WO2005103277A1

WO2005103277A1 - Dry amplification reagent mixture for polymerase chain reaction and the technique of pcr analysis

Info

Publication number: WO2005103277A1
Application number: PCT/RU2005/000043
Authority: WO
Inventors: Gadzhiramazan Omarovich Schaikhaev
Original assignee: Obschestvo S Ogranichennoy Otvetstvennostju 'kompania 'biokom'
Priority date: 2004-04-27
Filing date: 2005-02-08
Publication date: 2005-11-03
Also published as: RU2259401C1

Abstract

To the application for the invention 'Dry amplification reagent mixture for polymerase chain reaction and the technique of PCR analysis'. The present invention relating to molecular biology and biotechnology refers to dry amplification reagent mixture for polymerase chain reaction (PCR) and the technique of PCR-analysis; it can be used in veterinary, medicine, food industry and other applications relevant to DNA analysis. Dry amplification reagent mixture for PCR contains DNA-polymerase, deoxynucleoside triphosphates, buffer components, electrophoresis water-soluble dye, and stabilizers presented by carbohydrate composition of D-glucose, disaccharide (selected from the group of innulin, sucrose, trehalose maltose), and polysaccharide (selected from the group of D-mannitol, dextrans, phycoll, polyvinyl pyrrolidone). PCR-analysis technique includes dissolving of dry amplification reagent mixture for polymerase chain reaction in buffer solution containing Mg ions with subsequent addition of specific primers and analyzed DNA sample.

Description

DRY AMPLIFICATION REAGENT MIXTURE FOR POLIMERASE CHAIN REACTION AND THE TECHNIQUE OF PCR-ANALYSIS

Technical field

The present invention relating to molecular biology and biotechnology refers to dry amplification reagent mixture for polymerase chain reaction (PCR) and the technique of PCR-analysis; it can be used in veterinary, medicine, food industry and other applications relevant to DNA analysis.

Prior art

PCR represents the repeated cycles of in-vitro synthesis of certain parts of DNA (amplification) resulting in exponential increase in the number of DNA fragments flanked by two oligonucleotide primers. To carry out PCR, the amplification reaction mixture is prepared, to which the analyzed DNA sample is added for the amplification purposes with subsequent visualization of amplified nucleotide sequences. Amplification mixture includes: DNA-polymerase, Deoxynucleotide triphosphate solution (dNTP), primers, and buffer solution containing Tris-HCI to maintain medium pH values (about 8.0), KCI and (NH₄)₂SO to stabilize DNA-polymerase and dNTP, and MgCI₂ to activate DNA-polymerase. The mixture is prepared just prior to PCR by mixing the components which are to be kept in aqueous solutions at low temperature (-20°C). Prolonged storage as well as repeated freezing and thawing often cause a loss of reagent activity; there also is a possibility of exogenous DNA contamination during the blending of mixture components resulted in false- positive results. Lyophilization is used to maintain the activity of PCR reagents and to prolong the storage time at temperatures above 0°C. Either individual reagents e.g. dNTP (US 5.763.157, C07H 021/00, 1995), or reagent mixture (US 6.153.412, C12P 19/34, 2000) are lyophilized^'using special substances - stabilizers. Thus, gelatin, bovine serum albumin (BSA), (NH₄)₂SO , Thesit, polyethylene glycol-8000 (PEG-8000), polyol, as well as nonionic detergents NP40, TritonX-100 and Tween20 are used to stabilize DNA-polymerase and dNTP solutions (Science, 239:487-491 , 1988). To maintain the reaction activity of the mixture, glucytol, glucose, phycoll and sucrose are added to it prior to lyophilization (US 5.861.251 , C12P 19/34, 1999; US 6.153.412, C12P 19/34, 2000). The use of trehalose allows to preserve the characteristics of dried PCR mixture up to 1 year at storage temperatures from +4°C to +20°C (J. Clin. Microbiol., 1998, V.36(6), p.1798-1800). High specificity and sensitivity of PCR allows to use it for analysis of nucleotide sequence and gene sequencing, genotype determination and DNA-marking, diagnosis of hereditary and infectious diseases, identification of sex and personality, and detection of genetically modified organisms and foreign genetic material in food products. Specific oligonucleotide primers flanking the amplified DNA-fragment are required for every type of study. As a rule ready-to-use amplification mixtures already contain specific primers for every type of analysis (J. Clin. Microbiol., 1998, V.36(6), p.1798-1800). Thus, when studying various pathogenic organisms it is necessary to have ready-to-use PCR-mixtures differing only in their specific primer content for every pathogenic species. This increases the cost of each single analysis, hampers performing of serial studies, and limits the application of ready-to-use dry PCR-mixtures. The closest analog of the invention is the amplification mixture described in the patent US 6.153.412, C12P 19/34, 2000, which is a lyophilized mixture of aqueous solutions of PCR reagents. It contains: 10 mM Tris-HCI (pH=8.3), 40 mM KCI, 1.5 mM MgCI₂, DNA-polymerase, mixture of Deoxynucleotide Triphospates (dATP, dTTP, dGTP, dCTP; 250 mM each), 0.01% of water-soluble dye (selected from the group of bromphenol blue, xylencyanol, bromcresol purple, cresol purple), 1 mM DTT, 50 mg/ml BSA, 100 mM phycoll or sucrose as stabilizers, and oligonucleotide primers (50 pM each P1 δ'-cgccacgacgatgaacagac-S'and P2 δ'-ccacgggtaaagttgggc-S⁷). The mixture is prepared by blending aqueous solutions of reagents with subsequent quick freezing at -70°C and drying at low temperature. The mixture preserves its activity at +55°C for 136 and 115 hours. To perform PCR analysis, the mixture is dissolved in the deionized water. Dry PCR-mixtures similar to the one described above have high hydroscopicity, hence loss of activity can follow the prolonged storage at temperatures above 0°C, resulting from humidity absorption. The Mg²⁺ ions contained in the mixture can initiate the nonspecific reaction. Primers contained in the ready-to-use dry PCR-mixtures limit their application to the widespread tests. Disclosure of the invention

