WO2004078143A2

WO2004078143A2 - Methods for identification and uses of anti-inflammatory receptors for eicosapentaenoic acid analogs

Info

Publication number: WO2004078143A2
Application number: PCT/US2004/006766
Authority: WO
Inventors: Charles N. Serhan; Makoto Arita
Original assignee: The Brigham And Women's Hospital Inc.
Priority date: 2003-03-05
Filing date: 2004-03-05
Publication date: 2004-09-16
Also published as: US20090180961A1; US7341840B2; US7803557B2; US20060024758A1; WO2004078143A3

Abstract

The present invention is directed to methods for the identification and uses of a receptors that interact with anti-inflammatory compounds derived from eicosapentaenoic acid (EPA). The receptors are of the G-protein coupled receptor (GPCR) family, and are useful to screen candidate substances for anti-inflammatory activity, especially substances that are analogs of EPA. Such analogs are termed 'resolvins'; and are typically di- and tri-hydroxy EPA analogs. One analog herein denoted Resolvin E1 was identified in humans and prepared by total synthesis. In nanomolar range Resolvin E1 reduces dermal inflammation, peritonitis, dendritic cells (DCs) migration and IL-12 production. Also described herein is a receptor denoted Reso ER1 that interacts with Resolvin E1 to attenuate cytokine induced activation of inflammatory pathways mediated by transcription factor (NF)-kB. Treatment of DCs with small-interfering RNA specific for ResoE1 eliminated the ligand's ability to regulate IL-12. Assays of anti-inflammatory activity based on these discoveries are also described.

Description

METHODS FOR IDENTIFICATION AND USES OF ANTI- INFLAMMATORY RECEPTORS FOR EICOSAPENTAENOIC ACID

ANALOGS

CROSS-REFERENCE TO RELATED APPLICATIONfS

[001] This application claims priority to U.S. provisional application No.

60/452,244, filed March 5, 2003.

STATEMENT REGARDING RESEARCH & DEVELOPMENT

[002] The work leading to this invention was supported in part by National

Institutes of Health (NIH) grants GM38765, DK60583 and P01-DE13499. The U.S. Government therefore may have certain rights in the invention.

TECHNICAL FIELD

[003] This invention relates to the identification and uses of receptors that mediate anti-inflammatory activity, particularly to anti-inflammatory activity mediated by eicosapentaenoic acid analogs, and to uses of such receptors to screen candidate substances for anti-inflammatory activity.

BACKGROUND OF THE INVENTION

[004] Clinical assessment of dietary supplementation therapy with omega-3 polyunsaturated fatty acids (w-3 PUFA) indicate that they have a beneficial impact in certain human diseases (1). Their molecular mechanisms of action in reducing local inflammation has remained unclear, w-3 PUFAs are held to act via several possible mechanisms, such as preventing conversion of arachidonic acid to proinflammatory eicosanoids, or serving as an alternative substrate for 5-lipoxygenase to produce less potent 5-series leukotrienes (2). Of interest, fish leukocytes rich in w-3 PUFA generate eicosanoids from eicosapentaenoic acid (EPA; C20:5 w-3) that play signaling roles (3). However, the appropriate receptor site(s) has remained unidentified. [005] There is a need in the art for the identification of the receptor site(s) that interact with noel eicosanoids to help better understand the mode of action of such therapeutic agents.

SUMMARY OF THE INVENTION

[006] The essential fatty acid eicosapentaenoic acid (EPA) present in fish oils displays beneficial effects in a range of human disorders associated with inflammation including cardiovascular disease. Resolvin El, a recently identified oxygenated product of EPA, a resolving analog, was prepared by total synthesis and in nanomolar range proved to dramatically reduce dermal inflammation, peritonitis, splenic dendritic cell migration and interleukin-12 production. A receptor for resolvin analogs, for example Resolvin El (denoted Reso-Rl), that signals to attenuate cytokine induced nuclear factor (NF)-kB activation was identified. The results demonstrate novel counter- regulatory mechanisms in inflammation via receptor-ligand activation and provide the first evidence that EPA is a precursor to potent endogenous anti-inflammatory and endogenous host protective signals.

[007] In one aspect, the invention provides a method for screening a candidate substance for anti-inflammatory activity that includes contacting a cell that expresses the Reso E receptor with the candidate substance and detecting a biological activity mediated by the Reso E receptor. As used herein, a Reso E receptor (Reso ER) is a polypeptide sequence with a receptor activity, and which in various embodiments, has at least 50%, at least 60%, at least 70% or at least about 80% identity with the Reso ER sequences according to SEQ.ID NO: of

Figure 11. Sequence identity as used herein, is determined by any scientifically accepted method of calculating sequence identity, exemplified for example, by the BLAST programs in one embodiment, or FASTA programs that take into consideration conservative amino acid substitutions and stretches of regional identity in another embodiment.

[008] In another aspect, the invention provides a method of identifying a receptor that mediates an anti-inflammatory activity of a resolvin substance that includes introducing a nucleic acid configured to express a G-protein coupled receptor (GPCR) into a cell that does not endogenously express the GPCR, contacting the cell with a substance comprising a resolvin; and detecting that the cell has a reduced cytokine induced activation of a NF-kB transcription factor relative to a cell not contacted by the substance. As used herein, in one embodiment, a GPCR is a polypeptide sequence having at least 30%, or at least 40% or at least 50% or at least 60% or at least 70%, or at least about 80% identical to the Reso ER sequences defined above, which has at least 7 membrane spanning domains determinable by a Kyton-Doolittle hydropathy plot, and which has an biological activity coupled to a GTP binding activity of a G-protein. In another embodiment, a GPCR sequence has at least 60%, or at least 70%, or at least about 80% sequence identity within the second intracellular loop of the mouse, rat, or human, Reso ER, or human ALX sequences depicted in Figure 12 according to SEQ.ID

NOS and has at least 60%, or at least 70%, or at least about

80% sequence identity in the seventh transmembrane domain of as depicted Figure 12 according to SEQ.ID NOS .

[009] In another aspect, the invention provides a method for screening a candidate substance for anti-inflammatory activity that includes detecting that the candidate substance alters an activity mediated by a GPCR receptor.

