-guanidine dinucleotide motif (CpG oligonucleotide) used in the present invention have immunostimulatory effects in vertebrates, particularly mice. It is characterized by having. There is no particular limitation on the form of the oligonucleotide as long as it has an immunostimulatory effect in mice and has at least one unmethylated cytosine-guanidine dinucleotide motif in the sequence. CpG oligonucleotides can be double-stranded or single-stranded. In general, double-stranded molecules are more stable in vivo, but single-stranded molecules have stronger immunostimulatory effects.

Oligonucleotides are defined as multiple nucleotides (ie, A sugar linked to a phosphate group and a base (either cytosine (C), thymine (T), peracyl (U)), adenine (A), or guanine (G)) (Eg, molecules containing ribose or deoxyribose) form a phosphate ester between the 3′-hydroxyl and 5′-phosphate groups of the sugar residue, resulting in a large number of nucleic acids. It is a nucleotide multimer formed of covalently linked leotides, and is synonymous with nucleic acid. Oligonucleotide includes Oligoliponucleide, and Oligodoxyribonucleotide. The term also includes polynucleosides (ie, polynucleotides excluding phosphoric acid) and any other organic base, including polymers. Nucleic acid molecules can be obtained from existing nucleic acid sources (eg, genomic or cDNA), but are preferably synthesized (eg, produced by oligonucleotide synthesis).

 An unmethylated cytosine-guanine dinucleotide motif is a nucleotide sequence that is present in an oligonucleotide in the order of (5'—) cytosine-guanine (13 '). This means that at least the carbon or nitrogen constituting the pyrimidine ring of cytosine is not substituted with a methyl group.

Nucleotide sequence of CpG oligonucleotide used in the present invention Has an immunostimulatory effect in mice and has at least one unmethylated cytosine-guanidine dinucleotide chief in the sequence, including, but not limited to, the following: Ru C p G O Li Gore j click Les Ochi de der that having a nucleotide sequence shown Ri by the _{formula: 5, N 1 X 1 X} 2 CGX 3 X 4 N 2 3 '; in here, CG is not been methylation; X iX ₂ is, GT, GG, GA, AA , AT, AG, CT, CA, CG, TA, TT, and nucleotide sequences der selected Ri by TG Tona Ru group X ₃ X ₄ is a nucleotide sequence selected from the group consisting of TT, CT, AT, TG, AG, CG, TC, AC, CC, TA, AA, and CA; N ₂ is composed of each 1-5 0 residues about any base sequence. Is preferred to rather than, X! X ₂ is _{X 3 X 4 GA, AA,} GG or GT, and its is a TT, Τ C or C Τ. In other preferred embodiments, X i or X ₂ or both are bleach and X ₃ or X ₄ or both are pyrimidines, or X i X ₂ is a GA, and X ₃ or X ₄ or both are pyrimidines. When using O Li Gore j click Reochi de skeleton Hosuhorochioe bets, and N ₂ are arbitrary CCG, it is that you do not include the base sequence will leave CGGCCGG or CGCG preferred. Suitable examples of CpG oligonucleotides that can be used in the present invention are known (eg, International Publication No. WO 96/025555, Publication No. 98/41010 Non-Patent, International Publication No. 98/18810 Panplate, International Publication No. Fret), and the sequence can be appropriately selected with reference to known techniques. A preferred example of the CpG oligonucleotide used in the present invention is an oligonucleotide consisting of a nucleotide sequence of TCCATGACGTTCCTGACGTT (SEQ ID NO: 3). The underlined portion indicates an unmethylated cytosine-guanidine dinucleotide motif.

The chain length of the CpG oligonucleotide used in the present invention has an immunostimulatory effect in mice and has at least one non-methylated cytosine-guanine dinucleotide in the sequence. It is not limited as long as it has a leotide motif, but preferably has a length of at least 8 residues or more. It is known that sufficient immunostimulatory effect may not be obtained if the length is 7 residues or less (WO 96/025555 Panflet). . Rather than the preferred Ri good is, 8 to; the L 0 0 range of about residues and N _2, respectively;! To about 50 residues), more preferably about 8 to 50 residues (（! And N _2). Are about 1 to 25 residues, respectively).

 The CpG oligonucleotide used in the present invention includes all kinds of derivatives, including those having a base, a sugar, a phosphoric acid, and a backbone structure, which do not exist in nature. Is included. Examples of the derivatives included in the present invention include phosphodiester bonds and phosphodiester bonds in whole or in part of the skeleton of the oligonucleotide. Hosphorothioate bond, methylphosphonate bond, phosphoroamidate bond, phosphoroamidate bond Derivatives with phosphorodithioate bonds, morpholino groups, etc. (Yoko Tokaibayashi, etc., Cancer and Chemotherapy, Vol. 20, 1989-199, pp. 19, 19) 93 years).

Also, Deoxylibonucleodoguanidine (DNG) (Robert P et al., Proc. Natl. Acad. Sci. USA, Vol. 92, p. However, examples of derivatives include those substituted with other atoms or substituents, and modified sugar moieties such as α-ribose (Bertrand JR. Biochem. Biophys). R es. 164, 311, 1989).