Objectives-of-the-invention are multipurpose dry amplification reagent mixture for polymerase chain reaction preserving its reaction activity under prolonged storage at temperatures above 0°C and allowing to provide specific PCR, as well as PCR analysis technique. The abovementioned objectives are achieved as follows; dry amplification reagent mixture for PCR contains DNA-polymerase, Deoxynucleotide Triphosphates, buffers, electrophoresis water-soluble dye, stabilizers presented by carbohydrate composition of D-glucose, disaccharide (selected from the group of innulin, sucrose, trehalose, maltose), and polysaccharide (selected from the group of D-mannitol, dextrans, phycoll, polyvinyl pyrrolidone). PCR-analysis technique includes the dissolving of dry amplification reagent mixture for polymerase chain reaction in buffer solution containing Mg ions with subsequent addition of specific primers and analyzed DNA sample. Carbohydrate composition in the suggested amplification mixture not only performs the stabilizer function during lyophilization, but also allows to act under milder conditions, thus decreasing the hydroscopicity of the dry PCR mixture. Prepared mixture can be stored for a long time (one year and more) at the wide range of temperatures (from -20°C to +30°C) without loss of activity. The presence of Mg²⁺ ions in the buffer diluent but not in the mixture itself allows to control the moment of reaction initiation, to avoid occurrence of nonspecific products and false-positive results when performing PCR analysis using the suggested amplification mixture. The suggested amplification mixture is compatible with any primer system for genomic DNA, plasmid DNA, mitochondrial DNA, recombinant (genetically modified) DNA and can be used for PCR analysis for DNA of any multicellular or unicellular organisms, food products or their components as well as for quantitative determination of DNA in the samples. The suggested mixture contains DNA-polymerase (0.1 U/μl), deoxynucleoside triphosphates mixture (500 mM each), 80 mM Tris-HCI (pH=8.0), 0.1 % Triton X-100, 24mM (NH₄)₂SO_4, 0.5 mM EDTA, D-glucose (0.16%), disaccharide e.g. innulin (1.6%), polysaccharide e.g. D-mannitol (8%), and electrophoresis water-soluble dye e.g. xylencyanol (0.04%). The suggested PCR mixture is prepared by mixing aqueous solutions of forming components, then placed into the amplification tubes (10 μl each) and lyophilized at -20°C for 4 hours. The lyophilized mixture is used for PCR analysis: the mixture is diluted with 10 μl buffer solution (buffer-diluent) containing 5 mM MgCI₂, 10 mM Tris-HCI (pH=8.0), 0.1 % of Triton X-100, 5% of glycerol, then oligonucleotide primers (5 μl) and- DNA sample solution (5 μl) are added. The following reagents were used to prepare the suggested dry PCR- mixture: OligoTaq as DNA-polymerase; Pfu; Vent (Promega, USA) dNTP, Tris-HCI, Triton X-100, (NH )₂SO_4l EDTA, carbohydrates, electrophoresis dye (Sigma, USA). As an electrophoresis dye, the water-soluble dye selected from the group of bromphenol blue, xylencyanol, bromcresol purple, cresol purple was used. The present invention is realizable with other brands of reagents as well. Ready-to-use chemicals or the primers synthesized depending to the aims of the study, were used as oligonucleotide primers. DNA was extracted from the samples by standard methods.

