WO2005063980A1

WO2005063980A1 - METHOD OF ENZYMATICALLY CONSTRUCTING RNAi LIBRARY

Info

Publication number: WO2005063980A1
Application number: PCT/JP2004/019612
Authority: WO
Inventors: Kenzo Hirose; Daisuke Shirane; Kohtaroh Sugao; Shigeyuki Namiki; Masamitsu Iino
Original assignee: Toudai Tlo, Ltd.
Priority date: 2003-12-31
Filing date: 2004-12-28
Publication date: 2005-07-14
Also published as: JPWO2005063980A1; JP4747245B2; WO2005063980A8

Abstract

It is intended to provide a method of enzymatically preparing a systematic RNAi library from a target DNA. According to this method, a target DNA can be prepared not only from the cDNA or genomic sequence of a specific gene but also from a cDNA library. It is also intended to provide a screening method whereby a clone carrying an iRNA expression construct having a desired silencing activity can be selected from an RNAi library. In this screening, more efficient selection can be made by fusing a reporter gene or a negative selection marker with a target DNA.

Description

Specification

Enzymatic construction of RNAi library

Technical field

The present invention relates to a method for constructing an RNAi library based on a DNA expression vector, and particularly to a method for enzymatically constructing a systematic library for a target sequence. The present invention relates to a screening method for selecting an appropriate iRNA expression construct capable of silencing a target gene or the like using the above-described RNAi library constructed enzymatically.

Background art

[0002] A reverse genetics approach that determines the function of each gene by functional loss using the large amount of genome data currently available (Non-Patent Documents 1-5) has It has become an important technique to fully elucidate the relationship. Techniques for implementing the reverse genetics approach include the creation of knockout animals by gene targeting or antisense techniques.

Gene targeting technology by homologous recombination (Non-Patent Document 6) is widely used to determine the functions of various genes. However, the process is labor intensive and cannot be applied simply and widely. Also, antisense oligonucleotides can be used more conveniently, but their introduction often results in toxicity, instability, and non-specific effects (Non-Patent Document 7).

On the other hand, RNA interference (RNAi), a gene suppression phenomenon induced by double-stranded RNA (Non-Patent Document 8), is usually specific, and moreover, gene suppression is unprecedented in a wide range of organisms. The ability to obtain a body makes it an attractive alternative to gene targeting and antisense technologies (Non-Patent Documents 7, 9). RNAi has also been applied to genome-wide reverse genetics in C. elegans (Non-Patent Document 10). However, the use of RNAi was initially limited to invertebrates because long (> 30 nucleotides) double-stranded RNAs in higher vertebrates induced harmful interferon responses! The problem is a short (21-23 nucleotide) double strand called short interfering RNA (siRNA). Strand RNA force was overcome by the finding that RNAi is induced in mammals without causing adverse events (Non-Patent Document 11). Transient oligo siRNA effects are overcome by the development of DNA vectors that express siRNAs or short-chain, hairpin-shaped double-stranded RNAs (shRNAs) in cells that mimic siRNAs. (Non-Patent Documents 12-17).

Special Reference 1: Consortium, T.C.e.S. Genome sequence of the nematode C. elegans: a platform for investigating biology. Science 282, 2012-2018 (1998).

Non-Patent Document 2: Adams, M.D. et al. The genome sequence of Drosophila

melanogaster. Science 287, 2185-2195 (2000).

Patent Document 3: Waterston, R.H. et al. Initial sequencing and comparative analysis of the mouse genome.Nature 420, 520-562 (2002).

Patent Document 4: Lander, E.S. et al. Initial sequencing and analysis of the human genome.Nature 409, 860—921 (2001).

Non-Patent Document 5: Venter, J.C. et al. The sequence of the human genome.Science 291, 1304-1351 (2001).

Non-Patent Document 6: Capecchi, M.R.The new mouse genetics: altering the genome by gene targeting.Trends Genet. 5, 70-76 (1989).

Patent Document 7: Opalinska, J.B. & Gewirtz, A.M.Nucleic-acid therapeutics: basic principles and recent applications.Nat. Rev. Drug Discov. 1, 503-514 (2002).

Non-Patent Document 8: Fire, A. et al. Potent and specific genetic interference by

Double-stranded RNA in Caenorhabditis elegans.Nature 391, 806-811 (1998) .Non-Patent Document 9: Dykxhoorn, DM, Novina, CD. & Sharp, PA Killing the messenger: short RNAs that silence gene expression.Nat. Rev. Mol. Cell Biol. 4, 457-467 (2003).

Patent Document 10: Kamath, R.S. & Ahringer, J. Genome-wide RNAi screening in Caenorhabditis elegans.Methods 30, 313-321 (2003).

Non-patent literature ll: Elbashir, SM et al. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells.Nature 411, 494-498 (2001). Patent Document 12: Brummelkamp, TR, Bernards, R. & Agami, R.A system for stable expression of short interfering RNAs in mammalian cells.Science 296, 550-553 (2002).

Patent Document 13: Miyagishi, M. & Taira, K. U6 promoter-driven siRNAs with four uridine 3 overhangs efficiently suppress targeted gene expression in mammalian cells.Nat. Biotechnol. 20, 497-500 (2002).

Non-Patent Document 14: Yu, JY, DeRuiter, SL & Turner, DL RNA interference by expression of short-interfering RNAs and hairpin RNAs in mammalian cells.Proc.Natl.Acad.Sci. USA 99, 6047-6052 (2002).

Non-Patent Document 15: Sui, G. et al. A DNA vector-based RNAi technology to suppress gene expression in mammalian cells.Proc. Natl. Acad. Sci. USA 99, 5515—5520 (2002).

Non-Patent Document 16: Lee, NS et al. Expression of small interfering RNAs targeted against HIV-1 rev transcripts in human cells.Nat.Biotechnol. 20, 500-505 (2002) .Non-Patent Document 17: Paul, CP., Good, PD, Winer, I. & Engelke, DR Effective expression of small interfering RNA in human cells.Nat. Biotechnol. 20, 505—508 (2002).

Disclosure of the invention

Problems to be solved by the invention

[0003] Despite the development of RNAi technology, it has effective gene silencing activity

There is still no general rule for designing siRNA / shRNA expression constructs, so it takes time and money to identify suitable constructs.

RNAi is also considered to be specific. Depending on the designed sequence, a phenomenon called “off-target effect” that suppresses specific genes other than the target has also been detected. Therefore, in order to avoid off-target effects, it has become important to design siRNA or shRNA for which sequence in the target gene.

Means for solving the problem

[0004] The present invention relates to a library of shRNA expression constructs capable of systematic screening. An object of the present invention is to provide a production method and a screening method capable of selecting an expression construct having a desired silencing activity using the library. To this end, the present inventors have developed a technique called EPRIL (enzymatic production of RNAi libraries). That is, a target gene or the like is randomly cut, and adapters are connected to both ends of the random fragment. When one of the adapters has a hairpin structure, a fragment having a hairpin structure with a random fragment at the center is obtained. By extending the fragment converted into the hairpin structure with a polymerase having strand displacing activity, an iRNA expression construct capable of mainly expressing a hairpin double-stranded RNA is produced.

In addition, the present inventors fused a target gene with a reporter gene to select a target gene for silencing using the reporter gene silencing as an index. Further, the present inventors also provided a thymidine kinase gene which is a negative selection marker. Using this technique, a technology was developed that enables selection of an shRNA expression construct having the most effective silencing activity from the RNAi library. Furthermore, the present inventors have also shown that the library production method of the present invention can be applied to directly producing an RNAi library from a cDNA library. That is, the present invention is as described below.

1. A method for producing a desired target DNA polymerase RNAi library, comprising the following steps (1) and (3).

(1) randomly cutting the target DNA to generate a DNA fragment,

(2) connecting a hairpin-type adapter to one end of the DNA fragment to generate a hairpin-type DNA fragment;

(3) A method for producing an RNAi library, comprising the step of: causing a hairpin-type DNA fragment to undergo primer extension using a polymerase having Strand-displacing activity to generate an iRNA expression construct encoding interference RNA.

2. before or after the step (2), a step of connecting a double-stranded stump type adapter to the other end of the DAN fragment,

Either the double-stranded stump type adapter or the hairpin type adapter is provided with a restriction enzyme recognition site of an outside cutter, The adapter having the restriction enzyme recognition site is connected to the DNA fragment first, and the other adapter is connected to the end formed by adjusting the length of the DNA fragment by the restriction enzyme of the outside cutter. The method according to 1 above.

3. The method according to the above 2, wherein the hairpin-type adapter is provided with a restriction enzyme recognition site for an outside cutter.

4. The method according to the above 2, wherein the double-stranded stump-type adapter is provided with a restriction enzyme recognition site for an outside cutter.

5. The method for producing an RNAi library according to the above 1, further comprising a step of connecting the iRNA expression construct to the expression vector after the primer extension.

6. The method for producing an RNAi library according to the above item 5, wherein the expression vector can function in a mammal.

7. The method for producing an RNAi library according to the above 5 or 6, wherein the expression vector has an integration activity into a host chromosome.

8. The method for producing an RNAi library according to any one of the above items 17, wherein the target DNA is any one of a cDNA of a specific gene, a cDNA library, and a cDNA after subtraction.

9. The method for producing an RNAi library according to the above item 1, wherein in the step (1), the target DNA is fragmented using a DNA digestive enzyme that can be used for shotgun closing.

10. The method for producing an RNAi library according to any one of the above items 19, wherein the restriction enzyme of the outside cutter cuts at least 19 bp away from the recognition site in the first adapter.

11. The method for producing an RNAi library according to any one of the above 1 to 10, wherein the polymerase having a strand-displacing activity is heat-resistant.

12. The method for producing an RNAi library according to any one of 1 to 11 above, wherein the RNAi library is any one of a polymerase polymerase having a strand—displacing activity and a Vent polymerase.

13. An RNAi library produced by the method according to any one of 1 to 12 above.

14. From the RNAi library produced by the method described in any of 1 to 12 above A method for screening an siRNA expression construct having a desired RNAi activity, comprising introducing the RNAi library into a cell expressing a target DNA,

Measuring the expression of the target DNA.

