WO2007109733A2 - Diagnostic and prognostic markers and treatment strategies for multiple sclerosis - Google Patents

Abstract

Biological markers for multiple sclerosis, and their use in the diagnosis and clinical applications of the disease, are described.

Description

DIAGNOSTIC AND PROGNOSTIC MARKERS AND TREATMENT STRATEGIES FOR MULTIPLE SCLEROSIS

RELATED APPLICATIONS

The present application claims priority to U.S. Provisional Patent Application Ser. No. 60/784,425, filed on March 21, 2006, the entire content of which is specifically incorporated herein by reference.

GOVERNMENT SUPPORT

The present invention was made with U.S. government support under Grant Numbers R01NS039253, R01NS043990, and R01GM64402 from the National Institutes of Health. The U.S. Government has certain rights in these inventions.

BACKGROUND OF THE INVENTION

Multiple sclerosis (MS) is an autoimmune neurodegenerative disease, which is marked by inflammation within the central nervous system with lymphocyte attack against myelin produced by oligodendrocytes, plaque formation and demyelination with destruction of the myelin sheath of axons in the brain and spinal cord, leading to significant neurological disability over time. The disease frequently occurs in young adults between 20-40 years of age, is more prevalent in females than males (2:1), and has a characteristic geographical distribution—estimated prevalence in the USA is 120/100,000 individuals (250,000 to 350,000 cases).

The diagnosis of MS is still defined primarily by clinical terms and relies on a combination of history, neurological examination and ancillary laboratory and neuro- imaging studies. Typically, at onset an otherwise healthy person presents with the acute or sub acute onset of neurological symptomatology (attack) manifested by unilateral loss of vision, vertigo, ataxia, dyscoordination, gait difficulties, sensory impairment characterized by paresthesia, dysesthesia, sensory loss, urinary disturbances until incontinence, diplopia, dysarthria or various degrees of motor weakness until paralysis. The symptoms are usually painless, remain for several days to a few weeks, and then partially or completely resolve. After a period of remission, a second attack will occur. During this period after the first attack, the patient is defined to suffer from probable MS. Probable MS patients may remain undiagnosed for years. When the second attack occurs the diagnosis of clinically definite MS (CDMS) is made (Poser criteria 1983; C. M. Poser et al, Ann. Neural. 1983; 13, 227). These criteria have been revised in recent years to include radiological criteria for establishing the diagnosis (McDonald et al., Ann Neural 50:121-7; Polman et al., Ann Neural 2005; 58: 840-6) but even with these modifications, it may often take several years from the onset of clinical symptoms to establish the diagnosis.

Laboratory tests for MS include: 1) cerebrospinal fluid (CSF) evaluation of IgG synthesis, oligoclonal bands; 2) MRI of the brain and spinal cord and; 3) exclusion of other autoimmune diseases by blood tests [e.g.; serum B 12 level; HTLV 1 or HIV 1 titers; sedimentation rate or C-reactive protein; RA latex (Rheumatoid arthritis); ANA, anti-DNA antibodies (systemic lupus erythematosus)]. However, accurate diagnosis and prognosis in the "probable" stage, and early relapsing-remitting stages remains problematic. For example, it has been shown that positive MRI findings in the first demyelinating attack only provide a 50% successful prediction of development of clinically definite MS within 2-3 years (CHAMPS Study Group, Neurology 2002; 59:998-1005). Likewise, Villar et al (Neurology 2002; 59:877-83) found that detection of oligoclonal IgM bands with early symptoms were only partially predictive of development of clinically definite MS.

Such laboratory tests may provide some additional support for the diagnosis, but evidence of lesions disseminated in time and space remains a cardinal element of the diagnosis (Poser C M., 2001). In absence of definitive laboratory tests and pathognomonic clinical features, MS remains ultimately a diagnosis of exclusion.

While reliable serological tests are available for most autoimmune diseases, no such assay is available for the diagnosis of MS in part because no single antigen has been specifically associated with the disease. Thus, there exists a need for the identification of markers useful in the diagnosis and treatment of MS. The identification of MS-specific markers may further provide important insights into the pathogenesis of MS, including the precise mechanism of neuronal and myelin injury and the events leading to the onset of the disease.

SUMMARY OF THE INVENTION

A method for determining whether a subject has or is likely to develop multiple sclerosis (MS) or a condition relating thereto is provided herein. This method may comprise determining in a biological sample of a subject, the ratio of the level of a cystatin C protein fragment lacking about 8 amino acids at its C-terminus to the level of cystatin C protein, wherein a ratio of at least about 2 indicates that the subject has or is likely to develop MS or a condition relating thereto. The cystatin C protein lacking about 8 amino acids at its C-terminus may consist essentially of the amino acid sequence SEQ ID NO: 2. In some embodiments, the biological sample is cerebrospinal fluid (CSF), in which the ratio of the level of a cystatin C protein fragment lacking about 8 amino acids at its C-terminus to the level of cystatin C protein.

A method for determining whether a subject has or is likely to develop multiple sclerosis (MS) or a condition relating thereto comprises:

(a) obtaining CSF from a subject;

(b) determining the level of a cystatin C protein fragment lacking about 8 amino acids at its C-terminus;

(c) determining the level of a cystatin C protein that does not lack about 8 amino acids at its C-terminus; and

(d) establishing a ratio of the level determined in (b) to the level determined in (c). In another embodiment, the method comprises:

(a) contacting the biological sample or a portion thereof with an antibody that binds specifically to a cystatin C protein and to the cystatin C protein fragment to thereby obtain cystatin C and cystatin C protein fragment antibody complexes;

(b) isolating cystatin C and cystatin C protein fragment antibody complexes from the biological sample, to thereby obtain a composition enriched in cystatin C and cystatin C protein fragment;

(c) subjecting the composition enriched in cystatin C and cystatin C protein fragment to a size separation process, to thereby obtain a level of cystatin C protein and a level of cystatin C protein fragment; and

(d) determining the ratio of the level of cystatin C protein fragment to the level of cystatin C protein.

Also provided herein is a method for determining whether a subject has or is likely to develop MS or a condition relating thereto, comprising determining in a biological sample of a subject, the level of a cystatin C protein fragment lacking about 8 amino acids at its C-terminus, wherein a level of at least about 2-fold indicates that the subject has or is likely to develop MS or a condition relating thereto. In one embodiment, this method comprises: (a) contacting the biological sample or a portion thereof with an antibody that binds specifically to the cystatin C protein fragment to thereby obtain cystatin C protein fragment antibody complexes;

(b) isolating cystatin C protein fragment antibody complexes from the biological sample, to thereby obtain a composition enriched in cystatin C protein fragment;

(c) subjecting the composition enriched in cystatin C protein fragment to a size separation process, to thereby obtain a level of cystatin C protein fragment. Provided herein also is a method for determining whether a subject has or is likely to develop MS or a condition relating thereto, comprising determining in a biological sample of a subject the level of one or more biomarkers identified in Table 2 or Table 4, wherein a different level of one or more biomarkers relative to the level in a control, indicates that the subject has or is likely to develop MS or a condition relating thereto.

Provided herein also is an isolated protein comprising an amino acid sequence that is at least about 95% identical to SEQ ID NO: 2, wherein the protein does not comprise the last 8 amino acids of full-length cystatin C. Provided herein also is an amino acid sequence that is identical to SEQ ID NO: 2 and an amino acid sequence consisting essentially of SEQ ID NO: 2.

Further provided herein is an isolated nucleic acid encoding a protein comprising an amino acid sequence that is at least about 95% identical to SEQ ID NO: 2, wherein the protein does not comprise the last 8 amino acids of full-length cystatin C.

Further provided hererin is an isolated nucleic acid comprising a nucleotide sequence that is at least about 95% identical to SEQ ID NO: 1, wherein the nucleic acid does not encode a protein comprising the last 8 amino acids of full-length cystatin C. In one embodiment, the nucleic acid comprises a nucleotide sequence that is identical to SEQ ID NO: 1 or consists essentially of SEQ ID NO: 1.

Further provided herein is an isolated antibody that binds specifically to a cystatin C protein fragment lacking about 8 amino acids at its C-terminus and does not bind significantly to a full-length cystatin C protein. An isolated antibody that binds specifically to a cystatin C protein fragment consisting of the C-terminal 8 amino acids of cystatin C and does not bind significantly to a full length cystatin C protein is also provided.

Also provided are kits for use in an assay for determining whether a subject has or is likely to develop multiple sclerosis (MS) or a condition relating thereto. A kit may comprise an antibody that binds specifically to a cystatin C protein and a reagent for use in an assay provided herein. In one embodiment, a kit comprises an antibody that binds specifically to a cystatin C protein and one or more comparative values to which the results of an assay using the antibody can be compared.