 In addition, those in which the sugar moiety is replaced by another substance, those in which some bases are replaced by inosine or universal bases (bases that bind to any of A, T, C, and G), Cholesterol, acridine, poly-L-lysine, psoralen, long-chain alkyl at the 5 'or 3' end or inside the oligonucleotide Oligonucleotide derivatives such as those to which the above are bonded are also included in the present invention (G. Degols et al., Nucleic Acid Research. Vol. 17, pp. 9341, 1989). A. Mc Connaghie et al., J. Med. Chem. 38, 348, p. 488, 1993 G. Godard, etc. E ur. J. Biochem. 404 page, 1995).

 The CpG oligonucleotide used in the present invention preferably has a modified backbone. Modification of the oligonucleotide backbone has effects such as enhancement of nuclease resistance, enhancement of cell uptake, and enhancement of protein binding, and contributes to enhancement of immunostimulatory effects. .

The CpG oligonucleotide used in the present invention can be produced by a known method (for example, Stanley T. Cr). ooke and Bernald Lebleu, eds. in Antisense Research and Ap ications, CRC Publishing, Florida, 1993). Typically, the synthesis is performed using a chemical synthesizer (for example, Expedite Model 809, manufactured by Applied Biosystems Japan Co., Ltd.). In this case, the operation is performed according to the manual attached to the chemical synthesizer, and the obtained synthetic product is purified by an HPLC method using reversed phase chromatography or the like. Thus, it is possible to obtain oligonucleotides.

The immunostimulatory effect of the CpG oligonucleotide used in the present invention can be evaluated by using a known method (for example, International Publication No. 98/18810 pan). Fret). The immunostimulatory effect is measured by measuring various immune parameters, for example, lymphocyte proliferation, B cell IgM antibody production, and cytodynamic protein production (eg, mouse spleen-derived B cells). Can be evaluated. For example, the growth measurement of the lymphocytes, the incorporation of ³ H © lysine of mouse spleen-derived B cell cultures and indicators, in C p G O Li Gore j click Reochi de presence and absence Measure cell proliferation. C p G Oligonucleotide — At least 2 times, preferably 5 times, as compared to oligonucleotides (oligonucleotides without the unmethylated cytosine-guanidine dinucleotide motif) More preferably, it has an immunostimulating effect of 10 times or more.

As the antigen used in the present invention, a desired antigen may be used, and the type thereof is not particularly limited. The specific antigen means one specified antigen, and is synonymous with a desired antigen. Antigens broadly include any type of molecule that is recognized as foreign by the host immune system. Examples of antigens include, but are not limited to: cells, cell extracts, proteins, polypeptides, peptides, polysaccharides, polysaccharide conjugates, peptide mimetics of polysaccharides, lipids, glycolipids , Carbohydrates, viruses, viral extracts and allergens. Preferably, it is a protein, polypeptide or peptide. The protein, polypeptide or peptide can be prepared from cells or tissues that express the protein, and can be prepared using a peptide synthesizer (for example, peptide synthesizer type 133A, It can be prepared by a chemical synthesis method using Dono Systems Japan Co., Ltd.) or by a recombinant method using an appropriate host cell selected from prokaryotes or eukaryotes. W

18 In the method of the present invention, the step of "mixing the antigen with an unmethylated cytosine-oligonucleotide containing a guanidine dinucleotide motif" comprises the step of adjuvanting the non-methylated cytosine. This is a step of mixing an oligonucleotide containing a cytosine-guanidine dinucleotide motif and a desired antigen prepared in advance for administration to a mouse. Since the adjuvant CpG oligonucleotide can be provided in an aqueous solution, there is no need for the step of forming an emulsion with an antigen unlike FCA. The solution containing CpG oligonucleotide and the solution containing the antigen may be mixed at an appropriate ratio. The ratio of CpG oligonucleotide to antigen can be appropriately adjusted depending on the type of CpG oligonucleotide and antigen used, but typically the weight ratio is The preferred range is CpG-oligonucleotide: antigen: = 2: 1 to 10: 1. In the case of CpG oligonucleotide having an appropriate immunostimulatory action, about 10 to 20 O ^ g per mouse may be used for one administration. In addition, in the method of the present invention, CpG oligonucleotide is used as an adjuvant, and the first immunization is carried out in a photonode, whereby lymphocytes are efficiently lysed. Large amounts of antigen are not required because the nodes can be enlarged. Protein antigen In this case, about 1 to 5 O ^ g per mouse may be used for one administration. In immunization, the number (mol) of antigens is important. In the method of the present invention, in the case of a peptide or protein antigen, it is possible to efficiently enlarge the lymph node with an antigen amount of 1 nmol or less. When administering to mice, it is preferable to administer a small amount of liquid, so that the liquid volume of the mixture of CpG oligonucleotide and antigen is 500 per mouse. It is prepared so as to be not more than L, preferably not more than 20 O ^ L.

Mixtures of CpG oligonucleotides and antigens include adjuvants other than CpG oligonucleotides and CpG oligonucleotides and antigens. It can also contain substances (resins, porous particles, etc.) that enable stabilization and sustained release in vivo. That is, the “mixture of an antigen and an oligonucleotide containing a non-methylated cytosine-guanidine dinucleotide motif” in the method of the present invention includes (a) an antigen, and (b) ) Means a mixture containing CpG oligonucleotides. Adjuvants other than CpG oligonucleotides include saponin, trehalose dimycocoat, lipopolysaccharide or a derivative thereof, lipid A or a derivative thereof, and FCA. , FIA, Myo Nonon, Hydroxya What is known by those skilled in the art, such as lumidium, can be used. It is preferable to use CpG oligonucleotide in combination with myo-nonon or hydroxylamine, because it can induce a high antibody titer without damaging mouse tissues.