15. In the screening method according to 14 above,

As a fusion gene obtained by fusing target DNA with a reporter gene,

A screening method, wherein in the step of measuring the expression of the target DNA, the expression of the target DNA is measured using the activity of the reporter protein as an index.

16.A method for screening an siRNA expression construct having a desired RNAi activity from the RNAi library produced by the method according to any one of the above 1 to 12, wherein the target DNA is fused with a negative selection marker gene. Introducing the RNAi library into cells expressing the fusion gene,

Performing a selection with a negative selectable marker to select only cells having an RNAi effect.

17. A system for producing an RNAi library,

Including a hairpin type adapter and a double-stranded stump type adapter,

A system, wherein any of the adapters is provided with a restriction enzyme recognition site for an outside cutter.

18. The system according to the above 17, further comprising an outside cutter restriction enzyme and a polymerase having Z or Strand-displacing properties.

Brief Description of Drawings

FIG. 1 is a diagram showing an outline of EPRIL. (A) Illustrated protocol for enzymatic induction of cDNA into an shRNA expression library. (B) PAGE of DNAs during enzymatic induction. M, 25 bp ladder-shaped DNA marker. Lanes 1, 2, and 3 show the ligation of the first adapter and the product after Mmel digestion, the adapter 2-ligation fragment, and the fragment after the polymerase reaction. For each lane, the product is indicated by the arrowhead.

FIG. 2 is a diagram showing silencing of GFP expression by an RNAi library prepared from cDNA encoding GFP. (A) Histogram showing the distribution of RNAi efficiency. Bars represent the number of shRNA expression constructs. Circles indicate the normalized cumulative frequency. (B) Depending on the value of the fold reduction The fractional amounts of shRNA expression constructs with greater efficiency indicated are plotted against fold reduction. (C) Location and efficiency of individual shRNA expression constructs. The vertical axis represents the relative decrease and the horizontal axis represents the position of the GFP sequence. Each short horizontal bar represents the location and its RNAi efficiency. The orientation of the shRNA expression constructs is likewise indicated by the color of the bars, and the gray and black bars indicate shRNA expression constructs in which the guide sequence is 5 'and 3' to the inverted repeat sequence, respectively. (d) Plot the mean of the relative reduction for each position of the GFP sequence (mean value SD). The numbers in parentheses indicate the number of data for each group.

FIG. 3 shows RNAi efficiency profiles obtained by various transduction operations. (a) Compare the efficiency of GFP silencing by transfection of plasmid (left vertical axis, solid circle) or PCR amplified expression cassette (right vertical axis, gray circle) with retroviral transduction (horizontal). axis). (B) Efficiency of GFP silencing by in vitro transcribed shRNA transfection with Dicer digestion (grey circles) and without (black circles) is plotted against efficiency by plasmid transfection. (Horizontal axis).

[Figure 4] Silencing of type 1 IPR expression by an RNAi library derived from IPR cDNA

3 3

FIG. (A) Estimated RNAi efficiency based on GFP fluorescence intensity. The relative decrease in GFP fluorescence intensity is shown. Square boxes represent the IPR coding regions, and dots represent the respective shRNA expression

Three

Indicates the location of the target of the construct. Data on shRNA expression constructs, SI2A5 and SI3G6, are provided. (b) No shRNA expression construct (control), GFP-silencing shRNA expression vector (shGFP), or shRNA expression constructs targeting IPR (SI2A5 and

Three

Western blotting of A7r5 cells infected with a retrovirus, which have A3r6 and SI3G6). Actin has a role as a loading control. Edited standardized IPR expression level

Three bells are shown in the lower panel (mean SEM, n = 3). (C) IPR targeting shRNA expression

Three

Figure 4 shows the intracellular calcium response of A7r5 cells induced by nosopletsusin without transduction of the construct and with the introduction of SI2A5 or SI3G6. Bar indicates application of AVP.

FIG. 5 shows a thymidine kinase-based system for efficient RNAi construct selection. (A) Selection strategy scheme. The upper figure shows the selectable marker gene construct. TK-puro indicates mRNA encoding a fusion protein of thymidine kinase and puromycin N-acetyltransferase. GCV is converted to a toxic derivative of GCV (GCV-ppp), which leads to cell death. (B) RNAi effect of a mixture of reconstituted shRNA expression constructs in an RNAi library after GSV selection (left panel) and without selection (right panel). The continuous curve in the right panel represents data from the parent shRNA library. The dashed curve represents the GFP fluorescence distribution without transduction of the shRNA expression construct. (c) Analysis of individual RNAi library clones with or without GCV selection! Individual clones were classified into four categories according to their RNAi efficiency; weak (fold reduction value of 1.5), moderate (1.5-2.5), strong (2.5-4.5) and very strong (> 4.5). The normalized population represents the number of clones in each classification normalized to the total number of clones (n = 121 and 101 for clones with and without GCV selection, respectively).

BEST MODE FOR CARRYING OUT THE INVENTION

[0007] siRNA expression construct

According to the present invention, a method for producing an RNAi library from a desired target DNA has been provided. The RNAi library produced by the present invention is a library applicable to the genetics of mammals, plants, insects, yeasts and the like. Therefore, in the present specification, "iRNA" is applied to mammalian cells and the like, and is referred to as "short, double-stranded RNA (generally referred to as" siRNA "). ), Short hairpin-type double-stranded RNA (generally referred to as “shRNA” and this term is used synonymously in this document) and siRNA applied to gene suppression of nematodes, insects, plants, yeasts, etc. Compared to the above, it is used to include double-stranded RNA.

The method for producing an RNAi library of the present invention firstly includes a step of randomly cutting target DNA into fragments. Here, the target DNA may be a specific gene, a plurality of genes, a group of genes contained in an individual, a genomic or cDNA library, or the like. Here, the “gene” may be a genomic sequence containing introns, or may be a cDNA or the like. The species from which these genes and libraries are derived are not limited to mammals such as humans, plants, insects, bacteria and the like as described above.

[0008] In the first step, a desired target DNA is prepared and randomly fragmented. Fragment The length may be at least a length encoding an RNA capable of inducing RNAi, for example, ten or more bp or more. The appropriate length depends on the cell type for which silencing is to be induced. For example, in a mammalian cell, it can be 19 to 400 bp, preferably 19 to 200 bp, more preferably 19 to 50 bp. On the other hand, in plants and fungi, gene silencing can be induced even with long iRNAs of, for example, about 500 bp. Therefore, the enzyme that can be used in this step has a length corresponding to the cell type that induced the silencing! /, If it can produce a fragment larger than that, There are no restrictions on the type. Examples of enzymes that can be used include, but are not limited to, DNasel and restriction enzymes that can be used for shotgun clawing, such as CvilJI, HaeIII, Rsal, Alul, and Hpal.

[0009] In the second step, the above-mentioned DNA fragment force is used to generate a hairpin-type DNA using a hairpin-shaped oligonucleotide adapter (hereinafter referred to as "hairpin-type adapter"). Here, the “hairpin-type adapter” functions as a linker connecting at least one end of the double-stranded DNA fragment into a hairpin shape, and finally obtains iRNA expression by this method. It encodes an RNA linker that connects the antisense RNA strand to a hairpin. The hairpin-type adapter can be of any length, for example, 5-50 base, preferably 6-20 base, as long as it is effective for inducing RNA interference. However, it is also possible to use a hairpin type adapter having the length shown here or more. By adjusting the length by trimming in the process of constructing an iRNA expression construct described below, the length can be adjusted to the appropriate length when the iRNA expression construct is generated. In addition, by designing the hairpin portion to encode tRNA or combining it with a hammerhead ribozyme, the design should be such that the long hairpin RNA portion can be trimmed in cells to produce siRNAs of appropriate length. You can also. The sequence of the hairpin-type adapter may be any of artificial sequences and microRNA-derived sequences. The hairpin type adapter is preferably made of DNA, but may be made of RNA.

[0010] When a hairpin-type adapter is added to the random DNA fragment, the hairpin-type adapter generally binds to both ends of the DNA fragment unless the terminal structure of the DNA fragment is controlled. If the adapter binds to both ends of the DNA fragment, the operation of the primer extension described later will be hindered. Therefore, only one end of the double-stranded DNA In order to form a hairpin-type DNA to which the adapter is bound, a hairpin-type adapter is bound to both ends of the DNA fragment to cut the double-stranded portion of the circularly ligated DNA fragment to generate two hairpin-type DNAs. It is possible to do. In order to generate a hairpin-shaped DNA, such a DNA fragment having a circular shape can be cut by using a restriction enzyme that randomly cuts a double-stranded region derived from a DNA fragment. However, in order to control the efficiency of hairpin DNA production and the length of hairpin DNA, a restriction enzyme recognition site for an outside cutter is provided inside the hairpin adapter, and the double-stranded DNA region is ligated with this restriction enzyme. It is preferable to use a cutting method. Hairpin type DNA double strand

Regarding the control of the length of the DNA region, since it is said that a double-stranded RNA of about 19 to 21 bp can induce effective RNA interference in mammals, it is necessary to prepare an RNAi library to be applied to mammals. In this case, the restriction enzyme of the outside cutter is preferably an enzyme that cuts a site at least 19 bp or more away from the recognition site. An example of such an enzyme is Mmel. For example, Mmel breaks the double strand 20 or 21 bases away from the recognition site. Therefore, by providing an Mmel recognition site at the end of the hairpin-type adapter, the DNA fragment to which this hairpin-type adapter is connected is connected to one end of the 20-21 base DNA fragment by Mmel digestion. Hairpin-shaped DNA is generated. Thus, Mmel is a preferred restriction enzyme that produces a hairpin-type DNA encoding an effective length of iRNA that silences the target gene in mammalian cells. In addition to Mmel, similarly to Mmel, an enzyme that cuts a position 20 to 21 bases away from the recognition site is effective in this step. In the case of a restriction enzyme that cuts a site separated by 20-21 bases or more, the length of the DNA fragment encoding the iRNA can be adjusted by adjusting the position of the restriction enzyme recognition site in the adapter length adapter. Can be adjusted as desired.

