WO2004033718A2 - Trap-tagging: a novel method for the identification and purification of rna-protein complexes - Google Patents
Trap-tagging: a novel method for the identification and purification of rna-protein complexes Download PDFInfo
- Publication number
- WO2004033718A2 WO2004033718A2 PCT/CA2003/001555 CA0301555W WO2004033718A2 WO 2004033718 A2 WO2004033718 A2 WO 2004033718A2 CA 0301555 W CA0301555 W CA 0301555W WO 2004033718 A2 WO2004033718 A2 WO 2004033718A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- rna
- sequence
- rνa
- protein
- tag
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6811—Selection methods for production or design of target specific oligonucleotides or binding molecules
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6897—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6875—Nucleoproteins
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
Definitions
- TRAP-Tagging a novel method for the identification and purification of
- This invention relates to a method for the identification and purification of RNA-protein complexes formed in vivo and in vitro.
- RNA molecules In addition to serving as essential intermediates between genes and proteins, RNA molecules also serve structural and regulatory roles in a rapidly growing list of biological processes. These include all of the basic steps of transcription initiation, splicing, localization,, translation and stability (Dreyfuss, et al., 2002; Szymanski et al., 2003; Doudna and Rath, 2002; Erdmami et al., 2001; Pesole et al, 2001; Berkhout et al., 1989) as well as processes such as dosage compensation (Bell et al., 1988; Lee and Jaenisch, 1997; Meller et al., 2000; Salido et al, 1992), heterochromatin formation (Lee et al., 1997) and, telomere maintenance (Le et al., 2000).
- RNA biochemistry Bacillus subtilis et al., 1989
- host defense systems that block the infection process.
- these molecules and processes are crucial for cell and pathogen viability, and are excellent targets for drug intervention.
- RNA binding proteins generally do not have the same specificity as DNA binding proteins. Consequently, techniques that identify individual RNA-protein interactions frequently isolate proteins that are irrelevant to the processes being studied. Indeed, there is increasing evidence that many high affinity RNA/protein interactions require multiple contacts between cis-acting elements and several proteins within a complex (Chartrand et al., 2001).
- the invention provides a method for purifying an RNA-protein complex formed in vitro comprising providing an RNA fusion molecule comprising a target RNA sequence and at least two different RNA tags, wherein at least one RNA tag interacts with a ligand in a reversible manner; contacting the RNA fusion molecule with a cellular extract; providing conditions that allow the formation of an RNA-protein complex on the target RNA sequence; and subjecting the RNA-protein complex to at least two different affinity purification steps, each step comprising binding one RNA tag to an affinity resin capable of selectively binding one RNA tag and eluting the RNA tag from the affinity resin after substances not bound to the affinity resin have been removed.
- the RNA fusion molecule is contacted with a protein mixture in place of a cellular extract.
- the invention also provides for a method for purifying an RNA-protein complex formed in vivo comprising: expressing in a eukaryotic cell an RNA fusion molecule comprising a target RNA sequence and at least two different RNA tags, wherein at least one RNA tag interacts with a ligand in a reversible manner; providing conditions that allow the formation of an RNA-protein complex on the target RNA sequence; generating a cellular extract; subjecting the cellular extract to at least two different affinity purification steps, each step comprising binding one RNA tag to an affinity resin capable of selectively binding one RNA tag and eluting the RNA tag from the affinity resin after substances not bound to the affinity resin have been removed.
- the invention also provides for a protein identified by isolating an RNA-protein complex formed in vitro or in vivo according to the methods of the current invention.
- at least one RNA tag binds to an affinity resin through a fusion protein comprising a polypeptide that binds specifically to the RNA tag and a polypeptide that binds specifically to the affinity resin.
- the polypeptide that binds specifically to the affinity resin is selected from the group consisting of a maltose binding protein, a 6-histidine peptide, glutathione S transferase and a portion thereof sufficient to bind specifically to the affinity resin.
- Another aspect of the invention is an RNA fusion molecule comprising a target RNA sequence and at least two different RNA tags, wherein at least one RNA tag interacts with a ligand in a reversible fashion.
- RNA tags are repeated.
- the RNA tags are selected from streptavidin binding sequence (SI), an MS2 coat protein binding sequence, a streptomycin binding sequence (Streptotag), a sephadex binding sequence (D8), an N protein binding sequence (nut), a REN binding sequence, a TAT-binding sequence and an R17 coat protein binding sequence.
- the R ⁇ A tags are at least one MS2 coat protein binding sequence and at least one streptavidin binding sequence.
- the R ⁇ A tags are six MS2 coat protein binding sequences and two streptavidin binding sequences.
- the R ⁇ A fusion molecules further comprise at least one insulator sequence.
- the invention also provides for isolated D ⁇ A constructs encoding the R ⁇ A fusion molecules of the present invention and for vectors and host cells expressing the isolated D ⁇ A constructs.
- the invention relates to a method for screening test compounds or proteins for their ability to modulate or regulate an R ⁇ A-protein complex by performing the methods of the present invention for purifying R ⁇ A-protein complexes formed in vitro or in vivo and observing a difference, if any, between the R ⁇ A-protein complexes purified in the presence of the test compounds or proteins and the absence of the test compounds or proteins, wherein a difference indicates that the test compounds or proteins modulate the R ⁇ A-protein complex.
- This invention provides an isolated D ⁇ A construct comprising a transcription cassette, which comprises a promoter sequence, a bait sequence operably linked to the promoter, a transcriptional termination sequence which comprises a stop signal for R ⁇ A polymerase and a polyadenylation signal for polyadenylase, and at least two tag sequences.
- the isolated D ⁇ A construct comprises at least one streptavidin binding sequence [SEQ ID ⁇ O:l SEQ ID NO:2 SEQ NO 17] and at least one MS2 coat protein binding sequence [SEQ ID NO:4, SEQ ID NO:6 SEQ ID NO:7 SEQ NO 18].
- the isolated DNA construct comprises at least one tag sequence which hybridizes to the streptavidin binding sequence [SEQ ID NO:2] and at least one tag sequence which hybridizes to the MS2 coat protein sequence [SEQ ID NO:4] under high stringency hybridization conditions.
- the invention also provides an isolated DNA construct comprising a transcription cassette, which construct comprises, a promoter sequence, a bait sequence operably linked to the promoter, a transcriptional termination sequence, which comprises a stop signal for RNA polymerase and a polyadenylation signal for polyadenylase; and at least three tag sequences.
- the isolated DNA construct comprises at least one streptavidin binding sequence [SEQ ID NO:2 SEQ NO 17] and at least two MS2 coat protein binding sequences [SEQ ID NO:7 SEQ NO 18].
- the isolated DNA construct at least one tag sequence which hybridizes to the streptavidin binding sequence
- the isolated DNA constructs further comprise at least three insulator sequences, and in another embodiment at least four insulator sequences.