[010] In another aspect, the invention provides method for identifying a substance that interacts with a receptor that mediates an anti-inflammatory activity that includes interacting a candidate substance with a receptor that reduces cytokine induced (NF)-κB activation.

[011] In yet another aspect, the invention provides an isolated nucleic acid operably configured to express a nucleic acid that encodes a sufficient amount of a resolvin receptor polypeptide to mediate a biological response of the polypeptide when introduced into a cell. As used herein, a "resolvin receptor" is a receptor that interacts with any derivative of EPA that elicits an anti-inflammatory response.

[012] In still another aspect, the invention provides a method of identifying a receptor that mediates an anti-inflammatory activity that includes, providing a small interfering RNA (siRNA) against a nucleic acid that encodes a candidate receptor, expressing the siRNA in a cell that expresses the candidate receptor, subjecting the cell to a condition that induces pro- inflammatory response, and detecting whether expressing the siRNA in the cell increases the pro-inflammatory response relative to a cell subjected to the condition but not expressing the siRNA. In one example embodiment, the pro-inflammatory response is increased production of a cytokine that mediates the pro-inflammatory response, hi a more particular embodiment, the cytokine is IL-12. [013] While multiple embodiments are disclosed, still other embodiments of the present invention will become apparent to those skilled in the art from the following detailed description, which shows and describes illustrative embodiments of the invention. As will be realized, the invention is capable of modifications in various obvious aspects, all without departing from the spirit and scope of the present invention. Accordingly, the drawings and detailed description are to be regarded as illustrative in nature and not restrictive.

BRIEF DESCRIPTION OF THE DRAWINGS

[014] Figure 1. Lipidomic analysis of Resolvin El in human blood, (a)

Representative MS/MS selected ion chromatogram at m/z 291, (b) MS3 selected ion chromatogram at m/z 229 and (c) MS/MS (at m/z 349) spectrum of Resolvin El in human plasma.

[015] Figure 2. (a) Resolvin El generation from EPA. Human endothelial cells expressing COX-2 treated with ASA transform EPA by abstracting hydrogen at C16 to give R insertion of molecular oxygen to yield 18R-H(p)EPE. Alternatively, cytochrome P450 monooxygenase can convert EPA to 18R-HEPE (25). They are further converted via sequential actions of leukocyte 5-LO and leads to formation of Resolvin El. (b) Total organic synthesis of Resolvin El. Precursors 1-3 were prepared in isomerically pure form from starting materials with known stereochemistry and coupled sequentially to form acetylenic intermediate 4, which was selectively hydrogenated to form isomerically pure Resolvin El. (c) UV spectrum and (d) MS/MS spectrum of synthetic Resolvin El. (e) Inhibition of leukocyte trafficking in murine dorsal air pouch. Values represent mean + SEM from 5 different mice, *P < 0.05 (vs. vehicle control).

[016] Figure 3. (a) Phylo genetic tree representing amino acid sequence similarities between the human LXA4 receptor (ALX) and related GPCRs. (b) Functional screening for Resolvin El receptors. HEK293 cells co-transfected with pNF-kB-Luciferase and pcDNA3-GPCRs were exposed to Resolvin El (10 nM) and TNF-a. (c) Amino acid sequence alignment of human Reso ER1 with ALX. Asterisks indicate conserved amino acids. Putative transmembrane domains are lined and labeled as I- VII. (d) Resolvin El inhibits luciferase activity in a concentration dependent manner on cells transfected with pcDNA3-Reso ERl (filled circle) but not pcDNA3 (open circle), (e) Ligand specificity for Reso ERl. Cells transfected with pcDNA3-Reso ERl were exposed to lOOnM of each compound. Results are expressed as percent inhibition of luciferase activity and represent the mean + SEM from n=3 (b) or n=4 (d.e), *P < 0.05. (f) Actions of Resolvin El (filled circle), Resolvin El derivative (6,14-diacetylenic-Resolvin El, open rectangle) and 18R-HEPE (filled diamond) on [35S]-GTP-gS binding to membrane expressing Reso ERl. Results are expressed as a percentage of vehicle control with the mean +SEM (n=3). *P<0.05.

[017] Figure 4. (a) RT-PCR analysis of human peripheral blood leukocytes and glioma (DBTRG-05MG), monocytic (THP-1), lung epithelial (A549), hepatoma (HepG2), embryonic kidney (HEK293) cell lines, and brain and liver, (b) RT-PCR analysis of human peripheral blood monocytes exposed to either buffer alone, TNF-a (10 ng/ml), or IFN-g (25 ng/ml) for 6 h (gray) and 24 h (black). Expression levels were quantified by NIH image, normalized by GAPDH levels and expressed as fold increase over vehicle-treated cells, (c) MAP kinase activation in human peripheral blood monocytic cells and HEK-Reso ERl cells treated with lOOnM Resolvin El (E) or vehicle (V). (d) Pertussis toxin (PTX) blocks Resolvin El -induced ERK activation and NF-kB inhibition in HEK293 cells expressing Reso ERl.

[018] Figure 5. (a) Resolvin El inhibits DC IL-12 production in vitro stimulated by pathogen extract (STAg) and expression of Reso ERl specific siRNA enhances IL- 12 production. CDl lc+ DCs incubated with vehicle (open circle) or Resolvin El (closed circle) before STAg or no STAg (open square), (b) Reduction of Reso ERl expression by siRNA eliminates Resolvin El signaling. Expression of Reso ERl and GAPDH mRNA were determined by RT-PCR from DCs treated with either control(C) or Reso ER1(R) specific siRNAs (inset). Spleen cell suspensions transfected with siRNAs were treated with vehicle (ethanol, 0.1% v/v) or Resolvin El (1.0 mg/ml). Eight hours later cells were stimulated with STAg (10 mg/ml) and IL-12p40 was measured. Bars represent mean±SD (n=3), *P<0.05 (control vs. specific siRNA). (c) Resolvin El blocks IL-12 production in vivo. Mice administered with either 100 ng Resolvin El or vehicle were challenged intraperitoneally with PBS or STAg, and IL- 12p40 secretion from splenic CDllc+ DCs was measured, (d-g) Resolvin El blocks trafficking of CDllc+ DCs in spleen with pathogen extract challenge. Spleens from mice given 10 mg Resolvin El or vehicle were stained for CDl lc. (d) PBS plus vehicle (e) STAg plus vehicle (f) PBS plus Resolvin El (g) STAg plus Resolvin El. Arrows indicate CDl lc positive DCs accumulated in T cell enriched area.