As described above, the ability to perform trimming in any of the processes of generating an iRNA expression construct when a hairpin-type adapter is used. This trimming method is based on whether the adapter is DNA-based or RNA-based. It depends on whether it is a base. If the adapter is DNA-based, provide an optional restriction enzyme recognition site or cleavage site for trimming within the adapter, digest with this restriction enzyme, and then reconnect by ligation. Thus, the length of the adapter can be adjusted. The restriction enzyme for trimming may be any restriction enzyme capable of shortening the length of the adapter, which is particularly limited. As shown in Examples described later, Bcgl, which performs bidirectional cleavage from a recognition site, can be given as an example of a restriction enzyme. By providing a recognition site for Bcgl in the adapter, the inside of the adapter can be cut at two places with one restriction enzyme, Bcgl, so that trimming can be performed easily. It is of course possible to adjust the length of the adapter by combining two restriction enzymes. When an RNA-based adapter is used, an RNA / DNA hybrididoni heavy chain is formed in the adapter region by the primer extension described below. Trimming of the RNA / DNA hybrid region can be performed by first quenching the RNA chain with RNaseH, and then digesting the ssDNA with an enzyme that digests single-stranded DNA (ssDNA enzyme).

[0012] In the third step, an iRNA expression construct is generated using a hairpin-type DNA formed by adding a hairpin-type adapter to the DNA fragment. By primer extension of the hairpin-type DNA duplex using a polymerase having a strand-displacing activity, an iRNA expression construct in which a complementary sequence is head-til-bonded with an adapter interposed is generated. Here, an iRNA expression construct may be generated by the above-mentioned primer extension while the hairpin-type DNA generated in the above step is left as it is, but preferably, the adapter of the hairpin-type DNA is connected before performing the primer extension. It is preferable to protect the other end with another adapter. Here, an adapter to be connected for end protection is a DNA adapter having a truncated structure at both ends (hereinafter referred to as a “double-stranded truncated adapter” for convenience). "Or" Stump type adapter ". The sequence of this adapter is not particularly limited. The length is, for example, 5 to 100 bases, preferably 20 to 40 bases in consideration of the cost of synthesizing the adapter. However, even if the length is longer than this, naturally the protection of the DNA end can be achieved. Therefore, there is basically no upper limit of the length as long as it does not hinder the experimental operation.

[0013] In addition, since the stump-type adapter 1 is added for the purpose of protecting a DNA fragment, it is preferable that the adapter be removed after the primer extension is completed. Ply to be described in detail In order to facilitate removal of the stump-type adapter after mer-extension, it is preferable that the stump-type adapter is provided with a restriction enzyme site for excision or a cleavage site. There are no particular restrictions on the restriction enzymes that can excise the stump-shaped adapter V. It is preferable to use it. For example, Bpml cuts a position at a certain distance from a recognition site, as shown in an example described later. Therefore, by designing the Bpml recognition site in the stump-shaped adapter so that this cleavage site becomes the boundary between the DNA fragment and the stump-shaped adapter, the stump-shaped adapter is almost removed from the iRNA expression construct, The adapter sequence is completely removed by further digesting the remaining sticky ends with an enzyme having ssDNA digestion activity. The truncated adapter sequence is added to both ends of the iRNA expression construct. By cutting both ends with different restriction enzymes, it is possible to control the direction of connection to a vector described later. As shown in the examples below, one truncated adapter is excised with B pml and the other with Bbsl to remove the truncated adapters at both ends and to control the structure of both ends of the iRNA expression construct. It is possible to design a stump type adapter to obtain.

The hairpin DNA to which the stump-type adapter is connected is subjected to primer extension using a primer capable of aligning with the end of the adapter and a polymerase having a strand-displacing activity. The polymerase used here should have at least a strand displacing activity, but it is preferable that the polymerase be heat-resistant in order to perform this operation using a PCR device. Klenow Fragment and phi29 are examples of polymerases having a strand-displacing activity, and Bst polymerase and Vent polymerase are examples of those having a thermophilic property. The extension conditions can be appropriately determined depending on the polymerase used. For example, the conditions when Bst polymerase is used are described in an example described later. When the hairpin-type adapter is RNA-based, it is necessary to use an enzyme having a reverse transcription activity in addition to the above strand-displacing activity.

[0015] By performing the above primer extension, a truncated adapter is provided at both ends. A double-stranded DNA having a structure in which DNA fragments derived from the target DNA are head-tilled with a hairpin-shaped adapter is formed between the sequences. An unnecessary truncated adapter sequence at the end is removed from this structure to generate an iRNA expression construct. Unnecessary truncated adapter sequences can be removed by cutting with a restriction enzyme that recognizes the site provided on the truncated adapter. When the truncated adapter is trimmed by the restriction enzyme, a huge iRNA expression construct is generated.

[0016] The desired fragment may be purified in the process until the iRNA expression construct is produced, each time an adapter is added or digested with a restriction enzyme, or at the final stage of purification of the iRNA expression construct. It is preferable to remove excess adapters and fragments to be removed with a restriction enzyme from the reaction system. As an example of the purification, a method of extracting a fragment having a desired or expected length from the gel after electrophoresis, or a method of purifying the fragment using a tag or the like can be mentioned.

In the above embodiment, an example in which a hairpin-type adapter is added first after fragmentation of the target DNA and then a stump-type adapter is added, but the reverse operation is also possible.

[0017] As described above, the iRNA expression construct thus produced is connected to a vector to construct an RNAi library. The vector can be selected depending on the cell type to which the present library is to be applied, but preferably an expression vector having a plasmid backbone that can be amplified in a bacterium such as Escherichia coli can be suitably used. Examples of such a plasmid backbone that can be amplified in Escherichia coli and the like include M13-based vectors, pUC-based vectors, pBR322, pBluescript, and pCR-Script. Since such a bacterial plasmid can be amplified in a large amount, it is easy to prepare a large amount of a library, and it is convenient when performing a treatment such as trimming of a hairpin type adapter sequence. It is preferable to carry a drug selection marker such as Amp, an auxotrophic gene, and the like, as necessary, on the bacterial plasmid.

[0018] It is preferable that such a plasmid backbone is provided with an expression cassette corresponding to the host to be tested. The promoter in the expression cassette may be any suitable for the host cell. In the case of mammalian cells, it is preferable to use an RNA polymerase III-driven promoter for expressing short RNAs such as siRNA / shRNA. Better!/,. RNA polymerase III driven promo Examples of the promoter include a mouse U6 gene-derived promoter, a tRNA promoter, an adenovirus VA1 promoter, a 5S rRNA promoter, a 7SK RNA promoter, a 7SL RNA promoter, and an HI RNA promoter. To integrate the iRNA expression construct into the chromosome and stably express iRNA, it is preferable to use a retrovirus expression cassette and incorporate the iRNA expression construct into this cassette. An example using a retrovirus expression cassette will be described in Examples described later.

[0019] In order to express iRNA and carry out forward or reverse genetics in animal cells, plant cells, and the like, a vector depending on the host cell may be selected. For example, expression vectors derived from insect cells such as mammalian-derived expression vectors, for example, pcDNA3 (manufactured by Invitrogen), pEGF-BOS (Nucleic Acids. Res. 1990, 18 (17), p5322), pEF, and pCDM8 Vectors, for example, Bac-to-BAC baculovairus expression system (manufactured by Gibco BRL), plant-derived expression vectors such as pBacPAK8, and animal virus-derived expression vectors such as ρΜΗ1 and pMH2, for example, pHSV, pMV, pAdexLcw A retrovirus-derived expression vector, for example, pZIPneo, etc., yeast-derived expression vector, for example, `` Pichia Expression KitJ (manufactured by Invitrogen), pNVll, SP-Q01, etc. For example, pPL608, pKTH50, etc. The huge iRNA expression constructs described above are inserted into individual vectors to generate an RNAi library.

[0020] The RNAi library generated here can be directly used for forward and reverse genetics. In addition, an oligo-RNAi library is synthesized from the RNAi library of the present invention using an in vitro transcription system, and this oligo-RNAi library is generated and then used for research on forward and reverse genetics. Is also good.

[0021] Screening method

The present invention provides a screening method for selecting a clone having an iRNA expression construct capable of suppressing the expression of a target gene as described above in the RNAi library. Specifically, the screening method of the present invention comprises a step of introducing an RNAi library prepared from a target DNA by the above method into cells expressing the target DNA, and a step of measuring the expression of the target DNA. included.

[0022] The method for introducing an RNAi library into cells expressing the target DNA is as follows. One can be appropriately selected depending on the vector used when constructing one. For example, when a virus vector having infectivity is used, an RNAi library is introduced into cells due to the infectivity of the virus. In the case of a plasmid vector, a method using catonic ribosome DOTAP (manufactured by Boehringer Mannheim), electoral poration, lipofection, gene gun, calcium phosphate, DEAE dextran, etc. ! / You can.

[0023] Expression of the target DNA may be measured based on the expression level of the protein using an antibody against the target DNA. If the activity of a specific gene has been identified, the measurement may be performed. You may measure based on activity. For example, if it is known that the downstream gene is regulated as the activity of the target DNA, the expression of the target DNA is indirectly measured by measuring the expression of the downstream gene. Is also good.

[0024] When the function of the target DNA is unknown or the activity is difficult to measure, a transformant in which a fusion gene in which a reporter gene is connected to the target DNA is prepared is prepared. It is preferable to conduct screening.

[0025] For example, as a reporter, an enzyme such as a fluorescent protein (luciferase, GFP, CFP, YFP, RFP, etc.), aminoglycoside transferase (APH), thymidine kinase (TK), dihydrofolate reductase (dhfr) is used. Can be. By connecting the target DNA to the gene encoding such a reporter, the mRNA of the fusion gene is expressed in the cell. The iRNA against the target DNA expressed as a whole in the RNAi library suppresses the expression of this fusion gene, and the reporter activity decreases. Therefore, by using such a fusion gene in which the target DNA is fused with a reporter gene, it is possible to easily measure the silencing activity of each clone of the RNAi library with respect to the target DNA using the reporter activity as an index. . For example, when used for a reporter gene such as the fluorescent protein, the silencing activity of each clone in the RNAi library can be measured based on the decrease in the expression of the fluorescent protein. On the other hand, when a negative selection marker such as TK is used, the clones having no silencing activity in the RNAi library cannot suppress the TK activity, and the cells are killed by the addition of ganciclovir. On the other hand, in clones having silencing activity, TK activity is suppressed and The cells can survive even with the luster. When a negative selection marker is used as a reporter in this manner, only the cells into which the clones having silencing activity have been introduced selectively survive, so that clones having the iRNA expression constructs having silencing activity efficiently can be obtained. can get. By recovering the vector holding the iRNA expression construct from the cells selected here, it becomes possible to identify whether it is preferable to use any powerful region in the target DNA as an iRNA target.

