WO2007095279A2 - Dual nanoparticle assay for detection and separation of biological species - Google Patents

Abstract

The subject invention provides novel methods, kits, and compositions for use in detecting, quantifying, and/or separating target cells in a sample. In one embodiment, methods for the rapid collection and detection of leukemia cells are provided using a novel dual nanoparticle assay with aptamers as the molecular recognition element. Aptamer sequences are prepared using a cell based SELEX strategy, where the aptamers are specific for CCRF-CEM acute leukemia (AL) cells. Such aptamers preferably demonstrate a high degree of specificity or selectivity for AL cells in complex mixtures, including whole blood samples. According to one embodiment of the invention, aptamer modified magnetic nanoparticles are used for target cell extraction, while aptamer modified fluorescent nanoparticles are simultaneously added for sensitive cell detection. Combining two types of nanoparticle-based screening techniques allows for rapid, selective, and sensitive detection not possible by using either particle alone. In a related embodiment, fluorescent nanoparticles amplify the signal intensity corresponding to a single aptamer binding event, resulting in improved sensitivity over methods using individual dye labeled probes. In addition, aptamer modified magnetic nanoparticles allow for rapid extraction of target cells not possible with other separation methods. Fluorescent imaging and flow cytometry are used for cellular detection to demonstrate the application of this method for medical diagnostics.

Description

DESCRIPTION

DUAL NANOPARTICLE ASSAY FOR DETECTION AND SEPARATION OF BIOLOGICAL SPECIES

Cross-Reference to a Related Application

This application claims the benefit of U.S. provisional application Serial No. 60/773,267, filed on February 14, 2006, which is hereby incorporated by reference in its entirety, including all figures, tables, and drawings.

Background of the Invention

In spite of improved treatments for certain forms of cancer, it is still a leading cause of death in the United States. Since the chance for complete remission of cancer is, in most cases, greatly enhanced by early diagnosis, it is very desirable that physicians be able to detect cancers before a substantial tumor develops. However, the development of methods that permit rapid and accurate detection of many forms of cancer continues to challenge the medical community. One such illustrative form of cancer is leukemia. Leukemia is a malignant condition of white blood cells in which bone marrow is diffusely replaced by relatively immature white blood cells which generally also appear, in large numbers, in the circulating blood. See Robbins and Angell, Basic Pathology. Second Edition, W. B. Saunders Co., Philadelphia, 349-354 (1976). Leukemias may be classified as acute lymphocytic (or lymphoblastic), chronic lymphocytic, acute myelogenous, or chronic myelogenous.

Acute lymphocytic (or lymphoblastic) leukemia accounts for about 20 percent of all leukemias, occurs predominantly in children, and develops more frequently in males than in females. Untreated, the prognosis for survival is approximately four months; with treatment, survival may be for several years and some cures have been reported (Robbins and Angell, supra).

Thus, accurate, sensitive methods for leukemia diagnosis are necessary, especially to facilitate the selection of effective therapeutic pathways by clinicians. Assays for sensitive minimal residual disease (MRD) detection are also essential for monitoring disease development and distinguishing those who are more susceptible to relapse. Current methods for leukemia diagnosis apply combinations of bone marrow and peripheral blood cytochemical analyses including karyotyping (Faderl, S. et al., Blood, 91(l l):3995-4019 (1998)), imrminophenotyping by flow cytometry (Paredes- Aguilera, R. et al, "Flow Cytometric Analysis of Cell-Surface Intracellular Antigens in the Diagnosis of Acute Leukemia," American Journal of Hematology 68:69-74 (2001)), or microarray (Belov, L. et al., Cancer Research 61:4483-4489 (2001)), and amplification of malignant cell mutations by PCR (Ghossein, R. A. and Bhattacharya, S., European Journal of Cancer 36:1681-1694 (2000)). Immunophenotypic analyses of leukemia cells use antibody probes to exploit the variation of specific surface antigens in order to differentiate malignant cells from normal cell lines. The limitation to this method is that antigens used for cell recognition are normally not exclusively expressed on any single cell type, dramatically influencing sensitivity, and resulting in false positive signals. Because of this, immunophenotypic analyses often require multiple antibody probes for accurate cell detection, increasing both the complexity and cost of the method.

PCR based methods have proven to be highly sensitive diagnostic techniques for cellular recognition (Ghossein, R.A. and Bhattacharya, S., European Journal of Cancer, 36:1681-1694 (2000); Iinuma, H. et al., Int. J. Cancer, 89:337-344 (2000); and Liu Yin, J.A. and Grimwade, D., Lancet 360:160-162 (2002)), but they are indirectly detecting cells by monitoring RNA expression, and require prolonged RNA isolation steps before analysis. In addition, the variable sensitivity of PCR can limit its effectiveness as a diagnostic technique, and can lead to false-negative results, particularly with occult tumor cells where low-level signals are expected (see Ghossein, R.A. and Bhattacharya, S., European Journal of Cancer, 36:1681-1694

(2000)). Immunophenotypic analyses are also time consuming and costly, and therefore, there is still a need to develop new technologies for rapid, economical cell recognition.

Brief Summary

The present invention features simple, speedy, and cost efficient systems and methods for detecting, quantifying, and separating target cells or molecules in a sample. In particular, it allows for the reliable and rapid identification and isolation of cancer cells, preferably leukemia cells, where two different types of screening technologies are utilized simultaneously within a single cancer screening procedure. Accordingly, the subject invention improves the ability to make an accurate and rapid diagnosis of cancer, and also to provide a means for monitoring disease development and treatment efficacy.

According to the subject invention, agents capable of binding to an extracellular domain of a target cell or a portion of a molecule are provided, wherein attached to the binding agents are magnetically responsive substances or labeled compounds. Within the scope of this invention, the binding agents are novel synthetic

DNA aptamers having high affinity to target molecules of interest, in particular acute leukemia cells. Preferably, the labeled compounds are nanoparticles labeled with luminescent compounds. A preferred magnetically responsive substance is a paramagnetic material. In a first aspect, the subject invention features a method that makes use of luminescent assays and magnetic separation techniques to identify, quantify, and sort/separate target cells in a sample. In this method, (1) aptamers having a high affinity to a target cell or molecule are prepared; (2) any one aptamer of step (1) is conjugated to a labeled nanoparticle; (3) any one aptamer of step (1) is conjugated to a magnetically responsive substance; (4) contacting a sample comprising cells and/or molecules to the labeled aptamers of step (2) and to the magnetic conjugated aptamers of step (3) to allow any target cell/molecule present in the sample to bind with the labeled aptamers of step (2) and to the magnetic conjugated aptamers of step (3) to form magnetic, labeled, target cell/molecule complexes; and (5) subjecting any complexes to flow cell-based assays and magnetic activated cell sorting to detect, quantify, and sort target cells/molecules.

The methods of the subject invention are particularly applicable to the detection and isolation of leukemia cells in solution. The cells/molecules detected and/or sorted in accordance with the subject invention can be contained in any appropriate sample, including a biological fluid or a tissue culture fluid.

A collection of candidate aptamers for use in accordance with the subject invention is generated using conventional synthesis techniques. Preferably, each aptamer in the collection contains both randomized sequences as well as at least one adjacent primer sequence for amplification and/or sequencing. Candidate aptamers include single-stranded and/or double-stranded RNA or DNA of any length. A candidate aptamer may contain modified or derivatized groups known in the art, especially those identified in U.S. Patent No. 5,582,981 and 5,660,985, such as analogous forms of purines and pyrimidines and analogous forms of ribose and deoxyribose.

The success in performing the endeavors described above suggests a broad- spectrum applicability of the subject invention that is not limited to the specific biologic molecules studied herein. Those of skill in the art will appreciate that such systems and methods can be applied to any cell or molecule of interest, biologic or otherwise, that has an affinity for synthetic aptamer sequences.

The invention described below provides each of these advantages, among others, which will be apparent to those skilled in the art.

Brief Description of the Drawings

The file of this patent contains at least one drawing executed in color. Copies of this patent with color drawings(s) will be provided by the Patent and Trademark Office upon request and payment of the necessary fee.