[019] Figure 6 is a table showing the structures of various molecules discussed in the present application along with LC-MS/MS data related thereto.

[020] Figure 7 illustrates inhibition of leukocyte infiltration in murine zymosan- induced peritonitis.

[021] Figure 8 illustrates expression pattern of Reso ERl in various human tissues by dot blot hybridization.

[022] Figure 9 illustrates calcium mobilization in human monocytes.

[023] Figure 10 illustrates siRNA-directed silencing of Reso ERl expression in

HEK293 cells.

[024] Figure 11 illustrates a comparison of Reso ER sequences from mouse, rat and human sources.

[025] Figure 12 illustrates a comparison of GPCR sequences in the second intracellular loop and seventh transmembrane domain of mouse, rat and human Reso ER sequences and a human ALX sequence.

DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS

[026] In the detailed description that follows, citation is made to various references that may aid one of skill in the art to understand or practice the invention in its fullest scope. Each such reference is incorporated herein by reference, to the extent the teaching of those references do not conflict with the teachings provided herein.

[027] Clinical assessment of dietary supplementation with omega-3 polyunsaturated fatty acids (w-3 PUFA) indicate their beneficial impact in certain human diseases particularly those in which inflammation is suspected as a key component in pathogenesis (1-3). Their molecular bases of action in reducing disease and local inflammation is important and of interest given the heightened awareness that inflammation and resolution is a major mechanisms in many diseases including cardiovascular disease, arthritis, Alzheimer's disease, asthma and periodontitis (4,5). w- 3 PUFAs are widely held to act via several possible mechanisms, such as preventing conversion of arachidonate to proinflammatory eicosanoids, or serving as an alternative substrate producing less potent products (1). Of interest, fish leukocytes rich in w-3 generate mediators from eicosapentaenoic acid (EPA) that play signaling roles (6). However, the pathophysiological role of leukotriene and prostanoid-like compounds from EPA remains uncertain in humans as many of these molecules' role(s) are unknown.

[028] Recently, the present inventors discovered a novel family of aspirin-triggered bioactive lipids biosynthesized during the spontaneous resolution phase of acute inflammation in vivo. This family of bioactive lipids have been termed the Resolvins (resolution-phase interaction products), are described in more detail in U.S. Pat. Application No 10/639,714, filed August 12, 2003, entitled "Resolvins: Biotemplates for Novel Therapeutic Interventions" and in PCT application No. PCT/US03/25336, filed on August 12, 2003 and entitled the same, which are incorporated herein by reference in their entirety. The Resolvins are potent autacoids, which now can provide molecular means that underlie w-3 PUFA's protective actions (7,8). At local sites, aspirin treatment enables EPA conversion to the novel 18R series of oxygenated products that carry potent counterregulatory signals. One of the main compounds of this 18R series, namely 5,12,18R-trihydroxyeicosapentaenoic acid (termed Resolvin El) can arise via cell-cell interactions in murine inflammatory exudates, also exemplified with human vascular endothelium carrying aspirin-acetylated cyclooxygenase (COX)-2 and leukocytes possessing 5-lipoxygenase(LO) (7). Here, Resolvin El was generated in healthy human volunteers given EPA and aspirin, plasma values ranging 0.1 to 0.4 ng/ml for 6 donors using liquid chromatography-tandem mass spectrometry (LC- MS/MS) (Fig.l). Formation is consistent with the scheme that endothelial cells expressing COX-2 treated with aspirin transform vascular EPA and release 18R-HEPE. When leukocyte and endothelial cell interact within the vasculature, 18R-HEPE is rapidly converted to Resolvin El via transcellular biosynthesis (Fig.2a).

[029] To assign the complete stereochemistry of the main 18R series Resolvin El and establish its biological activities, biogenic Resolvin El was prepared (7), and matched with synthetic Resolvin El (5S,12R,18R-trihydroxy-6Z,8E,10E,14Z,16E- eicosapentaenoic acid) having complete stereochemistry that was prepared by total organic synthesis from isomerically pure precursors (Fig.2b). A geometric isomer carrying all-trans conjugation at both carbon 6 and 14 positions in native Resolvin El was also prepared by organic synthesis to establish chromatographic properties as described in the supplementary examples of this description. Since Resolvin El is produced in subnanogram amounts in vivo, both synthetic and biogenic materials were prepared for matching their physical properties using UV spectroscopy, LC-MS/MS, GC-MS, and importantly to compare biological activities. The matching synthetic compound eluted beneath a single peak in HPLC with UV absorbance maximum 271 nm and 234 nm, indicative of conjugated triene and diene in the molecule (Fig.2c). MS/MS fragmentation ions were essentially identical with the biogenic material namely a parent ion at m/z 349 = [M-H]- and diagnostic product ions at m z =291 and 195 (Fig.2d). Results of physical matching studies are summarized in The Supplementary Examples.

[030] Administration of as little as 100 ng/mouse of synthetic Resolvin El stopped leukocyte infiltration into inflammatory loci by 50-70 % in TNF-a induced dorsal air pouch, which proved to be as potent as the biogenic material (Fig.2e). For comparison in this model, local administration of dexamethasone (10 mg/mouse) gives 60% inhibition (Fig.2e) and aspirin (1.0 mg/mouse) gives 70% inhibition of leukocyte recruitment (9), indicating that Resolvin El at lOOng/mouse is orders of magnitude more potent than dexamethasone or aspirin in stopping leukocyte infiltration. Also indomethacin (100 ng/mouse) gave 25% inhibition and Resolvin El (100 ng/mouse) gave 50~60% inhibition of leukocyte recruitment in zymosan-induced peritonitis as described in The Supplementary Examples. Thel8S isomer gave essentially equivalent activity as native Resolvin El containing 18R, whereas the 6-trans,14-trans isomer showed reduced potency (-70%) for reducing leukocyte infiltration in zymosan-induced peritonitis. Based on matching of physical and biological properties, the 18R series Resolvin El, a potent anti-inflammatory lipid mediator, was assigned the complete structure 5 S , 12R, 18R-trihydroxy-6Z, 8E, 10E, 14Z, 16E-eicosapentaenoic acid.