Brief description of the figures

Fig. 1 shows the electrophoregram of bacterial pathogen Chlamydia pneumonia DNA amplification products (where M is the molecular weight marker Gene Ruler 1 kb DNA Ladder ("Fermentas", Latvia), "K+" is the positive control (Chlamydia pneumonia genomic DNA) - 183 bp, 1-3 are the analyzed samples, "K-" is the negative control (buffer TE)). Fig. 2 shows the electrophoregram of the pathogenic fungus Candida albicans DNA amplification products (where M is the molecular weight marker Gene Ruler 1 kb DNA Ladder ("Fermentas", Latvia), "K+" is the positive control

(Candida albicans genomic DNA) -490 bp, 1-4 are the analyzed samples, "K-" is the negative control (buffer TE)). Fig. 3 shows the electrophoregram of the pathogenic protozoa

Toxoplasma gondii DNA amplification products (where M is the molecular weight marker Gene Ruler 1 kb DNA Ladder ("Fermentas", Latvia), "K+" is the positive control (Toxoplasma gondii genomic DNA) - 523 bp, 1-5 are the analyzed samples, "K-" is the negative control (buffer TE)). Fig. 4 shows the electrophoregram of the Bovine leukemia virus DNA amplification products (where M is the molecular weight marker Gene Ruler 1 kb DNA Ladder ("Fermentas", Latvia), "K+" is the positive control (genomic

DNA of Bovine leukemia virus) - 347 bp, 1-4 are the analyzed samples, "K-" is the negative control (buffer TE)). Fig. 5 shows the electrophoregram of the Hepatitis A virus cDNA amplification products (where M is the molecular weight marker Gene Ruler 1 kb DNA Ladder ("Fermentas", Latvia), "K+" is the positive control (vector construction of the analyzed sequence) - 365 bp, 1-5 are the analyzed samples, "K-" is the negative control (buffer TE)). Fig. 6 shows the electrophoregram of the amplification products of DNA extracted from the plantlets of various sorts and F1 hybrids of white cabbage (where M is the molecular weight marker Gene Ruler 1 kb DNA Ladder ("Fermentas", Latvia); below are listed the names of sorts and hybrids: 1 - Aoba, 2 - Fujiwase, 3 - Amager 611 , 4 - Zimovka 1474, 5 - Moskovskaya Pozdnaya 19, 6 - Podarok, 7 - Nomer pervy Griboedovsky, 8 - Slava 231 , 9 - CastelloFI , 10 - MultitonFI , 11 - Darhem ElfE1 , 12 - Darhem Early F1 ; "K-" is the negative control (buffer TE)). Fig. 7 shows the electrophoregram of the amplification products of DNA extracted from the cross-striated muscular tissue of Bos taurus (where