Figure 1 shows flow cytometric determination of magnetic nanoparticle collection and separation efficiencies between target and control cells.

Figure 2(A) shows fluorescence images of extracted samples after five minute incubation with 40 μM Rubpy Dye-aptamer conjugates, followed by three magnetic separation washes.

Figure 2(B) shows fluorescence images of extracted samples after five minute incubation with 0.5 nM Rubpy nanoparticle- aptamer conjugates, followed by three magnetic washes.

Figure 2(C) shows a comparison of dye labeled cells to nanoparticle labeled cells from Figures 2(A) and 2(B) by flow cytometric analysis.

Figure 3(A) shows images of extracted samples from target cells. Figure 3(B) shows images of extracted samples from control cells. Figure 3(C) shows flow cytometric comparison of target and control signal from extracted samples of Figures 3(A) and 3(B) after 5 minute incubation with magnetic and fluorescent nanoparticles, followed by three magnetic separation washes. Figure 4(A) shows images of 1:1 ratio of target cells mixed with Fiuo-4 stained control cells.

Figure 4(B) shows images of Fluo-4 signal after separation of target cells from Figure 4(A) using the dual nanoparticle assay described herein.

Figure 4(C) shows images of Rubpy signal after separation of target cells from Figure 4(A) using the dual nanoparticle assay described herein.

Figure 4(D) shows 1 :1 ratio of Fluo-4 stained target cells mixed with unlabeled control cells.

Figure 4(E) shows images of Fluo-4 signal after separation of target cells from Figure 4(D) using the dual nanoparticle assay described herein. Figure 4(C) shows images of Rubpy signal after separation of target cells from Figure 4(D) using the dual nanoparticle assay described herein.

Figure 5(A) shows confocal images of magnetic, labeled target cells in a sample of whole blood.

Figure 5(B) shows confocal images of a whole blood sample without target cells.

Figures 5(C) and 5(D) show magnified confocal images of magnetic, labeled target cells extracted from the whole blood sample of Figure 5(A).

Brief Description of the Sequence SEQ ID NO:1 shows an aptamer for acute leukemia cells according to the subject invention.

Detailed Disclosure

The present invention provides dual nanoparticle assay systems and methods for the isolation of target cells and/or molecules from a solution via the combined use of flow cytometry assay with magnetic activated cell sorter (MACS). The dual nanoparticle assay of the invention enables simultaneous detection and separation of target cells and/or molecules, which is accomplished by contacting binding agents highly specific for the target cell/molecule, where the binding agents are either attached to a labeled compound for detection or to a magnetically responsive substance to facilitate separation of target cell/molecule from non-target substances. Such dual nanoparticle assays produce a universal, selective, and sensitive method for the collection and subsequent detection of various target cells/molecules.

According to the subject invention, detection and sorting of target substances comprises: (1) providing a binding agent capable of binding to an extracellular domain of a target cell or portion of a target molecule; (2) conjugating to a first binding agent a labeled compound; (3) conjugating to a second binding agent a magnetically responsive substance; (4) contacting the first and second conjugated binding agents with a solution that may contain target cells or molecules under conditions permitting binding of the first and second conjugated binding agents to any target cells or molecules present to form a complex including: the first and second binding agents, the magnetically responsive substance, the labeled compound, and the target cells or molecules; (5) subjecting any complexes present to conditions that enable detection and/or quantification of labeled compounds; (6) contacting the complex with a magnetized matrix under conditions permitting removal of the complex from the solution; and removing the target cells or molecules from the magnetized matrix.

In one embodiment, an assay is provided for detecting and collecting cancer cells, in particular leukemia cells. A high affinity DNA aptamer having a degree of specificity for acute leukemia cells is provided to act as the binding agent. In a preferred embodiment, the binding agent is an 88 base oligonucleotide sequence with specific binding properties (Kd = 5 nM) for CCRF-CEM acute leukemia cells. The aptamer is attached to magnetically responsive nanoparticles and fluorescent nanoparticles in order to develop a specific platform for collecting and imaging intact target leukemia cells from mixed cell and whole blood samples.

According to the subject invention, the term "biological sample" or "sample" refers to a mixture of molecules obtained from a patient. A biological sample can mean, but is not limited to, a sample of whole blood, blood plasma, urine, semen, saliva, lymph fluid, meningal fluid, amniotic fluid, glandular fluid, sputum, feces, sweat, mucous, and cerebrospinal fluid. A biological sample also includes experimentally separated fractions of all of the preceding solutions or mixtures containing homogenized solid material, such as feces, tissues, and biopsy samples.

Detection. Quantification, and Sorting of Target Cells/Molecules

The subject dual nanoparticle assay generally comprises the performance of the following steps: (1) simultaneously interacting a sample that may contain a target substance (e.g. cancer cell, recombinant protein, peptide, carbohydrate, lipid, glycolipid, etc.) with a first binding agent (such as an aptamer sequence) conjugated to a labeled compound and with a second binding agent conjugated to a magnetically responsive substance, to form magnetic, labeled-target-substance complexes where the target substance is present; (2) subjecting any magnetic, labeled-target-substance complexes to flow analyses; and (3) separating magnetic, labeled-target substance complexes from non-magnetic, labeled substances using the magnetically responsive substance.

The method can further comprise any one or combination of the following steps: (1) preparing a binding agent having a high affinity for an extracellular domain of a cancer cell; (2) preparing a binding agent having a high affinity for biologically significant molecules in mammals (such as enzymes, antibodies, antigens, serum proteins, interferons, interleukins, chemokines, and the like, which one skilled in the art would readily recognize and which are found in Goodman and Gilman's, The Pharmacological Basis of Therapeutics. 8^th ed., (1990) Pergomon Press, Elmsford, NY) (3) conjugating the binding agent to a labeled compound; (4) conjugating the binding agent to a magnetically responsive substance; (5) after separating the magnetic, labeled-target substance complexes from non-magnetic, labeled substances, extracting the separated complexes for further study; and (6) separating the magnetically responsive substance from the complex.

According to the subject invention, multiple assays can be performed on a single fluid sample. For example, more than one target cell or molecule can be rapidly and effectively detected and separated from non-target substances in a sample.

In certain embodiments, binding agents that individually detect different target substances are contacted with a sample to detect and sort different target substances in a single sample. To ensure detection of different target substances, it is contemplated herein to use a different labeled compound for each binding agent (and corresponding target substance). For example, where there are two target substances present in a sample, one can detect and separate the different target substances by providing a binding agent specific for each target substance, wherein the labeled compound attached to a binding agent for one target substance is different from the labeled compound attached to a binding agent for the other target substance.

In one embodiment, as a means of detection for an assay, different fluorescing moieties are conjugated via a nanoparticle to binding agents that individually have high affinity for a specific target cell/molecule. For example, a red fluorochrome

(such as Cy5) can be attached to a binding agent for a first target substance and an orange fluorochrome (such as Cy3) can be attached to a binding agent for a second target substance. Thus, due to the different fluorescent emissions of the labeled compounds, one skilled in the art would be able to distinguish the two different target substances from each other (as well as from other substances) in a sample.

The target substances can be physically separated from the non-target substances by simultaneously introducing binding agents conjugated to a magnetically responsive substance, thus forming magnetic, labeled-target-substance complexes that are separable from non-target substances using magnetic activity sorting. Preferably, the binding agent conjugated to the labeled compound and the binding agent conjugated to the magnetically responsive substance each binds to a different portion of a target cell/molecule in a non-interfering manner.

Target Molecules In the present DNA aptamer selection method, a target molecule can be any molecule capable of forming a complex with an oligonucleotide, including, but not limited to, peptides, proteins, enzymes, receptors, antibodies, hormones, glycoproteins, polymers, polysaccharides, nucleic acids, carbohydrates, lipids, sphingolipids, small organic compounds such as drugs, dyes, metabolites, cofactors, transition state analogs and toxins.