[031] The murine airpouch is widely used to assess dermal inflammation and arthritis (Fig.2e). The murine airpouch is characterized by a cavity and a lining composed of both fibroblast-like and macrophage-like cells (10). Intrapouch application of TNF-a evokes leukocyte infiltration by stimulating local release of chemokines and chemoattractants that are often produced by fibroblasts and phagocytes via regulation of nuclear factor (NF)-kB transcription factors (11). Systemic administration of Resolvin El dramatically attenuated leukocyte recruitment (Fig.2e), meaning that receptor target for Resolvin El was expressed in those cells which counterregulates TNF-a induced NF-kB activation.

[032] Resolvin El and Lipoxin (LX) A4 have different structures, are formed via different biosynthetic pathways and precursors (EPA vs arachidonate), yet they appear to share redundant beneficial properties that dampen excessive leukocyte recruitment (12), hence the present invention is based, at least in part, on recognizing that Resolvin El receptors share similar structural features to LO-derived eicosanoid receptors such as LXA4 receptor (ALX) and Leukotriene B4 receptor (BLT) (13). Fig.3a shows a branch of the phylogenetic tree of human ALX with closely related G-protein coupled receptors (GPCRs). Expression plasmids of each GPCR were introduced into HEK293 cells and the ability of Resolvin El to inhibit TNF-a stimulated NF-kB activation was monitored by co-transfection with NF-kB response element-luciferase reporter plasmid. This permitted analysis of the activation of the relevant post ligand-receptor "stop" signaling for downregulation of NF-kB activation as for example demonstrated with ALX- transfected cells and its ligands (14). Among those screened (Fig.3b), a putative orphan receptor denoted earlier as Dez/ChemR23 (15) was specifically activated by Resolvin El and at 10 nM inhibited NF-kB activation (Fig.3b). In view of these results, the Dez receptor is herein termed "Reso ERl." Reso ERl shares 36.4% identity with ALX in deduced amino acid sequences and of note contains a highly conserved domain within its second intracellular loop (75%) and seventh transmembrane region (69.5%) (Fig.3c).

[033] Resolvin El gave concentration dependent inhibition of TNF-a induced NF- kB activation with an EC50 of -1.0 nM in Reso ERl transfected cells but not in mock transfected cells (Fig.3d). In this system, 1 mM aspirin, a known inhibitor of NF-kB at high concentrations namely millimolar range (16), gave non-receptor dependent inhibition of 26.2+4.9% for Reso ERl transfected cells. Neither EPA nor 18R-HEPE at 100 nM, both metabolic precursors of Resolvin El, inhibited NF-kB in Reso ERl transfected cells (Fig.3e). The isomer 6-trans,14-trans at 100 nM showed reduced potency for NF-kB inhibition that was essentially the same magnitude reduction in vivo. The functional interactions between Reso ERl and G proteins using ligand-dependent binding of [35S]-GTPgS, a hydrolysis resistant GTP analog were also examined. Specific [35S]-GTPgS binding in isolated membranes obtained from cells expressing Reso ERl increased selectively with Resolvin El in a concentration-dependent manner (Fig.3f). These results indicate that Resolvin El transmits signal as a selective agonist via Reso ERl and counterregulates TNF-a stimulated NF-kB activation.

[034] Tissue distribution of human Reso ERl was determined with dot blots containing mRNAs from human tissues that showed expression of Reso ERl in several tissues such as cardiovascular system, brain, kidney, gastrointestinal tissues and myeloid tissues as is illustrated in Figure 8. Also, a murine receptor counterpart was found in developing bone using in situ hybridization (17). Among the human peripheral blood leukocytes, Reso ERl was abundantly expressed in monocytes, with lower amounts in neutrophils and T lymphocytes (Fig.4a), findings consistent with the observation that this receptor is expressed in antigen-presenting cells (APC) such as macrophage and dendritic cells (15). Both monocyte Reso ERl and COX-2 transcripts were highly upregulated by treatment with inflammatory cytokines such as TNF-a and IFN-g, and Reso ERl showed delayed induction to that of COX-2 (Fig.4b). Resolvin El increased phosphoryation of extracellular signal-regulated kinase (ERK) mitogen-activated protein (MAP) kinase both in peripheral blood monocytes and HEK293-Reso ERl cells, but not in mock-transfected HEK293 cells (Fig.4c). hi addition, treatment of HEK293-Reso ERl with pertussis toxin (PTX) abolished Resolvin El dependent ERK activation and NF-kB inhibition, indicating coupling to Gai/o -protein for the signal transduction (Fig.4d). As shown in Figure 9, Resolvin El did not evoke a calcium mobilization with either human peripheral blood monocytes or HEK-Reso ERl stable transformants, and at 100 nM did not inhibit calcium mobilization by 100 nM LTB4 (data not shown). These results demonstrate that Resolvin El activates Reso ERl, evokes ERK phosphorylation and regulates gene expression, through Gi/o-protein.

[035] Given expression of human Reso ERl in APCs, and since APC function is influenced by dietary w-3 PUFA supplementation (18), the activity of Resolvin El on APC function was examined using a microbial pathogen model. Injection of pathogen extract derived from Toxoplasma gondii (STAg) causes activation of splenic dendritic cells (DCs) to mobilize to T cell enriched areas where they produce high amounts of IL- 12 (19). Addition of increasing concentrations of Resolvin El to isolated mouse splenic CDllc+ DCs markedly inhibited IL-12p40 production by STAg within the nanomolar range (Fig.5 a).

[036] siRNA experiments were carried out to reduce Reso ERl in splenic DCs.