M is the molecular weight marker Gene Ruler 1 kb DNA Ladder

("Fermentas", Latvia), "K+" is the positive control (genomic DNA of Bos taurus) - 505 bp, 1-5 are the analyzed samples, "K-" is the negative control

(buffer TE)). Fig. 8 shows the electrophoregram of amplification products of DNA extracted from food products and convenience foods containing genetically modified soy, (where 1 is garlic phyto-cheese, 2 - soybean meat, 3 - phyto-cheese "Sojushka", 4 - mayonnaise "Soevy", 5 - soybean flour, 6 - soybean meat, 7 - sausage "Doktorskaya", "K+" is the positive control (Cauliflower mosaic virus (CaMV) 35S promoter fragment from transgenic soy line 40-3-2) - 153 bp, "K-" is the negative control (wheat flour)). Fig. 9 shows the electrophoregram of the results of liquid (A) and dry (B) amplification mixtures activity testing at 6 and 12 months respectively (by the example of CaMV 35S promoter from transgenic soy line 40-3-2). Amplicon size: 153 bp Fig. 10 shows the electrophoregram of the influence of carbohydrate composition on lyophilized PCR amplification reagent mixture activity preservation (where mixture 1 contains 0.16% D-glucose and 1.6% disaccharide (innulin), mixture 2 - 0.16% D-glucose and 8% polysaccharide (D-mannitol), mixture 3 - 1.6% disaccharide (innulin) and 8% polysaccharide (D-mannitol), mixture 4 - 0.16% D-glucose, 1.6% disaccharide (innulin), and 8% polysaccharide (D-mannitol) respectively, "K-" is the negative control (buffer TE), 1- is soybean flour, "K+" - is the positive control (CaMV 35S promoter fragment from transgenic soy line 40-3-2) -153 bp. Fig. 11 shows the electrophoregram of PCR analysis of human genomic DNA (where M is the molecular weight marker Gene Ruler 1 kb

DNA Ladder ("Fermentas", Latvia), "K+" is the positive control (348 bp PCR fragment characterizes Y chromosome presence, and 533 bp PCR fragment

- X chromosome presence respectively). Fig. 12 gives the diagram of the real-time PCR fluorescence curves. It shows the time to reach a certain threshold value of fluorescence; the time is expressed in number of amplification cycles. Value of 33.2 is proportional to the total concentration of soybean DNA (recombinant and native) in the analyzed sample upon lee (soybean lectin gene) fragment amplification (ROX labeling). Value of 36.8 is proportional to recombinant DNA concentration upon cp4 (glyphosate-tolerant gene) fragment amplification (FAM labeling) respectively. Recombinant DNA portion is determined from the calibration curve based on the ratio of these values (33.2/36.8); in the analyzed sample it corresponds to 5%. The best embodiments of the invention

The present invention is illustrated with the following examples. Example 1. Preparation of a lyophilized PCR amplification reagent mixture. The amplification mixture is prepared from the standard aqueous solutions and has the following composition: 80 mM Tris-HCI (pH 8.0J 0.1 % Triton X-100, 24mM (NH₄)₂SO_4, 0.5 mM EDTA, deoxynucleoside triphosphates dATP, dTTP, dGTP, dCTP; 500 mM each, OligoTaq DNA- polymerase 0.1 U/μl, 0.04% water-soluble electrophoresis dye (xylencyanol), 0.16% D-glucose, 1.6 % innulin, 8% D-mannitol. Prepared liquid mixture is placed into the tubes, 10 μl each, and then is lyophilized at temperature - 20°C for 4 hours. The mixture is to be kept at +4°C up to one year and more. Example 2.