Further provided herein are methods of treating or preventing MS or a condition relating thereto in a subject. A method may comprise administering to a subject in need thereof a therapeutically effective amount of an agent that decreases cathepsin activity. In one embodiment, the cathepsin is cathepsin B. The agent may inhibit the activity of cystatin C. In one embodiment, the agent inhibits the proteolytic cleavage of the last 8 amino acids of cystatin C.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 shows a representative CSF spectra generated by SELDI analysis. (A) Patient with multiple sclerosis showing a prominent peak at 12.5kD (arrow). The 13.4 kD peak is blunted. (B) The 12.5 kD peak is absent from the control patient. However the 13.4 kD peak is prominent (slanted arrow). Another small peak at 13.6 kD is also noted (vertical arrow) which is absent from the MS spectra.

Figure 2 shows a comparison of the ratio of the 12.5 kD to 13.4 kD peak in CSF from different disease states. The 12.5/13.4 peak ratio was significantly elevated in the MS group compared to OND (P<0.001), TM (P<0.001) HIV-ND (P<0.05) and HIV-D (P<0.05). Figure 3 shows an effect of anatomical location of last clinical attack on 12.5 kD peak height in CSF of MS/CIS patients. The peak was significantly higher in patients with recent infratentorial disease activity compared to those with a supratentorial involvement (P<0.05).

Figure 4 shows a partial purification of the 12.5 kD protein from CSF. (A) CSF incubated with protein A beads to remove IgG and then analyzed by SELDI time of flight mass spectroscopy shows the presence of the 12.5 kD protein. (B) CSF was further exposed to strong anion exchange beads and reanalyzed by SELDI time of flight mass spectroscopy which shows the removal of the 11.6 kD and 13.8 kD complexes and relative enrichment of the 12.5 kD protein.

Figure 5 shows immuno depletion of cystatin C from CSF. CSF was analyzed by SELDI time of flight mass spectroscopy following incubation with either (A) protein A beads alone, (B) protein A beads bound to rabbit anti-fusin antisera or (C) protein A beads bound to rabbit antisera to cystatin C. Both the 12.5 kD and the 13.4 kD proteins were selectively removed by the anti-cystatin antisera.

Figure 6 shows a correlation of cystatin C levels and cathepsin B activity in the CSF of

MS/CIS patients. (A) Higher cystatin C levels were associated with lower cathepsin B activity suggesting that cystatin C in the CSF of MS/CIS patients had not lost its cysteine protease inhibitory activity. (B) In some patients 12.5/13.4 peak ratios were associated with decreased cathepsin B activity.

Figure 7 shows N and C terminal cleavage of cystatin C. (A) Site of cleavage of cystatin C at the N terminal fragment between the arginine and lysine residues and at the C terminal region between the lysine and serine residues are marked by arrows.

(B) Tracings obtained from CSF analysis on Axima CFR MALDI-TOF mass spectrometer are shown. The control CSF shows the absence of any peaks at 12.5 kD, however, following repeated freeze thaws the same CSF sample has a peak at M/Z of 12,543 which corresponds to cystatin C following N terminal cleavage. In contrast CSF from the MS patient shows a peak at M/Z of 12,527 which corresponds to cystatin C following C terminal cleavage. Following prolonged storage, the CSF from the MS patient acquired a new peak corresponding to cystatin C following N terminal cleavage while the previous peak remains unchanged.

Figure 8 shows inhibition of cystatin C cleavage by pepstatin A. A CSF sample that had only the 13.4 kD peak was incubated with a protease inhibitor cocktail (PIC), a MMP inhibitor (FN439) or a cathepsin D inhibitor (pepstatin A) for 48 hours at room temperature.

Only, papstatin A significantly prevented cleavage of cystatin C.

Figure 9 shows modulation of cystatin C activity by cathepsin D and MMP-2.

Recombinant cystatin C (CysC) shows significant inhibition of cathepsin B activity

(P<0.01), which is further enhanced by treatment with cathepsin D (CathD). In contrast, treatment with MMP-2 shows an inhibition of CysC activity.

Figure 10 shows Table 1, which lists demographics of patients with MS/CIS.

Figure 11 shows Table 2, which lists peak intensities significantly altered in patients with

MS.

Figure 12 shows Table 3, which lists peptides recovered from tryptic digestion of the 12.5 kDa protein band. Amino acid residues, observed molecular weight, and sequence are shown.

Figure 13 shows cerebrospinal fluid spectra generated by surface-enhanced laser desorption/ionization analysis. (A) Patients with multiple sclerosis (MS) or clinically isolated syndromes (CIS) show either a prominent peak at 12.5kDa, 13.4kDa or blunted peaks at both molecular masses. (B) The 12.5kDa peak is absent from control patients with other neurological diseases (OND). However, the 13.4kDa peak is prominent. The scales in A and B are identical.

Figure 14 shows a decision tree for identifying patients with MS. For the purpose of this analysis, MS and CIS patients were analyzed as a single group. BPS analysis of 2 1 7 clusters shows that the 12.5kDa peak was the top splitter that correctly identified 19 of 29 MS/CIS patients. Of the remaining 29 samples, the 4.7 kDa peak correctly identified 16 OND patients. 3 of the OND patients but none of the MS/CIS patients were misclassified. Figure 15 shows the results of an analysis of CSF from patients with Multiple Sclerosis. A CM-IO chip was preequilibrated with 10OmM sodium acetate pH=4. A 1/10 dilution of CSF in 10OmM sodium acetate ph=4 and a final volume of 150 μL was put on each spot. Duplicate spots were used for each patient and incubated for 1 hour at room temperature. The chips were washed with binding buffer + 0.1% Triton XlOO and then rinsed with ultrapure water. The chip was air-dried and SPA applied as the EAM. The chips were "read" on a calibrated ProteinChip System (PBSl Ic; Ciphergen Biosystems, Inc.) at a laser intensity of 175 with the detector sensitivity at 6. Chips were also read at a higher laser intensity of 190 and mass deflector sensitivity at 8 to help detect higher mass proteins. A representative spectrum from a patient with multiple sclerosis shows a unique peak at 12.4 kD (upper panel), while it was absent in the patients with normal pressure hydrocephalus (lower panel).

Figure 16 and Figure 17 show Table 4, which lists peaks differentially expressed between controls and MS samples using Biomarker Wizard, including the two cystatin C peaks. Table 4A lists peaks A-I, which are elevated in MS. Table 4B lists peaks J-S, which are diminished in MS. Each of these peaks was identified using the same the weak cation CMlO chip as was used for the cystatin C peaks, hence these peaks have binding properties that are distinct in their identification. Figure 18 shows a spectrum that shows one of the peaks listed in Table 4.

DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS

The present inventors have discovered biological markers whose dysregulation is indicative of multiple sclerosis (MS). Methods and compositions for the diagnosis and treatment of MS or a condition relating thereto are thus provided. Related subject matter is discussed in U.S. Provisional Appl. Ser. No. 60/539,895, filed January 28, 2005, and U.S. Provisional Appl. Ser. No. 60/635,999, filed December 14, 2004, the contents of both of which are hereby incorporated by reference in their entireties.

The present invention is based at least in part on the identification of biological markers for MS. Samples of CSF from patients with CIS or MS were analyzed using the protein array technology surface-enhanced laser desorption/ionization (SELDI) time-of- flight mass spectroscopy, and the resulting mass spectra profiles were compared to those obtained from patients who did not have the disease. This resulted in the identification of several biomarkers of the disease.

Modulation of proteins in Multiple Sclerosis: Using a cation exchange chip that selectively binds proteins with a net negative charge, we identified 19 proteins that were dysregulated in the CSF of patients with multiple sclerosis. Of these, 9 were elevated and 11 were diminished in individuals with multiple sclerosis. Two of these peaks were positively identified as cystatin C as described below.

One of the biomarkers is a novel protein of 12.5 kD that was 100% specific for MS/CIS, as compared to non-MS patients. Tandem mass spectroscopy of a tryptic digest of this 12.5 kD protein identified it as a cleavage product of full-length cystatin C (13.4 kD), an important inhibitor of cysteine proteases including the cathepsins. While total cystatin C levels in the MS patients was not different compared to controls, the patients with the highest 12.5/13.4 peak ratios also had the greatest cathepsin B inhibitory activity. This suggests that cleavage of cystatin C may be an adaptive host response that identifies a subgroup of patients with MS.

The identification of these markers significantly advances the field of MS diagnosis and treatment as well as provides tools which will enable elucidation of the mechanisms underlying MS formation and progression, ultimately leading to formulation of efficient, stage specific, treatment regimens.