- the present invention relates to expression vectors and host cells comprising the isolated
- RNA fusion molecule comprising a target RNA sequence and at least two RNA tags, wherein at least one of the RNA tags interacts with a ligand in a reversible fashion.
- the RNA fusion molecule comprises at least one streptavidin binding tag [SEQ ID NO:3] and at least one MS2 coat protein binding tag [SEQ ID NO:5].
- the current invention also relates to an RNA fusion molecule comprising a target RNA sequence and at least three RNA tags, wherein at least two of the RNA tags interact with a ligand in a reversible fashion.
- the RNA fusion molecule comprises at least one streptavidin binding tag [SEQ ID NO: 3] and at least two MS2 coat protein binding tags [SEQ ID NO:8].
- the RNA fusion molecules further comprise at least 3 insulators, and in another embodiment, 4 insulators.
- the invention provides a method for isolating an RNA-protein complex formed in vivo comprising, expressing in a eukaryotic cell an RNA fusion molecule of the current invention, generating a whole cell extract, passing the extract over a first solid support comprising streptavidin protein, eluting a first eluate with the addition of biotin, collecting the first eluate, passing the first eluate over a second solid support comprising MS2 coat protein, eluting a second elute with the addition of a reagent selected from the group consisting of glutathione, RNAse or a denaturant, and collecting the second elute, wherein the second eluate contains the isolated RNA-protein complex.
- the current invention provides a method of identifying a protein in an RNA-protein complex comprising isolating an RNA-protein complex formed in vivo comprising, expressing in a eukaryotic cell an RNA fusion molecule of the current invention, generating a whole cell extract, passing the extract over a first solid support comprising streptavidin protein, eluting a first eluate with the addition of biotin, collecting the first eluate, passing the first eluate over a second solid support comprising MS2 coat protein, eluting a second elute with the addition of a reagent selected from the group consisting of glutathione, RNAse or a denaturant, and collecting the second elute, wherein the second eluate contains the isolated RNA-protein complex and identifying the protein in the RNA-protein complex.
- the invention also provides for a protein identified by performing the methods of isolating an RNA-protein complex formed in vivo.
- Another aspect of the current invention is a method for isolating an RNA-protein complex formed in vitro comprising, (a) expressing a RNA fusion molecule of the current invention in vitro, (b) obtaining a whole cell extract, (c) passing the whole cell extract over a first solid support comprising streptavidin protein, (d) eluting a first eluate with the addition of biotin, (e) collecting the first eluate, (f) passing the first eluate over a second solid support comprising MS2 coat protein, (g) eluting a second elute with the addition of a reagent selected from the group consisting of glutathione, RNAse or a denaturant, and (h) collecting the second eluate, wherein the second eluate contains the isolated RNA-protein complex.
- steps (c) to (e) are repeated.
- the current invention provides a method of identifying a protein in an RNA-protein complex comprising isolating an RNA-protein complex formed in vitro comprising (a) expressing a RNA fusion molecule of the current invention in vitro, (b) obtaining a whole cell extract, (c) passing the whole cell extract over a first solid support comprising streptavidin protein, (d) eluting a first eluate with the addition of biotin, (e) collecting the first eluate, (f) passing the first eluate over a second solid support comprising MS2 coat protein, (g) eluting a second elute with the addition of a reagent selected from the group consisting of glutathione, RNAse or a denaturant, and (h) collecting the second eluate, wherein the second eluate contains the isolated RNA-protein complex and identifying the protein in the RNA-protein complex.
- steps (c) to (e) are repeated.
- the invention also provides for a protein identified by the methods of isolating an RNA- protein complex formed in vitro .
- the invention also relates to a method of screening for a compound that modulates the formation of an RNA-protein complex formed in vivo comprising, expressing in a eukaryotic cell an RNA fusion molecule of the current invention in the presence of a test compound, generating a whole cell extract, passing the extract over a first solid support comprising streptavidin protein, eluting a first eluate with the addition of biotin, collecting the first eluate, passing the first eluate over a second solid support comprising MS2 coat protein, eluting a second eluate with the addition or a reagent selected from the group consisting of glutathione, RNAse or a denaturant, collecting the second eluate, wherein the second eluate contains the isolated RNA-protein complex, measuring th amount of isolated RNA-protein complex present, and comparing the amount of isolated RNA-
- the invention also provides for a method of screening for a compound that modulates the formation of an RNA-protein complex formed in vitro comprising, (a) expressing an RNA fusion molecule of the current invention in vitro, (b) obtaining a whole cell extract, (c) passing the whole cell extract over a first solid support comprising streptavidin protein, (d) eluting a first eluate with the addition of biotin, (e) collecting the first eluate, (f) passing the first eluate over a second solid support comprising MS2 coat protein, (g) eluting a second eluate with the addition of a reagent selected from the group consisting of glutathione, RNAse or a denaturant, (h) collecting the second eluate, wherein the second eluate contains the isolated RNA-protein complex, (i) measuring the amount of isolated RNA-protein complex present; and (j)comparing the amount of isolated RNA-protein complex present in the absence of the compound to be tested.
- steps (c) to (e) are repeated.
- the invention also relates to the compounds or proteins that modulate the RNA-protein complexes and that are identified by the screening methods of the current invention.
- the invention also provides for kits for detecting an RNA-protein complex comprising the RNA fusion molecules, the isolated DNA constructs and the vectors of the present invention.
- FIG. 1 Tandem RNA affinity purification.
- A) RNAs of interest are tagged at their 5' or 3' end with two different RNA tags. The tagged RNAs are then expressed either in vitro or in vivo and tested for .function.
- B) Functional complexes containing the tagged RNA are purified from extracts using two affinity resins, each of which is capable of binding one of the tags.
- An important aspect of the tags, particularly the first tag used, is that it must be capable of being dissociated from its affinity resin using conditions that do not disrupt the
- RNA-protein complex Proteins eluted from the second resin are generally sufficiently pure for identification by SDS PAGE, silver staining, and Mass Spectrometry. Bound RNAs can also be identified using RTPCR or microarray analysis.
- Lane 3 purification using TRAP RNA fused to a localization element from the 3'UTR of the Drosophila wingless gene mRNA (WLEl). .
- Lane 4 protein purification using TRAP RNA fused to a second transcript localizing element in the wingless mRNA 3' UTR (WLE2). Note that the RNAs containing the two baits
- Bic-D signal is highly enriched in lanes 3 and 4 after TRAP purification with the WLEl and
- Bic-D was detected in the crude extract (Lane 1) after much longer exposures (not shown).
- Fluorescently labeled untaggedWLE2 RNA moves to the apical cytoplasm above the nuclei (green) after injection into a syncitial blastoderm staged embryo.
- a mutated WLE2 element has no localizing activty. Labeled RNA remains below the nuclei.
- WLE2 RNA moves apically in the same manner as untagged WLE2 RNA, indicating that the addition of the TRAP sequence has no obvious effect on localization function.
- MS2 and SI motifs are flanked by insulator sequences and restriction sites that facilitate the shuffling of motifs and insertion into various vectors.