[0026] Kit

The present invention provides an RNAi library kit for performing the above-described method for enzymatically constructing an RNAi library. The kit can include the above-described hairpin-type adapter, stump-type adapter 1, primers and enzymes for primer extension, enzymes used for trimming if necessary, enzymes for purifying random DNA fragments, and the like. Also, a vector for inserting the iRNA expression construct can be included. Further, a protocol for performing the above-described method for enzymatically constructing an RNAi library may be attached. By preparing a material for carrying out the method for constructing a library of the present invention as described above, the method for constructing an RNAi library of the present invention can be carried out more easily and more easily.

Example

[0027]

Preparation of RNAi library

EPRIL involves several steps of enzymatic treatment to create a target cDNAs shrimp expression vector library (Figure la). First, double-stranded DNAs are fragmented almost randomly with DNasel (Anderson, S. Nucleic Acids Res. 9, 3015-3027 (1981)). Next, a hairpin-shaped adapter containing the recognition sequence of Mmel is ligated to the fragment. Mmel has been reported to cleave the upper and lower strands at sites 20 and 18 bases away from the recognition sequence, respectively (Boyd, AC et al. Nucleic Acids Res. 14, 5255-5274 (1986)). ), The inventors have found that Mmel also cleaves DNA at bases 21 and 19. Thus, Mmel digestion yields short 3'-overhanging DNA fragments with sequences 20 or 21 bases in length from the target cDNAs. Polyacrylamide gel electrophoresis (PAGE ) Shows Mmel digested DNA as a -40 bp band (FIG. Lb). After Mmel digestion, a second adapter is ligated to the resulting fragment. This adapter has two degenerate bases at the 3 'end of one strand so that the 3' overhang of the Mmel digest is plugged. After ligation of the second adapter, a primer extension reaction is performed to convert the single-stranded hairpin DNA into a double-stranded DNA with inverted repeats connected via a loop sequence (Figure 1). . The primer extension product is digested with an appropriate restriction endonuclease to remove extra sequences outside the inverted repeat sequence and inserted into the plasmid vector described below. Recircularization is performed after removing extraneous sequences in the long loop flanked by inverted repeats with an appropriate restriction end nuclease.

For library construction and shRNA expression, we used a plasmid with a retroviral vector containing a mouse U6 gene capella RNA polymerase III driven promoter. Using a retroviral vector to introduce the shRNA expression cassette ensures a stable RNAi effect (Paddison, P.J. & Hannon, G.J. Cancer Cell 2, 17-23 (2002)).

RNAi library from cDNA encoding GFP

To evaluate EPRIL, we generated an shRNA expression library from cDNA encoding green fluorescent protein (GFP). Sequence analysis of individual clones from the library showed that 290 out of 343 clones with sequence data had inverted repeats. 39 of these clones had incomplete inverted repeats.251 clones had an inverted repeat of 19 or more bases from the GFP sequence.GFP silencing Was a candidate shRNA expression construct. Most clones have an inverted repeat length of either 20 or 21 nucleotides, and 18 (7.2%), 139 (55.4%), and 94 (37.5%) of 251 clones They were 19, 20, and 21 bases in length, respectively. The first adapter can be ligated to both ends of the DNasel digested fragment, so that shRNAs with two different orientations should be obtained. Guide sequences that are complementary to the mRNA sequence are about the same frequency on the 5 'or 3' side of the shRNA (54.6% vs. 45.4%, p> 0.1). Analysis of the target sequence indicated that different shRNA expression constructs were generated with different partial forces of the target gene; the complete 720 For the entire bp GFP coding sequence, 96.3% of the total was covered by 157 non-overlapping shRNA expression constructs from 251 independent clones. Thus, EPRIL enables high-throughput production of vast arrays of shRNA expression constructs from cDNA of interest.

[0029] Retroviruses with shRNA expression constructs are produced from individual plasmids in a 96-well plate format, allowing the present inventors to simultaneously obtain a vast array of independent viruses. Jurkat T cells expressing GFP were also infected with the virus in the same format. GFP expression levels in infected cells were determined by flow cytometry to quantify RNAi efficiency. There was considerable variation in RNAi efficiency depending on the shRNA expression construct. As described above, the present inventors analyzed the distribution of RNAi efficiency in the measurement results of 262 non-overlapping constructs (FIG. 2a). Approximately 56% of the constructs had low RNAi activity (less than 1.5-fold reduction). In order to estimate the probability of finding a shRNA expression construct with RNAi efficiency greater than a predetermined fold reduction (X)! /, We determined for each fraction of shRNA expression constructs whose fold reduction exceeds X. Was plotted against X. Roughly 30% showed a reduction in RNAi efficiency of more than 30%, whereas only a small percentage had a reduction of more than 8 times. The overall probability is proportional to the fold reduction with a 1-1.7 power law scaling, which means that if you want to find RNAi constructs with a 5 fold reduction efficiency, e.g., 15 (5 ¹⁷ ) fold more candidate constructs That means you have to screen.

Next, the present inventors analyzed the region dependence of RNAi efficiency. Both efficient and inefficient shRNA expression constructs were distributed throughout the region (FIG. 2c). In the case of quantitative analysis, we classified the data according to ten equally subdivided regions (Figure 2d) and performed an analysis of variance. We found no significant region dependence (Kruskal 'Wallis test; p 0.4). In particular, the results indicate that the region is a poor substrate for RNAi (Dykxhoorn, DM et al. Nat. Rev. Mol. Cell Biol. 4, 457-467 (2003)). Have shown that even a region within 72 bp from the start codon can serve as a good target. Regarding the orientation of the shRNA expression construct, there was an overall trend that the guide sequence located on the 3 'side was more effective.

[0031] The variation pattern of the RNAi efficiency was such that 10 representative constructs examined showed that HEK293 or HeLa Since the cells showed a similar efficiency profile in some cases (data are shown,,,), they were independent of the cell type. Direct transfection of the minimal plasmid or PCR amplified shRNA expression cassette yielded a profile similar to retroviral transduction (FIG. 3a), excluding the effects of differences in viral titers. Furthermore, the RNAi profile of the in vitro transcribed shRNA by direct transfection correlated well with the DNA-based expression profile (FIG. 3b). Similar results were obtained when shRNAs transcribed in vitro were previously digested with Dicer. These results indicate that the factors that determine the RNAi efficiency profile are downstream of the transcription and Dicer 1-processing steps.

RNAi library from cDNA encoding type 1 IP receptor

Three

We examined whether the above strategy was applicable to endogenous genes. The present inventors encode inositol type 1,4,5-triphosphate receptor type 1 (Mignery, GA et al. J. Biol. Chem. 265, 12679-12685 (1990)) (IPR) as a target. DNA was used. GFP

Three

As before, we obtained various shRNA expression constructs for the IPR. Array data

Three

Of the 256 clones with the same data, 214 were found to have shRNA expression constructs, including 199 constructs with different target positions and overlapping each other. . To rapidly screen for effective shRNA expression constructs, we used Jurkat with a reporter construct expressing GFP and IPR head-til binding mRNAs.

Three

T cells were generated. Degradation of the target mRNA by the shRNA expression construct can be assessed by monitoring the decrease in GFP fluorescence (Kumar, R et al. Genome Res. 13, 2333-2340 (2003)). ShRNA expression constructs targeting IPR also have altered RNAi efficiency.

Three

(FIG. 4. We selected two shRNA expression constructs, SI2A5 and SI3G6, among the most effective constructs and these clones were expressed endogenously in the vascular smooth muscle cell line A7r5. We examined whether IPR can induce effective RNAi for IPR (De

Three

Smedt, H. et al. J. Biol. Chem. 269, 21691-21698 (1994)). Western blot analysis confirmed that the IPR expression level was reduced (Figure 4b). Loss of function is also

Three

Confirmation was also made by measuring the Ca ²⁺ response induced by sushin (Fig. 4c). These results indicate that EPRIL searches for effective shRNA expression constructs targeting endogenous genes. It shows that it is useful.

Intracellular selection of effective shRNA expression constructs

To facilitate throughput screening, the present inventors have developed a novel intracellular selection scheme based on a special selectable marker gene for efficient positive selection of shRNA expression constructs (Figure 5a). . The marker gene is also a component of the two head-til junctions; the first encodes a fusion protein consisting of thymidine kinase and puromycin N-acetyltransferase (Chen, YT & Bradley, A. Genesis 28). , 31-35 (2000)), the latter encoding the target mRNA. Usually, when ganciclovir (GCV) is applied, this marker gene is possessed by the intracellular accumulation of toxic derivatives of GCV by the action of thymidine kinase (Chen, YT & Bradley, A. Genesis 28, 31-35 (2000)). Cells are killed. When cells are transduced with shRNAs having effective RNAi activity for the target gene, the cells will escape cell death by silencing thymidine kinase expression. The present inventors constructed such a marker-gene using GFP as a target, introduced this into Jurkat T cells, and performed puromycin selection. Next, the inventors generated shRNA-expressing retroviruses as a mixture from a shRNAi library targeting GFP, and infected marker gene expressing cells with these retroviruses. The infected cells were treated with GCV for 48 hours to cultivate GCV-resistant cells. We recovered the shRNA expression constructs by PCR amplification of viable cells and reconstructed them into retroviral expression vectors to obtain the selected library. To determine whether GCV selection actually enriched the effective shRNA expression constructs, Jurkat T cells expressing GFP were infected with a virus mixture prepared from the reconstructed library. Flow cytometry results show that GFP expression in retrovirally transduced cells from the GCV-selected library was significantly attenuated compared to expression in cells transfected with the retrovirus from untreated or parental libraries. Indicated by. This indicates that GCV selection enriched for more effective shRNA expression constructs (Figure 5b). Successful enrichment of effective shRNA expression constructs by GCV selection was also confirmed by analysis of individual clones. A marked increase in the population of shRNA expression constructs with high and efficiency was observed in the GCV selection library (FIG. 5c). These results are live Rally Force A novel intracellular selection scheme has been shown to be useful for obtaining effective shRNA expression constructs.