Methods for determining whether a subject has or is likely to develop MS, early stages of MS, or a condition related thereto

Provided herein are methods for determining whether a subject has or is likely to develop MS or a condition relating thereto. What is presently referred to as MS is intended to refer to all types and stages of MS. Types of MS include but are not limited to the following: benign MS, relapsing remitting MS, secondary chronic progressive MS, and primary progressive MS, Progressive Relapsing Multiple Sclerosis, Chronic Progressive MS, Transitional/Progressive MS, malignant MS, also known as Marburg's Variant, and acute multiple sclerosis. Early stages of MS include an acute or sub acute onset of neurological symptomatology (attack); first attack, probable stage, second attack, early relapsing-remitting stages, and clinically isolated syndromes (CIS). "Conditions relating to MS" include, e.g., Devic's Disease, also known as Neuromyelitis Optica; and Balo's concentric sclerosis. The methods described herein may also predict the presence or likelihood of development of the early stages of MS and conditions relating to MS. For example, the methods described herein may determine: the likelihood of a symptomless subject to develop MS or an early stage thereof or a condition relating thereto; the likelihood of a subject having symptoms, e.g., symptoms which resemble those present in early stage MS, to have or to develop MS or an early stage thereof or a condition relating thereto; the likelihood of a subject having early stage MS symptoms to develop MS; or the likelihood of a subject having early stage MS symptoms to develop a particular type of MS. The methods described herein may also be used to determine the prognosis of a subject having MS, an early stage thereof or a condition relating thereto. For example, the methods may allow the prognosis of a subject that is being treated, e.g., with interferon-beta. The methods may also be used for determining the severity of the disease.

The method may be used to determine whether a subject is more likely than not to have MS, an early stage thereof, or a condition relating thereto, or is more likely to have MS, an early stage thereof, or a condition relating thereto than to have another disease, based on the difference between the measured and standard level or reference range of the biomarker. Thus, for example, a patient with a putative diagnosis of MS or a condition relating thereto may be diagnosed as being "more likely" or "less likely" to have MS in light of the information provided by a method of the present invention. If a plurality of biomarkers are measured, at least one and up to all of the measured biomarkers must differ, in the appropriate direction, for the subject to be diagnosed as having (or being more likely to have) MS or a condition relating thereto. Preferably, such difference is statistically significant.

As will be apparent to those of ordinary skill in the art, the above description is not limited to making an initial diagnosis of MS or a condition relating thereto, but also is applicable to confirming a provisional diagnosis of MS or a condition relating thereto, or for "ruling out" such a diagnosis. Biomarker measurements are taken of a biological sample from a patient, e.g., suspected of having the disease, and compared with a standard level or reference range. Typically, the standard biomarker level or reference range is obtained by measuring the same marker or markers in a set of controls, such as from subject(s) that do not have MS or a condition relating thereto. The standard level can be obtained from one or more subjects, e.g., 1-5; 5-10; 10-50; or more subjects. Measurement of the standard biomarker level or reference range need not be made contemporaneously; it may be a historical measurement or a data set to which to compare the marker measurements. Preferably the normal control is matched to the patient with respect to some attribute(s) (e.g., age or sex). Depending upon the significant difference between the measured and standard level or reference range, the patient can be diagnosed, e.g., as having MS or a condition related thereto; as being likely to develop MS or a condition related thereto; or as not having MS or a condition related thereto.

A significant difference may be a statistically significant difference. A statistically significant difference between the measured and standard (control) level may be determined by first adding or substracting at least one, at least two, at least three, or at least four standard deviations to a standard or reference level to obtain a reference range. A measured level may then be compared to this reference range. For markers (e.g., Table 4A) whose levels are elevated in MS or a condition related thereto, the measured level is greater than the control level plus at least one, at least two, at least 3, or at least 4 standard deviations above the reference level. For markers (e.g., Table 4B) whose levels are diminished in MS or a condition related thereto, the measured level is less than the control level minus at least one, at least two, at least 3, or at least 4 standard deviations below the reference level.

In another embodiment, a significant difference may mean a difference of at least 2- fold, 3-, A-, 5-, 10- or more fold, with respect to the reference value

In one embodiment, a method for determining whether a subject has or is likely to develop MS, a precursory condition thereof or a condition relating to MS, comprises determining in a biological sample of the subject the level or amount of a marker set forth in Table 4A. If the level is more than the control mean intensity plus the standard deviation for that marker in the Table, then the result is considered positive, i.e., the subject has or is likely to develop MS, a precursory condition thereof or a condition relating to MS. A level that is at least about the control mean intensity plus 2, 3, 4 or 5 standard deviations for that marker in the Table is also considered a positive result. If the measurement of the level of the marker in a subject is done using a different method than that used for obtaining the data in the Table, a different set of control values and optionally standard deviations can be obtained according to methods known in the art. Thus, even using a different method, a result may be considered positive if the value measured is higher than the mean control value plus 1, 2, 3, 4 or 5 standard deviations calculated for that mean contol value.

Similarly, regarding markers which are decreased in MS relative to controls, such as those set forth in Table 4B, a result is considered positive if the value measured is lower than the mean control value minus 1, 2, 3, 4 or 5 standard deviations calculated for that mean contol value.

Accordingly, a method, e.g., a diagnostic method, may comprise first obtaining a mean control value and a standard deviation, to which a value measured in a subject can be compared. Mean control values and standard deviations can be determined according to methods known in the art and may be based on, e.g., 2, 3, 5, 10, 20, 50 or more individuals who are not known to have MS, a precursory condition thereof or a condition relating thereto.

Values for kDa and M/Z of the peaks provided herein are accurate within about 30 Da or 30 Da/Z. Thus, markers falling within about 20 to 50 or about 30 to 40 or about 25 to 35 Da or Da/Z of the values provided hererin fall within the scope of the invention.

A method may comprise one or more of the following: obtaining a biological sample from the subject; determining the level of a marker in the sample, wherein the marker is selected from the group consisting of the markers set forth in Table 2 and Table 4; comparing the level of the marker in the sample to a reference value; and determining whether the level of the marker is increased (Table 4A) or decreased (Table 4B) by at least about 1, 2, 3, or 4 standard deviations, or by at least about 50%, 2-fold, 3-, A-, 5-, 10- or more fold, with respect to the reference value. The reference value may be the level of the marker in at least one sample from a non-multiple sclerosis subject.

The level of the marker may be determined by detecting the presence of the polypeptide in the sample. Also in all embodiments, the presence of the marker may also be determined by assessing the gene expression or activity of the marker present in the sample, as compared to a reference value.

It is also likely that a combination of biomarkers may be more predictive of the disease activity or aid in diagnosis compared to a single biomarker.

The methods of the present invention may be used to make the diagnosis of MS or a condition relating thereto, independently from other information such as the patient's symptoms or the results of other clinical or paraclinical tests. However, the methods of the present invention are preferably used in conjunction with such other data points.

Biomarkers described herein may be measured in combination with other signs, symptoms and clinical tests of MS, such as MRI scans or MS biomarkers reported in the literature. Likewise, more than one of the biomarkers of the present invention may be measured in combination. Measurement of the biomarkers of the invention along with any other markers known in the art, including those not specifically listed herein, falls within the scope of the present invention.

The description of the methods herein makes reference to measuring "a marker." The methods of the invention may involve measuring two markers, three markers, or four or more markers, or ratios of the same. The two markers, three markers, or four or more markers may comprise any combination of markers seleceted from Table 2 or Table 4.

Thus, a method, e.g., for diagnosing multiple sclerosis in a subject may comprise obtaining one or more biological samples from the subject; determining the level of a plurality of markers in the one or more biological samples, wherein at least one of the plurality of markers is selected from the group consisting of the markers listed in Table 2 and Table 4; and comparing the level of at least one of the plurality of markers to a reference value.

The biological sample to be tested for biomarkers may be of any tissue or fluid. Preferably, the sample is a CSF or serum sample, but other biological fluids or tissue may be used. Possible biological fluids to be tested for biomarkers include, but are not limited to, plasma, saliva, urine, and neural tissue. CSF represents a preferred biological sample to analyze for MS markers as it bathes the brain and removes metabolites and molecular debris from its liquid environment. Thus, biomolecules associated with the presence and/or progression of MS are expected to be present at highest concentrations in this body fluid. Furthermore, molecules initially identified in CSF may also be present, presumably at lower concentrations, in more easily obtainable fluids such as serum, urine, and saliva. Such biomarkers may be valuable for monitoring all stages of the disease and response to therapy. Serum also represents a preferred biological sample as it is expected to be reflective of the systemic manifestations of the disease. In some embodiments, the level of a marker may be compared to the level of another marker or some other component in a different tissue, fluid or biological "compartment." Thus, a differential comparison may be made of a marker in CSF and serum. It is also within the scope of the invention to compare the level of a marker with the level of another marker or some other component within the same compartment.

As indicated in Table 2 and Table 4, some of the marker measurement values are higher in samples from MS patients, while others are lower. A significant difference in the appropriate direction in the measured value of one or more of the markers indicates that the patient has (or is more likely to have) MS or a condition relating thereto. If only one biomarker is measured, then that value must increase or decrease to indicate MS or a condition relating thereto. In some preferred embodiments, multiple markers are measured, and a diagnosis of MS, or early stage thereof, or a condition relating thereto is indicated by changes in multiple markers. Measurements can be of (i) a biomarker of the present invention, (ii) a biomarker of the present invention and another factor known to be associated with MS or a condition relating thereto (e.g., MRI scan); (iii) a plurality of biomarkers comprising at least one biomarker of the present invention and at least one biomarker reported in the literature, or (iv) any combination of the foregoing. Furthermore, the amount of change in a biomarker level may be an indication of the relatively likelihood of the presence of the disease.