Specific target molecules of interest include molecules of biological and physiological relevance in both prokaryotic and eukaryotic organisms, particularly mammals. Examples of such biologically significant molecules in mammals include, but are not limited to, erythropoietin, tissue plasminogen activator, granular colony stimulating factor (G-CSF), growth hormone (GH), endostatin (O'Reilly et al., (1997) Cell 88:277-285), interferons, interleukins, chemokines (Shi et al., (1997) FASEB J. 11:1330; Bubrovsky et al., (1996) PNAS, USA 92:700-709), enzymes such as SOD

(Yoshikai et al., (1995) Cancer Res. 55(8) 1617-1620) and amylase, antibodies (particularly the constant "Fc" regions thereof), OKT3 (Ho et al., (1998) Science 280:1866-1867), serum proteins (e.g., Factor VIII (Papadopulos-Eleopulos et al., (1990) Genetica 95:35-50), Factor VIX, plasminogen, antithrombin III (Jones et al., (1992) Br. J. Cancer 66:744-747), albumin, protein C (Griffin et al., (1993) Blood

82:1989-93), etc.), and vaccines (e.g., HbsAg (Davis et al., (1994) Vaccine 12:1503- 1509), etc.). The physiological significance of most of these, and many other molecules, may similarly be found in Goodman and Gilman's The Pharmacological Basis of Therapeutics, 8th ed., (1990) Pergamon Press, Elmsford, N. Y. Those of skill in the art will appreciate that a virtually unlimited number of other target molecules may also be used with the claimed methods.

For several of the Examples, thyroid transcription factor 1 (TTFl) was chosen as the target molecule. It was recently learned that TTFl is a highly specific marker for primary lung adenocarcinomas, and antibodies against TTFl have been recommended to be included in a panel of antibodies for the differential diagnosis between primary and metastatic adenocarcinomas of the lung (Reis-Filho J S, Carrilho C, Valenti C, Leitao D, Ribeiro C A, Ribeiro S G, Schmitt F C. (2000) Is TTFl a good immunohistochemical marker to distinguish primary from metastatic lung adenocarcinomas? Pathol Res Pract 196(12):835-40). Therefore, the TTFl aptamers described herein may be a valuable diagnostic tool for diseases such as primary lung adenocarcinoma.

Binding Agent

A binding agent of the invention is any entity having a high affinity to a portion of an extracellular domain of a cell and/or high affinity to a portion of a target molecule. The binding agent of the invention will vary depending on the target cell/molecule and/or the type of assay to be performed. Specific examples of binding agents that can be used in accordance with the subject invention include, but are not limited to, antibodies (polyclonal antibody, a monoclonal antibody, or a portion of a monoclonal antibody), antigens, haptens, other types of proteins with binding specificity, as well as a probe or a ligand capable of binding to the target cell/molecule.

In one embodiment, the binding agent is a DNA aptamer. Highly specific DNA aptamers for use in accordance with the invention are selected by SELEX (see Ellington, A.D. and Szostak, J. W., Nature. 346:816-820 (1990); and Tuerk, C. and Gold, L., Science, 249:505-510 (1990)) to bind with specific molecular or cellular targets. Of late, aptamers have been recognized as reliable affinity ligands which rival antibodies in their diagnostic potential (see Brody, E.N. and Gold, L., Reviews in Molecular Biotechnology, 74:5-13 (2000)). While antibodies are still extracted and purified from animals, aptamers can be easily synthesized for the analysis of molecules unlimited by toxicity, and without animal destruction (see Tombelli, S.; Minunni, M.; Mascini, M. Biosensors and Bioelectronics 20: 2424-2434, 2005;

German, ! et al., Anal. Chem. 70:4540-4545 (1998)).

Aptamers are able to fold into unique three dimensional conformations with distinct biomolecular binding properties, and have successfully been used for protein detection by sensor array and affinity capillary electrophoresis, and for targeted therapeutic applications, including a biodegradable nanoparticle-aptamer based method for targeted drug delivery to specific prostate cancer cells and many other interesting applications. See, for example, Kirby, R. et al., Anal. Chem, 76:4066- 4075 (2004); Tan, W. et al., Curr Opin Chem Biol, 8(5):547-553 (2004); Yang, CJ et al., The Proceedings of National Academy of Sciences, 102:17278-17283 (2005); Li, J. et al., Biochemical and Biophysical Research Communications, 292(l):31-40

(2002); Osborne, S.E. et al, Current Opinion in Chemical Biology, 1:5-9 (1997); Farokhzad, O.C. et al., Cancer Research, 64:7668-7672 (2004); and Daniels, D.A. et ah, PNAS, 26(100):15416-15421 (2003)).

In a preferred embodiment, tumor cell SELEX — an in vitro process identifying DNA sequences with strong affinities toward intact tumor cells — is used to select an aptamer with high specificity toward a target leukemia cell line. Aptamers selected by cell SELEX have the ability to differentiate between numerous types of cells. These natural discriminatory properties are revealed during the selection process. Following the published protocols, an aptamer for acute leukemia cells with the following sequence was selected:

TTTAAAATACCAGCTTATTCAATTAGTCACACTTAGAGTTCTAGCTG CTGCGCCGCCGGGAAAATACTGTACGGATAGATAGTAAGTGCAATCT-B' (SEQ ID NO:1).

In a preferred embodiment, the aptamer sequences used to bind to acute leukemia cells have at least 80% homology, more preferably 90%, and more preferably at least 95% homology to the aptamer sequence of SEQ ID NO: 1. It is contemplated that the aptamer sequences may be varied in their sequences, by up to

20 percent, more preferably by 10 percent, most preferably by 5 percent, while retaining the functional properties as described herein.

Nanoparticles Embodiments of this invention use nanoparticles to which magnetically responsive substances or labeled compounds are incorporated. The quantity of magnetically responsive substance or labeled compound in the nanoparticle is not critical and can vary over a wide range, so long as the quantity makes the nanoparticle useful in the assays described herein (such as flow cytometry assay or magnetic activated sorting).

Methods of preparation of nanoparticles are well known in the art. For example, the preparation of monodisperse sol-gel silica nanospheres using the well- known Stober process is described in Vacassy, R. et al., "Synthesis of Microporous Silica Spheres," J. Colloids and Interface Science, 227, 302 (2000). Nanoparticles of the invention can be prepared from a single material or a combination of materials.

For example, nanoparticles can be prepared from either one or a combination of materials including, but not limited to, polymers, semiconductors, carbons, or Li⁺ intercalation materials. Metal nanoparticles include those made from gold or silver. Semi-conductor nanoparticles include those made from silicon or germanium. Nanoparticles of the present invention can be synthesized using a template synthesis method. For example, nanoparticles can be synthesized using templates prepared from glass (Tonucci, Rj. et al., Science 258, 783 (1992)), xeolite (Beck, J.S. et ah, J. Am. Chem. Soc, 114, 10S34 (1992)), and a variety of other materials (Ozin, G.A., Adv. Mater., 4, 612 1992)). Alternatively, nanoparticles can be prepared using a self-assembly process, as described in Wang, Z.L., "Structural Analysis of Self- Assembling Nanocrystal Superlattices," Adv. Mater., 10(l):13-30 (1998). In one embodiment of the invention, the nanoparticle comprises a polymeric matrix that is inert to components of a biological sample and to the magnetically responsive substance and/or labeled compound other than those already affixed to the nanoparticle. Other characteristics of the nanoparticle of the invention are that it be solid and insoluble in the sample and in any other solvents or carriers used in an assay (such as flow cytometry), and that it be capable of affixing either a magnetically responsive substance and/or labeled compound to the nanoparticle.

Examples of suitable polymers for use in preparing nanoparticles of the invention include, but are not limited to, polyesters, polyethers, polyolefms, polyalkylene oxides, polyamides, polyurethanes, polysaccharides, celluloses, and polyisoprenes. Preferred polymers include polystyrene, polyorganosiloxane, poly(methyl methacrylate), polystyrene, polylactic acids, and other biodegradable polymers, acrylic latexes, polyorganosiloxane, cellulose, polyethylene, poly(vinyl chloride), poly(ethyl methacrylate), poly(tetrafluoroethylene), poly(4-iodostyrene/ divinylbenzene), poly(4-vinylpyridine/divinylbenzene), poly(styrene/ divinyl benzene), crosslinked melamine particles, phenolic polymer colloids, polyamide 6/6, natural rubber, naturally occurring biopolymers such as algenates, and collagen, or mixtures thereof. Crosslinking is useful in many polymers for imparting structural integrity and rigidity to the nanoparticle.