- RNAs of interest can be tagged at their 5' or 3' end with two different RNA tags. Tagging at 5' end is shown here.
- RNAse indicator
- high salt glutathione
- denaturants glutathione
- proteases can be used.
- Tags used for affinity purification are shown in the left hand column. Sizes, affinity matrices, eluting reagents, and performance are shown in the columns to the right. Binding and elution efficiencies were determined using 32 P-labeled RNAs expressed in vitro and are expressed as percentage of label loaded.
- bait sequence is a cDNA or DNA sequence that encodes a target RNA sequence.
- suitable bait sequences include RNAs, such as, the HIV Tat- binding tar element, the E. coli N protein binding box B element, and various recognition elements within RNA splice sites.
- isolated DNA sequence includes DNA whether single or double stranded.
- the sequence is isolated and/or purified (i.e. from its natural environment), in substantially pure or homogeneous form, free or substantially free of nucleic acid or genes of the species of interest or origin other than the promoter or promoter fragment sequence.
- the DNA sequence according to the present invention may be wholly or partially synthetic.
- isolated encompasses all these possibilities.
- operably linked means joined as part of the same nucleic acid molecule, suitably positioned and oriented for transcription to be initiated from the promoter.
- promoter refers to a sequence of nucleotides from which transcription may be initiated of DNA operably linked downstream (i.e. in the 3' direction on the sense strand of double-stranded DNA).
- the promoter or promoter fragment may comprise one or more sequence motifs or elements conferring developmental and/or tissue-specific regulatory control of expression.
- the promoter or promoter fragment may comprise a neural or gut-specific regulatory control element.
- DNA tag refers to short DNA or cDNA sequences that encode a binding partner for a ligand.
- the ligand may be any molecule that specifically binds to the binding partner such as, antibiotics, antibodies or specific proteins.
- the DNA tags of the current invention may be located 3 ' or 5 ' to the bait sequence.
- DNA tags encode RNA tags.
- RNA tags refers to short RNA sequences that function as a binding partner for a ligand.
- the RNA tags must be short, fully modular and must not interfere with each other or with the target RNA sequence. At least one of the RNA tags must interact with its binding partner in a reversible fashion.
- transcription cassette refers to a nucleic acid sequence encoding a nucleic acid that is transcribed.
- Cassettes described herein contain multiple components such as tags, insulators and suitable restriction sites.
- nucleic acid elements such as promoters, enhancers, transcriptional termination sequences and polyadenylation sequences are typically included in the transcription cassette.
- cellular extract refers to proteins isolated lysated cells; for example, nuclear, cytoplasmic or organelle extracts or fractions thereof or a mixture of purified or recombinant proteins; or a combination thereof.
- MS2 refers to MS2 coat protein binding sequence as DNA [SEQ ID NO: 1]
- 2xMS2 refers to two MS2 coat protein binding sequences as DNA
- SEQ ID NO:14 Nut (N binding) RNA sequence. This is the RNA produced by SEQ NO 12.
- SEQ ID NO :17 - TRAPS 1 DNA - SI tags with Bglll, Cla I restriction sites and spacers.
- SEQ ID NO: 18- TRAPMS2- MS2 tags with Sea I restriction sites and spacers.
- the present invention relates to a method for isolating specific RNA-protein complexes formed in vivo. However, it can also be used to isolate or verify complexes formed in vitro.
- RNA of interest In vivo complex formation and purification is accomplished by expressing tagged versions of the RNA of interest in vivo and then using the tag to isolate associated functional RNP complexes.
- Tags in the form of short RNA sequences that interact with specific proteins, antibiotics or synthetic ligands can be readily inserted 5' or 3' to the RNA of interest (see Fig 1 A). Although a number of these potential RNA tags exist, purification with these tags gives at most a thousand-fold purification of the associated RNAs. By using two RNA tags, the TRAP-tag method of the current invention provides approximately a million-fold purification of associated RNAs, which is sufficient for the identification of most cellular proteins.
- the tags in the current invention must be relatively short, fully modular, and must not interfere with each other or with the RNA of interest.
- at least one of the tags must interact with its ligand in a reversible fashion so that RNP complexes can be eluted intact from the first ligand matrix and bound to the second matrix (see Fig. IB).
- TRAP-tagged RNAs When expressed in vivo, TRAP-tagged RNAs assemble into functional complexes, and these complexes are readily purified to homogeneity.
- isolated DNA sequence refers to a DNA sequence the structure of which is not identical to that of any naturally occurring DNA sequence or to that of any fragment of a naturally occurring DNA sequence spanning more than three separate genes.
- the term therefore covers, for example, (a) DNA which has the sequence of part of a naturally occurring genomic DNA molecule; (b) a DNA sequence incorporated into a vector or into the genomic DNA of a prokaryote or eukaryote, respectively, in a manner such that the resulting molecule is not identical to any naturally occurring vector or genomic DNA; (c) a separate molecule such as a cDNA, a genomic fragment, a fragment produced by reverse transcription of polyA RNA which can be amplified by PCR, or a restriction fragment; and (d) a recombinant DNA sequence that is part of a hybrid gene, i.e., a gene encoding a fusion protein.
- nucleic acids present in mixtures of (i) DNA molecules, (ii) transfected cells, and (iii) cell clones, e.g., as these occur in a DNA library such as a cDNA or genomic DNA library.
- Modifications in the DNA sequence which result in production of a chemically equivalent or chemically similar amino acid sequence, are included within the scope of the invention. Modifications include substitution, insertion or deletion of nucleotides or altering the relative positions or order of nucleotides. Sequence identity
- the invention includes modified nucleic acid molecules with a sequence identity at least about: >95% to the DNA sequences provided in SEQ ID NO: 1, SEQ ID NO 2, SEQ ID NO 4, SEQ ID NO 6, SEQ ID NO 7, SEQ ID NO 9, SEQ ID NO 10, SEQ ID NO 12, SEQ ID NO
- SEQ ID NO 15 SEQ ID NO 17, SEQ ID NO 18, SEQ ID NO 19 (or a partial sequence thereof or their complementary sequence).
- Sequence identity is most preferably assessed by the algorithm of the BLAST version 2.1 program advanced search
- Blast is a series of programs that are available online at http//www.ncbi.nlm.nih.gov/BLAST.
- DNA sequences functionally equivalent to the SI SEQ ID NO: 2, or MS2 SEQ ID NO: 4 can occur in a variety of forms as described above.
- sequences of the invention can be prepared according to numerous techniques. The invention is not limited to any particular preparation means.
- the nucleic acid molecules of the invention can be produced by cDNA cloning, genomic cloning, cDNA synthesis, polymerase chain reaction (PCR) or a combination of these approaches (Current
- Sequences may be synthesized using well-known methods and equipment, such as automated synthesizers.