The mouse ResoER receptor (17), which shares 80.3% identity with human Reso ERl, was also present in splenic DCs. Resolvin El's action in regulating IL-12 production from DCs was eliminated by treatment with a siRNA specific for the mouse Reso ERl (Fig.5b). It was confirmed that this siRNA treatment dramatically reduced Reso ERl mRNA expression in DCs (Fig.5b, inset) and cell-surface expression of recombinant Reso ERl in HEK293 cells as described in the Supplementary Example. These results confirm that Resolvin El's anti-inflammatory action is mediated via Reso ERl . hi vivo treatment with Resolvin El also blocked IL-12 production (Fig.5c) as well as DC migration into T cell areas of the spleen (Fig.5d-g).

[037] Acute inflammation is a protective host response to foreign challenge or tissue injury that could lead to, if unopposed, loss of tissue structure as well as function. In many chronic disorders, prolonged and unresolved inflammation is believed to contribute to pathogenesis (4). Resolution of inflammation is an active process controlled by endogenous mediators that can counterregulate pro-inflammatory gene expression and cell trafficking, as well as stimulate inflammatory cell clearance (11,20). The observation that cytokines upregulated Reso ERl as well as COX-2 in monocytes indicates that in scenarios where COX-2 is induced during inflammation, monocytes as well as endothelial cells treated with aspirin can also potentially convert w-3 EPA into Resolvin El in concert with PMN (7), that may serve an autocrine and/or paracrine message to terminate further NF-kB activation and cytokine production in a temporal and spatially regulated fashion. Resolvin El is generated in healthy volunteers taking EPA and aspirin (Fig.l). These results are consistent with the notion that COX-2 is also constitutively expressed in healthy vasculature in vivo (21, 22). Also, the results presented here support the notion that aspirin, in addition to its well-appreciated action to inhibit prostanoid formation, can exert its beneficial actions, in part, via EPA catabolic synthesis of 18R series Resolvin El that in turn interacts with receptors such as Reso ERl to dampen further proinflammatory processes. It is likely that in vivo, Resolvin El can also interact with additional receptors, in addition to Reso ERl. Indeed, Resolvin El can, at higher concentrations (~0.5mM), interact with recombinant LTB4 receptor BLT1 (7) and could potentially antagonize BLT1 and BLT2 receptors (23) in vivo. Endogenous chemically redundant anti-inflammatory lipid autacoids act with high affinities (nM range) and stereoselectivity on structurally related receptors as does aspirin triggered lipoxin A4 generated from arachidonic acid (24) to enhance resolution by "stopping" PMN recruitment and IL-12 production from APC. Together, the present findings provide an endogenous agonist driven and hst-protective molecular mechanism that can underlie some of the beneficial actions of ω-3 EPA observed in many clinical situations (1-3) as well as identify novel components in endogenous anti- inflammation/resolution, exemplified by Resolvin El and one of its receptors Reso ERl that are of interest as new checkpoint regulators (20) in the pathogenesis of a wide range of human diseases.

Supplementary Examples and Methods

[038] Studies reported here were performed using protocols approved by Harvard

Medical Area Standing Committee on Animals and human subjects in accordance with the Brigham and Women's Human Research Committee.

LC-MS/MS analysis of Resolvin El

[039] Human plasma samples were collected at 4 hours after oral administration of fish oil supplement (Fish Oil Concentrate, Walgreens) containing EPA (1 g) and DHA (0.7 g) followed by aspirin (160 mg) at 3 h in six healthy volunteers. Plasma samples were extracted by C18 solid phase extraction with d4-LTB4 (Cascade) as internal standard for LC-MS/MS analysis (7) using a Finnigan LCQ liquid chlomatography ion trap tandem mass spectrometer equipped with a LUNA C18-2 (100 x 2mm x 5mm) column and UV diode array detector using mobile phase (methanol:water:acetate at 65:35:0.01) from 0 to 8 min, ramped to methanol 8 to 30 min, with a 0.2 ml/min flow rate.

Murine dorsal air-pouch model

[040] Dorsal air pouches were raised on male FvB mice (6-8 wk) by injecting 3 ml of sterile air subcutaneously on days 0 and 3. On day 6, 100 ng/mouse of compounds were injected into tail vein. Inflammation in the air-pouch was induced by intrapouch injection of mouse recombinant TNF-a (100 ng/pouch), and pouch lavages were collected at 4 h and cells were enumerated.

Zvmosan induced peritonitis

[041] For peritonitis, 100 ng/mouse of Resolvin El or related structures was injected into tail vein and followed by 1 ml zymosan A (1 mg/ml) into the peritoneum. Peritoneal lavages were collected at 2 h and cells were enumerated.

GPCR cDNAs and phylo genetic tree

[042] GPCR cDNAs were cloned by RT-PCR using specific primers designed according to the GenBankTM database; human FPR(P21462), ALX(P25090), FPRL2(P25089), GPR1(A55733), GPR32(O75388), Dez(Q99788), CRTH2(Q9Y5Y4), C3AR(Q16581), C5AR(P21730), BLT1(Q15722). mouse Reso ERl (U79525). The phylogenetic tree was constructed using the "All All Program" at the Computational Biochemistry Server at ETHZ ( http://cbrg.inf.ethz. ch/Server/AHAll.html ).

NF-kB reporter gene assay

[043] HEK293 cells (1.0 ' 105 cells) were transiently transfected with 50 ng pNF- kB-luciferase (Stratagene), 500 ng of either pcDNA3 or pcDNA3-GPCRs and the internal standard pRL-TK (Promega) using Superfect transfection reagent (Qiagen). After 24 h, cells were exposed to the test compounds for 30 min, stimulated with recombinant human TNF-a (1.0 ng/ml, BD Pharmingen) for 5 h. Luciferase activity was measured by the Dual-Luciferase reporter assay system (Promega). Basal induction of luciferase activity by TNF-a was >150-fold in this system. Efficient expression of GPCRs to the cell surface was observed by immunostaining using HA-tagged GPCR constructs. For PTX treatment, HEK293 cells were treated with PTX (200 ng/ml) for 24 h before stimulation.

r35S1-GTPgS binding assay

[044] HEK293 cells stably expressing human Reso ERl were homogenized in ice- cold TED buffer (20mM Tris-HCl pH7.5/lmM EDTA/5mM MgC12/lmM DTT). Membrane fraction (10 mg) was incubated in 400 ml of GTP-binding buffer (50mM Hepes, pH7.5/100mM NaCl/lmM EDTA/5mM MgC12/lmM DTT) containing 0.1 nM [35S]-GTPgS (>1000 Ci/mmol, Amersham) and 10 mM GDP for 30 min at 30 °C. The bound and unbound [35S]-GTPgS was separated by rapid filtration through GF/C filters, and counted by liquid scintillation. Nonspecific binding was determined in the presence of 50 mM unlabeled GTPgS. Basal [35S]-GTP-gS binding was 81.6 + 1.5 cpm/mg protein.