Functional groups for attachment of the binding agent, magnetically responsive substance, and/or labeled compound to the nanoparticle can be incorporated into the polymer structure or attached to a surface of a nanoparticle by conventional means, including the use of monomers that contain the functional groups, either as the sole monomer or as a co-monomer. Examples of suitable functional groups are amine groups ( — NH₂), ammonium groups ( — NH₃ ⁺ or — NR.3⁺), hydroxyl groups ( — OH), carboxylic acid groups ( — COOH), and isocyanate groups ( — NCO). Useful monomers for introducing carboxylic acid groups into polyolefins, for example, are acrylic acid and methacrylic acid. Attachment of the binding agent, magnetically responsive substance, and/or labeled compound to nanoparticle surface can be achieved by electrostatic attraction, specific affinity interaction, hydrophobic interaction, or covalent bonding. Covalent bonding is preferred. Linking groups can be used as a means of increasing the density of reactive groups on the nanoparticle surface and decreasing steric hindrance to increase the range and sensitivity of the assay, or as a means of adding specific types of reactive groups to the nanoparticle surface to broaden the range of types of binding agents, magnetically responsive substances, and/or labeled compounds that can be affixed to the nanoparticle. Examples of suitable useful linking groups are polylysine, polyaspartic acid, polyglutamic acid and polyarginine.

In certain embodiments of the invention, the surface of polymer nanoparticles can be functionalized using well known chemical methods. For example, methods employed for polylactide synthesis allow for differential end-functionalization. Polymerization occurs by an insertion mechanism mediated by Lewis acids such as Sn²⁺ whose bonds with oxygen have significant covalent character. An alcohol complexed with the metal ion initiates polymerization, which continues by stepwise ring-opening of the lactide monomers to generate a new alkoxide-metal complex capable of chain growth. The polymer molecular weight can be controlled by the molar ratio of initiating alcohol to the lactide monomer. The resulting polyester possesses directionality with a hydroxyl terminus (from the first monomer) and a functional group at the ester terminus determined by the structure of the initiating alcohol. The latter can contain a variety of functional groups to enable attachment of a binding agent, magnetically responsive substance, and/or labeled compound to a nanoparticle surface. Alternatively, functional groups can be introduced by copolymerization.

Natural amino acids are sterically similar to lactic acid but offer a variety of functional groups on their side chains (-OH, -CO₂H, -NH₂, -SH, etc.). Moreover, amino acids are found in all cell types, so that the polymer degradation products are non-toxic. Monomers derived from an amino acid and lactic acid can be synthesized by standard methods and used for random copolymerization with lactide. In accordance with the present invention, nanoparticles can have functional groups on any surface to enable the attachment of a binding agent, magnetically responsive substance, and/or labeled compound.

In addition, the binding agent, magnetically responsive substance, and/or labeled compound can be incorporated into the nanoparticle framework, which can include chitosan, PEGylated PLGA (poly(lactic-co-glycolic acid), or other PEGylated compounds. For example, a commercially available PEG-maleimide can be incorporated into chain-end thiols on the outer surface of the nanoparticles. Alternatively, the binding agent, magnetically responsive substance, and/or labeled compound can be incorporated into nanoparticle frameworks composed of polymeric materials including, for example, polylactide based polymers as described above.

In one embodiment, aptamers can be attached to nanoparticles of the invention via proteins. Aptamers can be attached to proteins utilizing methods well known in the art (see Brody, E.N. and L. Gold, "Aptamers as therapeutic and diagnostic agents," J Biotechnol, 74(1):5-13 (2000) and Brody, E.N. et ah, "The use of aptamers in large arrays for molecular diagnostics," MoI Diagn, 4(4):381-8 (1999)). For example, photo-cross-linkable aptamers allow for the covalent attachment of aptamers to proteins. Such aptamer-linked proteins can then be immobilized on a functionalϊzed surface of a nanoparticle.

For example, aptamer-linked proteins can be attached covalently to a nanoparticle surface via attachment of the aptamer-linked protein by functionalization of the nanoparticle surface. Alternatively, aptamer-linked proteins can be covalently attached to a nanoparticle surface via linker molecules. Non-covalent linkage provides another method for introducing aptamer-linked proteins to a nanoparticle surface. For example, an aptamer-linked protein may be attached to a nanoparticle surface by absorption via hydrophilic binding or Van der Waals forces, hydrogen bonding, acid/base interactions, and electrostatic forces.

In embodiments in which nanoparticles are used for flow cytometry assays, care should be taken to avoid the use of nanoparticles that emit high autofluorescence since this renders them unsuitable for flow cytometry. Nanoparticles created by standard emulsion polymerization techniques from a wide variety of starting monomers generally exhibit low autofluorescence. Conversely, particles that have been modified to increase porosity and therefore surface area (such particles are referred to in the literature as "macroporous" particles) exhibit high autofluorescence. Autofϊuorescence in such particles further increases with increasing size and increasing percentage of divinylbenzene monomer.

Within these limitations, the size range of the nanoparticles of the invention can vary and particular size ranges are not critical to the invention. In most cases, the aggregated size range of the nanoparticles lies within the range of from about 0.3 micrometers to about 100 micrometers in particle diameter and preferably within the range of from about 0.5 micrometers to about 40 micrometers. The nanoparticles utilized in the application of the invention had an average diameter of approximately 50 nanometers.

Dual nanoparticle assays performed in accordance with this invention are achieved by assigning the nanoparticles to two or more groups, where each group is useful in the performance of either an assay or magnetic activity sorting. For example one group of nanoparticles can be conjugated to labeled compounds and another group of nanoparticles can be conjugated to magnetically responsive substances.

Detection and/or Quantification of Labeled Compounds

The assays performed to detect labeled compounds (when bound to target cells/molecules) in accordance with the present invention can be any type of heterogeneous assay that yields a result differentiating a target cell/molecule from other non-labeled substances in a biological sample. In one embodiment of the invention, an electrical light is used to excite labeled compounds to enable detection of target cells/molecules. Alternatively, labeled compounds can be detected based on an electrochemical reaction to emit detectable chemiluminescent signals. Methods of and instrumentation for flow cytometry are known in the art, and those that are known can be used in the practice of the present invention. Flow cytometry in general resides in the passage of a suspension of the microparticles as a stream past a light beam and electro-optical sensors, in such a manner that only one particle at a time passes through the region. As each particle passes this region, the light beam is perturbed by the presence of the particle, and the resulting scattered and fluorescent light are detected. The optical signals are used by the instrumentation to identify the subgroup to which each particle belongs, along with the presence and amount of label, so that individual assay results are achieved. Descriptions of instrumentation and methods for flow cytometry are found in the literature. Examples are McHugh, "Flow Microsphere Immunoassay for the Quantitative and Simultaneous Detection of Multiple Soluble Analytes," Methods in Cell Biology 42, Part B (Academic Press, 1994); McHugh et al., "Microsphere-Based Fluorescence

Immunoassays Using Flow Cytometry Instrumentation," Clinical Flow Cytometry, Bauer, K. D., et al., eds. (Baltimore, Md., USA: Williams and Williams, 1993), pp. 535-544; Lindmo et al., "Immunometric Assay Using Mixtures of Two Particle Types of Different Affinity," J. Immunol. Meth. 126: 183-189 (1990); McHugh, "Flow Cytometry and the Application of Microsphere-Based Fluorescence Immunoassays,"

Immunochemica 5: 116 (1991); Horan et al., "Fluid Phase Particle Fluorescence Analysis: Rheumatoid Factor Specificity Evaluated by Laser Flow Cytophotometry,". Immunoassays in the Clinical Laboratory, 185-189 (Liss 1979); Wilson et al., "A New Microsphere-Based Immunofluorescence Assay Using Flow Cytometry," J. Immunol Meth. 107: 225-230 (1988); Fulwyler et al., "Flow Microsphere