- DNA SEQ ID NO: 4 molecules can be isolated using conventional DNA-DNA or DNA-RNA hybridization techniques. These nucleic acid molecules and the SI SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO 17 and MS2 SEQ ID NO 4, SEQ ID NO 6, SEQ ID NO 18 sequences can be modified without significantly affecting their activity.
- the present invention also includes nucleic acid molecules that hybridize to one or more of the DNA sequences provided SI SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 17 and MS2 SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 18 (or a partial sequence thereof or their complementary sequence).
- Such nucleic acid molecules preferably hybridize to all or a portion of SI SEQ ID SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 17 or MS2 SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 18 or their complement under low, moderate (intermediate), or high stringency conditions as defined herein (see Sambrook et al.
- the portion of the hybridizing nucleic acids is typically at least 15 (e.g. 20, 25, 30 or 50) nucleotides in length.
- the hybridizing portion of the hybridizing nucleic acid is at least 80% e.g. at least 95% or at least 98% identical to the sequence or a portion or all of a nucleic acid encoding SI or S2 or their complement.
- Hybridizing nucleic acids of the type described herein can be used, for example, as a cloning probe, a primer (e.g. a PCR primer) or a diagnostic probe.
- Hybridization of the oligonucleotide probe to a nucleic acid sample typically is performed under stringent conditions. Nucleic acid duplex or hybrid stability is expressed as the melting temperature or Tm, which is the temperature at which a probe dissociates from a target DNA. This melting temperature is used to define the required stringency conditions. If sequences are to be identified that are related and substantially identical to the probe, rather than identical, then it is useful to first establish the lowest temperature at which only homologous hybridization occurs with a particular concentration of salt (e.g. SSC or SSPE).
- salt e.g. SSC or SSPE
- the temperature of the final wash in the hybridization reaction is reduced accordingly (for example, if sequences having greater than 95% identity with the probe are sought, the final wash temperature is decreased by 5 degrees Celsius).
- the change in Tm can be between 0.5 degrees Celsius and 1.5 degrees Celsius per 1% mismatch.
- Low stringency conditions involve hybridizing at about: 1XSSC, 0.1 % SDS at 50°C.
- High stringency conditions are: 0.1XSSC, 0.1% SDS at 65°C.
- Moderate stringency is about IX SSC 0.1% SDS at 60 degrees Celsius.
- the parameters of salt concentration and temperature can be varied to achieve the optimal level of identity between the probe and the target nucleic acid.
- the present invention also includes nucleic acid molecules from any source, whether modified or not, that hybridize to genomic DNA, cDNA, or synthetic DNA molecules that encode.
- a nucleic acid molecule described above is considered to be functionally equivalent to a SI nucleic acid molecule SEQ ID NO: 1, SEQ ID NO 2, SEQ ID NO 17 of the present invention if the sequence encoded by the nucleic acid molecule is recognized in a specific manner by streptavidin and is elutable by biotin.
- a nucleic acid molecule described above is considered to be functionally equivalent to a MS2 SEQ ID 4, SEQ ID NO 6, SEQ ID NO 7, SEQ ID NO 18 nucleic acid molecule of the present invention if the sequence encoded by the nucleic acid molecule is recognized in a specific manner by the MS2 coat binding protein.
- the present invention provides an expression vector comprising a transcription cassette.
- the transcription cassette can be cloned into a variety of vectors by means that are well known in the art.
- a vector may comprise a suitably positioned restriction site or other means for insertion of a transcription cassette.
- the vector may also contain a selectable marker.
- CMN Casper promoter vector may be employed for use in an assay or experiment.
- vectors such as adenovirus may be employed.
- Cell cultures transfected or transformed with the D ⁇ A sequences of the current invention are useful as research tools particularly for studies of R ⁇ A-protein complexes.
- suitable vectors Host Cells
- a further aspect of the present invention provides a host cell containing a transcription cassette of the current invention.
- host cells include yeast, ES, PI 9, COS, S2 and SF9 cells.
- Methods known in the art for transformation include but are not limited to electroporation, rubidium chloride, calcium chloride, calcium phosphate or chloroquine transfection, viral infection, phage transduction, microinjection, and the use of cationic lipid and lipid/amino acid complexes or of liposomes, or a large variety of other commercially available and readily synthesized transfection adjuvants, are useful to transfer the vectors of the current invention into host cells.
- Host cells are cultured in conventional nutrient media.
- the media may be modified as appropriate for inducing promoters, amplifying nucleic acid sequences of interest or selecting transformants.
- the culture conditions such as temperature, composition and pH will be apparent. After transformation, transformants may be identified on the basis of a selectable phenotype.
- RNA fusion molecules comprising RNA tags, insulator elements and target RNA sequences.
- the RNA fusion molecule contains at least two different RNA tags. Suitable RNA tags include, but are not limited to streptavidin binding sequence, an MS2 coat protein binding sequence, a streptomycin binding sequence (Streptotag), a sephadex binding sequence, an N protein binding sequence, a REV binding sequence, a TAT-binding sequence and an R17 coat protein binding sequence. In some embodiments of the invention, it will be suitable to have more than one copy of an RNA tag. For example, it may be desirable to have 2xMS2 coat protein binding sequence and 2X SI binding sequence (see Fig 5).
- increasing the number of RNA tags in the RNA fusion molecule increases the degree of purification of the resulting RNA-protein complex due to an increase in the affinity of the RNA-protein complex for the affinity resin.
- a target RNA sequence may be an oligoribonucleotide sequence or a ribonucleic acid sequence.
- the target RNA sequence is RNA, including ribosomal RNA, RNA encoded by a gene, messenger RNA, UTRs, ribozyme RNA, catalytic RNA, small nuclear RNA, small nucleolar RNA, etc., from a microorganism, or an RNA expressed by a cell infected with a virus, or RNA from a host cell, or RNA encoded by a genomic sequence; or RNA encoded by a chemically synthesized DNA sequence or random RNA encoded by randomly isolated DNA.
- Insulator elements may be placed on either side of the RNA tags and function to ensure proper folding of the RNA tags and to discourage interactions between the tags and the target RNA sequence.
- suitable insulator elements include, but are not limited to stretches of 4-5 identical nucleotides (eg, adenosines) coupled with paired restriction sites that do not interact with the tag or bait sequences. The 5' and 3' restriction sites should be identical as these sequences can then hybridize, forming a stem that forces the "insulator" polynucleotide sequences to be "unpaired” thus isolating the internal tag or bait structures from the remainder of the RNA sequences produced from a specific vector. Insulator elements may also be called spacers.
- the invention provides a method for purifying an RNA-protein complex formed in vitro or in vivo.
- the isolated protein part of the RNA-protein complex may then be identified by various methods and techniques including but not limited to SDS-page, silver staining, Western blotting and mass spectrometry.
- suitable solid supports for use with the different embodiments of the current invention include affinity columns comprising bound streptavidin or bound MS2, wherein the MS2 can be bound to agarose or sepharose beads.
- MS2 affinity columns can also be made by crosslinking to resins such as affigel beads, or binding as a fusion protein to an appropriate resin (eg GST-MS2 to glutathione beads).