Dot Blot Hybridization and RT-PCR

[045] Hybridization to MTE array (CLONTECH) was carried out using 1.1 kb.p. fragment encoding open reading frame of Reso ERl following the manufacturer's protocol. Primers used in amplifications are 5'-ATGAGAATGGAGGATGAAGA-3' and 5'-TCAAAGCATGCCGGTCTCC-3' for human Reso ERl, 5'- ATGGAGTACGACGCTTA CAA-3' and 5'-TCAGAGGGTACTGGTCTCCTTCT-3' for mouse Reso ERl, 5*-GCTGACTATGGCTACAAAAGCTGG-3' and 5'- ATGCTCAGGGACTTGAGGAGG GTA-3' for COX-2, 5'-

GACCACAGTCCATGACATCACT-3' and 5'-TCCACCACCC TGTTGCTGTAG-3' for glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Amplified products were confirmed by direct sequencing.

MAP kinase activation

[046] MAP kinase activation in monocytes and HEK293 cells after treatment with

100 nM of each compound was determined. After incubations, cells were lysed in cold lysis buffer (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 0.5 mM EDTA, 1.0 % NP-40, 0.5 % sodium deoxycolate, 10 mM NaF, 10 mM sodium pyrophosphate) containing protease inhibitor cocktail (Sigma). 40 mg of protein was separated on SDS-PAGE and immunoblot was performed using anti-phospho-ρ44/42 MAP kinase (Cell Signaling) and anti-ERK (Santa Cruz) antibodies. For PTX treatment, HEK-Reso ERl cells were incubated with or without PTX (200 ng/ml) for 24 h at 37 °C and ERK activation was monitored by addition of Resolvin El (lOOnM) for 5 min. Activation of spleen dendritic cells with pathogen extract (STAg)

[047] Experiments were performed essentially as in (19). STAg was prepared from sonicated T. gondii (RH strain) tachzoytes. For isolated DC experiments, 70-85% CDllc positive DCs were isolated from spleen. CDl lc÷ DC suspensions (1.0 xl06 cells/ml) were spread into 96-well plates and incubated for 24 h with Resolvin El before the addition of STAg (5 mg/ml). After overnight culture, supematants were collected and IL-12p40 was measured with a sandwich ELISA. For in vivo treatments, C57BL/6 mice (n=3 per group) were injected intravenously with 100 ng Resolvin El. After 18 h the animals were challenged intraperitoneally with PBS (0.2 ml/mouse), STAg (5 mg/ml) and sacrificed after an additional 6 h. CDl lc+ DCs were isolated from spleen and IL12-p40 secretion was measured at 24 h. For DC migration, Splenic frozen section from mice treated as above but given 10 mg of Resolvin El or vehicle were stained for CDl lc and counterstained with hematoxylin.

RNA interference

[048] Chemically synthesized siRNA for mouse Reso ERl (5'-

AACACUGUGUGGUUUGUCAACdTdT-3') and Non-specific control IX siRNA (5'- AUUGUAUGCGAUCGCAGACUU-3') were from Dharmacon Research. Spleen cells (1.0 l06 cells/ml) were transfected using Chariot (Active Motif) following manufacturers' instructions. Briefly, siRNA was mixed with Chariot transfection reagent and incubated at room temperature for 30 minutes. Spleen cells were plated in serum-free RPMI medium, 200 ng siRNA/Chariot solution was added and incubated for 2 h at 37°C, followed by adding 10% FCS RPMI to the cultures. To assure effective inhibition of gene expression, cells were further incubated for 30 h at 37°C before STAg stimulation.

LC-MS/MS data

[049] Figure 6 illustrates results obtained from chromatographic analysis of synthetic and biogenic resolving El . [050] For note (a) LC-MS/MS was performed with Finnigan LCQ liquid chromatography ion trap tandem mass spectrometer equipped with a LUNA C18-2 (100 x 2mm x 5mm) column and a UV diode array detector using isocratic mobile phase (MeOH:H2O:AcOH at 65:35:0.01 (vol:vol:vol), with a 0.2 ml/min flow rate). For note (b) GC-MS was performed with a Hewlett-Packard 6890 equipped with a HP 5973 mass detector. A HP5MS cross-linked 5% ME siloxane column (30 m x 0.25 mm x 0.25 mm) was employed with a temperature program. The helium flow rate was 1.0 ml/min and the initial temperature was 150 °C, followed by 230 °C (2 min), and 280 °C (10 min). Trimethylsilyl derivatives were prepared with each compound following treatment with diazomethane. For note (c) spectra were recorded in methanol.

Inhibition of leukocyte infiltration in murine zymosan-induced peritonitis.

[051] 18R-HEPE (100 ng), Resolvin El (100 ng), or Indomethacin (100 ng) was injected intravenously into mouse tails followed by zymosan A into the peritoneum. Mice were sacrificed, and peritoneal lavages were collected (2 h) and cells enumerated (n=3).

Effect of pertussis toxin (PTX) on Resolvin El -induced ERK activation (a) and NF- kB inhibition (b).

[052] Figure 4d illustrate effects of PTX on Resolvin El induced activation and

NF-kB inhibition. In-(a) HEK-hReso ERl cells were incubated with or without PTX (200 ng/ml) for 24 h at 37 C and ERK activation was monitored by addition of Resolvin El (lOOnM) for 5 min. In (b) HEK293 cells were transiently transfected with pcDNA- hReso ERl, pNF-kfi-luciferase and pRL-TK. After 24 h with or without PTX (200 ng/ml), cells were exposed to Resolvin El (50 nM) for 30 min, stimulated with TNF-a (1.0 ng/ml) for 5 h, and luciferase activity was measured.

siRNA-directed silencing of Reso ERl expression in Hek293 cells.