PCR analysis for infectious pathogens. Biological material infected with Chlamydia pneumonia (bacterial pathogen), Candida albicans (pathogen fungus), Toxoplasma gondii (pathogen protozoa), Bovine leukemia virus was used for PCR analysis. 10 μl of buffer diluent containing 5 mM MgCI₂, 10 mM Tris-HCI (pH=8.0), 0.1 % Triton X-100, 5% glycerol are added into each tube with the lyophilized amplification mixture described in example 1. Then 5 μl of oligonucleotide primers mixture (10 pM of each primer) are added into each tube ((F) 5^'-gtggagccttatgggaatgcggttgtg-3^" and (R) 5'- tagctgttgctacgccagcgtctgttg-3^x are used to detect DNA of Chlamydia pneumonia] (F)5^"-gcaatccccaagacaatcacctaat-3^'and (R) 5^Λ- gactggcatcatccgacaaataaga-3^' - to detect DNA oiCandida albicans, (F) 5^'- ctccacacttcattgtgtggagt-3^' and (R) δ^'-gatacaagaacacgaagttcctga-S^' - to detect DNA of Toxoplasma gondii, /^'(F) 5^'- ggaggtggaaagatgcgaactatt -3^' and (R) 5^'- gtccgctctactaaccctgaactt -3^') - to detect DNA of Bovine leukemia virus respectively. After mixing, 5 μl of DNA probe from the analyzed samples are added into each tube with ready-to-go PCR mixture. Buffer TE is used as a negative control, and genomic DNA of relevant pathogen is used as a positive control. After remixing, the tubes are placed into amplificator, and then amplification is carried out in the followinς- mode: 1. 94°C - 60 sec, 62°C - 40 sec, 72° - 90 sec (1 cycle); 2. 94°C - 30 sec, 60°C - 30 sec, 72°C -60 sec (1 cycle); 3. 94°C - 20 sec, 58°C -20 sec, 72°C - 40 sec. (43 cycles); 4. 72°C - 60 sec PCR products are analyzed by electrophoresis in ethidium bromide-stained 1.5% agarose gel at voltage 100 V (see Figs. 1 , 2, 3, and 4). Example 3. PCR analysis for RNA-virus (e.g. Hepatitis A virus). RNA is extracted from the biological material, and then cDNA is obtained by reverse transcription. Buffer diluent is added as described in example 2 into the tubes with lyophilized amplification mixture, similar to the one described in example 1 , but containing sucrose as disaccharide, and polyvinyl pyrrolidone as polysaccharide. Then, 5 μl of oligonucleotide primers mixture ((F) 5^' -tttaatttgtttcagttgtatagaggaccat- 3^' and (R) 5 - gtgacagacaagtaacaactaaaggacaaa-3'; 10 pM each) are added into each tube to detect cDNA of Hepatitis A virus. Further preparation for amplification is performed as described in example 2. Previously obtained cDNA (5 μl) is used as the analyzed sample. As a negative control, buffer TE is used, and vector construction of nucleotide sequence identical to the analyzed one is used as a positive control. Amplification mode and detection conditions are used as described in example 2 (see fig.5). Example 4. PCR analysis for plant genomic DNA (DNA-markiny) The study was carried out over various sorts and hybrids of white cabbage (Brassica oleracea L. var. capitata). Amplification mixture similar to the one described in example 1 , but containing Pfu as DNA-polymerase was used. Genomic DNA is extracted from 14-days old plantlets. Buffer diluent is added as described in example 2 into the tubes with lyophilized amplification mixture. Then 5 μl (20 pM) of oligonucleotide primer (e.g. PawS16 complementary to the repetitive ends of the family R173 retro-transposon - R173 Ds element (5^x-acctctgcgcttggaggc-3^") are added into the tubes. Further preparation for amplification is carried out as described in example 2. Sterile distilled water is used as the negative control. Amplification is carried out in the following mode: 1. 94°C - 3 min.; 2. 94°C - 45 sec, 55°C - 45 sec, 72°C - 100 sec (35 cycles); 3. 72°C - 3 min. PCR products are analyzed as described in example 2 (see fig. 6). Example 5. PCR analysis for animal DNA Amplification mixture similar to the one described in example 1 , but containing phycoll as polysaccharide was used for animal DNA PCR analysis (e.g. for meat species identification). To perform the study mitochondrial DNA is extracted from the cross- striated muscular tissue of Bos Taurus by standard method. Buffer diluent is added as described in example 2 into the t bes with lyophilized amplification mixture. Then 5 μl of oligonucleotide primers mixture are added into the tubes (e.g. to detect DNA fragment encoding cytochrome B (F) 5^'- gacctcccagctccatcaaacatctcatcatgatgaaa-3^'and (R) 5^'- ctagaaaagtgtaagaaccgtaatataag-3'; 10 pM each, are used). Then extracted