cDNA library 1 RNAi library 1

EPRIL offers the opportunity to construct shRNAi libraries from complex mixtures of cDNAs, such as cDNA libraries, rather than from a single cDNA source. Such shRNAi libraries should be extremely valuable for comprehensively searching for genes involved in specific cellular functions. Therefore, the present inventors have investigated whether or not the present technology can be realized for such a purpose. EPRIL was performed on a cDNA library prepared from mouse bone marrow progenitor cells FL5.12 cells and the mRNA level of which was also expressed to prepare a shRNAi library. Sequencing of randomly selected clones revealed that 215 of the 240 obtained sequences contained inverted repeats (Table 1). Of these, inverted repeats from 35 clones contained sequences with more than 10 bases of poly A or T, probably from the poly A tail of mRNAs. Therefore, a BLAST search was performed on the remaining 180 clones. The sequence of 165 clones matched the cDNA sequence and / or ESTs (Table 2). The present inventors classified these clones derived from gene transcripts according to the gene cluster (Build 126) and found that 146 out of 165 clones belonged to at least one of the gene clusters. . Among these, some clones corresponded to the same cluster, suggesting that these clones were derived from the same gene. These include genes encoding heat shock protein 8, ubiquitin B and ribosomal protein L41, all of which are highly expressed in many organs. Since the size of the gene cluster is an approximate estimate of the relative expression level, the size of the cluster was compared to the number of occurrences of the same gene. Clusters with more than one repetitive sequence were significantly larger than those without repetitive sequences (p <0.003, Man-Whit-I U-test). These characteristics suggest that the RNAi library exhibits an initial expression profile. We further analyzed the target location of the transcript. 53% corresponded to the coding region, 44% corresponded to the 3'-untranslated region, and 3% corresponded to the 5'-untranslated region. Thus, various partial forces of the transcript also resulted in shRNA expression constructs. The result shows that EPRIL can be used even for a cDNA library that can be a complex mixture of various genes. Indicates applicability

Sequence summary of each clone of one shRNA library prepared from FL5.12 cDNA Sequence obtained 240

Non-repeat structure 25

Clone 215 containing inverted repeat structure

Origin of reverse repetition

Poly A ^a 35

cDNA / EST 165

Mitochondrial gene 6

Genomic DNA ^b 3

Primer 3

Unidentified 3

a Reverse repeat sequence containing a sequence of 10 or more bases of adenine or thymine b Sequence that matches genomic DNA sequence but does not match cDNA / ESTs sequence

Table 2 ■ Target gene identification of each clone in 165shRNA library prepared from FL5.12 cDNA library using EPRIL method

Clone Target gene (uni-target gene direction stem number name) Length of the first gene (cluster

Size)

SF2—1— H12 Hspa8 heat shock Mm.197551 20 protein 8 (9743)

SF2_1_D10 Hspa8 heat shock Mm.197551 20 protein 8 (9743)

SF2— 2— D12 Hspa8 heat shock Mm.197551 20 protein 8 (9743)

SF2— 1— F07 Hspa8 heat shock Mm.197551 21 protein 8 (9743)

SF1— 2—B03 Rps26 ribosomal Mm.372 (889) 20 protein S26

SF2— 2—D09 Rps26 ribosomal Mm.372 (889) CDS

protein S26

SF1-1-1—G12 Rps26 ribosomal Mm.372 (889) 5'UT 5 '21 protein S26 R

SF1_1_F05 Rps26 ribosomal Mm.372 (889) 5'UT 5 '19 protein S26

SF1— 2— C04 Ubb ubiquitin B Mm.235 CDS 3 '20

(3529)

SF1—2—E11 Ubb ubiquitin B Mm.235 CDS 5 '20

(3529)

SF1— 1— C05 Ubb ubiquitin B Mm.235 CDS 5 '20

(3529)

SF21- 2— C11 Rpl41 ribosomal Mm.13859 3'UT 3 '19 protein L 1 (1795) R

SF1-11-1 D08 Rpl41 ribosomal Mm.13859 3'UT 3 '20 protein L41 (1795) R

SF1—1— C08 Rpl41 ribosomal Mm.13859 3'UT 3 '20 protein L41 (1795) R

SF1 2 B01 Mil2-pending Mm.175661 3'UT 3 '21 interferon induced (105)

transmembrane

protein 2 like

SF2 1 E10 Mil2-pending Mm.175661 CDS 3 '21 interferon induced (105)

transmembrane

protein 2 like SF1— _1- _F10 Mil2- pending Mm.175661 CDS 3 '20 interferon induced (105)

transmembrane

protein 2 like

SF2- _1—one C11 5830436L09Rik Mm.44497 3'UT 5 '20

RIKEN cDNA (92)

5830436L09 gene

SF2. — 1- _B09 5830436L09Rik Mm.44497 3'UT 5 '21

RIKEN cDNA (92) R

5830436L09 gene

SF1- — 2— _E01 5830436L09Rik Mm.44497 3'UT 5 '20

RIKEN cDNA (92) R

5830436L09 gene

SF1― 一 2― _A11 Eef1a1 eukaryotic Mm.196614 CDS 3 '20 translation (15776)

elongation factor 1

alpha 1

SF2— 丄 — A12 Eef1a1 eukaryotic Mm. 196614 CDS 3 '20 translation (15776)

elongation factor 1

alpha 1

SF1. — 1- _B1 1 Actb actin, beta, Mm.297 3'UT 3 '21 cytoplasmic (4500) R

SF1_ — 1— — A03 Actb actin, beta, Mm.297 3'UT 3 '20 cytoplasmic (4500) R

SF1— — 1-one E01 Arbp acidic Mm.5286 CDS 3 '21 ribosomal (3925)

phosphoprotein PO

SF1_ _1_ _H05 Arbp acidic Mm. 5286 CDS 3 '20 ribosomal (3925)

phosphoprotein PO

SF2 一 — 1_ — G05 2010004J23Rik Mm.10706 CDS 3 '20

RIKEN cDNA (3330)

2010004J23 gene

SF1— — 1— _E09 2010004J23Rik Mm.10706 CDS 5 '21

RIKEN cDNA (3330)

2010004J23 gene

SF2— —2 one — A12 Npm1 Mm.6343 CDS 5.20 nucleophosmin 1 (2295)

SF1_ —I— -E05 Npm1 Mm.6343 CDS 3 '21 nucleophosmin 1 (2295) SF1 2 F12 Slc25a5 solute Mm.658 CDS 3 '21 carrier family 25 (1308)

(mitochondrial

carrier; adenine

nucleotide

translocator),

member 5

SF2 1 D08 Slc25a5 solute Mm.658 CDS 3 '19 carrier family 25 (1308)

(mitochondrial

carrier; adenine

nucleotide

translocator),

member 5

SF2-2-2-C07 Rpa1 replication Mm.180734 CDS 3 '20 protein A1 (833)

SF2_2_D07 Rpa1 replication Mm.180734 CDS 3 '20 protein A1 (833)

SF1 2 E03 Erh enhancer of Mm.21952 3'UT 3 '20 rudimentary (510) R homolog

(Drosophila)

SF1 2 A02 Erh enhancer of Mm.21952 3'UT 5 '20 rudimentary (510) R homolog

(Drosophila)

SF1 2 A08 0610025G13Rik Mm. 43330 CDS 3 '19

RIKEN cDNA (704)

0610025G13 gene

SF2 2 A01 0610025G13Rik Mm. 43330 CDS 5 '20

RIKEN cDNA (704)

0610025G13 gene

SF2 1 B11 Psmd protease Mm.157105 CDS 5 '21

(prosome, (502)

macropain) 26S

subunit, ATPase 1

SF1 1 F12 Psmd protease Mm.157105 CDS 5 '19

(prosome, (502)

macropain) 26S

subunit, ATPase 1 kinase 1

w ω c w c qi en CO

ω 20 SF22 A08 Hnral- ri

o o o

rotein- 171

related nli

SF12 B09 Gnb2r-5} ri- p SF21C05 pe —— p9 Staotn Mm. 1187 3UTF22B11 Fmrhvmosi_- yg dehdroenase

In osate h

p (yy) 58-ceadehde344rll- l Mm 52895 B08 GaDd.- SF1- J. _F06 Prdxl peroxiredoxin Mm. 30929 3'UT 5 '21

1 (1359) R

SF2- — 2— _D04 Rpl32 ribosomal Mm. 104368 CDS 5 '20 protein L32 (1273)

SF1-one 1- _C03 Rpl26 ribosomal Mm. 3229 CDS 3 '21 protein 26 (1169)

SF1- _2— _D01 Rpl18 ribosomal Mm.41923 CDS 5 '20 protein L18 (1 149)

SF1- _1- — F02 3100001 N19Rik Mm.43749 3'UT 3 '21

RIKEN cDNA (1 121) R

3100001 N19 gene

SF1- _2- — C05 Tuba2 tubulin, alpha Mm.197515 CDS 3 '20

2 (1073)

SF1- — 2— — B12 2010 203 J19Rik Mm.4280 CDS 5 '20

RIKEN cDNA (1058)

2010203J19 gene

SF2_ — 1— — H08 Rps20 ribosomal Mm. 21938 5'UT 5 '20 protein S20 (1024) R

SF2. 丄 _A04 Canx calnexin Mm.153481 3'UT 3 '21

(993) R

SF2. 丄 — G12 Sfrs2 splicing factor, Mm.21841 3'UT 5 "20 arginine / serine-rich (955) R

2 (SC-35)

SF2— _1_one B10 Lcp1 lymphocyte Mm.153911 3'UT 3 '21 cytosolic protein 1 (940) R

SF1 一 —2— _F04 Cfl1 cofilin 1, Mm. 4024 3'UT 3 '21 non-muscle (940) R

SF2_1-111 B12 Rps25 ribosomal Mm.265 (927) 3'UT 5 '21 protein S25 R

SF2— _1_ _H01 Es10 esterase 10 Mm.38055 CDS 3 '20

(925)