 In the method of the present invention, "a mixture of an antigen and an oligonucleotide containing an unmethylated cytosine monoguanidine nucleotide motif is contained in at least a foot knot. Step of priming a mouse by administration ”will be described.

The method of the present invention is characterized by using at least a photonode as a route for administering an antigen to a mouse in the first immunization. In the conventional method for producing mouse monoclonal antibodies using spleen-derived cells for cell fusion using CpG oligonucleotide as an adjuvant, administration into the footnode is not effective. (“ImmunEasy ^™ Mouse Adjuvant Handbook”, QIAGEN, January 2001, p.8—10), however, the present inventor adjuvanted CpG oligonucleotide. By using at least a foot knot as a route of administration of the antigen to the mouse during the first immunization, the mouse lymph node can be efficiently enlarged. It was found that it was possible, and the mouse that used lymph node-derived cells for cell fusion was used. A method for producing a monoclonal antibody was completed.

 The footnode may be the forelimb or the hindlimb, but is preferably the hindlimb. The administration is preferably performed on both the left and right sides. In addition, as long as at least Photnode is used as the administration route, administration to other sites is also acceptable. Other sites include intramuscular, intraperitoneal, subcutaneous and intradermal.

 In a preferred embodiment, the method of the present invention provides for the mixture of the antigen and an oligonucleotide containing an unmethylated cytosine-guanidine dinucleotide motif with at least a foot. The step of priming a mouse by administering it into a pad '' refers to the step of priming in the step of priming, wherein the mouse is immunized intramuscularly, intradermally, subcutaneously, or intraperitoneally in addition to the footpad. The method is characterized in that a mixture of an antigen and an oligonucleotide containing an unmethylated cytosine guanidine dinucleotide motif is administered. In the case of intramuscular, particularly preferred is in the thigh muscles of both limbs. By combining the intra-footpad and intra-thigh muscle administration in the first immunization, the lumbar and inguinal lymph nodes, in particular, can be efficiently enlarged.

Although the mouse used in the method of the present invention is not particularly limited, SPF mouse is used for the purpose of producing a monoclonal antibody. It is preferable to use it. Typically, mice of strains such as BALB / c, ddY and C57BL / 6 can be used.

 In the method of the present invention, the step of administering a mixture of an antigen and an oligonucleotide containing an unmethylated cytosine-guanine dinucleotide motif into a mouse footpad is followed by It may further include the step of performing additional immunization. The booster immunization can be carried out either by administering a mixture of an adjuvant and an antigen or administering only the antigen, but it is preferable to administer the antigen only when administering immediately before cell fusion. In the method of the present invention, the CpG oligonucleotide is used as an autant and the first immunization is carried out in the peptide, whereby the lymphocyte is efficiently lysed. Nodal enlargement is possible, so boosters should be boosted within 2 weeks, preferably within 9 days after the first dose of the mixture of CpG oligonucleotide and antigen. Is possible. As a route of administration of the booster, it is preferable to use a footnode, but intramuscular, intraperitoneal, intradermal, subcutaneous and intravenous may be used as appropriate.

In addition, the method of the present invention uses a CpG oligonucleotide as an adjuvant, and the first immunization is performed in the footnode, so that the lymph node is more efficiently used. Can be enlarged. A single immunization and a single boost immunize the mouse. In contrast to the conventional mouse immunization method that required multiple booster immunizations and an immunization period of at least one month or more (for example, a method using FCA as an adjuvant and spleen-derived cells for cell fusion), The method of the present invention has made it possible to establish immunity in mice within one booster immunization period of two weeks. Whether or not immunity has been established can be confirmed by measuring the titer of an antibody reactive with the administered antigen in mouse blood. Booster immunizations can be performed more than once if necessary.

The “step of isolating the lymph node from the mouse and fusing the lymph node-derived cells with myeloma cells to obtain a hybridoma” in the method of the present invention will be described. It is preferred that the mice be killed within a few days after the boost. The sacrificed mice are laparotomized under sterile conditions and the lymph nodes are isolated. There are no particular restrictions on the lymph nodes to be isolated, such as lumbar, inguinal, popliteal, ischial, tail, mesenteric, and Peyer's patches. At least one type of lymph node can be used, such as renal node, thymic node, axillary node, upper arm node, and cervical node. Generally, antigen-reactive lymph nodes are located in the lymph nodes near the antigen administration site. W 200

24 Because there are many papillae and the lymph nodes are often enlarged, administration of an antigen to the hind limb footpad may result in inguinal, lumbar, and sciatic lymph nodes. It is preferable to use a node, a tail lymph node, a popliteal lymph node, and the like, and particularly, it is preferable to use a lumbar lymph node and / or an inguinal lymph node. Lymph node-derived cells obtained from a plurality of lymph nodes may be mixed and used for cell fusion.

By loosening the isolated lymph node on a cell strainer using a pin set or the like in a medium, it is possible to prepare a lymph node-derived cell. At this point, it is preferable to count the number of obtained lymph node-derived cells. Although the child to get the least for the 1 XI 0 ⁷ or more of the antibody-producing cells also in order to perform the cell fusion efficiency good phrase is important, mouse method of immunization using a conventional FCA adjuvant Roh down doors, etc. Thus, it was difficult to enlarge the lymph node, and a sufficient number of cells could not be obtained from the lymph node.