It is to be understood that any correlations between biological sample measurements of these biomarkers and MS or a condition relating thereto, as used for diagnosis of the disease or evaluating drug effect, are within the scope of the present invention. C-terminal Cystatin C cleavage product as a predictor of MS or a condition relating thereto

A method of diagnosing or pro gno sing or determining whether a subject has or is likely to develop multiple sclerosis may comprise obtaining a sample from an individual and determining the level, amount, or activity of a C-terminal cystatin C polypeptide cleavage product, and e.g., compare it to the amount of full-length cystatin C polypeptide in the sample. In accordance with such methods, the C-terminal cystatin C polypeptide cleavage product may function as an internal standard for diagnosing MS, an early stage thereof, or a condition relating thereto. An increase in the C-terminal cystatin C polypeptide cleavage product relative to the amount of full-length cystatin C polypeptide in the sample is predictive of individuals that are afflicted with or at risk of developing MS or an early stage thereof or a condition relating thereto.

In one example, those skilled in the art may measure a ratio of the level, amount or activity of the C-terminal cystatin C polypeptide cleavage product relative to the amount of full-length cystatin C polypeptide in the sample. This may be useful to diagnose individuals that are afflicted with or at risk of developing MS, an early stage thereof, or a condition relating thereto when the results indicate an increased ratio of a C-terminal cystatin C polypeptide cleavage product relative to the amount of full-length cystatin C polypeptide in the sample, relative to a ratio calculated from a reference sample.

Wherein the comparison of said ratios reflects a significant increase in the level, amount, or activity of the C-terminal cystatin C polypeptide cleavage product or products thereof relative to the cystatin C polypeptide, said individual is identified as being afflicted with or at risk of developing multiple sclerosis, an early stage thereof or a condition related thereto.

Wherein the comparison of said ratios reflects an increase in the level, amount, or activity of the C-terminal cystatin C polypeptide cleavage product thereof relative to the cystatin C polypeptide by at least about 1.5, 1.8, 2.0, or 2.5, -fold, said individual is identified as being afflicted with or at risk of developing multiple sclerosis, an early stage thereof or a condition related thereto.

Wherein the comparison of said ratios reflects an identical or decrease in the level, amount, or activity of the C-terminal cystatin C polypeptide cleavage product or products thereof relative to the cystatin C polypeptide, said individual is identified as not being afflicted with or at risk of developing multiple sclerosis, an early stage thereof or a condition related thereto.

Accordingly, a method may comprise:

(a) obtaining a sample from an individual and determining the level, amount, or activity of:

(i) a cystatin C polypeptide; and

(ii) a C-terminal cystatin C polypeptide cleavage product or products thereof; and

(b) calculating a ratio of the level, amount, or activity of the C-terminal cystatin C polypeptide cleavage product or products relative to the cystatin C polypeptide; and comparing the ratio to that in an individual not afflicted with or at risk of developing multiple sclerosis; wherein comparison of the ratios provides a diagnostic or prognostic indicator of multiple sclerosis, an early stage thereof, or a condition related thereto in said individual.

In an example, a method comprises one or more of the following steps, not necessarily in the order provided: (a) contacting the biological sample or a portion thereof with an antibody that binds specifically to a cystatin C protein and to the cystatin C protein fragment to thereby obtain cystatin C and cystatin C protein fragment antibody complexes; (b) isolating cystatin C and cystatin C protein fragment antibody complexes from the biological sample, to thereby obtain a composition enriched in cystatin C and cystatin C protein fragment; (c) subjecting the composition enriched in cystatin C and cystatin C protein fragment to a size separation process, to thereby obtain a level of cystatin C protein and a level of cystatin C protein fragment; and (d) determining the ratio of the level of cystatin C protein fragment to the level of cystatin C protein.

One skilled in the art may measure a ratio of the level, amount or activity of a cystatin C protein fragment lacking about 8 amino acids at its C-terminus (SEQ ID NO: 2) relative to a cystatin C protein that does not lack about 8 amino acids at its C-terminus (e.g., a full-length cystatin C polypeptide). When the results indicate an increase of the cystatin C polypeptide lacking about 8 amino acids relative to a cystatin C polypeptide that does not lack about 8 amino acids at its C-terminus, a diagnosis of a subject that is afflicted with or at risk of developing MS, an early stage thereof, or a condition relating thereto is made.

A method may comprise: (a) contacting a biological sample or a portion thereof with an antibody that binds specifically to a cystatin C protein and to the cystatin C protein fragment to thereby obtain cystatin C and cystatin C protein fragment antibody complexes; (b) isolating cystatin C and cystatin C protein fragment antibody complexes from the biological sample, to thereby obtain a composition enriched in cystatin C and cystatin C protein fragment; (c) subjecting the composition enriched in cystatin C and cystatin C protein fragment to a size separation process, to thereby obtain a level of cystatin C protein and a level of cystatin C protein fragment; and (d) determining the ratio of the level of cystatin C protein fragment to the level of cystatin C protein.

A size separation process can be chromatography, e.g, gel chromatography, and others further described herein. A method of diagnosis of having of likelihood of developing a disease or condition as described herein may also comprise a combination of methods, e.g., determining the level of one or more biomarkers, e.g., described herein, and the ratio between the cystatin C cleavage product and cystatin C. Measurement and Detection of Biomarkers

In the methods of the invention, biomarker levels are measured using conventional techniques. A wide variety of techniques are available, including mass spectroscopy, immunoprecipitation, chromatographic separations, 2-D gel separations, binding assays (e.g., immunoassays), competitive inhibition assays, and so on. It is within the ability of one of ordinary skill in the art to determine which method would be most appropriate for measuring a specific marker. Thus, for example, a robust ELISA assay may be best suited for use in a physician's office while a measurement requiring more sophisticated instrumentation may be best suited for use in a clinical laboratory. Regardless of the method selected, it is important that the measurements be reproducible.

The markers of the invention can be measured by mass spectroscopy, which allows direct measurements of analytes with high sensitivity and reproducibility. A number of mass spectrometric methods are available and could be used to accomplish the measurement. Electrospray ionization (ESI), for example, allows quantification of differences in relative concentration of various species in one sample against another; absolute quantification is possible by normalization techniques (e.g., using an internal standard). Matrix-assisted laser desorption ionization (MALDI) or the related SELDI technology (Ciphergen, Inc.) also could be used to make a determination of whether a marker is present, and the relative or absolute level of the marker. Moreover, mass spectrometers that allow time-of- flight (TOF) measurements have high accuracy and resolution and are able to measure low abundant species, even in complex matrices like serum or CSF.

In preferred embodiments, the level of the markers may be determined using a standard immunoassay, such as sandwiched ELISA using matched antibody pairs and chemiluminescent detection. Commercially available or custom monoclonal or polyclonal antibodies are typically used. However, the assay can be adapted for use with other reagents that specifically bind to the marker. Standard protocols and data analysis are used to determine the marker concentrations from the assay data.

For protein markers, quantification can be based on derivatization in combination with isotopic labeling, referred to as isotope coded affinity tags ("ICAT"). In this and other related methods, a specific amino acid in two samples is differentially and isotopically labeled and subsequently separated from peptide background by solid phase capture, wash and release. The intensities of the molecules from the two sources with different isotopic labels can then be accurately quantified with respect to one another.

In addition, one- and two-dimensional gels have been used to separate proteins and quantify gels spots by silver staining, fluorescence or radioactive labeling. These differently stained spots have been detected using mass spectroscopy, and identified by tandem mass spectroscopy techniques. In other embodiments, the markers are measured using mass spectroscopy in connection with a separation technology, such as liquid chromatography-mass spectroscopy or gas chromatography-mass spectroscopy. Reverse-phase liquid chromatography may be coupled to high resolution, high mass accuracy ESI time-of- flight (TOF) mass spectroscopy. This allows spectral intensity measurement of a large number of biomolecules from a relatively small amount of any complex biological material without sacrificing sensitivity or throughput. Analyzing a sample will allow the marker (specified by a specific retention time and m/z) to be determined and quantified.

As will be appreciated by one of skill in the art, many other separation technologies may be used in connection with mass spectroscopy. For example, a vast array of separation columns are commercially available. In addition, separations may be performed using custom chromatographic surfaces (e.g., a bead on which a marker specific reagent has been immobilized). Molecules retained on the media subsequently may be eluted for analysis by mass spectroscopy.

As an example, an antibody may be used to isolate a protein marker provided herein in a biological sample (e.g., by immunoprecipitation). A sample is contacted with an antibody affixed to a solid support (such as a bead or solid surface) to a biomarker of the invention, and the marker becomes tethered to the support by virtue of being bound to the antibody affixed to the solid support. The solid support containing the antibody-biomarker complex is washed under conditions which allow the antibody to remain bound to the biomarker. Non-specific components of the sample are thus separated and removed from the presence of the biomarker, with the biomarker remaining tethered to the support. The resulting composition thus becomes enriched with biomarker as a result of the concentration of the marker in the sample and the removal of non-marker components of the sample. The level of the marker may then be determined by any of a number of methods. The antibody-marker complex may be detected, or the marker may be eluted from the antibody and detected. As an example, the antibody-marker complex or eluted marker may be subjected to any number of methods for determining size, such as spectroscopy, chromatographic separations, or 2-D gel separations.