DNA samples are added to ready-to-go amplification mixture as described in example 2. Buffer TE is used as a negative control. Amplification is carried out in the following mode: 94°C - 3 min., 94°C - 45 sec, 62°C - 35 sec,

72°C - 80 sec. (35 cycles); 72°C - 3 min., PCR products are analyzed as described in example 2 (see fig. 7).

Example 6.

PCR analysis for genetically modified DNA in food products and convenience foods. DNA for analysis was extracted from the soybean flour and soy- containing food by standard method. Amplification mixture is similar to the one described in example 1 but contains maltose as disaccharide. Buffer diluent is added as described in example 2 into the tubes with lyophilized amplification mixture. Then, 5 μl of oligonucleotide primers mixture are added into each tube (e.g. primers complementary to nucleotide sequence of cauliflower mosaic virus (CAMV) 35S promoter: (F) 5^'-ggctatcgttcaagatgcctctgc-3\ and (R) 5^'- ggattgtgcgtcatcccttacgtc-3^"; 10 pM each). Then 5 μ! of extracted DNA sample are added into the ready-to-go amplification mixture. Buffer TE is used as a negative control, and DNA of glyphosate-tolerant transgenic soy line 40-3-2 (Monsanto, USA) - as a positive control. Amplification is is carried out in the following mode: 1. 94°C - 3 min.; 2. 94°C - 45 sec, 72°C - 30 sec, 72°C -40 sec. (35 cycles); 3. 72°C - 4 min. PCR products are, analyzed as described in example 2 (see fig. 8). Example 7.

The influence of lyophilization on the stability of reaction activity of PCR reagent mixture Mixture (I) is prepared, lyophilized and stored as described in example 1. Mixture (II) is prepared from aqueous solutions of forming components. The mixture contains 10 mM Tris-HCI (pH=8.0), 24mM (NH₄)₂SO , 1.5 mM MgCI₂, DNA-polymerase, deoxynucleoside triphosphates mixture (dATP, dTTP, dGTP, dCTP; 250 mM each), 0.1 % TritonX-100, 5% glycerol, 0.01 % electrophoresis water-soluble dye (e.g. xylencyanol), and 0.16% D-glucose, 1.6% innulin, 8% D-mannitol as stabilizers. Mixture (II) is to be stored at -20°C. Mixtures (I) and (II) are used to detect genetically modified DNA from transgenic soy line 40-3-2 (Monsanto, USA). DNA for PCR analysis is extracted as described in example 6. To perform analysis, the mixture (I) is dissolved in the buffer solution as described in example 2, then 5 μl of oligonucleotide primers for CAMV 35S promoter detection are added into it as described in example 2. 5 μl of the same oligonucleotide primers are added into the mixture (II). The contents of both tubes are mixed and 5 μl of DNA c^'f transgenic soy line 40-3-2 are added into each tube. Amplification and detection is performed as described in example 6. Analysis is repeated monthly within 12 months (see fig.9). Example 8. Influence of carbohydrate composition on preservation of activity of lyophilized PCR amplification reagent mixture. PCR mixtures are prepared similar to the one described in example 1 but they differ in carbohydrate composition used as stabilizers: 1. contains 0.16% D-glucose and 1.6% disaccharide innulin; 2. contains 0.16% D-glucose and 8% polysaccharide D-mannitol; 3. contains 1.6% disaccharide innulin and 8% polysaccharide D- mannitol; 4. contains 0.16% D-glucose, 1.6% disacrharide innulin and 8% polysaccharide D-mannitol (as described in example 1). PCR mixtures were used to detect genetically modified DNA in the soybean flour. Dry amplification mixture preparation for amplification, addition of the analyzed sample, positive and negative controls, and PCR performing and visualization of obtained results were carried out as described in example 6 (see fig.10). Example 9.