Immunoassay for the Quantitative and Simultaneous Detection of Multiple Soluble Analytes," Meth. Cell Biol. 33: 613-629 (1990); Coulter Electronics Inc., United Kingdom Patent No. 1,561,042 (published Feb. 13, 1980); and Steinkamp et al., Review of Scientific Instruments 44(9): 1301-1310 (1973). At this time, there are a number of commercially available flow cytometry instruments that utilize electrochemiluminescence for analytical measurements. Species that can be induced to emit electrochemulminescence (ECL) can be used as labeled compounds of the invention. The light generated by ECL labeled compounds can be used as a reporter signal in diagnostic procedures (see, for example, U.S. Patent No. 5,238,808). For instance, an ECL labeled compound can be covalently coupled to a binding agent such as an aptamer, antibody, nucleic acid probe, receptor or ligand; the participation of the binding agent in a binding interaction can be monitored by measuring ECL emitted from the ECL labeled compound. For more background on ECL, ECL labels, ECL assays and instrumentation for conducting ECL assays see U.S. Patent Nos. 5,093,268; 5,147,806; 5,324,457; 5,591,581;

5,597,910; 5,641,623; 5,643,713; 5,679,519; 5,705,402; 5,846,485; 5,866,434; 5,786,141; 5,731,147; 6,066,448; 6,136,268; 5,776,672; 5,308,754; 5,240,863; 6,207,369 and 5,589,136 and Published PCT Nos. WO99/63347; WO00/03233; WO99/58962; WO99/32662; WO99/14599; WO98/12539; WO97/36931 and WO98/57154.

In one embodiment, the labeled compound is a nanoparticle having at least one fluorochrome incorporated therein to impart emission spectra characteristics that enable visual detection. In other embodiments, the labeled compound is a nanoparticle having any known colored dyes incorporated therein to impart light scattering characteristics that enable visual detection. In further embodiments, the labeled compound is a nanoparticle having any one or combination of the following incorporated therein: i) organometallic compounds where the metal is from, for example, the noble metals of group VIII, including Ru-containing and Os-containing organometallic compounds such as the Tris(2,2'- bipyridyl)dichlororuthenium(II)hexahydrate (RuBpy) moiety and Tris(2,2'- bipyridyl)osmium(π)bis(hexafluorophosphate) (OsBpy) ii) luminol and related compounds.

In another embodiment, electro semiconductor quantum dots are used to label target compounds. Electro semiconductor quantum dots are ultrasmall semiconductor microcrystallites, in which the carrier confinement is sufficiently strong to allow only quantized states of the electrons and "holes." Optical excitation of a semiconductor quantum dot leads to the creation of a quasiparticle known as an exciton — a negatively charged electron bound together with a positively charged hole. In contrast to the electrical injection of electrons that leads to the Coulomb blockade effect, a quantum dot remains neutrally charged following optical excitation. See Bayer et al. {Nature 405, 923-926 (2000)) and Warburton et al. {Nature 405, 926-929 (2000)), both of which study this exciton in detail by measuring the light emitted when the hole and electron recombine. This occurs when extra electrons are electrically injected into the quantum dot, or when additional excitons are created in a carefully controlled way.

In a preferred embodiment, an aptamer is attached to fluorescent nanoparticles to provide enhanced signal and a means of detection via flow cytometry assay.

Beneficial aspects of stable luminescent probes — specifically high sensitivity and ease of detection — facilitate biological and nano-scale imaging analyses. Dye doped silica nanoparticles have previously been used to replace fluorescent dyes because of their signal amplification and compatibility for the immobilization of biomolecules. See Zhao, X. et al, The Proceedings of National Academy of Sciences, 101:15027-32 (2004); Zhao, X. et al., J. Am. Chem. Soc, 125:11474-11475 (2003); and Zhao, X. et al., Advanced Materials 16(2):173 (2004)).

Exploiting the availability of hydroxyl groups on the particle surface has proven useful for DNA and mRNA detection (see Zhao, X. et al., Am. Chem. Soc. 125:11474-11475 (2003); and Lian, W. et al., Anal. Biochem, 334: 135-144 (2004)) as well as protein and antigen detection. See, for example, Lian, W. et al., Anal. Biochem, 334:135-144 (2004); Yang, W. et al., Analytica Chimica Acta 503(2):163-

169 (2004); Santra, S. et al, J. Biomedical Optics, 6(2) (2001); Santra, S. et al., Anal. Chem. 73:4988-4993 (2001); Yang, H. et al., Analyst 128:462-466 (2003)); and Ye, Z. et al., Anal. Chem. 76:513-518 (2004).

In accordance with the subject invention, fluorescent-doped silica nanoparticles are utilized to enhance the signal intensity corresponding to each aptamer binding event to a target cell/molecule. For example, for each fluorescent nanoparticle bound to a target cell via an aptamer, a silica nanoparticle containing thousands of dye molecules is immobilized on the cell surface. Upon excitation (i.e., with a light source), those dye molecules simultaneously release a fluorescent signal that is significantly brighter than an individual dye probe.

To detect and/or quantify target cells/molecules bound to labeled compounds in a biological sample, fluorescence imaging and/or flow cytometry are used. Such assays can also be used to confirm the selectivity and enhanced sensitivity of the assay.

Magnetically Responsive Substance

The term "magnetically responsive substance" or "magnetic nanoparticle," as used herein, denotes a material that responds to a magnetic field. Magnetically responsive substances of interest in this invention include paramagnetic materials, ferromagnetic materials, ferrimagnetic materials, and metamagnetic materials.

Paramagnetic materials are preferred. Examples are iron, nickel, and cobalt, as well as metal oxides such as Fe₃O₄, BaFei₂Oi9, CoO, NiO, Mn₂O₃, Cr₂O₃, and CoMnP. Rather than constituting the entire nanoparticle, the magnetically responsive substance is preferably only one component of the nanoparticle whose remainder consists of a polymeric material to which the magnetically responsive substance is affixed.

In certain embodiments, the magnetically responsive substance and labeled compound are attached to separate but identical binding agents via nanoparticle(s).

Alternatively, the magnetically responsive substance and labeled compound can both be attached to a single binding agent via nanoparticle(s). In other embodiments, the magnetically responsive substance and labeled compound are attached to separate and different binding agents via nanoparticle(s). In aspects and embodiments of this invention that involve the use of magnetically responsive substances, the quantity of magnetically responsive substance in the nanoparticle is not critical and can vary over a wide range. The quantity can affect the density of the nanoparticle, however, and both the quantity and the nanoparticle size can affect the ease of maintaining the nanoparticle in suspension for purposes of achieving maximal contact between the liquid and solid phase and for facilitating flow cytometry. Furthermore, an excessive quantity of magnetically responsive material in the nanoparticles will produce autofluorescence at a level high enough to interfere with the assay results. It is therefore preferred that the concentration of magnetically responsive material be low enough to minimize any autofluorescence emanating from the material.

With these considerations in mind, the magnetically responsive substance in a nanoparticle in accordance with this invention preferably ranges from about 1% to about 75% by weight of the particle as a whole. A more preferred weight percent range is from about 2% to about 50%, a still more preferred weight percent range is from about 3% to about 25%, and an even more preferred weight percent range is from about 5% to about 15%. The magnetically responsive substance can be dispersed throughout the nanoparticle (such as polymeric nanoparticle), applied as a coating on the nanoparticle surface, or as one of two or more coatings on the nanoparticle surface, or incorporated or affixed in any other manner that secures the magnetically responsive substance in the nanoparticle (e.g., nanoparticle polymer matrix). Magnetic Separation and Sorting

Methods of and instrumentation for applying and removing a magnetic field as part of an assay are known to those skilled in the art and reported in the literature. Examples of literature reports that describe magnetically responsive substances and their use in assays include, but are not limited to, U.S. Patent Nos. 4,141,687 and

4,115,534; Vlieger, A. M. et al, Analytical Biochemistry 205:1-7 (1992); Dudley, Journal of Clinical Immunoassay 14:77-82 (1991); and Smart, Journal of Clinical Immunoassay 15:246-251 (1992).