Analysis by liquid chromatography-mass spectroscopy produces a mass intensity spectrum, the peaks of which represent various components of the sample, each component having a characteristic mass-to-charge ratio (m/z) and retention time (r.t.). The presence of a peak with the m/z and retention time of a biomarker indicates that the marker is present. The peak representing a marker may be compared to a corresponding peak from another spectrum (e.g., from a control sample) to obtain a relative measurement. Any normalization technique in the art (e.g., an internal standard) may be used when a quantitative measurement is desired. In addition, deconvoluting software is available to separate overlapping peaks. The retention time depends to some degree on the conditions employed in performing the liquid chromatography separation.

The better the mass assignment, the more accurate will be the detection and measurement of the marker level in the sample. Thus, the mass spectrometer selected for this purpose preferably provides high mass accuracy and high mass resolution. The mass accuracy of a well-calibrated Micromass TOF instrument, for example, is reported to be approximately 2 mDa, with resolution m/Am exceeding 5000.

A number of the assays discussed above employ a reagent that specifically binds to the marker ("marker specific reagent"). Any molecule that is capable of specifically binding to a marker is included within the invention. In some embodiments, the marker specific reagents are antibodies or antibody fragments. In other embodiments, the marker specific reagents are non-antibody species. Thus, for example, a marker specific reagent may be an enzyme for which the marker is a substrate. The marker specific reagents may recognize any epitope of the targeted markers.

A marker specific reagent may be identified and produced by any method accepted in the art. Methods for identifying and producing antibodies and antibody fragments specific for an analyte are well known. Examples of other methods used to identify marker specific reagents include binding assays with random peptide libraries (e.g., phage display) and design methods based on an analysis of the structure of the marker.

The chromatographic separation techniques described above also may be coupled to an analytical technique other than mass spectroscopy such as fluorescence detection of tagged molecules, NMR, capillary UV, evaporative light scattering or electrochemical detection. Methods for monitoring the progression of MS or a condition relating thereto

In an alternative embodiment of the invention, a method is provided for monitoring an MS patient over time to determine whether the disease is progressing. The specific techniques used in implementing this embodiment are similar to those used in the embodiments described above. The method is performed by obtaining a biological sample, such as serum or CSF, from the subject at a certain time (ti); measuring the level of at least one of the biomarkers in the biological sample; and comparing the measured level with the level measured with respect to a biological sample obtained from the subject at an earlier time (to). Depending upon the difference between the measured levels, it can be seen whether the marker level has increased, decreased, or remained constant over the interval (ti-to). A further deviation of a marker in the direction indicating MS or a condition relating thereto, or the measurement of additional increased or decreased MS markers, would suggest a progression of the disease during the interval. Subsequent sample acquisitions and measurements can be performed as many times as desired over a range of times t₂ to t_n.

In addition to indicating a progression of the disease, tracking a marker level in a patient can be used to predict exacerbations or indicate the clinical course of the disease. For example, as will be apparent to one of skill in the art, the biomarkers of the present invention could be further investigated to distinguish between any or all of the known forms of MS (CIS, benign MS, relapsing remitting MS, secondary chronic progressive MS, and primary progressive MS) or any described types or subtypes of the disease. In addition, the sensitivity and specificity of any method of the present invention could be further investigated with respect to distinguishing MS or a condition relating thereto from other diseases of autoimmunity, or other nervous system disorders, or to predict relapse and remission. Methods for monitoring therapies for MS or a condition relating thereto

Analogously, the markers of the present invention can be used to assess the efficacy of a therapeutic intervention in a subject. The same approach described above would be used, except a suitable treatment would be started, or an ongoing treatment would be changed, before the second measurement (i.e., after to and before ti). The treatment can be any therapeutic intervention, such as drug administration, dietary restriction or surgery, and can follow any suitable schedule over any time period. The measurements before and after could then be compared to determine whether or not the treatment was effective. As will be appreciated by one of skill in the art, the determination may be confounded by other superimposed processes (e.g., an exacerbation of the disease during the same period).

A marker may also be used to screen a candidate drug in a clinical trial to determine whether a candidate drug is effective in treating MS or a condition relating thereto. At time to, a biological sample is obtained from each subject in population of subjects diagnosed with MS or a condition relating thereto. Next, assays are performed on each subject's sample to measure levels of a biological marker. In some embodiments, only a single marker is monitored, while in other embodiments, a combination of markers is monitored. Next, a predetermined dose of a candidate drug is administered to a portion or sub- population of the same subject population. Drug administration can follow any suitable schedule over any time period. In some cases, varying doses are administered to different subjects within the sub-population, or the drug is administered by different routes. At time ti, after drug administration, a biological sample is acquired from the sub-population and the same assays are performed on the biological samples as were previously performed to obtain measurement values. As before, subsequent sample acquisitions and measurements can be performed as many times as desired over a range of times t₂ to t_n. In such a study, a different sub-population of the subject population may serve as a control group, to which a placebo is administered. The same procedure may be followed for the control group: obtaining the biological sample, processing the sample, and measuring the biological markers to obtain a measurement chart.

Specific doses and delivery routes can also be examined. The method is performed by administering the candidate drug at specified dose or delivery routes to subjects with MS or a condition relating thereto; obtaining biological samples, such as serum or CSF, from the subjects; measuring the level of at least one of the biomarkers in each of the biological samples; and, comparing the measured level for each sample with other samples and/or a standard level. Typically, the standard level is obtained by measuring the same marker or markers in the subject before drug administration. Depending upon the difference between the measured and standard levels, the drug can be considered to have an effect on MS or a condition relating thereto. If multiple biomarkers are measured, at least one and up to all of the biomarkers must change, in the expected direction, for the drug to be considered effective. Preferably, multiple markers must change for the drug to be considered effective, and preferably, such change is statistically significant.

As will be apparent to those of ordinary skill in the art, the above description is not limited to a candidate drug, but is applicable to determining whether any therapeutic intervention is effective in treating MS or a condition relating thereto.

As indicated in Tables 2 and 4, some of the marker measurement values are higher in samples from MS patients, while others are lower. The p-values shown were obtained by univariate analysis. A significant change in the appropriate direction in the measured value of one or more of the markers indicates that the drug is effective. If only one biomarker is measured, then that value must increase or decrease to indicate drug efficacy. If more than one biomarker is measured, then drug efficacy can be indicated by change in only one biomarker, all biomarkers, or any number in between. In some embodiments, multiple markers are measured, and drug efficacy is indicated by changes in multiple markers. Measurements can be of both biomarkers of the present invention and other measurements and factors associated with MS or a condition relating thereto (e.g., measurement of biomarkers reported in the literature and/or MRI imaging). Furthermore, the amount of change in a biomarker level may be an indication of the relatively efficacy of the drug. Polypeptides

One of the polypeptides that is significantly dysregulated in patients with MS or CIS is a cleavage product of cystatin C. Thus provided herein is a composition comprising a C- terminal cleavage product of cystatin C. In one aspect, the C-terminal cleavage product comprises a deletion of amino acids from the C-terminus. Preferably, the cystatin C cleavage product is a cystatin C polypeptide that lacks exactly 8, about 8, or at least 8 amino acids at its C-terminus. Human cystatin C is a 146 amino acid polypeptide with Accession number NP 000090 on the NCBI website. The full-length human cystatin C polypeptide sequence is shown below:

1 MAGPLRAPLL LLAILAVALA VSPAAGSSPG KPPRLVGGPM DASVEEEGVR RALDFAVGEY

61 NKASNDMYHS RALQVVRARK QIVAGVNYFL DVELGRTTCT KTQPNLDNCP FHDQPHLKRK

121 AFCSFQiYAV PWQGTMTLSK STCQDA (SEQ ID NO: 4)

SEQ ID NO: 2, which consists of SEQ ID NO: 4 lacking exactly 8 contiguous amino acid residues from the C-terminus is shown below:

1 MAGPLRAPLL LLAILAVALA VSPAAGSSPG KPPRLVGGPM DASVEEEGVR RALDFAVGEY 61 NKASNDMYHS RALQVVRARK QIVAGVNYFL DVELGRTTCT KTQPNLDNCP FHDQPHLKRK

121 AFCSFQiYAV PWQGTMTL (SEQ ID NO: 2)

Provided herein are polypeptides comprising, consisting of, or consisting essentially of an amino acid sequence that is at least about 70%, 80%, 90%, 95%, 98% or 99% identical to SEQ ID NO: 2. The polypeptides preferably do not comprise the last 8 amino acids that are normally present in full-length cystatin C, i.e., the polypeptide does not comprise all or a portion of the amino acid sequence SKSTCQDA at its C-terminus. Certain polypeptides comprise an amino acid sequence that differs from SEQ ID NO: 2 in one or more, e.g., 1, 2, 3, 4, 5 or 10, amino acid substitutions, additions or deletions. The amino acid changes may be conservative amino acid changes. Polypeptides comprising at least 4, 10, 20, 30, 50, 100 or 130 contiguous amino acids of SEQ ID NO: 2 are also encompassed. Polypeptides may have a molecular weight of approximately between 7 kDa and 12.5 kDa.