- the current invention relates to a method of screening for a compound that modulates or regulates the formation of an RNA-protein complex formed in vivo or in vitro.
- the test compound may be either fixed or increased, a plurality of compounds or proteins may be tested at a single time.
- “Modulation”, “modulates”, and “modulating” can refer to enhanced formation of the RNA-protein complex, a decrease in formation of the RNA-protein complex, a change in the type or kind of the RNA-protein complex or a complete inhibition of formation of the RNA-protein complex.
- Suitable compounds include but are not limited to proteins, nucleic acids, small molecules, hormones, antibodies, peptides, antigens, cytokines, growth factors, pharmacological agents including chemotherapeutics, carcinogenics, or other cells (i.e. cell- cell contacts). Screening assays can also be used to map binding sites on RNA or protein. For example, tag sequences encoding for RNA tags can be mutated (deletions, substitutions, additions) and then used in screening assays to determine the consequences of the mutations. Kits
- the invention includes kits for detecting RNA-protein complexes comprising at least one isolated DNA construct of the invention or at least one vector of the current invention. Tandem RNA purification
- RNA motifs suitable as RNA affinity tags exist. We first tested five of these for potential use in our double-tagging system. These include the “streptotag”, a streptomycin binding aptamer (Bachler et al., 1999), “Sl”,a streptavidin binding aptamer (Srisawat and Engelke, 2001), “Dl”, a sephadex binding aptamer (Srisawat et al., 2001), the MS2 phage coat protein binding RNA (Jurica et al., 2002), "TAR”, a Tat protein binding sequence (Puglisi et al., 1995) and the lambda phage box B RNA (Lazinski et al., 1989).
- streptotag a streptomycin binding aptamer
- Sl streptavidin binding aptamer
- Dl a sephadex binding aptamer
- MS2 phage coat protein binding RNA Jurica et al.
- Table 1 shows the relative binding and elution efficiencies of each 32 P -labeled tag and its ligand.
- Two of the five tags, the streptavidin (SI, SEQ ID NO: 1 and SEQ ID NO: 2) and MS2 coat protein (MS2) tags were found to bind and elute efficiently under the desired purification conditions. Importantly, neither tag cross-reacted with any of the other tested ligands. Greater than 95% of the SI tag SEQ ID NO: 1 and SEQ ID NO: 2 bound to streptavidin agarose beads, of which 95%o could be recovered with the addition of biotin. Approximately 75%o of the loaded MS2 tag bound to GST-coat protein- beads, and approximately 70%> of the loaded tag could be eluted with glutathione.
- RNA binding proteins were tested for the ability to purify specific RNA binding proteins from a complex protein mixture.
- Two, approximately 100-nucleotide long elements from the Drosophila wingless gene mRNA (WLEl and WLE2) were chosen for this purpose. These elements are required for the asymmetrical localization of wingless transcripts to apical cytoplasm (Simmonds et al., 2001). The two elements show no similarity in sequence or predicted secondary structure and exhibit marked differences in their ability to localize transcripts. On the other hand, both appear to mediate localization via dynein-dependent microtubule transport (Wilkie and Davis, 2001). Hence, they probably interact with unique but overlapping subsets of proteins.
- RNA binding proteins (Simmonds and Krause, in preparation).
- Figure 2B shows that one of these proteins is Bic-D, a protein previously implicated as being required for apical mRNA transport in blastoderm stage Drosophila embryos (Bullock and Ish-Horowicz, 2001).
- TRAP-tagged WLE RNAs Localization of TRAP-tagged WLE RNAs in Drosophila embryos
- the final test was to ensure that complexes formed on the tagged RNAs in vivo are both active and readily purified.
- tagged WLE constructs were first fluorescently labeled and injected into syncitial blastoderm stage embryos. RNAs with an apical localization motif will move from the site of injection upwards, between the syncitial nuclei to the apical surface (Bullock and Ish-Horowicz, 2001).
- Figure 3A shows untagged WLE2 RNA after localization to the apical surface.
- Figure 3C shows that TRAP-tagged WLE2 RNA localizes to the apical surface in an indistinguishable fashion.
- TRAP-tagged wingless localization elements expressed in transgenic embryos also localized apically (data not shown). Extracts were made from these transgenic fly lines and used for purification of WLE- associated proteins.
- FIG. 4 shows that, as in vitro, each of the tagged WLE constructs binds a different subset of proteins. The identities of some of these proteins were determined by Mass Spectrometry. Once again, one of the purified proteins included Bic-D.
- the SI tag SEQ ID NOT SEQ ID NO: 2 is particularly well suited for repeated rounds of purification. It provides high degrees of purification with little loss of material, and the biotin used for elution is easily removed. Biotin removal is achieved by running the eluate over an avidin column (the SI tag SEQ ID NO: 1 SEQ ID NO: 2 does not bind avidin).
- TRAP tags could be placed within each yeast gene and substituted for the endogenous gene by homologous recombination.
- this approach is probably the most useful for small RNAs and functionally characterized RNA motifs.
- RNAi drug targets
- Viral RNAs such as HIV, hepatitis B, and the proteins that bind them, are particularly applicable targets. Examples of such uses include the treatment of viral infections, the control of cellular proliferation and the stimulation of neuronal regeneration.
- the plasmid was modified by addition of an Spel restriction site 3' to the polylinker Xhol site using the paired olgionucleotides 5'SpeI TCGAGACTAGT and ySpel AGCTTGATCAG.
- streptavidin aptamer was added by hybridization of S 1 Bgffl ⁇ '
- the MS2 aptamer was created by hybridizing the oligos
- MS2 5' (CAAACGACTCTAGAAAACATGAGGATCACCCATGTCTGCAGG)
- MS2 3' (TCGACCTGCAGACATGGGTGATCCTCATGTTTTCTAGAGTCGTTTTTGAGC) and the oligos MS2 5' (TCGACTCTAGAAACATGAGGATCACCCATGTCTGCAGGTCAAAAAGAGCT) and
- MS2 3' (CTTTTTGACCTGCAGACATGGGTGATCCTCATGTTTTCTAGAG), subcloning the two fragments separately into pBluescript SK " (Stratagene) and were then ligating the excised fragments together with the pSP72 vector linearized with S ⁇ cII. Clones were then sequenced to identify those with MS2 aptamer sequences in the correct orientation. Primers used to create other tags tested include 5 'Streptotag Kpnl
- Plasmids produced by these manipulations are referred to respectively as pTRAPSl, pTRAPMS2, pTRAPSlMS2, pTRAPN, pTRAPSlN.