PCR analysis for human genomic DNA Amplification mixture similar to the one described in example 1 but containing Vent as DNA-polymerase was used for PCR analysis of human genome (e.g. for fetal sex determination). Genomic DNA is extracted from the fetal cells contained in maternal blood. Buffer diluent is added as described in example 2 into the tubes with lyophilized amplification mixture. Then, 5 μl of oligonucleotide primers mixture are added into each tube (e.g. primers complementary to the unique nucleotide sequences of amelogenin gene in human X and Y chromosomes: 5^'- gatggttggcctcaagcctgtg -3^' and 5^'- accttgctcatattatacttgaca -3 ). Then 5 μl of extracted DNA are added into the prepared amplification mixture. As a negative control, buffer TE is used, and as a positive control - vector construction of nucleotide sequences identical to the analyzed ones. Amplification is carried out in the following mode: 1. 94°C - 60 sec, 62°C - 40 sec, 72°C - 90 sec. (1 cycle); 2. 94°C - 30 sec, 60°C - 30 sec, 72°C - 30 sec. (1 cycle); 3. 94°C - 20 sec, 58°C -20 sec, 72°C - 40 sec. (43 cycles); 4. 72°C - 60 sec. PCR products are analyzed as described in example 2 (see fig. 11). Example 10. Quantitative PCR analysis. To quantify genetically modified DNA in the- soybean flour containing soy from genetically modified line 40-3-2 (Monsanto, USA), PCR analysis was carried out using amplification mixture described in example 1. Real-time PCR device Smart Cycler II (Cefeid, USA) was used for quantitative determination of DNA in the analyzed sample. Quantitative analysis was performed according to TaqMan technique (Heid C.A., Stevens J., Livak K.J. and Williams P.M. Real time quantitative PCR. Genome Res. 6, 986-994, 1996). Buffer diluent is added into the tubes with lyophilized amplification mixture as described in example 2. Then, 5 μl of mixture of oligonucleotide primers and probes (oligonucleotides labeled with fluorescent dyes ROX and FAM) are added into the tubes. As primers, the oligonucleotides (F) 5^'- gtggtcccaaagaacct -3\ (R) 5^Λ- cccttgagccatgaacc -3^' complementary to the nucleotide sequence of cp4 gene (glyphosate-tolerant gene), and oligonucleotides (F) 5^'- accagcaaggcaatgaa -3^' and (R) 5^'- cgagaaagaaggcatct - 3' complementary to the nucleotide sequence of lee gene (soy lectin) are used 10 pM each. As probes, oligonucleotides labeled with fluorescent dyes (5 -(FAM)agcacgtaagggatgacgca(BHQ1) -3^' and (5^Λ- (ROX)ttactggaacaagttcgtgc(BHQ2) -3^Λ) complementary to cp4 and lee nucleotide sequences respectively are used 6 pM each. Then 10 μl of extracted DNA (concentration of 10 ng/μl) are added into ready-to-go amplification mixture. DNA extracted from the wheat flour is used as a negative control. To perform amplification and detection, the tubes containing prepared amplification mixtures and DNA are placed into real-time PCR device. Amplification is carried out in the following mode: 1. 94 °C- 3 min; 2. 94 °C-20 sec, 57 °C-30 sec, 72 °C-30 sec. (45 cycles) (see fig.12),

Claims

SUBJECT OF THE INVENTION

1. Dry amplification reagent mixture for polymerase chain reaction containing DNA-polymerase, deoxynucleoside triphosphates, buffer components, electrophoresis water-soluble dye, and stabilizers presented by carbohydrate composition differing from the prior ones in that the carbohydrate composition contains glucose, disaccharide (selected from the group of innulin, sucrose, trehalose, maltose etc), and polysaccharide (selected from the group of D-mannitol, dextrans, phycoll, polyvinyl pyrrolidone etc).

2. PCR-analysis technique that includes dissolving of dry amplification reagent mixture for polymerase chain reaction described in p.1 in buffer solution containing Mg ions with subsequent addition of specific primers and analyzed DNA sample.