The polypeptides are preferably biologically active, i.e., they retain at least one biological activity of wild-type cystatin C, e.g., inhibition of cathepsin B. For example, the polypeptides described in the previous paragraph may exhibit a biological function of a protein comprising an amino acid sequence consisting of SEQ ID NO: 2. Certain polypeptides have a stronger biological activity than wild-type cystatin C, e.g., at least about 50%, 2 fold, 3 fold, 5 fold or more stronger. Other polypeptides may have an activity that is similar or identical to that of wild-type cystatin C. Biological activity of cystatin C may be determined as described in the examples.

Other polypeptides provided herein are cystatin C fragments lacking the N-terminal 8 amino acids, and cystatin C fragments lacking both the N-terminal 8 amino acids and the C-terminal 8 amino acids, e.g.,

LLAILA V ALA VSPAAGSSPG KPPRLVGGPM DASVEEEGVR RALDFAVGEY NKASNDMYHS RALQVVRARK QIVAGVNYFL DVELGRTTCT KTQPNLDNCP FHDQPHLKRK AFCSFQIYAV

PWQGTMTLSK STCQDA (SEQ ID NO: 5)

LLAILAVALA VSPAAGSSPG KPPRLVGGPM DASVEEEGVR RALDFAVGEY NKASNDMYHS RALQVVRARK QIVAGVNYFL DVELGRTTCT KTQPNLDNCP FHDQPHLKRK AFCSFQIYAV

PWQGTMTL (SEQ ID NO: 7)

Proteins lacking the 8 N-terminal amino acids generally have a lower biological activity relative to the wild-type cystatin C. Homo logs of such protein, e.g., comprising, consisting of, or consisting essentially of an amino acid sequence that is at least about 70%, 80%, 90%, 95%, 98% or 99% identical to SEQ ID NO: 5 or 7 are also encompassed.

A cystatin C polypeptide cleavage product (or fragment) may be linked, directly or indirectly to one or more amino acids or to one or more heterologous peptides, e.g., to form a fusion protein. Heterologous peptides may be peptides that can be used for detecting; purifying; stabilizing; or solubilizing the endostatin peptide. For example, a heterologous peptide may be a TAG peptide or a His6 tag. A peptide or protein may by linked to an immunoglobulin (Ig) constant heavy or light chain domain or portion thereof. For example, a peptide may be linked to a CHl, CH2 and/or CH3 domain of a heavy chain. If the constant region is from a light chain, it may be from a kappa or lambda light chain. If the constant region is from a heavy chain, it may be from an antibody of any one of the following classes of antibodies: IgG, IgA, IgE, IgD, and IgM. IgG may be IgGl, IgG2, IgG3 or IgG4. The constant domain may be an Fc fragment. The constant domain may be from a mammalian antibody, e.g., a human antibody. Soluble receptor-IgG fusion proteins are common immunological reagents and methods for their construction are known in the art (see e.g., U.S. Pat. Nos. 5,225,538, 5,726,044; 5,707,632; 750,375, 5,925,351, 6,406,697 and Bergers et al. Science 1999 284: 808-12). Preferred as immunoglobulin is the constant part of the heavy chain of human IgG, particularly IgGl, where dimerization between two heavy chains takes place at the hinge region. It is recognized that inclusion of the CH2 and CH3 domains of the Fc region as part of the fusion polypeptide increases the in vivo circulation half-life of the polypeptide comprising the Fc region, and that of the oligomer or dimer comprising the polypeptide.

Constant Ig domains may also contain one or more mutations that reduce or eliminate one or more effector function, e.g., binding to Fc receptors and complement activation (see, e.g., S. Morrison, Annu. Rev. Immunol, 10, pp. 239-65 (1992); Duncan and Winter (1988) Nature 332: 738-740; and Xu et al. (1994) J Biol. Chem. 269: 3469- 3474). For example, mutations of amino acids corresponding to Leu 235 and Pro 331 of human IgGI to GIu and Ser respectively, are provided. Such constructs are further described in U.S. Pat. No. 6,656,728.

The constant Ig domain may be linked to the N-terminus or C-terminus of a peptide.

A peptide and heterologous peptides or moeity may also be linked through a linker sequence, which may be degradable, e.g., hydrolyzable. For example a linker may comprise a thrombin cleavage site. An exemplary nucleotide sequence encoding such a site has the following nucleotide sequence: 5' TCT AGA GGT GGT CTA GTG CCG CGC GGC AGC GGT TCC CCC GGG TTG CAG 3', which encodes a peptide having the amino acid sequence: Ser Arg GIy GIy Leu VaI Pro Arg GIy Ser GIy Ser Pro GIy Leu GIn. A peptide may also be fused to a signal sequence. For example, when prepared recombinantly, a nucleic acid encoding the peptide may be linked at its 5' end to a signal sequence, such that the peptide is secreted from the cell.

A peptide or protein may also be linked to a moiety, such as a polymer. The polymer need not have any particular molecular weight, but it is preferred that the molecular weight be between about 300 and 100,000, more preferably between 10,000 and 40,000. In particular, sizes of 20,000 or more are best at preventing protein loss due to filtration in the kidneys. Exemplary polymers include water-soluble degradable or non- degradable polymer. The polymer may be a copolymer comprising an acrylic polymer, alkene polymer, urethane polymer, amide polymer, polyimine, polysaccharide, or ester polymer. Alternatively, the polymer is polyglutamate, a polysaccharide such as dextran or dextrin-2-sulphate, polyvinylpyrolidone, a copolymer of divinylether and maleic anhydride (DIVEMA), or a copolymer of polethylene glycol and aspartic acid. In certain instances, the polymer is a linear or branched polyethylene glycol.

A polymer may be a homopolymer of polyethylene glycol (PEG) or is a polyoxyethylated polyol, wherein, preferably, the polymer is soluble in water at room temperature. Non-limiting examples of such polymers include polyalkylene oxide homopolymers such as PEG or polypropylene glycols, polyoxyethylenated glycols, copolymers thereof and block copolymers thereof, provided that the water solubility of the block copolymer is maintained. Examples of polyoxyethylated polyols include, for example, polyoxyethylated glycerol, polyoxyethylated sorbitol, polyoxyethylated glucose, or the like.

A peptide may be bonded directly to a polymer or bonded to a polymer via a linking group. The polymer may be bonded to an amino acid at the N-terminus or the C-terminus of the peptide. In certain instances, the polymer is bonded to the nitrogen atom of the N- terminus amino acid of the peptide. Alternatively, the polymer may be bonded to the sulfur atom of a cysteine residue or to a lysine or arginine residue. Other sites are also possible.

A protein, peptide or analog thereof may be labeled, such as with a marker that may be directly or indirectly detectable. An indirect marker is a marker that cannot be detected by itself but needs a further directly detectable marker specific for the indirect marker. Exemplary detectable labels include enzymes, dyes, radioisotopes, digoxygenin, biotin, and radioisotopes. A protein described herein may also be fused to a peptide that may, e.g., facilitate labeling of the protein or linking it to another moiety. For example, an 11 -residue peptide with the sequence DSLEFIASKLA ("YBBR tag") may be fused to the N- or C- terminus of the protein, or inserted, e.g., in a flexible loop, in the middle of the protein (Yin et al. (2005) PNAS 102:15815). Functionally homologous peptides, which preferable form an alp ha- helix, may also be used. This peptide can then be labeled site specifically by Sfb- catalyzed small-molecule CoA modification. The following labels may be attached: biotin, glutathione, fluorescent probes such as fluorescein, Alexa Fluor dyes, and redox probes such as porphyrin. Labeling can be performed as described in Yin et al., supra.

Also included are polypeptides which have been modified using ordinary molecular biological techniques so as to improve their resistance to proteolytic degradation or to optimize solubility properties or to render them more suitable as a therapeutic agent. Analogs of such polypeptides include those containing residues other than naturally occurring L-amino acids, e.g., D-amino acids or non-naturally occurring synthetic amino acids.

Peptides and proteins may also comprise one or more non-naturally occurring amino acids. For example, nonclassical amino acids or chemical amino acid analogs can be introduced as a substitution or addition into peptides. Non-classical amino acids include, but are not limited to, the D-isomers of the common amino acids, 2,4-diaminobutyric acid, alpha-amino isobutyric acid, 4-aminobutyric acid, Abu, 2-amino butyric acid, gamma- Abu, epsilon-Ahx, 6-amino hexanoic acid, Aib, 2-amino isobutyric acid, 3 -amino propionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, homocitrulline, cysteic acid, t-butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine, beta-alanine, fluoro-amino acids, designer amino acids such as beta-methyl amino acids, Calpha-methyl amino acids, Nalpha-methyl amino acids, and amino acid analogs in general.