The method of the present invention uses a CpG oligonucleotide as an adjuvant, and the first immunization is carried out in the foot node to efficiently reduce the immunity. since the child to hypertrophy of the lymph nodes is possible, mouse-out one animal Nitsu, any one of the lymph nodes (if any left and right to match both sides) good Ri, 1 XI 0 ⁷ or more of even rather small Lymph node-derived cells Can be obtained.

Myeloma cells used for cell fusion are generally cell lines obtained from mice, for example, 8-azaguanine-resistant mice (derived from BALB / c) Myeloma cell line P3X63Ag8U.l (P3-Ul) [Yelton, DE et al. Current Topics in icroDiology and Immunology, 81, 1-7 (1978)], P3 / NSI / 1 ■ Ag4-1 (NS ■ 1) [Kohler, G. et al. European J. Immunology, 6, 511 -519 (1976)], Sp2 / 0-Agl4 (SP-2) [Shulman, M. et al. Nature, 276, 269-270 (1978)], P3X63Ag8.653 (653) [Kearney, JF et al. J. Immunology, 123, 1548-1550 (1979)], and P3X63Ag8 (X63) [Horibata, K. and Harris, AW Nature, 256, 495-497 (1975)]. These cell lines are grown in a suitable medium, such as 8-azaguanine medium (Glutamine, 2-mercaptoethanol, genomycin, and perfetal fetal serum (RPI-164 medium)). 8-azaguanine in a medium supplemented with “FCS” below), Iscove's Modified Dulbecco's Medium (hereinafter “IMDM”), or Darco's Modified Dulbecco's Medium. Subculture in Dulbecco's Modified Eagle Medium (DMEM). 3-4 days before normal medium of engagement (e.g., 1 0% FCS ASF 1 0 4 medium containing (Ajinomoto Co., Ltd.)) were subcultured, 2 XI 0 ⁷ or more cells to fusion those day Reserve a number.

 Currently, the most common means of cell fusion between lymph node-derived cells and myeloid cells is polyethylene glycol, which has relatively low cytotoxicity and simple fusion procedures. This is the method that uses. This method includes, for example, the following procedure. Wash the lymphocyte-derived cells and myeloma well with a serum-free medium (for example, RPMI 164) or phosphate buffered saline (hereinafter referred to as “PBS”). Mix the cells so that the ratio of the number of cells derived from the nodes to the number of cells in the mouth is about 1: 1 to 10: 1, and centrifuge. In this step, it is also possible to mix the lymph node-derived cells and myeloma cells and then wash the cells. I like it because it will be less.

Subsequently, the supernatant was removed, and the precipitated cell group was loosened. Then, with stirring, 50% (w / V) of polyethylene glycol (100%) was added. A serum-free medium containing 400.000) is added dropwise. Then, slowly add 10 ml of serum-free medium and centrifuge. Discard the supernatant again and transfer the precipitated cells to an appropriate amount of hypoxanthine- It is suspended in a normal medium (hereinafter, referred to as "HAT medium") containing a solution of aminopterin 'thymidine (hereinafter referred to as "HAT") and mouse interleukin-12 (hereinafter referred to as "IL_2"). Dispense into each well of a culture plate (hereinafter referred to as “plate”), and incubate at 37 ° C for about 2 weeks in the presence of 5% carbon dioxide. Supplement the HAT medium as needed.

 When the myeoma cell is an 8-azaguanine-resistant strain, that is, a hypoxanthine / guanine / phospholibosyltransferase (HGPRT) -deficient strain, the myeloma cell that has not fused , And fusion cells of myeoma cells cannot survive in HAT-containing medium. On the other hand, fused cells between antibody-producing cells, or hybrids between antibody-producing cells and myeloma cells can survive, but are fused to antibody-producing cells. Has a lifetime. Therefore, by continuing the culture in the HAT-containing medium, only the hybridomas between the antibody-producing cells and the myeloma cells survive, and as a result, the hybridomas can be selected.

The step of culturing the obtained hybridoma and recovering the antibody from the culture supernatant in the method of the present invention will be described. This stage The floor further comprises a step of cloning (unifying) the hybridoma, and determining that the obtained hybridoma produces an antibody of interest (an antibody reactive with a desired specific antigen). It may include a confirmation step.

 For a hybridoma that has grown in a colony, the medium is replaced with a medium excluding the aminopterin from the HAT medium (hereinafter referred to as “HT medium”). Thereafter, a part of the culture supernatant is collected, and the antibody titer is measured by, for example, the ELISA method.

 Various methods for measuring the antibody titer used herein include radioisotope immunoassay (RIA), enzyme-linked immunosorbent assay (ELISA), fluorescent antibody, and passive hemagglutination. Techniques can be used, but RIA or ELISA is more preferable in terms of detection sensitivity, speed, accuracy, and possibility of automation of operation.

The antibody titer can be measured, for example, by the following procedure according to the ELISA method. First, the antigen is adsorbed on a solid surface such as a 96-well plate for ELISA, and the solid surface on which the antigen is not adsorbed is exposed to a protein that is unrelated to the antigen, for example, peroxyserum albumin ( (BSA), and after cleaning the surface, A sample (eg, a hybridoma culture supernatant, a serum diluent) is brought into contact with the first antibody to bind the antibody in the sample to the above antigen. Further, an antibody against a mouse antibody labeled with an enzyme is added as a second antibody to bind to the mouse antibody.After washing, a substrate of the enzyme is added, and a change in absorbance due to color development based on the decomposition of the substrate is measured. Thereby, the antibody titer is calculated.