As an alternative to centrifugation, magnetic nanoparticle-aptamer based cell sorting is employed, as described herein, for selective malignant cancer cell separation and collection. Previously, magnetic activated cell sorting (MACS) was extensively used for selective extraction and enrichment of epithelial cells (Griwatz, C. et al., J. Immun. Methods 183:251-265 (1995)), endothelial cells (Marelli-Berg. F.M. et al., J. Immun. Methods 244:205-215 (2000)), bacteria (Porter, J. et al, J. Applied Microbiology 84:722-732 (1998)), and circulating tumor cells (see Iinuma, H. et al., Int. J. Cancer 89:337-344 (2000); Stanciu, L.A. et al, J. Immun. Methods 189:107-115 (1996); Hu, X.C. et al, Oncology 64:160-165 (2003); and Benez, A. et al, J. CHn. Lab. Analysis 13:229-233 (1999)). To date, MACS has not been used in combination with aptamers and labeled compounds to provide a rapid and accurate combination assay and separation technique for target cancer cells in a single biological sample.

While current MACS methods normally use micron-sized magnetic polymer beads, certain embodiments of the present invention to utilize 65nm silica coated magnetic nanoparticles. Magnetic nanoparticles have previously been used for gene collection (see Zhao, X. et al, W. Anal Chem. 75(14):3476-3483 (2003)) and peptide isolation for MS analysis (Turney, K. et al, Rapid Comm. Mass Spec. 18:1-8 (2004)). The small size and increased relative surface area of nanoparticles provide enhanced extraction capabilities compared with larger particles.

In a preferred embodiment, MACS and flow cytometry assay techniques are simultaneously implemented, wherein aptamer conjugated, iron oxide doped nanoparticles are provided for selective leukemia cell extraction as well as quantification of leukemia cells present in the biological sample. In addition to enabling selective target extraction, magnetic nanoparticle based sorting removes the need to centrifuge cell samples and the need for presample clean up. As a result, the collection of unwanted nanoparticle aggregates and unbound materials from target cell extractions is eliminated, and a reduced background is observed.

Utility of Selected Target Cells/Molecules

The target cells or molecules isolated by the systems and methods described by the invention can be used to purify target cells/molecules from the biological sample for such uses as research, development, diagnostic and pharmaceutical industry applications.

One aspect of the present His6 aptamers is their application to solid supports. In one aspect, arrays of tagged proteins can be immobilized in an array on a solid support, in which the solid support has been spotted with an aptamer such as the aptamers of SEQ ID NOS: 14, 15 and 16. In another aspect, solid supports used in SPR may be modified to accept the present aptamers, and his-tagged proteins used as target molecules to be captured or immobilized by the present aptamers.

The following example illustrates a procedure for practicing the invention. This example should not be construed as limiting the scope of the invention in any way. All percentages are by weight and all solvent mixture proportions are by volume unless otherwise noted.

Example 1 Materials All materials were purchased from Sigma-Aldrich (St. Louis, MO) unless otherwise noted. Whole blood samples were obtained from Research Blood Components, LLC (Brighton, MA). Fluo-4 was purchased from Molecular Probes (Eugene, OR), and carboxylethylsilanetriol sodium salt was purchased from Gelect, Inc. (Morrisville, PA). N-hydroxysulfosuccinimide (Sulfo-NHS) and l-Ethyl-3-[3- dimethylaminopropyl] carbodiimide Hydrochloride (EDC) were purchased from

Pierce Biotechnology, Inc.( Rockford, IL). Hydrochloric acid and Ammonium Hydroxide were obtained from Fisher Scientific. Fluorescent Nanoparticle Synthesis:

Dye doped nanoparticles were synthesized by the reverse microemulsion method (see Santra, S. et al., J. Biomedical Optics, 6(2) (2001)). First, 1.77 mL Triton x-100, 7.5 mL cyclohexane, 1.6 mL n-hexanol were added to a 20 mL glass vial with constant magnetic stirring. Then, 400 μL of H₂O and 80 μL of 0.1M tris(2,2' -bipyridyl) dichlororuthenium (II) hexahydrate (Rubpy) dye (MW=748.63) were added, followed by the addition of 100 μL Tetraethyl Orthosilicate (TEOS). After thirty minutes of stirring, 60μL NHUOH was added to initiate silica polymerization. After 18 hours, the carboxyl modified silica post-coating was initiated by adding 50 μL TEOS, 40 μL carboxylethylsilanetriol sodium salt, and 10 μL 3-(Trihydroxyl)propyl methyl phosphonate. Polymerization proceeded for 18 hours, and particles were centrifuged, sonicated, and vortexed four times with 95% ethanol, followed by one wash with H₂O. Carboxyl functionalized Rubpy nanoparticles were modified with DNA by adding 1.2 mg EDC, 3.5 mg Sulfo-NHS, and 0.5 nmoles DNA with 2 mg of particles dispersed in 1.5 mL of 10 mM MES buffer (pH= 5.5). The solution was then mixed for three hours. Particles were then washed by centrifugation at 14000 rpm three times with 0.1 M Phosphate Buffered Saline (PBS) (pH=7.2). Rubpy nanoparticles were stored at room temperature and were dispersed in cell media buffer at a final concentration of ~10 mg/mL.

Magnetic Nanoparticle Synthesis:

The iron oxide core magnetic nanoparticles (see Tumey, K. et al., Rapid Comm. Mass Spec, 18:1-8 (2004)) were prepared by means of precipitating iron oxide by mixing ammonia hydroxide (2.5%) and iron chloride at 350 RPM using a mechanical stirrer (10 minutes). The iron chloride solution contains ferric chloride hexahydrate (0.5 M), ferrous chloride tetrahydrate (0.25 M), and HCl (0.33 M). After three washes with water and once with ethanol, an ethanol solution containing ~1.2 % ammonium hydroxide was added to the iron oxide nanoparticles, yielding a final concentration of ~7.5 mg/mL.

To create the silica coating for the magnetite core particles, tetraethoxyorthosilicate (200 μL) was added, and the mixture was sonicated for 90 minutes to complete the hydrolysis process. For post coating, an additional aliquot of TEOS (10 μL) was added and additional sonication was performed for 90 minutes. The resulting nanoparticles were washed three times with ethanol to remove excess reactants. For avidin coating, a 0.1 mg/mL Fβ3θ4-SiO₂ (silica coated magnetic nanoparticles) solution and a 5 mg/mL avidin solution were mixed and then sonicated for 5-10 minutes. The mixture was incubated at 4° C for 12-14 hours. The particles were then washed three times with 10 mM phosphate buffered saline (PBS) pH 7.4 and dispersed at 1.2 mg/mL in 10 mM PBS, and the avidin coating was stabilized by cross-linking the coated nanoparticles with 1% glutaraldehyde (1 hour at 25^° C). After another separation, the particles were washed three times with IM Tris-HCl buffer. Then, the particles were dispersed and incubated in the IM Tris-HCl buffer (3 hours at 4^° C), followed by three washes in 20 rnM Tris-HCl, 5 mM MgCl₂, pH 8.0.

DNA was attached to the particles by dispersing the particles at 0.2 mg/mL in 20 mM Tris-HCl, 5 mM MgCl₂, pH 8.0. Biotin labeled DNA was added to the solution at a concentration of 31 μM. The reaction was incubated at 4° C for 12 hours, and three final washes of the particles were performed using 20 mM Tris-HCl, 5 mM MgCl₂ at pH 8.0. Magnetic nanoparticles were used at a final concentration of ~0.2 mg/mL and stored at 4° C before use.

Magnetic Extraction:

For each magnetic extraction the specified amount of magnetic nanoparticles were added to the sample. The aptamer conjugated magnetic nanoparticles were then incubated with the target cells for 5 minutes unless specified otherwise. After the incubation period a magnetic field was applied to the side of the sample container.