Also provided are derivatives of peptides and proteins, such as chemically modified peptides and peptidomimetics. Peptidomimetics are compounds based on, or derived from, peptides and proteins. Peptidomimetics can be obtained by structural modification of known peptide sequences using unnatural amino acids, conformational restraints, isosteric replacement, and the like. The subject peptidomimetics constitute the continum of structural space between peptides and non-peptide synthetic structures; peptidomimetics may be useful, therefore, in delineating pharmacophores and in helping to translate peptides into nonpeptide compounds with the activity of the parent peptides. Additionally, peptidomimetics based on more substantial modifications of the backbone of a peptide can be used. Peptidomimetics which fall in this category include (i) retro-inverso analogs, and (ii) N-alkyl glycine analogs (so-called peptoids).

In addition to a variety of sidechain replacements which can be carried out to generate peptidomimetics, the description specifically contemplates the use of conformationally restrained mimics of peptide secondary structure. Numerous surrogates have been developed for the amide bond of peptides. Frequently exploited surrogates for the amide bond include the following groups (i) trans-olefms, (ii) fluoroalkene, (iii) methyleneamino, (iv) phosphonamides, and (v) sulfonamides.

Peptides may comprise at least one amino acid or every amino acid that is a D stereoisomer. Other peptides may comprise at least one amino acid that is reversed. The amino acid that is reversed may be a D stereoisomer. Every amino acid of a peptide may be reversed and/or every amino acid may be a D stereoisomer.

In another illustrative embodiment, a peptidomimetic can be derived as a retro- enantio analog of a peptide. Retro-enantio analogs such as this can be synthesized with commercially available D-amino acids (or analogs thereof) and standard solid- or solution- phase peptide-synthesis techniques, as described, e.g., in WO 00/01720. The final product may be purified by HPLC to yield the pure retro-enantio analog.

Also included are peptide derivatives which are differentially modified during or after synthesis, e.g., by benzylation, glycosylation, acetylation, phosphorylation, amidation, pegylation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc. In specific embodiments, the peptides are acetylated at the N-terminus and/or amidated at the C-terminus.

Modifications (which do not normally alter primary sequence) include in vivo, or in vitro chemical derivatization of polypeptides, e.g., acetylation, or carboxylation. Also included are modifications of glycosylation, e.g., those made by modifying the glycosylation patterns of a polypeptide during its synthesis and processing or in further processing steps; e.g., by exposing the polypeptide to enzymes which affect glycosylation, e.g., mammalian glycosylating or deglycosylating enzymes. Also embraced are sequences which have phosphorylated amino acid residues, e.g., phosphotyrosine, phosphoserine, or pho spho threonine . A peptide (or polypeptide) may also be fused to a signal sequence. For example, when prepared recombinantly, a nucleic acid encoding the peptide may be linked at its 5' end to a signal sequence, such that the peptide is secreted from the cell.

Peptides (or polypeptides) may be used as a substantially pure preparation, e.g., wherein at least about 90% of the peptides in the preparation are the desired peptide. Compositions comprising at least about 50%, 60%, 70%, or 80% of the desired peptide may also be used. The polypeptides may also be encompassed in pharmaceutical compositions, e.g., comprising a pharmaceutically acceptable vehicle.

Polypeptides described herein may be used as immunogens for the production of antibodies. For such use, e.g., the polyptides may be in a composition with an adjuvant.

Proteins corresponding to the other peaks described in Table 2 and Table 4 are also encompassed. Exemplary polypeptides are those associated with the 12.5 kDa peak (Table 2 and Table 4 (peak A)), the 3.9 kDa peak (Table 2 and Table 4 (peak F)), the 13.4 kDa peak (Table 2 and Table 4 (peak J)), the 13.6 kDa peak (Table 2 and Table 4 (peak N)), and the 4.7 kDa peak (Table 4 (peak Q)). Fragments and variants of such polypeptides are also included within the scope of the invention. Nucleic acids

Provided herein are nucleic acids encoding a C-terminal cleavage product of cystatin C. In one aspect, the C-terminal cleavage product comprises a deletion of amino acids from the C-terminus. Preferably, the cystatin C cleavage product is a cystatin C polypeptide that lacks exactly 8, about 8, or at least 8 amino acids at its C-terminus.

In accordance therewith, one embodiment of the present invention is directed to an isolated polynucleotide which encodes a cleavage product of a cystatin C polypeptide, or fragment thereof, e.g., those described herein. Isolated polynucleotides that encode polypeptides with higher sequence homologies of, for example, 70%, 80%, 90%, 95% or 98%, which have the ability to inhibit cathepsin B activity moreso than full-length cystatin C, are also contemplated by this invention. Preferably, an isolated polynucleotide encodes a cystatin C cleavage fragment comprising an amino acid sequence consisting essentially of SEQ ID NO: 2.

In another embodiment, the present invention is directed to an isolated polynucleotide which encodes a polypeptide comprising at least 4, 10, 20, 30, 50, 100 or 130 contiguous amino acids of SEQ ID NO: 2, wherein said polypeptide does not comprise the last 8 amino acids of full-length cystatin C and has the ability to inhibit cathepsin B activity moreso than full-length cystatin C. In this embodiment, the isolate polynucleotide encodes a polypeptide representing a cystatin C cleavage product with activity similar to or identical to SEQ ID NO: 2.

In another embodiment, the isolated polynucleotide encodes a cleavage product, or fragment thereof, of cystatin C having a molecular weight of approximately between 7 kDa and 12.5 kDa and exhibiting a similar or identical biological function of SEQ ID NO: 2. In one embodiment, the polynucleotide encodes a polypeptide as set forth above having the ability to modulate, e.g. capable of inhibiting cathepsin B activity moreso than full-length cystatin C.

The invention is also directed to polynucleotides encoding derivatives or analogs of the cystatin C cleavage products which are functionally active, i.e., capable of inhibiting cathepsin B activity moreso than full-length cystatin C.

In another embodiment, the polynucleotide encodes a polypeptide cleavage product in the form of a fusion protein. A further aspect of the invention is the use of the polynucleotide as set forth above for the production of a polypeptide to be used as an immunogen for the production of antibodies. Methods of production of the cleavage product, e.g. by recombinant means, are provided.

In a specific embodiment, the invention relates to a recombinant cell harboring a polynucleotide described herein, capable of producing a polypeptide described above, (e.g. SEQ ID NO: 2). In another embodiment, the present invention relates to use of such a recombinant cell for the production of recombinant cystatin C cleavage product. A cystatin C cleavage product may be expressed from a polynucleotide encoding a cleavage product, or from a nucleic acid expressing a cystatin C polypeptide and thereafter cleaving the cystatin C by proteolytic digest to produce the cleavage product.

The human cystatin C cDNA is an 818 nucleotide sequence with Accession number NM 000099 on the NCBI website. The open reading frame encoding full-length cystatin C consists of nucleotides 76 to 490 and is shown below:

ATGGCC GGG CCC CTGCGC GCC CCGCTGCTC CTG CTG GCC ATC CTG GCC GTG GCC CTGGCC GTGAGC CCC GCG GCC GGCTCCAGT CCC GGCAAG CCG CCG CGC CTG GTG GGAGGC CCC ATGGAC GCCAGC GTG GAG GAG GAG GGT GTGCGGCGT GCACTGGAC TTT GCC GTC GGC GAG TAC AAC AAA GCCAGCAAC GACATGTAC CACAGC CGC GCGCTGCAG GTG GTG CGC GCC CGCAAG CAGATC GTAGCT GGGGTGAAC TACTTC TTG GAC GTG GAG CTGGGC CGAACCACGTGTACCAAGACC CAG CCCAAC TTGGAC AAC TGC CCC TTC CAT GAC CAGCCACAT CTGAAAAGGAAA GCATTC TGC TCT TTC CAGATC TAC GCT GTGCCT TGGCAG GGCACAATGACC TTGTCGAAA TCCACC TGT CAGGAC GCC TAG (SEQ IDNO: 3) The nucleotide sequence encoding a human cystatin C fragment lacking the 8 C- terminal amino acids set forth below:

ATG GCC GGG CCC CTGCGC GCC CCGCTG CTC CTG CTG GCC ATC CTG GCC GTG GCC CTGGCC GTGAGC CCC GCG GCC GGCTCCAGT CCC GGCAAG CCG CCG CGC CTG GTG GGAGGC CCC ATGGAC GCCAGC GTG GAG GAG GAG GGT GTGCGGCGT GCACTGGAC TTT GCC GTC GGC GAG TAC AAC AAA GCCAGCAAC GACATGTAC CACAGC CGC GCGCTGCAG GTG GTG CGC GCC CGCAAG CAGATC GTAGCT GGGGTGAAC TACTTC TTG GAC GTG GAG CTGGGC CGAACCACGTGTACCAAGACC CAG CCCAAC TTGGAC AAC TGC CCC TTC CAT GAC CAGCCACAT CTGAAAAGGAAA GCATTC TGC TCT TTC CAGATC TAC GCT GTGCCT TGGCAG GGCACAATGACC TTGTCG

(SEQIDNO: 1)

In one aspect, the invention relates to an isolated polynucleotide, or fragment thereof, encoding any of the cystatin C polypeptides described above. Thus, the invention relates to an isolated polynucleotide having a polynucleotide sequence with at least 60% identity to the polynucleotide sequence of SEQ ID NO: 1, wherein the polynucleotide sequence does not encode a polypeptide comprising the last 8 amino acids of full-length cystatin C. Preferably, the polypeptide has the ability to inhibit cathepsin B activity moreso than full-length cystatin C. Isolated nucleic acids with higher sequence homologies of, for example, 70%, 80%, 90%, 95% or 98% with similar function are also contemplated by this invention.