 By measuring the antibody titer, it is determined that a hybridoma producing the desired antibody is present. The cells in the gel are transferred to another plate and subjected to cloning. The cloning method is a limiting dilution method in which a plate is diluted so that one hybridoma is contained in one well of the plate, and the colony is cultured in a soft agar medium and cultured. The soft agar method to recover, the method of taking out and culturing individual cells by micro chromatography, and the method of separating one cell by Celso, etc. The limiting dilution method is simple and often used.

For the wells for which the antibody titer has been recognized, for example, the cloning by limiting dilution method is repeated 2 to 4 times. (The desired antibody) is selected as a hybridoma. After completion of cloning, the hybridoma is cultured by changing the medium from HT medium to normal medium. Large-scale culture is performed by rotary culture using large culture bottles or spinner culture. The antibody can be recovered by purifying the supernatant from this large-scale culture using a method known to those skilled in the art, such as gel filtration. In addition, by growing the hybridoma in the abdominal cavity of a mouse of the same strain (for example, BALB / c) or a NuZNii mouse, ascites containing a large amount of the target antibody can be obtained. Can be.

Antibody recovery and purification from the culture supernatant of the hybridoma include, for example, treatment with a conventional protein precipitant, ultrafiltration, molecular sieving chromatography (gel filtration), and adsorption chromatography. Various types of chromatographs such as chromatograph, ion exchange chromatograph, affinity chromatograph, high-performance liquid chromatograph (HPLC), etc. Dialysis, dialysis, and combinations thereof. When the antibody is IgG, affinity chromatography using a protein A-containing column is particularly useful. The hybridoma obtained by the method for producing a monoclonal antibody and the hybridoma in the present invention is a hybridoma that produces an IgG antibody in a preferred embodiment. When the immunization period is short, most of the obtained hybridomas are hybridomas that produce IgM antibody, and the affinity of the antibodies is often low. In the method of the present invention, the immunization period is two weeks, which is shorter than before, but the CpG oligonucleotide is used as an adjuvant, and the first immunization is performed with the photoimmunoassay. Can produce an antibody with a high affinity in IgG type, since it is possible to efficiently induce an immune response to a specific antigen in mice by performing intracellular injection. It became possible to acquire high predoma efficiently. Evening of antibodies produced by hybridomas can be easily performed using a commercially available typing kit or the like.

Example

 The present invention will be described in more detail with reference to the following Examples, but it should not be understood that the present invention is limited to these Examples.

Example 1 Preparation of Anti-SJ2 368 Mouse Monoclonal Antibody (1) Preparation of Antigen

The extracellular domain of the human SJ2368 protein (SEQ ID NO: 1) (in the amino acid residues 1-222 of SEQ ID NO: 1) is used as an administration antigen for antibody production. Equivalent) and histidine tag Or chimera (fusion) protein with the human IgGFc fragment. The expression plasmid for human SJ2368-His, a chimeric protein of the extracellular domain of human SJ2368 and a histidine tag, was constructed by the following method.

That is, Sense Primer 1 (5,1 CCGCTCGAGCAGGAAGGCCAT GGCGGGGCCCGAG-3 ') and Antisense Primer 1 (5,1 CGCGGATCCGGCTTCTGGGAC CTCCAGCAAGAA-3,) were synthesized, and the Ministry of Economy, Trade and Industry (METI), an international microbial depository organization, Plasmid sj was commissioned by the Institute of Biotechnology, Industrial Technology, and Technology on September 18, 2003, and transferred to a deposit based on the Busust Convention on September 17, 2002. 0 2 3 6 8 (Accession No. FERMBP — 8 1 8 2.) to type I using Pyrobest DNA Polymerase (TAKARA) for 10 seconds at 98 ° C, 30 seconds at 55 ° C, 7 2 The PCR reaction was repeated 30 times at 1 ° C. for 30 minutes. The obtained PCR product of about 0.7 kb was digested with XhoI and BamHI, and the DNA fragment was recovered by agarose gel electrophoresis. In addition, pc DNA 3.1 / Myc-His (-) A is replaced with Xhol and Ba After digestion with mHI, the above DNA fragment was ligated. The competent cell JM109 was transformed and human SJ2368-His expression plasmid was prepared according to a standard method. Human SJ 2 3

The expression plasmid of human SJ238-Fc, a chimera protein of 68 extracellular domains and the human IgG Fc fragment, was constructed by the following method. Sense primer 2 (5, 1 C C G G

A A T T C A G G A A G G C C A T G G C G G

GGCCCCGAGC-3 '), and using antisense primer 1 to make sj02368 into a type II? 0 13 6 3 DNA Polymerase (TAKARA) repeats 30 cycles at 98 ° C for 10 seconds, 55 ° C for 30 seconds, and Ί2 ° C for 1 minute 30 times, and performs PCR reaction. went. About 0 obtained.

 The R product was digested with Ec0RI and BamHI, and the DNA fragment was recovered by agarose gel electrophoresis.