After a minute, the non-magnetic materials were removed with a Pasteur pipette and then fresh buffer was added and the magnetic field was removed. The materials were mixed in the buffer and previous steps were repeated for a total of three times to remove anything nonspecifically bound to the magnetic nanoparticles. . Cells — CCRF-CEM cells (CCL-119 T-cell, human acute lymphoblastic leukemia), and Ramos cells (CRL-1596, B-cell, human Burkitt's lymphoma) were obtained from ATCC (American Type Culture Association), and cultured in RPMI ' medium supplemented with 10% fetal bovine serum (FBS) and 100 IU/mL penicillin- Streptomycin. Before nanoparticle incubation, cells were dispersed in 500 μL cell media buffer and centrifuged at 920 rpm for five minutes three times, and were then redispersed in 200 μL media buffer. Fluorescent and magnetic nanoparticle solutions were then simultaneously added to the cell solutions at a 20:1 ratio, respectively.

After nanoparticle incubation, cells were washed by magnetic extraction with 500 μL media buffer three times, and redispersed in 20 μL buffer for imaging and 200 μL buffer for flow cytometric and collection efficiency analyses. All pure sample experiments started with 1.0 x 10⁵ - 5.0 x 10^s cells before nanoparticle incubation.

Sample Assays:

To determine the extraction and detection capabilities in an artificial complex sample, equal amounts of CEM and Ramos cells were mixed and tested using the assay. Approximately 10⁵ cells of each type were mixed, followed by magnetic and fluorescent nanoparticle incubation for five minutes. Magnetic extraction procedures were performed three times to remove unbound cells. A 2 μL aliquot of the redispersed extracted sample was then imaged by confocal microscopy.

To show applicability in real biological samples, whole blood was spiked with 10⁵ CEM cells. Fluorescent and magnetic nanoparticles were then incubated for five minutes with spiked and unspiked blood samples, followed by three magnetic extractions. Confocal imaging was then used to characterize cell extractions.

Collection efficiency was measured from pure cell samples and spiked blood samples. For efficiency studies, cell samples subjected to nanoparticle incubation and magnetic extractions were compared to samples not subjected to any separations by magnetic extraction. For pure cell analyses, 5 - 30μg of magnetic nanoparticles were individually incubated in 5 μg increments with approximately 10⁵ cells initially, and subjected to magnetic extractions after five minute incubation. The efficiency of cell extraction from the spiked blood sample was determined by incubating magnetic nanoparticles (30μg) with 500 μL whole blood spiked with 10⁵ CEM cells. Cells were counted by flow cytometry for pure samples, and by imaging for blood samples.

Various magnetic nanoparticle concentrations were used to determine maximum collection efficiency and optimal separation efficiency. Cell Imaging:

Fluorescence imaging was conducted with a confocal microscope setup consisting of an Olympus DC-81 inverted microscope with an Olympus Fluoview 500 confocal scanning system and three lasers, a tunable Argon Ion laser (458nm, 488nm,

514nm), a green HeNe laser (543nm), and a red HeNe laser (633nm) with three separate photomultiplier tubes (PMT) for detection. The cellular images were taken with a 2Ox 0.70 NA objective. The fluorescent nanoparticles were excited with

488nm line of the Argon ion laser and emission was detected using a 610nm long pass filter. Fluo-4 was excited with the 488nm laser line and was detected with a 505-

525nm band pass filter.

Flow Cytometry:

Fluorescence measurements were also made using a FACScan cytometer (Becton Dickinson Immunocytometry Systems, San Jose, CA). To support imaging data, Rubpy fluorescence of pure samples initially containing 10⁵ cells were measured by counting 30000 events. Cell experiments were performed exactly as stated for imaging experiments, except all solutions were diluted to a final volume of 200 μL.

Cell sorting allowed for accurate quantitative analysis of cell samples, as well as a platform for collection efficiency determination.

Collection Efficiency:

Values for the collection efficiency were obtained by incubating increasing amounts of magnetic nanoparticles with the target CEM cells and Ramos control cells. The number of cells collected was determined by flow cytometry by the counting of signal events. In addition, the cell counting was performed on a control sample of both cell types that did not undergo the magnetic extraction and was taken as the total amount of the cells. The collection efficiency was calculated by dividing the number of events for each sample by the total cell number. As seen in figure 1 , the collection efficiency of target cells from ranges from 30-80%, however the collection efficiency seems to plateau at around 80%. In addition, the Ramos control cells had collection efficiencies ranging from 0.5-5% for the same magnetic nanoparticle concentrations. This indicates that the target cells can be preferentially extracted from a sample, while few of the Ramos cells are extracted using the same method. Since the use of 10μ.L of magnetic nanoparticles had the highest separation efficiency, this amount was used for sample assay experiments.

Dye and Nanoparticle Fluorescent Intensity Comparison:

To demonstrate the fluorescence enhancement capabilities of Rubpy doped nanoparticles, individual Rubpy probes were linked with a DNA aptamer of the invention and directly compared to Rubpy Nanoparticle-aptamer conjugates after immobilization on the target cells. Equal concentrations of magnetic and Rubpy nanoparticles (0.5 nM) were incubated with CEM cells, then washed by magnetic extraction with 500 μL media buffer three times, and redispersed in 20 μL buffer for imaging and 200 μL buffer for flow cytometric analysis.

Figure 2 (A) and (B) compare cell extractions labeled with fluorescent nanoparticles to extractions labeled with Rubpy dye. There is a significant difference in the amount of fluorescent signal seen in the two images. Flow cytometry was used to verify that the Rubpy nanoparticles provide enhanced fluorescence signal, and Figure 2 (C) confirms over a 100-fold enhancement of Rubpy nanoparticle labeled cells to Rubpy dye labeled cells. This figure also shows the nanoparticle labeled cells in an apparent bimodal distribution. While the exact cause of this pattern is unknown possible explanations include the formation of nanoparticle aggregates, the formation of cell/nanoparticle aggregates, different levels of receptors on cells, or simply an artifact of the experimental method used. Nonetheless the experiment illustrates the signal advantage that the fluorescent nanoparticles possess over single fluorophores.

Sample Assays:

To demonstrate the concept of the dual nanoparticle assay system of the present invention, individual CEM and Ramos cell solutions were subjected to a dual nanoparticle assay procedure as described herein, followed by fluorescent imaging and flow cytometric analysis. Before nanoparticle incubation, cells were dispersed in

500 μL cell media buffer and centrifuged three times at 920 rpm for five minutes, and were then redispersed in 200 μL media buffer. Fluorescent and magnetic nanoparticle solutions were then simultaneously added to the cell solutions at a 20:1 ratio, respectively. After five-minute nanoparticle incubation, cells were washed by magnetic extraction with 500 μL media buffer three times, and redispersed in 20 μL buffer for imaging and 200 μL buffer for flow cytometric analyses. All pure sample experiments started with 1.0 x 10⁵ - 5.0 x 10⁵ cells before nanoparticle incubation. Each pure cell extraction was repeated 10 times. Figure 3 shows representative confocal images of 2 μL aliquots of target cells (A), and control cells (B) after five minute incubation and three magnetic extractions.

. There was a noticeable change in both the amount of cells present and fluorescent signal between the extracted cell solutions. Magnetic collection pulled out few control cells, while a significant number of target cells were extracted using the same procedures. In addition, the few control cells inadvertently collected by magnetic extractions were labeled with few Rubpy nanoparticles and had no significant fluorescent signal. Conversely, the target CEM cells that were subjected to the assay had very intense fluorescent signals that made them easily distinguishable from the control cells. The flow cytometric analysis of the pure sample assay, Figure 3 (C) confirms that fewer control cells were collected than target cells, and the control cells showed less fluorescent emissions than the extracted target cells.

Mixed Cell Sample Assays:

In order to evaluate the potential of the assay of the present invention, complex samples needed to be tested to determine extraction and detection capabilities in complex matrices. Figure 4 shows the results from an artificial complex sample where equal amounts of CEM and Ramos cells were mixed and the subject dual nanoparticle assay was applied. To differentiate CEM from Ramos cells,

Fluo-4 — a fluorescent calcium indicator — was used to label Ramos cells prior to nanoparticle incubation. Fluo-4 labeled control cells were mixed (1:1) with unlabeled CEM cells shown in Figure 4 (A). Magnetic and fluorescent nanoparticles were simultaneously added and incubated at 4°C for five minutes with occasional gentle stirring.