[053] Hek293 cells (5.0 xl05 cells) were transiently co-transfected with haemagglutinin(HA)-tagged mouse Reso ERl expression plasmid (pHM6-mReso ERl, 0.5 mg) and siRNA (1.5 mg) using Superfect (Qiagen). After 48 h, cells were harvested and stained with anti-HA monoclonal antibody 3F10 and FITC-anti-rat IgG (Roche) and analyzed for cell-surface expression of HA-mReso ERl by flow cytometry. REFERENCES

[054] 1. De Caterina, R, Endres, S., Kristensen, S.D., Schmidt, E.B. eds. N-

3 fatty acids and vascular disease. Bi&Gi Publishers, Verona (1993). [055] 2. Marchioli, R. et al. Dietary supplementation with n-3 polyunsaturated fatty acids and vitamin E after myocardial infarction: results of the

GISSI-Prevenzione trial. Lancet 354, 447-455 (1999). [056] 3. Albert, CM. et al. Blood levels of long-chain n-3 fatty acids and the risk of sudden death. N. Engl. J. Med. 346, 1113-1118 (2002). [057] 4. Weiss, U. eds. Insight: Inflammation, Nature 420, 845 (2002).

[058] 5. Funk, CD. Prostaglandins and leukotrienes: advances in eicosanoid biology. Science 294, 1871-1875 (2001). [059] 6. Rowley, A.F., Hill, D.J., Ray, C.E., Munro, R. Haemostasis in fish, an evolutionary perspective. Thromb. Haemost. 77, 227-233 (1997). [060] 7. Serhan, CN. et al. Novel functional sets of lipid-derived mediators with antimflammatory actions generated from omega-3 fatty acids via cyclooxygenase

2-nonsteroidal antiinflammatory drugs and transcellular processing. J. Exp. Med. 192,

1197-1204 (2000). [061] 8. Serhan, CN. et al. Resolvins: A family of bioactive products of omega-3 fatty acid transformation circuits initiated by aspirin treatment that counter proinflammation signals. J. Exp. Med. 196, 1025-1037 (2002). [062] 9. Clish, C.B. et al. Local and systemic delivery of a stable aspirin- triggered lipoxin prevents neutrophil recruitment in vivo. Proc. Natl. Acad. Sci. USA

96, 8247-8252 (1999). [063] 10. Lawrence, T., Willoughby, D.A., Gilroy, D.W. Anti-inflammatory lipid mediators and insights into the resolution of inflammation. Nature Reviews. 2,

787-795 (2002). [064] 11. Tessier, P. A. et al. Chemokine networks in vivo. Involvement of C-

X-C and C-C chemokines in neutrophil extravasation in vivo in response to TNF-a. J.

Immunol. 159, 3595-3602 (1997). [065] 12. McMahon, B., Mitchell, S., Brady, H.R., Godson, C Lipoxins: revelations on resolution. Trends Pharmacol. Sci. 22, 391-395 (2001). [066] 13. Yokomizo, T., Izumi, T., Chang, K, Takuwa, Y., Shimizu, T. A G- protein-coupled receptor for leukotriene B4 that mediates chemotaxis. Nature 387, 620-

624 (1997). [067] 14. Gewirts, A.T. et al. Lipoxin A4 analogs attenuate induction of intestinal epithelial proinflammatory gene expression and reduce the severity of dextran sodium sulfate-induced colitis. J. Immunol. 168, 5260-5267 (2002). [068] 15. Samson, M. et al. ChemR23, a putative chemoattractant receptor, is expressed in monocyte-derived dendritic cells and macrophages and is a coreceptor for

SIV and some primary HIV- 1 strains. Eur. J. Immunol. 28, 1689-1700 (1998). [069] 16. Kopp, E., Ghosh, S. Inhibition of NF-kB by sodium salicylate and aspirin. Science 265, 956-959 (1994). [070] 17. Methner, A. et al. A novel G protein-coupled receptor with homology to neuropeptide and chemoattractant receptors expressed during bone development. Biochem. Biophys. Res. Commun. 233, 336-342 (1997). [071] 18. Endres, S. The effect of dietary supplementation with n-3 polyunsaturated fatty acids on the synthesis of interleukin-1 and tumor necrosis factor by mononuclear cells. N. Engl. J. Med. 320, 265-271 (1989). [072] 19. Aliberti, J., Hieny, S., reis e Sousa, C, Serhan, C.N., Sher, A.

Lipoxin-mediated inhibition of IL-12 production by DCs: a mechanism for regulation of microbial immunity. Nature Immunol. 3, 76-82 (2002). [073] 20. Nathan, C. Points of control in inflammation. Nature 420, 846-852

(2002). [074] 21. Topper, J.N., Cai, J., Falb, D., Gimbrone, M.A., Jr. Identification of vascular endothelial genes differentially responsive to fluid mechanical stimuli:

Cyclooxygenase-2, manganase superoxide dismutase, and endothelial cell nitric oxide synthase are selectively up-regulated by steady laminar shear stress. Proc. Natl. Acad.

Sci. USA 93, 10417-10422 (1996). [075] 22. Cheng, Y. et al. Role of prostacyclin in the cardiovascular response to thromboxane A2. Science 296, 539-541 (2002). [076] 23. Yokomizo, T., Kato, K., Terawaki, K, Izumi, T., Shimizu, T. A second leukotriene B4 receptor, BLT2: A new therapeutic target in inflammation and immunological disorders. J. Exp. Med. 192, 421-431 (2000). [077] 24. Serhan, CN. Endogenous chemical mediators in anti-inflammation and pro-resolution. Curr. Med. Chem. 1, 177-192 (2002). [078] 25. Capdevila, J.H. et al. The highly stereoselective oxidation of polyunsaturated fatty acids by cytochrome P450BM-3. J. Biol. Chem. 271, 22663-

22671 (1996).

Claims

CLAIMSWhat is claimed is:What is claimed is:

1. A method for screening a candidate substance for anti-inflammatory activity, comprising contacting a cell that expresses a Reso E receptor with the candidate substance; and detecting a biological activity mediated by the Reso E receptor.