 Also, after pMl304 described in W097 / 423219 was re-published, it was digested with EcoRI, and the ends were blunt-ended using DNABlunting Kit (Evening Carabio Inc.). . In addition

After digestion with Kpnl, a fragment of about 7.0 Okb was recovered. Then, pM1304 was double-digested with BamHI and ρρnI. After shunting, a 0.7 kb DNA fragment was recovered. These two types of DNA fragments were ligated with the above-mentioned DNA fragments. The transformant cell JM109 was transformed and human SJ2368-Fc expression plasmid was prepared according to a standard method. The amino acid sequence of the human SJ2368_Fc protein obtained by this construction is as shown in SEQ ID NO: 2. The obtained expression plasmid was introduced into COS cells by the following method. That is: FUGENE 6 (Roche-Diagnostics) 5 and each of the above brass mids DN

A12.5 μg was mixed with the attached protocol, and added to C0S cells grown on a semiconfruent 150 cm ² flask. 5% C 0 ₂ presence, the culture supernatant was collected after culturing for 3 days at 3 7 ° C. After performing SDS-PAGE on human SJ2368-His and human SJ2368-Fc contained in the culture supernatant, an anti-histidine tag antibody (Penta.His Antibody; QIAGEN) And peroxidase-labeled anti-mouse immunoglobulin antibody; DAK 0) or anti-Fc antibody (peroxidase-labeled anti-human IgA, IgG, 1 gM, Kappa, Lambda antibody; DAKO) to detect by Western blotting, and to detect human SJ2368-His and human SJ2368 -It was confirmed that Fc was expressed in the culture supernatant.

 Furthermore, human SJ2368-His was purified from the culture supernatant using a nickel column, and human SJ2368-Fc was purified using a ProteneA column.

An adjuvant-antigen mixture was prepared by the following method. 20 g of the purified SJ2368-Fc protein was dissolved in 50 L of physiological saline, and used as an adjuvant containing CpG oligonucleotide as an adjuvant containing QIAGEN Imm. The unEasy Mouse Adjuvant was added to 50 μl [] to prepare 100 μl. Emulsion mixed with 50 〃L of Freund's complete adjuvant (FCA, DIFCO) commonly used as a control and 50 pi L of saline containing 20 g of antigen Was prepared.

(2) Administration to mice

 ddY mice (male, 8 weeks old, SLC) were each administered 50 L of the adjuvant-antigen mixture into the footpads of both feet via a micromouth syringe. Nine days later, 20 〃g of the antigen, diluted with 100 〃L of physiological saline, was administered in a volume of 50 liters each to the footnode. The administration was performed in one CpG group and three FCA groups.

(3) Cell fusion Three days after the final administration, the mice were squeezed and the lumbar lymph node was aseptically removed. The extracted lymph nodes were replaced with RPMO containing 10% fetal calf serum.

The lymphocytes were immersed in I164 medium (GIBCO), and the lymphocytes were separated by squeezing the lymph nodes on a 100-micron cell strainer (FALCON). Measure the cell concentration of the separated lymphocytes, collect the cells by centrifugation, and culture the P3X63-Ag.8.

The mixture was mixed at a ratio of 3U1) and 4: 1 (lymphocyte: P3U1) and centrifuged again. After washing twice with serum-free RPM I1640 medium, the medium was removed so that no medium remained. Then warmed to 37 ° C

Cell fusion was performed using a 45% polyethylene glycol solution containing 5% DMSO (SIGMA) according to the method of Tamoe Ando et al. (Introduction to single clone antibody experimental procedures, Kodansha). After the completion of the fusion, the cells were suspended in 10% fetal bovine serum containing 1 XHAT (GIBCO), 50% Hybridoma-SFM (GIBCO, hereinafter referred to as SFM), and 40% RPMI 1640 medium. The cells were seeded on a 96-well plate at about 0.2 mL / well. Cultured at 37 ° C and 5% C02, and after 1 week, when hybridoma growth was observed, 10% fetal calf serum containing 1XHT, 50% SFM, 40% RPM I

The medium was replaced with a 1640 medium. The medium was changed several times. After that, the culture supernatant was sampled to screen for a nodipril dormer producing an antibody against the antigen.

 (4) No, Iburi Doma Screening

 Dilute the purified SJ2368-His protein described in (1) to 76 µg / mL with 76 mM phosphate buffer (PH6.4, hereafter referred to as PBS), and add 96 wells. The solution was dispensed into immunoplates (NUNC, M axisorp) at 50 µL / well, and allowed to stand at 4 ° C overnight. The next day, the plate was washed with ion-exchanged water and blocked with 2% StabIgard / PBS (SurModics). After standing, the sampled culture supernatant was added to each well, reacted at 37 ° C for 1 hour, and washed three times with physiological saline containing 0.05% Tween 20. . Next, a peroxidase-labeled anti-mouse immunoglobulin antibody (DAKO) was diluted 100-fold with PBS containing 10% heron serum, and each well was subjected to a 50-L addition. After reacting at 37 ° C for 1 hour, the plate was washed 5 times in the same manner, and a TMB solution (BioFix) was added to each well. After the reaction at room temperature for 10 minutes, the reaction was stopped with a 0.5 M sulfuric acid solution. The absorbance at 450 nm was measured with a plate spectrophotometer (NJ-2100, Japan Inecast).