After incubation, a magnetic field was applied to remove cells which were not attached to the aptamer labeled iron oxide particles. A 2 μL aliquot of the extracted sample was then illuminated to monitor Fluo-4 and Rubpy fluorescence as shown in Figure 4 (B) and (C), respectively. Based on the images, the assay was able to collect the CEM cells in the sample and bright fluorescence from the Rubpy nanoparticles made them easily distinguishable. The experiment was also performed by labeling CEM cells with Fluo-4 and mixing them with unlabeled control cells as in Figure 4

(D). The cells shown in Figure 4 (E) were separated by the two particle assay, and all exhibit a Fluo-4 signal. In Figure 4 (F), the same cells are shown with the Rubpy emission overlaid. The presence of the Fluo-4 fluorescence proves that only the CEM cells were collected and imaged. The lack of Fluo-4 signal in Figure 4 (B), along with the presence of the Fluo-4 signal in Figure 4 (E) prove that only target cells are being collected using this method for extractions from 1 :1 cell mixtures. These samples were repeated 5 times with similar results achieved for each experiment.

Whole Blood Sample Assays: Blood samples were also used to determine detection capabilities of the subject dual nanoparticle assay system when subjected to complex biological solutions. Control experiments indicated that the aptamer sequence used was stable in serum samples for up to. 2 hours. Target cells were spiked into whole blood samples (500 μL) and compared to unspiked samples after magnetic extraction to make certain that target cells could be detected in complex biological samples.

As shown in Figure 5, nonspecific interactions caused the unwanted collection of some red blood cells, but the lack of Rubpy fluorescent signal on the unwanted cells allows for target cells to still be accurately distinguished. For magnetic extractions from whole blood samples, 40% of the spiked target cells were routinely recovered after three magnetic washes and after accounting for dilution. This is consistent with current extraction efficiency values reported by immunomagnetic separation (Stanciu, L-A. et at., J. Immun. Methods 189:107-115 (1996); Benez, A. et al., J. Clin. Lab. Analysis 13:229-233 (1999)). These experiments were repeated for total of five times with similar results being obtained in each sample. This experiment was meant to mimic a real clinical sample which normally would contain thousands of different species. With successful extraction of the target cell line from whole blood, the subject method is shown to be applicable for biomolecular and cellular detection in real clinical applications. The subject dual nanoparticle assay selectively removes target cells from complex mixtures with collection efficiencies rivaling or surpassing current methods for cellular detection from clinical samples. The utilization of aptamer conjugated magnetic and fluorescent nanoparticles in this assay was possible only because there are sufficient aptamer binding sites for both types of particles on target leukemia cells. For the analysis of cells having few aptamer recognition sites, different aptamers or other recognition elements can be labeled on each type of particle to eliminate competitive binding. Compared with current diagnostic techniques, the dual nanoparticle assay described herein has three distinct advantages for molecular recognition. First, highly specific aptamers were used for molecular recognition. Prolonged stability and facile synthesis make aptamers an ideal replacement for antibodies in cellular recognition studies. As demonstrated in this Example, incorporating aptamers onto nanoparticles does not adversely affect the aptamer' s binding properties with intact cells, and therefore the aptamers can be utilized for selective extraction and sensitive molecular detection. The aptamer used in this Example was selected specifically for intact target cells, and cellular detection is possible without significant sample preparation.

The second major advantage of the dual nanoparticle assay of the invention is magnetic nanoparticle-aptamer based cell sorting, which allows for selective cell collection from complex samples. Iron oxide doped silica nanoparticle-aptamer conjugates were used herein for t-cell collection and washing. The aptamer described in this Example is based on MACS application, which is effective for the selective extraction of target molecules, and allows for enhanced extraction efficiency from clinical samples. Another advantage of magnetic extraction is the removal of nanoparticle aggregates and other unbound fluorescent materials that normally would cause increased background fluorescence.

The dual nanoparticle assay of the invention is also very fast, with rapid incubation and magnetic extractions allowing for rapid detection. While immunophenotypic and PCR based analyses take hours to complete, the subject dual nanoparticle assay requires as little as 5 minute incubation for sufficient nanoparticle binding, and the entire method can easily be performed in less than one hour. In this Example, fluorescent dye-doped nanoparticles were used to provide enhanced signaling capabilities. Rubpy doped nanoparticle-aptamer conjugates were used to amplify the signal intensity corresponding to each aptamer binding event, resulting in much improved sensitivity compared to individual Rubpy dye labeled probes. Nanoparticles were coated with silica, and dye concentrations inside the nanoparticles were optimized to reduce photobleaching effects, further enhancing the method's sensitivity. Rubpy nanoparticles are shown here to increase the fluorescent signal corresponding to aptamer binding to the target leukemia cells, and have been used here as effective, sensitive replacements for individual Rubpy labeled aptamer probes. The fluorescent nanoparticles also add an additional level of selectivity to the method since only cells that are magnetically extracted and possess a high fluorescent intensity are recognized as target cells. As in the whole blood experiments, some cells were non-specifically extracted but were easily distinguished from the target cells based on the fluorescence intensity. Though Rubpy nanoparticles have shown an enhancement here over individual dye labeled probes, the true benefit of the subject dual nanoparticle assay will be revealed when the enhancement effects of nanoparticles are used to detect binding with low expression cell surface markers. This is crucial since there are many markers that are few in number on the cell surface that cannot be detected using current dye labeling methods. Accordingly, the systems and methods of the subject invention for rapid cellular and molecular detection may be beneficial for applications in clinical diagnostics.

All patents, patent applications, provisional applications, and publications referred to or cited herein are incorporated by reference in their entirety, including all figures and tables, to the extent they are not inconsistent with the explicit teachings of this specification.

It should be understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application.

Claims

ClaimsWe claim:

1. A method for the analysis of a sample to simultaneously detect and isolate individual target cells and/or molecules, said method comprising: contacting said sample with first and second binding agents highly specific for the target cells and/or molecules, wherein the first binding agent is conjugated to a labeled compound and the second binding agent is conjugated to a magnetically responsive substance, to form magnetic, labeled-target complexes; subjecting the sample to a system that enables detection and/or quantification of the labeled compound; subjecting the sample to a magnetized matrix; and extracting any magnetic, labeled-target complexes from the sample.

2. The method of claim 1, wherein the system for detecting and/or quantifying the labeled compound is fluorescence imaging and/or flow cytometry.

3. The method of claim 1, wherein the labeled compound comprises a nanoparticle to which a fluorochrome is incorporated.

4. The method of claim 3, wherein the fluorochrome is selected from the group consisting of RuBpy, Cy3, Cy5, and Fluo-4.

5. The method of claim 1, wherein the first and second binding agents are selected from the group consisting of: antibodies, antigens, haptens, proteins, and aptamers.

6. The method of claim 1, wherein the first and second binding agents are DNA aptamers.

7. The method of claim 1 , wherein the magnetically responsive substance comprises a nanoparticle to which a magnetically responsive material is incorporated.

8. The method of claim 7, wherein the magnetically responsive material is selected from the group consisting of: paramagnetic materials, ferromagnetic materials, feπimagnetic materials, and metamagnetic materials.

9. The method of claim 8, wherein the magnetically responsive material is a paramagnetic material selected from the group consisting of: iron, nickel, cobalt, Fe₃O₄, BaFe₁₂Oi₉, CoO, NiO, Mn₂O₃, Cr₂O₃, and CoMnP.

10. The method of claim 1, wherein the first and second binding agents are separate yet identical binding agents.

11. The method of claim 1, wherein the labeled compound and magnetically responsive substance are both attached to a single binding agent.

12. The method of claim 1, wherein the first and second binding agents are separate and different binding agents.

13. The method of claim 1, further comprising the step of preparing the first and second binding agent and conjugating the labeled compound to the first binding agent and conjugating the magnetically responsive substance to the second binding agent.

14. The method of claim 1, further comprising the step of removing the magnetically responsive substance from the sample.

15. The method of claim 1, wherein the target cells and/or molecules are CCRF-CEM cells.