- the wingless 3'UTR regions referred to as WLEl (wg 3'UTR 1-181), WLE2 (wg 3'UTR 659-773), 2x WLE2 (tandem duplication of WLE2) , WLE2-mutated (WLE2 with residues 678-689 mutated to the sequence AGATCT) and wg 3'UTR 360-1107 were amplified by polymerase chain reaction (PCR) and cloned into the BamHI site of the pTRAPSlMS2 vector to create the vectors pTRAPSlMS2+WLEl, pTRAPSlMS2+WLE2 , pTRAPSlMS2+2xWLE2 pTRAPSlMS2+WLE2(mutated) and pTRAPS
- Hpal -Spe fragements of pTRAPSlMS2+WLEl, pTRAPSlMS2+WLE2, pTRAPSlMS2+wg 3'UTR 360-1107, pTRAPSlMS2+2xWLE2, pTRAPSlMS2+WLE2(mutated) or pTRAPSlMS2 (no insert) were subcloned into BgH -StuI cut pCASPER-HS (Thummel and Pirrotta 1992).
- a coat protein GST fusion was made by subcloning a PCR fragment consisting of the entire open reading frame, with a BamHI site added 3' and an Xhol site added 5', into the vector pGEX4T-l (Pharmacia).
- the fusion protein was expressed in E. coli BL21 cells grown at 37°C for 3 hours (OD 600 of 1.8) and then induced withlOOmM IPTG for 4.5 hours. Cells were pelleted in 250 ml aliquots, quick frozen in liquid nitrogen and stored for as long as 2 months at -70°C. Cell pellets were lysed by sonication (5 min at 50%) and bound to Glutathione- Sepharose beads (Pharmacia) as specified by the manufacturer.
- the fusion protein was cross-linked to the beads using 20mM dimethyl pimelimidate dissolved in 200mM HEPES (pH 8.5) buffer (Bar-Peled et al., 1996).
- the cross-linked affinity resin can be stored for at least 6 months at -20°C in storage buffer (HEPES pH 7.4, 80 mM NaCl, ImM EDTA, ImM DTT, 40% glycerol).
- storage buffer HEPES pH 7.4, 80 mM NaCl, ImM EDTA, ImM DTT, 40% glycerol.
- glutathione elution from the coat protein beads is desired, the protein can be left uncoupled. However, the eluted protein may then obscure the presence of other specifically bound proteins.
- Templates for transcription were made by linearization of pTRAP constructs with Xhol, phenol/chloroform extraction to remove the enzyme and ethanol precipitation.
- 25 ⁇ l transcription reactions contained l ⁇ g linearized pTRAP DNA, 5 ⁇ l 5x T7 RNA polymerase buffer (400mM Tris-HCl pH 8.0, 60mM MgCl 2 ), 5 ⁇ l lOmM NTP mix, l ⁇ l 0.75mM DTT (RNAse free), 20U placental RNAse inhibitor (MBI), 15U T7 RNA polymerase and RNAse free water to 25 ⁇ l.
- 5 ⁇ l 5x T7 RNA polymerase buffer 400mM Tris-HCl pH 8.0, 60mM MgCl 2
- 5 ⁇ l lOmM NTP mix l ⁇ l 0.75mM DTT (RNAse free)
- 20U placental RNAse inhibitor (MBI) 15U T7 RNA polymerase and RNAse free
- RNA product is approximately 25 ⁇ g, which is the amount of RNA added to 1ml of Drosophila cytoplasmic extract (described below). Extract preparation
- TRAP constructs in transgenic embryos were induced using a 30 min heat pulse (36.5°C ). Cytoplasmic extracts were prepared essentially as described by Moritz (Sullivan et al., 2000) with the following changes.
- TPB working solution was made by adding glycerol to 10%, proteinase inhibitor (Complete EDTA free; Roche) and DTT (ImM final) to diluted stock solution.
- RNAse free conditions and solutions made with DEPC treated water were used throughout.
- thawed lysate was re-centrifuged for 5 min at 14,000g, and lO ⁇ g RNA added per ml of lysate. After incubation for 2-3 hours at 4°C, the lysate was mixed with streptavidin agarose beads (Sigma: 200 ⁇ l beads/ml extract) pre-equilibrated lxTPB solution. After gentle rocking for lh at 4°C, the mixture was added to an RNAse-free chromatography column and allowed to settle. Columns were then un-plugged, the unbound material allowed to flow-through and then washed three times with 1ml TPB.
- Bound complexes were eluted by plugging the columns, adding 500 ⁇ l Biotin elution buffer, (lx TPB + 5mM d-Biotin, Sigma), incubating for lhr at 4°C and then opened and the eluate collected. An additional 250 ⁇ l Biotin elution buffer was added to the column and the eluates pooled. An option at this point is to repeat the streptavidin affinity chromatography after first removing the biotin (using Avidin-agarose beads).
- Streptavidin eluates were then bound to GST-MCP beads. Approximately 50 ⁇ l of GST-CP sepharose beads, pre-washed 3 times in lx TPB, was used per 500 ⁇ l of streptavidin eluate.. After rocking for lh at 4°C, the mixture was transferred to a plugged RNAse-free mini column. After the beads settled, the column was unplugged, the unbound material allowed to flow-through and the beads washed three times with 1ml lxTPB.
- Bound complexes were eluted using either glutathione elution buffer (Pharmacia), high salt (5xTPB), RNAse (200 ⁇ l of 2mg/mlRNAseA + 5000u/mlRNAse Tl (Fermentas) or various denaturants (eg. urea, SDS). This was done by adding one bed volume of elution buffer, incubating for 30 min, eluting, rinsing three times with elution buffer and pooling the four eluates. Proteins were then resolved by SDS PAGE and identified by Trypsin proteolysis, Mass Spectrometry (Fenyo 1998) and submission of the data to Drosophila genomic databases (Adams 2000).
- RNA-binding proteins RNA 5, 1509-1516 (1999).
- Keene J.D. Ribonucleoprotein infrastructure regulating the flow of genetic information between the genome and the proteome. Proc NatlAcad Sci USA 98, 7018-7024 (2001).