SF2— _2_ -D05 Eif3s3 eukaryotic Mm. 183083 CDS 3 '21 translation initiation (899)

factor 3, subunit 3

(gamma)

SF1_ —1— -D09 Tcp1 t-complex Mm.2223 CDS 3 '20 protein 1 (894)

SF1 一 — 1_ C07 Rpl24 ribosomal Mm. 107869 CDS 5 '20 protein 24 (870)

SF2-1 —2_ -C09 Set SET Mm.28805 3'UT 3 '19 translocation (865) R Sword 4

99 Mm.274 SF11 D01

0) (73 CO CO

(} 544 l "Π ~ n" Π

ho

1 1 1 1 ho

One

II CS 3 SF11E06 Mm.12848D- 'M

1 1 1

o -n

(} 604 O Ό

o _ k _ k o k o

Γ O

— 5S3 Mm.10508 CDS-) 464

II CS 5 SF22A02 Mm.28952D-) 483

II9 CS 3 SF12D09 Mm.17311D- ---- 06 Mm.22569 CDS 52A-

() 528

'' SF2 Mm. 41596 3UT 5--) 574

So6 CSF2 rol Mm.2171D

IVJ ΓΟ r) N3 ro r N3 NJ N) N3

-> O-»■ o o o o) 584 O O CD O

3955 3U 3 Mm.T--

() Mm.850603 CDS

() 606

Mm.128512 3 ョ-) 697

Mm.35389 CDS p transcrition factor

y polmerase ro- (a fctor BTF3RNA

p () to Transcriton69i4

2 1IOC890 sa538 CS21imilr Mm.1D

() c IKENDNA743

SF2 AOS 2410030A14Rik Mm.196612 3 SF2 1 C08 Elavil EI_AV Mm.1 19162 3'UT 3 '21 (embryonic lethal, (433) R abnormal vision,

Drosophila) -like 1

(Hu antigen R)

SF2 1 G07 Psmb3 proteasome Mm. 21874 3'UT 5 '20

(prosome, (425) R macropain) subunit,

beta type 3

SF2— 1—A06 Pfdn5 prefoldin 5 Mm.181847 3'UT 3 '20

(417) R

SF2— 1—A09 Rps28 ribosomal Mm. 200920 CDS 3 '21 protein S28 (408)

SF2 1 B06 Tomm22 Mm.246435 3'UT 3 '20 translocase of outer (382) R mitochondrial

membrane 22

homolog (yeast)

SF1_1_E02 4933427L07Rik Mm.173826 3'UT 5 '20

RIKEN cDNA (350) R 4933427L07 gene

SF2 1 G02 Cdc2a cell division Mm.4761 CDS 3 '20 cycle 2 homolog A (344)

(S. pom be)

SF2_1_F11 Stx7 syntaxin 7 Mm.10818 CDS 5 '20

(338)

SF2 1 C04 Slc6a6 solute carrier Mm. 200518 3'UT 5 '19 family 6 (318) R

(nsurotransmitter

transporter, taurine),

member 6

SF1 1 A12 Eif4el3 eukaryotic m.227183 CDS 3 '20 translation initiation (308)

factor 4E like 3

SF1 1 E12 1700001 A24Rik Mm.28085 3'UT 3 "21

RIKEN cDNA (306) R 1700001 A24 gene

SF1 2 F06 Srcasm Src Mm.167868 CDS 5 '21 activating and (298)

signaling molecule SF1—— 2— _G01 Mus musculus 8 Mm. 29866 3'UT 5, 21 days embryo whole (296) R body cDNA, RIKEN

full-length enriched

library,

clone: 5730496F02

product: HYPOTHET

ICAL 8.0 KDA

PROTEIN homolog

[Mus musculus], full

insert sequence

SF1_ — 1- — C06 2610034N03Rik Mm.182574 3'UT 3 '20

RIKEN cDNA (294) R

2610034N03 gene

SF2_ — 1- _C09 2310042M24Rik Mm.27328 3'UT 3 '21

RIKEN cDNA (293) R

2310042M24 gene

SF1— — 1— _F07 Snrpg small nuclear Mm.21764 3'UT 3, 20 ribonucleoprotein (273) R polypeptide G

SF2_ J. — C07 2010 204I15Rik Mm.245830 CDS 5, 19

RIKEN cDNA (273)

2010204115 gene

SF2— — 1— — F09 Serpinbl a serine (or Mm. 250802 CDS 3, 19 cysteine) proteinase (269)

inhibitor, clade B,

member 1 a

SF2_ _1_ — C03 Rragc Ras-related Mm. 28746 3'UT 3, 20

GTP binding C (261) R

SF2-1-1 11 _A08 Zfp161 zinc finger Mm. 29434 3'UT 5 '19 protein 161 (254) R

SF2_ _2_ _C01 BC014795 cDNA Mm.185518 3'UT 3 '20 sequence (248) R

BC014795

SF11-1 —21-1 D10 2610040E16 ik Mm.24737 3'UT 3 '21

RIKEN cDNA (229) R

2610040E16 gene

SF1_ —2— _F1 1 1 190006C12Rik Mm.20188 3'UT 3, 20

RIKEN cDNA (215) R

1 190006C12 gene

SF2— _2_ — B12 Ftsj Ftsj homolog (E. Mm. 227141 3'UT 3, 20 coli) (204) R SF1 1 B09 6720463M24Rik Mm.23503 3'UT 3 '20 RIKEN cDNA (202) R 6720463M24 gene

SF1 1 E07 Rac2 RAS-related Mm. 1972 3'UT 3 '21

C3 botulinum (197) R substrate 2

SF2 2 D02 4931426N11 Rik Mm.261333 3'UT 5 '21

RIKEN cDNA (197) R 4931426N11

gene, HIGH-RISK

HUMAN PAPILLOMA VIRUSES E6

ONCOPROTEINS TARGETED PROTEIN E6TP1

ALPHA homolog

[Homo sapiens]

SF1 2 D06 Siat7b Mm. 3947 3'UT 5 '20 siaiyltransferase 7 (181) R

((alpha-N-acetylneur

aminyl

2,3-beta-galactosyl- 1,3) good acetyl

galactosaminde

alpha-2,6-sialyltransf

erase) B

SF1 2 G07 4632419l22Rik Mm.171304 3'UT 5 '21

RIKEN cDNA (180) R 4632419122 gene

SF2 1 A10 Kcp2-pending Mm.177991 CDS 3 '21 keratinocytes (179)

associated protein 2

SF1 1 A06 2610034F18Rik Mm.258434 3'UT 3, 20

RIKEN cDNA (172) R 2610034F18 gene

SF2 1 B02 Pwp2h PWP2 Mm.103522 CDS 5, 19

(periodic tryptophan (169)

protein) homolog,

yeast

SF1 2 A07 LOC269796 Mm.74611 CDS 5 '20 hypothetical protein (165)

LOC269796

M M r NJ

OOO CD O '' O 00 O oo

SF2- _2-— A09 B2301 18H07Rik: Mm.157502 ND ND 20

RIKEN cDNA (157)

B230118H07 gene

SF1- — 2— _E09 Mus musculus Mm.259526 ND ND 20 transcribed (11)

sequence with

moderate similarity

to protein pir: S12207

(M. musculus)

S 12207 hypothetical

protein (B2 element)

-mouse

SF1— — 1— _G10 Mus musculus, clone Mm.33438 ND ND 20

IMAGE: 6310380, (33)

mRNA

SF1. — 1— — D03 Rpl18: Ribosomal Mm.41923 ND ND 21 protein 18 (1149)

SF2— _1_ — C02 CtnnbH: Catenin, Mm. 45193 ND ND 20 beta like 1 (296)

SF1. _2_ — B11 Mus musculus cDNA Mm.247431 ND ND 19 clone (57)

IMAGE: 6814793,

partial cds

SF1— —2— — D02 Mus musculus cDNA Mm.220932 ND ND 20 clone (124) /Mm.218

IMAGE: 6491231, 611 (327)

partial

cds / A530017D24Rik

: RIKEN cDNA

A530017D24 gene

SF1_ _2— — C03 Daf1: Decay Mm.101591 ND ND 20 accelerating factor (160) /Mm.235

1 / Mus musculus 775 (2)

transcribed

ssqus 门 ces

SF1— —2— _D04 Mus musculus Mm.31941 ND ND 21 transcribed (4) /Mm.25929

sequences / Revl l: 4 (127)

REV1-like (S.

cerevisiae) SF2.— 1— _E01 Gas5: Growth arrest Mm.270065 ND ND 20 specific 5 / Mus (304) /Mm.272

musculus cDNA 492 (115)

clone

IMAGE: 4500943,

partial cds

SF1- _2— — C12 6030458L21 Rik: Mm.250293 ND ND 19

RIKEN cDNA (57) /Mm.8756

6030458 then 21 8 (83)

gene / 2010317E24Ri

k: RIKEN cDNA

2010317E24 gene

SF2— — 2— — B09 Unknown EST ND ND ND 21

SF1 一 — 1— — A05 Unknown EST ND ND ND 21

SF2_ _1._A11 Unknown EST ND ND ND 20

SF2_ J. _H02 Unknown EST ND ND ND 20

SF1_ _2— _A12 Unknown EST ND ND ND 20

SF1_ Λ — B02 Unknown EST ND ND ND 20

SF2 一 — 1— — A01 Unknown EST ND ND ND 20

SF1— — 1- — D07 Unknown EST ND ND ND 20

SF2. — 1— — D07 Unknown EST ND ND ND 21

SF1_ _1. — H12 Unknown EST ND ND ND 20

SF1_ — 1— _H03 Unknown EST ND ND ND 20

SF1— _2— _C02 Unknown EST ND ND ND 20

SF1- 2— — E12 Unknown EST ND ND ND 20

SF1— J. — C02 Unknown EST ND ND ND 20

SF2— J. — B05 Unknown EST ND ND ND 20

SF2— —2— _C08 Unknown EST ND ND ND 20

SF2— — 1— _H10 Unknown EST ND ND ND 21

SF1— — 2— _D07 Unknown EST ND ND ND 20

SF1— _1_One D1 1 Unknown EST ND ND ND 20 aNot determined. Method

Cell culture

Jurkat T cells were cultured in RPMI 1640 medium (Invitrogen) containing 10% fetal calf serum (FCS), penicillin and streptomycin. GP293, HEK293, A7r5, and HeLa cells were prepared from Dulbecco's modified Eagle's medium containing 10% FCS ( (Sigma or Invitrogen). FL5.12 cells (donated by Dr. Inaba, Hiroshima University) were maintained in RPMI 1640 (Sigma) containing 10% FCS and 1 ng / ml IL-3 (Wako, Japan).