In the group using CpG oligonucleotide as adjuvant Among the 88 seeded cells, 10 cells (positive cells) for which antigen-binding activity was observed were found. On the other hand, in the group using FCA as adjuvant, the number of positive wells was 0 in 3 out of 88 seeding wells. Table 1 shows the number of lymph node cells measured in (3) and the results of the positive cells measured in (4). The group using FCA shows the average value of three cases.

 table 1

 In the group using FCA as an adjunctive agent, the lymph node could not be sufficiently enlarged even when administered intravenously, and even when cell fusion was performed, SJ23 was observed. No hybridoma producing 68 antibody was obtained. On the other hand, in the group using CpG oligonucleotide as the adjuvant, hyperplasia of the lymph node was observed, and a hybridoma producing the SJ2368 antibody was obtained. And came out. (5) Preparation of purified antibody

Clones are performed on the wells for which the antibody titer is recognized by the limiting dilution method, and an antibody that reacts with the SJ2368 protein is produced. Hai Puri Doma 10 I got a clone. The selected hybridomas are cultured in 10% fetal calf serum, 50% SFM, and 40% RPMI-164 medium, and then cultured in Hybridoma-SFM medium (GIBC0) to produce antibodies. The antibody was purified using rosep-A column (Millipore). All of the resulting 10 clones could be purified by protein A and were of the IgG type. When the subclass of the highly reactive F1157—10—2 antibody was analyzed using the IsoStrip Mouse Monoclonal Antibody I Rotyping Kit (Roche), the Was IgG 2 a / A? Further, when the affinity of the antibody was measured by Biacore 300 (Biacore), the affinity constant was 2.32 X 10 — ⁹ M, which was regarded as an adjuvant. First immunization was performed in the footnode using CpG oligonucleotides, and lymph node-derived cells were used for cell fusion. It was clear that high-affinity IgG antibodies could be efficiently obtained. The time required to establish this antibody was 2 weeks of immunization (from the first immunization to cell fusion, with only one additional dose during this period), 7 days from cell fusion to primary screening, and 7 days To secondary screening It took 10 days, 2 weeks from cell growth to cell freezing, for a total of 1.5 months.

Example 2 Preparation of Anti-SCD14 (1-307) S288C Protein Monoclonal Antibody

 (1) Preparation of administration antigen

 S CD14 (1-307) S2886C protein (hereinafter referred to as CD1) prepared by the method described in WO 01/72993 4 (may be written as (S286C)) 15 μg is dissolved in physiological saline, and QIAGEN is used as an adjuvant containing CpG oligonucleotide. Of ImmunEasy Mouse Adjuvant or 150 L of 50 μL was added to make 200 L.

 (2) Administration to mice

 dd 50 μL of adjuvant-monoantigen mixture was added to the thigh muscles and feet of both feet of Y mouse (male, 8 weeks old, SLC), respectively. Was administered. 9 days later, antigen protein

15 ^ g was diluted with 100 µL of physiological saline, and each of them was administered in a footpad 5 times.

(3,) cell fusion Three days after the final administration, the mice were squeezed and the lumbar lymph node was aseptically removed. The excised lymph node was immersed in RPMI medium (0180〇0) containing 10% fetal bovine serum, and re-substituted on a 100 micron cell strainer (FALCON). The lymph nodes were separated by squeezing the lymph nodes, and cell fusion was performed as in Example 1 (3). After the medium was changed several times, the culture supernatant was sampled to screen the hybridomas producing antibodies against the antigen.

 (4) Screening of hybrid vehicles

 Dilute purified CD14 (S286C) to l〃g / mL with PBS, dispense into a 96-well immunoplate (NUNC, M axisorp) at 50 LZ, and add 4 ° C. C Left overnight. The antibody titer in the culture supernatant was measured in the same manner as described in Example 1 (4).

Seed in a group using ImmunEasyMouseAdjuvant as an adjuvant containing CpG oligonucleotides at 30 // L and at a group using 150 ^ L. Out of the 88 pairs, the number of pairs (positive pairs) showing antigen-binding activity was 4 and 5, respectively. Positive gel is cloned by limiting dilution and reacts with CD14 (S286C) protein Obtained 9 clones of hybridoma producing antibody. Table 2 shows the results of the number of lymph node cells measured in (3) and the positive cells measured in (4).

Table 2

 No difference in the immunological effect due to the difference in the amount of adjuvant was observed. When CD14 (S286C) is used as an antigen, lymphoma node hypertrophy is also observed, and a hybridoma producing CD14 (S286C) antibody is obtained. Was completed.

 (5) Immunization by intramuscular administration

Using QIAGEN's ImmunEasyMouseAdjuvant as an adjuvant containing CpG oligonucleotide, ddY mouse (medium) was prepared according to the method described in the attached manual. Antigen, 8 weeks old, SLC). That is, 2 / g of CD14 (S286C) protein and 20 L of Immun Easy Mouse Adjuvant were mixed, and the antigen to be administered was prepared to be 1 OOL with physiological saline. . Thigh muscles of both feet 5 O ^ L of an adjuvant-antigen mixture was administered into the meat via a micro syringe. Two weeks later, booster immunization was performed with the adjuvant-antigen mixture prepared in the same manner. Seven days after the booster immunization, blood was collected from the mice and the antibody titer of the serum was measured according to the method described in (4), but no increase in the antibody titer was observed. When the CD14 (S286C) protein was used as an antigen, this method could not induce an immune response in mice, and could not produce antibodies.

Example 3 Preparation of Anti-CPR Monoclonal Antibody

 (1) Preparation of adjuvant-antigen mixture

 Dissolve 20 g of CRP (C-reactive protein, ADVYChemical) to 150 µL with physiological saline and use it as an adjuvant containing CpG oligonucleotides. Immun Easy Mouse Adjuvant of the company was added to 50 L of calorie to prepare 200 L of L.

 (2) Administration to mice

dd Y mice (8-week-old, SLC) were given 50 μL of adjuvant-antigen mixture to the microsyringe in the thigh muscles and in the feet of both feet. More administration. 9 days later, antigen protein W

44

A solution obtained by diluting 2 O ^ g with 100 L of physiological saline was administered to the footpad in an amount of 50 L each.