Abstract
Description
Claims
Priority Applications (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
GB0507065A GB2409274B (en) | 2002-10-11 | 2003-10-10 | Trap-tagging: a novel method for the identification and purification of RNA-protein complexes |
DE10393473T DE10393473T5 (en) | 2002-10-11 | 2003-10-10 | Trap tagging: a novel method for the identification and purification of RNA-protein complexes |
AU2003273700A AU2003273700A1 (en) | 2002-10-11 | 2003-10-10 | Trap-tagging: a novel method for the identification and purification of rna-protein complexes |
US10/531,095 US20060105341A1 (en) | 2002-10-11 | 2003-10-10 | Trap-tagging: a novel method for the identification and purification of rna-protein complexes |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CA002407825A CA2407825A1 (en) | 2002-10-11 | 2002-10-11 | Trap-tagging: a novel method for the identification and purification of rna-protein complexes |
CA2,407,825 | 2002-10-11 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2004033718A2 true WO2004033718A2 (en) | 2004-04-22 |
WO2004033718A3 WO2004033718A3 (en) | 2004-07-22 |
Family
ID=32075106
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CA2003/001555 WO2004033718A2 (en) | 2002-10-11 | 2003-10-10 | Trap-tagging: a novel method for the identification and purification of rna-protein complexes |
Country Status (6)
Country | Link |
---|---|
US (1) | US20060105341A1 (en) |
AU (1) | AU2003273700A1 (en) |
CA (1) | CA2407825A1 (en) |
DE (1) | DE10393473T5 (en) |
GB (1) | GB2409274B (en) |
WO (1) | WO2004033718A2 (en) |
Families Citing this family (18)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20070166741A1 (en) * | 1998-12-14 | 2007-07-19 | Somalogic, Incorporated | Multiplexed analyses of test samples |
US6242246B1 (en) * | 1997-12-15 | 2001-06-05 | Somalogic, Inc. | Nucleic acid ligand diagnostic Biochip |
US20060057573A1 (en) * | 2002-02-15 | 2006-03-16 | Somalogic, Inc | Methods and reagents for detecting target binding by nucleic acid ligands |
US7947447B2 (en) | 2007-01-16 | 2011-05-24 | Somalogic, Inc. | Method for generating aptamers with improved off-rates |
US7964356B2 (en) * | 2007-01-16 | 2011-06-21 | Somalogic, Inc. | Method for generating aptamers with improved off-rates |
US8975026B2 (en) | 2007-01-16 | 2015-03-10 | Somalogic, Inc. | Method for generating aptamers with improved off-rates |
US7855054B2 (en) * | 2007-01-16 | 2010-12-21 | Somalogic, Inc. | Multiplexed analyses of test samples |
US20110136099A1 (en) * | 2007-01-16 | 2011-06-09 | Somalogic, Inc. | Multiplexed Analyses of Test Samples |
EP2933340B1 (en) * | 2007-07-17 | 2017-09-06 | Somalogic, Inc. | Aptamers with uridines and/or thymidines substituted at the 5-position with a benzyl group |
US8906700B2 (en) | 2007-11-06 | 2014-12-09 | Ambergen, Inc. | Methods and compositions for phototransfer |
US20090162845A1 (en) * | 2007-12-20 | 2009-06-25 | Elazar Rabbani | Affinity tag nucleic acid and protein compositions, and processes for using same |
WO2009118108A1 (en) * | 2008-03-26 | 2009-10-01 | Merck Patent Gmbh | Method of long term storage of substrate-coupled beads |
US8703416B2 (en) | 2008-07-17 | 2014-04-22 | Somalogic, Inc. | Method for purification and identification of sperm cells |
EP2542266A4 (en) | 2010-03-03 | 2013-10-23 | Somalogic Inc | Aptamers to 4-1bb and their use in treating diseases and disorders |
SG2014006522A (en) | 2010-04-12 | 2014-03-28 | Somalogic Inc | 5-position modified pyrimidines and their use |
US9267371B2 (en) * | 2013-08-01 | 2016-02-23 | Trace Logic, Inc | Oil and gas fracture liquid tracing with oligonucleotides |
JP2015055568A (en) * | 2013-09-12 | 2015-03-23 | 株式会社日立ハイテクノロジーズ | Biomolecule analysis method and biomolecule analyzer |
JP2023504683A (en) * | 2019-12-03 | 2023-02-06 | キム・ソンチョン | Methods of obtaining profiles for target molecular populations of samples |
Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2000023621A2 (en) * | 1998-10-22 | 2000-04-27 | Singer Robert H | Visualization of rna in living cells |
WO2000032619A1 (en) * | 1998-11-30 | 2000-06-08 | Ribogene, Inc. | Methods and compositions for identification of inhibitors of ribosome assembly |
WO2001048480A1 (en) * | 1999-12-28 | 2001-07-05 | Keene Jack D | METHODS FOR ISOLATING AND CHARACTERIZING ENDOGENOUS mRNA-PROTEIN (mRNP) COMPLEXES |
WO2002061079A2 (en) * | 2001-01-29 | 2002-08-08 | Isis Innovation Limited | Biligands |
US20030068803A1 (en) * | 2001-01-12 | 2003-04-10 | Robin Reed | Purification of functional ribonucleoprotein complexes |
WO2003087138A2 (en) * | 2002-04-12 | 2003-10-23 | Rigel Pharmaceuticals, Inc. | Methods for identifying polypeptide factors interacting with rna |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JPH04503309A (en) * | 1989-07-28 | 1992-06-18 | アメリカ合衆国 | Effective directional gene cloning system |
US7825227B2 (en) * | 2002-05-09 | 2010-11-02 | Prolexys Pharmaceuticals, Inc. | Method for purification of a protein complex and identification of its components |
-
2002
- 2002-10-11 CA CA002407825A patent/CA2407825A1/en not_active Abandoned
-
2003
- 2003-10-10 US US10/531,095 patent/US20060105341A1/en not_active Abandoned
- 2003-10-10 GB GB0507065A patent/GB2409274B/en not_active Expired - Lifetime
- 2003-10-10 DE DE10393473T patent/DE10393473T5/en not_active Withdrawn
- 2003-10-10 AU AU2003273700A patent/AU2003273700A1/en not_active Abandoned
- 2003-10-10 WO PCT/CA2003/001555 patent/WO2004033718A2/en not_active Application Discontinuation
Patent Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2000023621A2 (en) * | 1998-10-22 | 2000-04-27 | Singer Robert H | Visualization of rna in living cells |
WO2000032619A1 (en) * | 1998-11-30 | 2000-06-08 | Ribogene, Inc. | Methods and compositions for identification of inhibitors of ribosome assembly |
WO2001048480A1 (en) * | 1999-12-28 | 2001-07-05 | Keene Jack D | METHODS FOR ISOLATING AND CHARACTERIZING ENDOGENOUS mRNA-PROTEIN (mRNP) COMPLEXES |
US20030068803A1 (en) * | 2001-01-12 | 2003-04-10 | Robin Reed | Purification of functional ribonucleoprotein complexes |
WO2002061079A2 (en) * | 2001-01-29 | 2002-08-08 | Isis Innovation Limited | Biligands |
WO2003087138A2 (en) * | 2002-04-12 | 2003-10-23 | Rigel Pharmaceuticals, Inc. | Methods for identifying polypeptide factors interacting with rna |
Non-Patent Citations (9)
Title |
---|
BACHLER M ET AL: "StreptoTag: A novel method for the isolation of RNA-binding proteins" RNA, CAMBRIDGE UNIVERSITY PRESS, CAMBRIDGE, GB, vol. 5, no. 11, November 1999 (1999-11), pages 1509-1516, XP002237133 ISSN: 1355-8382 * |