2. The method of claim 1 wherein the biological activity is reduced cytokine induced activation of a NF-kB transcription factor relative to a cell not contacted with the candidate substance.

3. The method of claim 2 wherein the cytokine is selected from the group consisting of TNF-α and IFN-γ.

4. The method of claim 1 wherein the biological activity includes reduced cytokine induced COX-2 expression relative to a cell not contacted with the candidate substance.

5. The method of claim 1 comprising introducing an isolated nucleic acid into the cell prior to contacting the cell with the substance, the isolated nucleic acid being operably configured to express the Reso E receptor in the cell.

6. The method of claim 5 wherein the cell is from a cultured cell line.

7. The method of claim 6 wherein the cultured cell line does not endogenously express the Reso E receptor.

8. The method of claim 6 wherein the cultured cell line is a HEK293 cell line.

9. The method of claim 1 wherein the cell is from a cultured cell line that endogenously expresses the Reso E receptor.

10. The method of claim 9 wherein the cultured cell line is a THP-1 cell line.

11. The method of claim 1 wherein the biological activity is reduced expression of a reporter protein encoded by a nucleic acid sequence operably linked to a control sequence that is transcriptionally regulated by the NF-kB transcription factor.

12. The method of claim 11 wherein the reporter protein is luciferase.

13. The method of claim 1 wherein the cell is a leucocyte.

14. The method of claim 9 wherein the leucocyte is selected from the group consisting of monocyte, neutrophil, and T-lymphocyte.

15. The method of claim 14 wherein the leukocyte is a monocyte that is an APC selected from the group consisting of a macrophage and a dendritic cell.

16. The method of claim 1 wherein the cell is selected from the group consisting of a brain cell and a glioma cell.

17. The method of claim 1 wherein the cell is contained within a dorsal air pouch and wherein the method further includes contacting the dorsal air pouch with a cytokine that induces NF-kB expression.

18. The method of claim 17 wherein the cytokine is selected from the group consisting of TNF-α and IFN-γ.

19. The method of claim 17 wherein the biological activity is reduced recruitment of leukocytes into the dorsal pouch relative to cells not contacted with the candidate substance.

20. The method of claim 1 wherein the biological activity is binding of a hydrolysis resistant GTP analog to a G-protein that interacts with the Reso E receptor.

21. The method of claim 1 wherein the cell is a splenic cell and the biological activity is reduced expression of a cytokine that induces monocyte migration to splenic cells relative to a cell not contacted with the candidate substance.

22. The method of claim 21 wherein the splenic cell comprises an activated splenic dendric cell, and the biological activity is reduced expression of IL- 12 from the splenic dendritic cell.

23. The method of claim 22 wherein the splenic dendritic cell is a CDl lc⁺ cell.

24. The method of claim 1 wherein contacting the cell comprises administering the candidate substance to an animal in vivo, and the biological activity is reduced expression of 11-12 and reduced migration of dendritic cells into T-cell areas of a spleen relative to a an animal not administered the candidate substance.

25. The method of claim 1 wherein the Reso E receptor is selected from the group consisting of the murine Reso E receptor according to SEQ.ID NO: a rat Reso E receptor according to SEQ.ID NO: and human Reso

ERl according to SEQ.ID NO:

26. The method of claim 1 wherein the Reso E receptor is human Reso ERl.

27. The method of claim 1 wherein the candidate substance comprises a resolvin molecule.

28. The method of claim 27 wherein the resolvin molecule is a poly- hydroxylated eicosapentaenoic acid. (pH-EPA)

29. The method of claim 27 wherein the resolvin molecule is Reso-El .

30. A method of identifying a receptor that mediates an anti- inflammatory activity of a resolvin substance, comprising introducing a nucleic acid configured to express a G-protein coupled receptor (GPCR) into a cell that does not endogenously express the GPCR; contacting the cell with a substance comprising a resolvin; and detecting that the cell has a reduced cytokine induced activation of a NF-kB transcription factor relative to a cell not contacted by the substance.

31. A method for screening a candidate substance for anti-inflammatory activity, comprising, detecting that the candidate substance alters an activity mediated by a GPCR receptor.

32. A method for identifying a substance that interacts with a receptor that mediates an anti-inflammatory activity, comprising interacting a candidate substance with a receptor that reduces cytokine induced (NF)-κB activation.

33 The method of claim 1, wherein the receptor is a G-protein coupled receptor (GPCR).

34. The method of claim 33, wherein the GPCR is selected from the group consisting of FPR (P21462), FPRL2(P25089), GPR1(A55733), GPR32(O75388), Dez(Q99788), CRTH2(Q9Y5Y4), C3AR(Q16581) and C5AR(P21730).

35. The method of claim 34, wherein -the GPCR is Dez (Q99788) according to SEQ.ID NO: .

36. The method of claim 1, wherein the receptor is introduced into a HEK293 cell by introducing an isolated nucleic acid configured to express the receptor in the HEK293 cell..

37. An isolated nucleic acid operably configured to express a nucleic acid that encodes a sufficient amount of a resolvin receptor polypeptide to mediate a biological response of the polypeptide when introduced into a cell.

38. The isolated nucleic acid of claim 37 wherein the resolvin receptor polypeptide is according to SEQ.ID NO:

39. The isolated nucleic acid of claim 37 wherein the nuclidic acid encoding the polypeptide comprises the Reso-Rl Dezaccording to SEQ.ID NO:

40. The isolated nucleic acid of claim 37 wherein the polypeptide sequence is a human sequence.

41. The isolated nucleic acid of claim 37 wherein the polypeptide sequence is a murine sequence.

42. A method of identifying a receptor that mediates an anti- inflammatory activity comprising; providing a siRNA against a nucleic acid that encodes a candidate receptor, expressing the siRNA in a cell that expresses the candidate receptor; subjecting the cell to a condition that induces pro- inflammatory response; and detecting whether expressing the siRNA in the cell increases the proτ inflammatory response relative to a cell subjected to the condition but not expressing the siRNA.

43. The method of claim 42 wherein the pro-inflammatory response is increased production of IL-12.