 (3) Cell fusion

 Three days after the final administration, the mice were strangled and the lumbar and inguinal lymph nodes were aseptically removed. The excised lymph node was immersed in RPMI 164 medium (GIBCO) containing 10% fetal bovine serum, and lysed on a 100 micron cell strainer (FALCON). Then, the lymphocytes were separated from each other, and cell fusion was performed in the same manner as in Example 1 (3). After the medium was exchanged several times, the culture supernatant was sampled to screen the hybridomas producing antibodies against the antigen.

 (4) High pre-doma screening

 CRP was diluted with PBS to l ^ g / mL, dispensed into 96-well immunoplates (NUNC, Maxisorp) at 50 L / well, and allowed to stand at 4 C overnight. The antibody titer in the culture supernatant was measured in the same manner as in the method described in Example 1 (4).

In the group using lumbar lymph node-derived cells and the group using inguinal lymph node for cell fusion, among the 88 seeded cells, the number of antigen-binding activities observed (positive cells) was In it 8 8 and 5 5 W

 45 Table 3 shows the number of lymph node cells measured in (3) and the results of the positive cells measured in (4).

 Table 3

 In the case of administration using CpG oligonucleotide as an adjuvant, the combined use of intra-foot and intra-thigh muscle administration allows the average number of lymph nodes to be increased. Hypertrophy was observed, and the hypertrophy was particularly remarkable in the inguinal and lumbar lymph nodes. There is no difference in the number of cells that can be collected from the inguinal and lumbar lymph nodes and the positive rate, and it is possible to produce antibodies against the target antigen using either of the lymph nodes. Was shown.

 The invention's effect

 In immunizing mice, CpG oligonucleotides are used as adjuvants, and the first immunization is performed in the mouse photonodes, thereby affecting the type of antigen. As a result, the lymph node of the mouse could be reliably enlarged, and cell fusion using lymph node-derived cells became possible. This has made it possible to produce mouse monoclonal antibodies with high efficiency and in a short period of time.

Claims

 Scope of Claim 1. A method for producing a mouse monoclonal antibody, which comprises the following steps (a) to (d);

(a) mixing the antigen with an oligonucleotide containing an unmethylated cytosine-guanidine dinucleotide;

() At least administering a mixture of an antigen and an oligonucleotide containing an unmethylated cytosine-guanidine dinucleotide into a footnode to a mouse; First immunization. Stage;

 (c) isolating the lymph node from the mouse and fusing the lymph node-derived cells with myeloma cells to obtain a hybridoma;

(d) culturing the obtained hybridoma and recovering the antibody from the culture supernatant.

2. In the first immunization step, the antigen and the non-methylated cytosine-guanine dinucleotide motif are contained intramuscularly, intradermally, subcutaneously or intraperitoneally in addition to the footnode. 2. The method according to claim 1, wherein the method comprises administering a mixture with an oligonucleotide.

3. The lymph nodes are lumbar, inguinal, popliteal, sciatic, caudal, mesenteric, pelvic, and renal. Claim 1 characterized in that it is at least one kind of lymph node selected from the group consisting of a thymic node, a thymic lymph node, an axillary node, an upper arm node and a cervical node. The method described in.

4. The method of claim 1 wherein the lymph node-derived cells, per mouse, even rather small Ri by any one of the lymph nodes characterized by the this that can in 1 XI 0 ⁷ pieces acquired.

 5. The method according to claim 1, wherein the hybridoma produces an IgG type antibody.

 6. The method according to claim 1, wherein the oligonucleotide containing the unmethylated cytosine monoguanidine dinucleotide has a base sequence represented by the following formula. the method of.

Equation 5, N ₁ X ₁ X ₂ CGX ₃ X 4 N ₂ 3 '

(Where CG is not methylated and X iX ₂ is selected from the group consisting of GT, GG, GA, AA, AT, AG, CT, CA, CG, TA, TT, and TG X ₃ X ₄ is a nucleotide sequence selected from the group consisting of TT, CT, AT, TG, AG, CG, TC, AC, CC, TA, AA, and CA. Ah Ri, and N ₂ is composed of any of the nucleotide sequences of each 1-5 0 residues. )

7. X i X s are, GT, GG, nucleotide sequence der selected Ri by the group consisting of GA and AA Ri, X ₃ X ₄ are, TT, CT, and T

7. The method according to claim 6, which is a base sequence selected from the group consisting of C.

 8. A method for inducing an immune response to a specific antigen in a mouse, the method comprising the following steps (a) and (b):

 (a) mixing the antigen with an oligonucleotide containing an unmethylated cytosine guanidine nucleotide chief;

(b) by administering a mixture of the antigen and an oligonucleotide containing an unmethylated cytosine guanidine dinucleotide at least in the footnode; First immunization of mice.

 9. A method for producing a hybridoma that produces an antibody reactive to a specific antigen, the method comprising the following steps (a) to (c):

(a) Antigen and unmethylated cytosine-guanidine nucleotide Mixing with the oligonucleotide containing the chief;

(b) A mixture of the antigen and an oligonucleotide containing an unmethylated cytosine-guanidine dinucleotide is administered, at least, in the photonode. Priming the mouse with:

 (c) isolating the lymph node from the mouse and fusing the lymph node-derived cells with myeloma cells to obtain a hybridoma.