DAS R ET AL: "Functional association of U2 snRNP with the ATP-independent spliceosomal complex E." MOLECULAR CELL. UNITED STATES MAY 2000, vol. 5, no. 5, May 2000 (2000-05), pages 779-787, XP002278260 ISSN: 1097-2765 * |
JURICA MELISSA S ET AL: "Purification and characterization of native spliceosomes suitable for three-dimensional structural analysis." RNA (NEW YORK, N.Y.) UNITED STATES APR 2002, vol. 8, no. 4, April 2002 (2002-04), pages 426-439, XP002278261 ISSN: 1355-8382 cited in the application * |
LAZINSKI D ET AL: "SEQUENCE-SPECIFIC RECOGNITION OF RNA HAIRPINS BY BACTERIOPHAGE ANTITERMINATORS REQUIRES A CONSERVED ARGININE-RICH MOTIF" CELL, CELL PRESS, CAMBRIDGE, NA, US, vol. 59, no. 1, 6 October 1989 (1989-10-06), pages 207-218, XP009018449 ISSN: 0092-8674 cited in the application * |
LIN Y ET AL: "Inhibition of multiple thermostable DNA polymerases by a heterodimeric aptamer." JOURNAL OF MOLECULAR BIOLOGY. ENGLAND 8 AUG 1997, vol. 271, no. 1, 8 August 1997 (1997-08-08), pages 100-111, XP002278264 ISSN: 0022-2836 * |
PUGLISI J D ET AL: "SOLUTION STRUCTURE OF A BOVINE IMMUNODEFICIENCY VIRUS TAT-TAR PEPTIDE-RNA COMPLEX" SCIENCE, AMERICAN ASSOCIATION FOR THE ADVANCEMENT OF SCIENCE,, US, vol. 270, no. 5239, 17 November 1995 (1995-11-17), pages 1200-1203, XP000616607 ISSN: 0036-8075 cited in the application * |
SRISAWAT C ET AL: "Sephadex-binding RNA ligands: rapid affinity purification of RNA from complex RNA mixtures." NUCLEIC ACIDS RESEARCH. ENGLAND 15 JAN 2001, vol. 29, no. 2, 15 January 2001 (2001-01-15), page E4 XP002278263 ISSN: 1362-4962 * |
SRISAWAT C ET AL: "Streptavidin aptamers: affinity tags for the study of RNAs and ribonucleoproteins." RNA (NEW YORK, N.Y.) UNITED STATES APR 2001, vol. 7, no. 4, April 2001 (2001-04), pages 632-641, XP002278262 ISSN: 1355-8382 * |
SRISAWAT CHATCHAWAN ET AL: "RNA affinity tags for purification of RNAs and ribonucleoprotein complexes." METHODS (SAN DIEGO, CALIF.) UNITED STATES FEB 2002, vol. 26, no. 2, February 2002 (2002-02), pages 156-161, XP002278259 ISSN: 1046-2023 * |
Also Published As
Publication number | Publication date |
---|---|
WO2004033718A3 (en) | 2004-07-22 |
GB2409274B (en) | 2007-05-02 |
US20060105341A1 (en) | 2006-05-18 |
CA2407825A1 (en) | 2004-04-11 |
AU2003273700A8 (en) | 2004-05-04 |
GB2409274A (en) | 2005-06-22 |
GB0507065D0 (en) | 2005-05-11 |
DE10393473T5 (en) | 2005-09-08 |
AU2003273700A1 (en) | 2004-05-04 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US20060105341A1 (en) | Trap-tagging: a novel method for the identification and purification of rna-protein complexes | |
Heim et al. | The basic helix–loop–helix transcription factor family in plants: a genome-wide study of protein structure and functional diversity | |
Feldbrügge et al. | PcMYB1, a novel plant protein containing a DNA‐binding domain with one MYB repeat, interacts in vivo with a light‐regulatory promoter unit | |
Antic et al. | ELAV tumor antigen, Hel-N1, increases translation of neurofilament M mRNA and induces formation of neurites in human teratocarcinoma cells | |
Birkenbihl et al. | Functional dissection of the plant-specific SBP-domain: overlap of the DNA-binding and nuclear localization domains | |
Naumann et al. | Pivotal role of AtSUVH2 in heterochromatic histone methylation and gene silencing in Arabidopsis | |
Wang et al. | An oligo selection procedure for identification of sequence‐specific DNA‐binding activities associated with the plant defence response | |
US7655441B2 (en) | Nucleic acid sequences having gene transcription regulatory qualities | |
Girin et al. | Identification of a 150 bp cis‐acting element of the AtNRT2. 1 promoter involved in the regulation of gene expression by the N and C status of the plant | |
Green et al. | In vitro DNA footprinting | |
Qu et al. | The Arabidopsis thaliana tandem zinc finger 1 (AtTZF1) protein in RNA binding and decay | |
Abaza et al. | Drosophila UNR is required for translational repression of male-specific lethal 2 mRNA during regulation of X-chromosome dosage compensation | |
CN112424362A (en) | Integration of a nucleic acid construct into a eukaryotic cell using transposase from medaka | |
West et al. | Shared protein components of SINE RNPs | |
Yamada et al. | Characterization of the promoter region of biosynthetic enzyme genes involved in berberine biosynthesis in Coptis japonica | |
Dominski et al. | Mutations in the RNA binding domain of stem-loop binding protein define separable requirements for RNA binding and for histone pre-mRNA processing | |
Arai et al. | Genome-wide analysis of MpBHLH12, a IIIf basic helix-loop-helix transcription factor of Marchantia polymorpha | |
Nyikó et al. | Functional and molecular characterization of the conserved Arabidopsis PUMILIO protein, APUM9 | |
Pekovic et al. | RNA binding proteins Smaug and Cup induce CCR4–NOT-dependent deadenylation of the nanos mRNA in a reconstituted system | |
Tamura et al. | Affinity‐based high‐resolution analysis of DNA binding by VASCULAR‐RELATED NAC‐DOMAIN7 via fluorescence correlation spectroscopy | |
CN115667283A (en) | RNA-guided kilobase-scale genome recombination engineering | |
Best et al. | MSP1 encodes an essential RNA‐binding pentatricopeptide repeat factor required for nad1 maturation and complex I biogenesis in Arabidopsis mitochondria | |
KR100648842B1 (en) | Methods of identifying pharmacologically active substances and DNA templates for use in such methods | |
Kanazawa et al. | The binding of nuclear factors to the as-1 element in the CaMV 35S promoter is affected by cytosine methylation in vitro | |
Foley et al. | A global view of RNA-protein interactions reveals novel root hair cell fate regulators |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PH PL PT RO RU SC SD SE SG SK SL TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
ENP | Entry into the national phase |
Ref document number: 0507065 Country of ref document: GB Kind code of ref document: A Free format text: PCT FILING DATE = 20031010 Ref document number: 2006105341 Country of ref document: US Kind code of ref document: A1 |
|
WWE | Wipo information: entry into national phase |
Ref document number: 0507065.1 Country of ref document: GB Ref document number: 10531095 Country of ref document: US |
|
122 | Ep: pct application non-entry in european phase | ||
WWP | Wipo information: published in national office |
Ref document number: 10531095 Country of ref document: US |
|
NENP | Non-entry into the national phase |
Ref country code: JP |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: JP |