[0036] Construction of plasmid

All plasmids, including the plasmid pNAMA-U6 with the shRNA expression retroviral vector, were constructed using standard molecular biology techniques. Briefly, the U6 promoter and termination signal-encoding DNA obtained by PCR amplification from pSilencerl.O-U6 (Ambion) were transferred from a pMX retrovirus vector (donated by Dr. Kitamura, University of Tokyo). It was inserted into the Nhel site of a plasmid having a 3 'LTR. Primer pair, 5'-CGCGGATCCGAATGCTTTTTTTAATTCCTGCAGCCCG-3 '(SEQ ID NO: 1) and 5'

Using -CGCGGATCCGAAGACCCCAAACAAGGCTTTTCTCCAAG-3 '(SEQ ID NO: 2), PCR amplification was further performed on the plasmid to form a Bbsl / Bsml site for inserting an shRNA-encoding DNA fragment, thereby obtaining pBsk-U63-3LTR. . To construct pNAMA-U6, a Hindlll / Sall fragment having a 3 'LTR containing a U6 promoter at the Nhel site was

It was excised from pBsk-U63-3LTR and inserted into the Hindlll / Sall site of pda5LTR-DeRed2-M4 having a 3 'LTR-deficient pMX vector together with the DsRed2 gene (Clontech) derived from pDsRed2-Nl.

[0037] Encodes a retrovirus that expresses a thymidine kinase-puromycin-N-acetyltransferase fusion protein (Chen, YT & Bradley, A. Genesis 28, 31-35 (2000)) under the control of the SV40 promoter Plasmid pMS240-PNS was also constructed with a PCR amplified fragment encoding thymidine kinase and puromycin acetyltransferase. A DNA fragment containing the thymidine kinase and puromycin N-acetyltransferase genes was subcloned into a self-inactivating retroviral vector pMS240 to produce pMS240-PNS. pMS240-PNS has a BamHI / Notl site for cloning a DNA fragment encoding the target gene. To select an effective shRNA expression construct targeting GFP, a pd2EGFP-I (Clontech) GFP coding fragment was inserted at that site. [0038] Plus encoding a retroviral vector to monitor IPR silencing

Three

Encodes a destabilized Dani GFP variant to construct the pMX-d2EGFP-IPR

Three

DNA was prepared from pd2EGFP-1 and inserted into pMX. Coding IPR from pBS-IPR

The DNA to be loaded was inserted into a site downstream of d3EGFP.

[0039] EPRIL

To create a shRNA expression construct targeting GFP, a BamHI / Notl DNA fragment encoding GFP was obtained from pEGFP-1 (Clontech). In the case of IPR, rat 1 type IP

3 3

A fragment encoding the entire coding region of R was prepared by EcoRI / Notl digestion of pBS-IPR1.

Three

To generate an shRNA expression construct derived from the cDNA library, a double-stranded cDNA library was prepared from mRNA prepared from FL5.12 cells using the Super SMART PCR cDNA synthesis kit (Clontech), -Used directly for further induction without aging. Next, EPRIL was applied using these DNA fragments according to a six-step protocol as follows:

[0040] Step 1. Preparation of random DNA fragments

DNA fragments were prepared using 1 mM MgCl, 0.1 mg / ml BSA ゝ and 50 mM Tris-HCl (pH 7.5).

2

After limited digestion with DNasel in the presence, the ends were repaired with 0.1 U / 1 T4 DNA polymerase (Takara, Japan). The concentration of DNasel (Takara, Japan) was determined empirically for each preparation to give a digest with an average size on PAGE of about 100-200 bp.

[0041] Step 2. Ligation and Mmel cutting of the first adapter

The digests were ligated with T4 DNA ligase (DNA Ligation Kit version 2, Takara, Japan) to hairpin-shaped oligonucleotides, adapters 1, 5, column number: 3). The hairpin-shaped adapter 1 was purified by native PAGE from chemically synthesized oligonucleotides before use. The nick between the 5 'end of Adapter 1 and the 3' end of the digested DNA was 0.1 mM NAD, 1.2 mM EDTA, 10 mM (NH4) after treatment with 1.0 or 1.25 U / 1 T4 polynucleotide kinase. ) SO, 4 mM MgCl

4 2 4 2

And 0.006 U / 1 E. coli ligase (Takara) in the presence of 30 mM Tris-HCl (pH 8.0). , Japan). A short DNA fragment with the adapter attached was generated by cleavage with Mmel. The resulting DNA fragment was detected as a single band migrating at 40 bp on native PAGE. The gel band was excised and the Mmel-cleaved product was obtained by phenol-cloth form extraction and ethanol precipitation.

[0042] Step 3. Ligation of the second adapter

After preparing the adapter 2 having a truncated shape by annealing the oligonucleotide pair, 5, -CAAAGAGTCTTCGGCCCTCCAGACCGTGAGTC-3 '(SEQ ID NO: 4) and 5'-GCCGAAGACTCTTTGNN-3' (SEQ ID NO: 5), Purified using PAGE. The latter oligonucleotide contains two degenerate bases at the 3 'end, termed "N", which represent A, C, G, or T. # 4 Adapter 2 was ligated to the Mmel-cleaved DNA fragment from step 2 using DNA ligase. After purification by PAGE, nicks on the adapter 2-ligation fragment were repaired by treatment with T4 polynucleotide kinase (Takara, Japan) and T4 DNA ligase.

[0043] Step 4. Primer extension

Next, the product from step 3 was subjected to a primer extension reaction, along with the primer oligonucleotide, 5'-GACTCACGGTCTGGAGGGCCGAA-3 '(SEQ ID NO: 6), 0.1% triton X-100, 0.2 mM dNTPs, 10 mM KC1, 10 mM (NH) SO

4 2 4, 2 mM MgSO, and

Four

After incubating at 94 ° C for 135 seconds in a reaction buffer containing 20 mM Tris-HCl (pH 8.8), the mixture was cooled to 62 ° C. Next, 0.02 U / μl Bst DNA polymerase large fragment (NEB) was added to the reaction mixture to initiate the primer extension reaction. The reaction was performed at 65 ° C for 300 seconds and stopped by cooling to 4 ° C. Reaction products were purified by PAGE.

Step 5. Subcloning to plasmid

The product from step 4 was digested with Bpml, blunt-ended with tarenou fragments (Takara, Japan) and then digested with Bbsl. pNAMA-U6 was digested with Bsml, similarly blunt-ended and digested with Bbsl, followed by treatment with bacterial alkaline phosphatase (Takara, Japan). The digested fragments were gel purified and ligated at a molar ratio of about 3: 1. After purification of the ligation mixture, it was introduced into ElectroMAX DH5a-E competent cells (Invitrogen) by electroporation. Transform cells into 100 g / ml The cells were seeded on a 500 cm ² LB agar plate containing sylin. After overnight incubation, turf-grown bacteria were collected with a spatula, and plasmid DNA was prepared using a plasmid purification kit (plasmid MIDI kit, Qiagen).

[0045] Step 6. Excessive linker cleavage

The plasmid purified from step 5 was digested with Bcgl, blunt-ended with T4 DNA polymerase, and circularized again by self-ligation. This procedure removes most of the sequence from adapter 1 Short linker sequence, 5 '

-TTGTCCGAC-3 '(SEQ ID NO: 7) is retained. To eliminate as much as possible contamination of the incompletely digested plasmid, the DNA was digested with Mfel whose recognition sequence was present in the Bcgl cut portion of the sequence from adapter 1. ElectroMAX DH5a-E competent cells were transformed with the recirculated plasmid and selected on LB-agar plates containing 100 μg / ml carbecillin. After overnight culture on the plate, a plasmid library stock was obtained.

[0046] Recovery of shRNA expression construct from genome

shRNA expression constructs were recovered by PCR amplification from 100 ng of genomic DNA also prepared from transduced FL5.12 cells. For PCR, Vent DNA polymerase (NEB) was used with a primer pair, 5'-GTACGAGCGCACCGAGGGCCGCCACC-3 '(SEQ ID NO: 8) and 5'-GGCGTTACTTAAGCTAGCGATCCGACGCCGCCATC-3, (SEQ ID NO: 9). PCR amplified DNA was digested with Notl and A11II and subcloned into pBsk-3LTR. After transformation and purification, the DNA encoding the 3 'LTR containing the recovered shRNA expression construct was excised with Hindlll and Notl and subcloned into pda5LTR-DsRed2-M4. The resulting plasmid is structurally identical to pNAMA-U6 and can be packaged to produce a retrovirus with the recovered shRNA expression construct.

[0047] Preparation of shRNA in vitro

shRNAs were synthesized by using in vitro transcription based on the T7 promoter. To prepare type I for in vitro transcription, two chemically synthesized oligonucleotides, a T7 promoter-encoding oligonucleotide, 5'-taatacgactcactataG-3 '(SEQ ID NO: 10) And shRNA-encoded oligonucleotide 5, -AAAN GTCGGACAAN '

20-21 20-21 ctatagtgagtcgtatta-3, (SEQ ID NOS: 11, N and N 'correspond to the basic structure of shRNA

20-21 20-21

The corresponding sequence is shown, lower case letters indicate nucleotides complementary to the T7-promoter-encoding oligonucleotide) were incubated at 94 ° C for 135 seconds and then annealed at 45 ° C for 30 seconds. Next, the annealed oligonucleotide was converted to double-stranded DNA type II by an extension reaction at 50 ° C. for 600 seconds using a large fragment of Bst DNA polymerase (0.08 U / 1). The shRNA was also purified using the CUGA7 in vitro transcription kit (Futtsubon Gene, Japan) according to the manufacturer's protocol. The transcribed shRNA was purified using a gel filtration spin column (Microspin G-25, Amersham Bioeciences). When preparing Dicer-digested shRNA, shRNA was treated with recombinant human Dicer (Gene Therapy Systems) according to the manufacturer's protocol.

[0048] The N sequences of the different shRNA-encoding oligonucleotides are

20-21

TCTCGGCATGGACGAGCTGT (shGFPl) (SEQ ID NO: 12)

CTTCACCTCGGCGCGGGTCT (shGFP5) (SEQ ID NO: 13)

CTACAAGACCCGCGCCGAGG (shGFP7) (SEQ ID NO: 14)

CCCCATCGGCGACGGCCCCGT (shGFPIO) (SEQ ID NO: 15)

AGATCCGCCACAACATCGAGG (shGFP12) (SEQ ID NO: 16)

TCAGCTCGATGCGGTTCACC (shGFP13) (SEQ ID NO: 17)

CCACAAGTTCAGCGTGTCCGG (shGFP14) (SEQ ID NO: 18)

CTTCAAGTCCGCCATGCCCGA (shGFP17) (SEQ ID NO: 19)

TGCTGGTAGTGGTCGGCGAGC (shGFP18) (SEQ ID NO: 20)

TCGGCGCGGGTCTTGTAGTTG (shGFP19) (SEQ ID NO: 21) and

TTGTAGTTGCCGTCGTCCTT (shGFP20) (SEQ ID NO: 22).

The N 'sequence was complementary to the N sequence.

20-21 20-21

[0049] Retrovirus production and transduction

For high-throughput screening, retrovirus generation and transduction with shRNA expression constructs was performed in a 96-well plate format. The plasmid is QIA ゥ Prepared in 96-well plate format using the E96 Ultra Plasmid Kit (Qiagen) according to the manufacturer's protocol. In a GP293 packaging cell line (Clontech), 200 ng of retrowinores setter plasmid and 17 ng of VSG-G encoding plasmid were placed in a 96-well plate using Lipofectamine 2000 (Invitrogen) for each well. Transfetat. Two days after transfection, a culture medium containing the retrovirus was obtained. Retroviral transduction was performed by adding 50 μl of medium containing retrovirus particles to ₁ ^ 1¾1: cell suspension (1.0 10 ⁵ cells _/ ½1) 501. For retroviral production on a medium scale, DNA is purified by plasmid MIDI kit and propagated in a 10 cm culture dish by transfection with 24 μg of retrowinoresetter plasmid and 2 μg of VSG-G encoding plasmid. Retrovirus packaging was performed on GP293. If necessary, the retroviral particles were concentrated by centrifugation at 晚, and then resuspended in an appropriate culture medium.

[0050] Flow cytometry and evaluation of RNAi efficiency

Relative GFP expression levels are based on fluorescence intensity analyzed using a FAC Scan Flow Cytometer (BD)! / Estimated. The fold reduction of GFP fluorescence (control fluorescence intensity divided by the fluorescence intensity of shRNA-transduced cells) was used as a measure of RNAi efficiency. A series of internal control shRNA expression constructs were included in each 96-well plate to correct for batch-to-batch differences in RNAi efficiency due to variations in retrofilska titer.

[0051] Western blot analysis

A7r5 cells were infected with the retrovirus carrying the shRNA expression construct. Four days later, the cells were collected by trypsinization, soluble, and subjected to SDS-PAGE. After transferring the SDS-PAGE product to the PVDF membrane, the protein corresponding to the IPR is transferred to the primary antibody and the secondary antibody.

Three

The antibodies were Eg IgG anti-type I IPR (Alomone) and HRP-conjugated antibody, respectively.

Three

It was probed with heron IgG (MBL, Japan) and detected by chemiluminescence. Quantification of the immunoblot signal intensities was performed using IPLab spectral software (Scan Analytics, Inc.). The IPR signal is detected by an anti-actin antibody

Three

Normalized by immunoblot signal of actin probed using Santa Cruz. [0052] Intracellular calcium measurement

To measure intracellular calcium, A7r5 cells seeded on a cover glass were infected with shRNA-expressing retrovirus, and 4 days after infection, the Ca ²⁺ indicator Fura-2 was loaded. Changes in intracellular Ca ²⁺ concentration were determined by inversion with a CCD camera (Photometries) as described previously (Hirose, K. et al. Science 284, 1527-1530 (1999)). The evaluation was performed by fluorescence measurement based on ratio measurement in a microscope. Cells were stimulated by caloricizing 1ηΜ arginine vasopressin (AVP) in the presence of the L-type Ca ²⁺ channel inhibitor -cardipine (10 μΜ).

Industrial applicability

[0053] As described above, the present inventors have established a technology "EPRIL" capable of enzymatically deriving a shRNA expression library from cDNA type I polymerase. Applying the present invention to a single source of cDNA, the library can provide a vast array of candidate shRNA expression constructs for various regions on the cDNA. Combining EPRIL with a no-throughput screening and intracellular selection scheme provides a generic platform for generating the best shRNA expression construct sizes and collections for any gene. Such collections will generally make a significant contribution to RNAi-based high-throughput reverse genetics in mammals.

[0054] The present inventors have attempted to identify efficient RNAi sequence selectivity. We have observed a weak but general trend that shRNA expression constructs having a U at the fourth nucleotide from the 5 'end of the guide sequence are effective for GFP and IPR. Vs position

Three

The selectivity to work was not always consistent. For example, G at the second nucleotide is

All three tended to show a positive tendency. GFP showed no such tendency. Clearly, more data is needed than various genetic powers to determine overall sequence selectivity. EPRIL will greatly facilitate such research.

[0055] EPRIL allows large cDNA libraries consisting of complex mixtures of cDNAs

An shRNAi library can be created. We estimated that the library contained 3 × 10 ⁵ —4 × 10 ⁶ independent cDNA-derived shRNA expression constructs. Therefore, the methods of the present invention provide a measure of absolute phenotype, such as cell morphology, adhesion, cell death, RNAi-based forward genetics could be performed where genes can be identified by selection based on the expression levels of key molecules and other functional indicators. The shRNA sequence can perfectly match 20 and 21-base long tags with random sequences (Saha, S. et al. Nat. Biotechnol. 20, 508-512 (2002)) probability 9.1 X 10 ¹³ Contact and 2.3 X 10- ¹³ are, since sufficiently small again considering the size one 3 X 10 ⁹ bp of mouse or human genome, can serve as a reliable tags for gene identification.

Forward genetics using the RNAi library of the present invention may be applied at the animal level. Because lentivirus-mediated transduction can generate mice with shRNA expression constructs (Rubinson, DA et al. Nat. Genet. 33, 401-406 (2003)), we target different genes. The shRNA expression construct can efficiently produce a huge array of mutant animals. Systematic screening based on phenotype allows easy identification of genes involved in a particular phenotype. This feature contrasts with that of a large-scale mutagenesis project that is ongoing in mice using ethylnitrosoperrea (ENU) (Kile, BT et al. Nature 425, 81-86 (2003)). . ENU-mutagenesis efficiently produces mutant animals, but requires a tedious and tedious process to determine the locus. In addition, variations in the RNAi efficiency of shRNA expression constructs can lead to the discovery of unique phenotypes due to varying degrees of gene silencing. Thus, EPRIL provides a new style of forward genetics in mammals and, together with its role in RNAi-based reverse genetics, will contribute significantly to elucidating the relationship between genes and functions at the whole genome level. Will.

Claims

Claims [1] A method for producing an RNAi library from a desired target DNA, comprising the following steps (1) and (3).

(1) randomly cutting the target DNA to generate a DNA fragment,

[2] a step of connecting a double-stranded stump type adapter to the other end of the DAN fragment before or after the step (2),

Either the double-stranded stump type adapter or the hairpin type adapter is provided with a restriction enzyme recognition site of an outside cutter,

The adapter having the restriction enzyme recognition site is connected to the DNA fragment first, and the other adapter is connected to the end formed by adjusting the length of the DNA fragment by the restriction enzyme of the outside cutter. The method of claim 1, wherein

[3] Hairpin-type adapter has a restriction enzyme recognition site for the outside cutter

The method of claim 2.

[4] The method according to claim 2, wherein the double-stranded stump type adapter is provided with a restriction enzyme recognition site for an outside cutter.

[5] The method for producing an RNAi library according to claim 1, further comprising a step of connecting the iRNA expression construct to the expression vector after the primer extension.

[6] The method for producing an RNAi library according to claim 5, wherein the expression vector can function in a mammal.

[7] The expression vector according to claim 5 or 6, wherein the expression vector has an integration activity into a host chromosome.

Method for producing RNAi library.

[8] The production of the RNAi library according to any one of claims 1 to 7, wherein the target DNA is any one of a cDNA of a specific gene, a cDNA library, and a cDNA after subtraction. Construction method.

[9] The method for producing an RNAi library according to claim 1, wherein in the step (1), the target DNA is fragmented using a DNA digestive enzyme usable for shotgun cloning.

[10] The method for producing an RNAi library according to any one of claims 1 to 9, wherein the restriction enzyme of the outside cutter cuts at least 19 bp away from the recognition site in the first adapter. .

[11] The method for producing an RNAi library according to any one of [1] to [10], wherein the polymerase having a strand-displacing activity is heat-resistant.

[12] Strand—Polymerase polymerase with displacing activity or Vent polymerase! The method for producing an RNAi library according to any one of claims 1 to 11, wherein the RNAi library is a DNA.

[13] An RNAi library produced by the method according to any one of claims 1 to 12.

[14] A method for screening an siRNA expression construct having a desired RNAi activity from an RNAi library produced by the method according to any one of claims 1 to 12, wherein the cell comprises a target DNA-expressing cell. Introducing the RNAi library,

Measuring the expression of the target DNA.

[15] The screening method according to claim 14,

As a fusion gene obtained by fusing target DNA with a reporter gene,

[16] A method for screening an siRNA expression construct having a desired RNAi activity from an RNAi library produced by the method according to any one of claims 1 to 12, wherein the target DNA and the negative selection marker gene are combined. Introducing the RNAi library into cells expressing the fused gene,

[17] A system for producing an RNAi library,

Including a hairpin type adapter and a double-stranded stump type adapter, A system, wherein any of the adapters is provided with a restriction enzyme recognition site for an outside cutter.

18. The system according to claim 17, further comprising an outside cutter restriction enzyme and a polymerase having Z or Strand-displacing properties.