In another embodiment, the invention relates to an isolated polynucleotide encoding a fragment of a cystatin C polypeptide, which fragment comprises a contiguous stretch of at least 4, 10, 20, 50, 100 or 130 amino acids of SEQ ID NO: 2, wherein said polypeptide does not comprise the last 8 amino acids of full-length cystatin C. Preferably, the recited fragment has the ability to inhibit cathepsin B activity more than full-length cystatin C. The polynucleotide may encode a fragment that has a molecular weight between about 7 kDa and 12.5 kDa.

Preferably, the polynucleotide as set forth above relates to the nucleic acid sequence for a cystatin C cleavage product as described above, including the genomic sequence, mRNA or cDNA, polymorphic, allelic, isoforms and mutant forms thereof, and nucleic acid constructs of the gene, including vectors, plasmids and recombinant cells and transgenic organisms containing or corresponding to cystatin C cleavage product.

Nucleic acids include vectors, such as expression vectors for producing a peptide, e.g., viral vectors. Also encompassed herein are cells comprising a nucleic acid encoding a peptide described herein and methods for producing peptides comprising culturing these cells to produce a peptide. These methods can be used of producing recombinant peptides or for expression of a petpide in a cell, e.g., in a cell of a subject.

Appropriate vectors may be introduced into host cells using well known techniques such as infection, transduction, transfection, transvection, electroporation and transformation. The vector may be, for example, a phage, plasmid, viral or retroviral vector. Retroviral vectors may be replication competent or replication defective. In the latter case, viral propagation generally will occur only in complementing host cells.

The vector may contain a selectable marker for propagation in a host. Generally, a plasmid vector is introduced in a precipitate, such as a calcium phosphate precipitate, or in a complex with a charged lipid. If the vector is a virus, it may be packaged in vitro using an appropriate packaging cell line and then transduced into host cells.

Preferred vectors comprise cis-acting control regions to the polynucleotide of interest. Appropriate trans-acting factors may be supplied by the host, supplied by a complementing vector or supplied by the vector itself upon introduction into the host.

In certain embodiments, the vectors provide for specific expression, which may be inducible and/or cell type-specific. Particularly preferred among such vectors are those inducible by environmental factors that are easy to manipulate, such as temperature and nutrient additives.

Expression vectors useful in the present invention include chromosomal-, episomal- and virus-derived vectors, e.g., vectors derived from bacterial plasmids, bacteriophage, yeast episomes, yeast chromosomal elements, viruses such as baculoviruses, papova viruses, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses, and vectors derived from combinations thereof, such as cosmids and phagemids.

The DNA insert should be operatively linked to an appropriate promoter, such as the phage lambda PL promoter, the E. coli lac, trp and tac promoters, the SV40 early and late promoters and promoters of retroviral LTRs, to name a few. Other suitable promoters will be known to the skilled artisan. The expression constructs will further contain sites for transcription initiation, termination and, in the transcribed region, a ribosome binding site for translation. The coding portion of the mature transcripts expressed by the constructs will preferably include a translation initiating site at the beginning and a termination codon (UAA, UGA or UAG) appropriately positioned at the end of the polypeptide to be translated. As indicated, the expression vectors will preferably include at least one selectable marker. Such markers include dihydrofolate reductase or neomycin resistance for eukaryotic cell culture and tetracycline, kanamycin, or ampicillin resistance genes for culturing in E. coli and other bacteria. Representative examples of appropriate hosts include, but are not limited to, bacterial cells, such as E. coli, Streptomyces and Salmonella typhimurium cells; fungal cells, such as yeast cells; insect cells such as Drosophila S2 and Sf9 cells; animal cells such as CHO, COS and Bowes melanoma cells; and plant cells. Appropriate culture mediums and conditions for the above-described host cells are known in the art.

Among vectors preferred for use in bacteria include pQE70, pQE60 and pQE9, pQElO available from Qiagen; pBS vectors, Phagescript vectors, Bluescript vectors, pNH8A, pNHlβa, pNH18A, pNH46A available from Stratagene; pET series of vectors available fromNovagen; and ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 available from Pharmacia. Among preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTl and pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL available from Pharmacia. Other suitable vectors will be readily apparent to the skilled artisan.

Among known bacterial promoters suitable for use in the present invention include the E. coli lad and lacZ promoters, the T3, T5 and T7 promoters, the gpt promoter, the lambda PR and PL promoters, the trp promoter and the xyl/tet chimeric promoter. Suitable eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, the promoters of retroviral LTRs, such as those of the Rous sarcoma virus (RSV), and metallothionein promoters, such as the mouse metallothionein-I promoter.

Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE-dextran mediated transfection, cationic lipid-mediated transfection, electroporation, transduction, infection or other methods. Such methods are described in many standard laboratory manuals (for example, Davis, et al., Basic Methods In Molecular Biology (1986)).

Transcription of DNA encoding the polypeptides of the present invention by higher eukaryotes may be increased by inserting an enhancer sequence into the vector. Enhancers are cis-acting elements of DNA, usually about from 10 to 300 nucleotides that act to increase transcriptional activity of a promoter in a given host cell-type. Examples of enhancers include the SV40 enhancer, which is located on the late side of the replication origin at nucleotides 100 to 270, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.

A recombinant soluble form of a polypeptide of the present invention may also be produced, e.g., by deleting at least a portion of the transmembrane domain, such that the protein is not capable to localize itself to a cell membrane. Also within the scope of the invention are nucleic acids encoding splice variants or nucleic acids representing transcripts synthesized from an alternative transcriptional initiation site, such as those whose transcription was initiated from a site in an intron. Such homologues can be cloned by hybridization or PCR using standard methods known in the art.

The polynucleotide sequence may also encode for a leader sequence, e.g., the natural leader sequence or a heterologous leader sequence. Alternatively, the nucleic acid can be engineered such that the natural leader sequence is deleted and a heterologous leader sequence inserted in its place. The term "leader sequence" is used interchangeably herein with the term "signal peptide". For example, the desired DNA sequence may be fused in the same reading frame to a DNA sequence which aids in expression and secretion of the polypeptide from the host cell, for example, a leader sequence which functions as a secretory sequence for controlling transport of the polypeptide from the cell. The protein having a leader sequence is a preprotein and may have the leader sequence cleaved by the host cell to form the mature form of the protein.

For secretion of the translated polypeptide into the lumen of the endoplasmic reticulum, into the periplasmic space or into the extracellular environment, appropriate secretion signals may be incorporated into the expressed polypeptide, for example, the amino acid sequence KDEL. The signals may be endogenous to the polypeptide or they may be heterologous signals.

Nucleic acids that encode the biomarkers set forth in Table 2 and Table 4, e.g., the 12.5 kDa peak (Table 2), the 3.9 kDa peak (Table 2), the 13.4 kDa peak (Table 2), the 13.6 kDa peak (Table 2), and the 4.7 kDa peak (Table 4), fragments and variants of such polypeptides, are also included within the scope of the invention.

In a specific embodiment, the invention relates to a recombinant cell producing a polypeptide described above, (e.g. SEQ ID NO: 2), preferably a recombinant form of the polypeptide. In another embodiment, the present invention relates to use of such a recombinant cell for the production of recombinant cystatin C cleavage product. A cystatin C cleavage product may be expressed from a nucleic acid expressing the same, or from a nucleic acid expressing a cystatin C polypeptide and thereafter cleaving the cystatin C by proteolytic digest to produce the cleavage product.

Antibodies

Antibodies binding specifically to the biomarkers described herein, e.g., in Table 2 and Table 4, are also encompassed herein.

In certain embodiments, the present invention provides antibodies that bind with high specificity to the cystatin C cleavage product polypeptides provided herein. Thus, antibodies that bind to a polypeptide consisting of SEQ ID NOs: 2 or 4 are provided. In addition to antibodies generated against the full length polypeptide or cleavage product, antibodies may also be generated in response to smaller constructs comprising epitopic core regions. Antibodies that bind to any of the polypeptides described above are also provided.

Antibodies may bind essentially only to a full-length cystatin C, e.g., an antibody may bind specifically to an epitope that is absent in the cleavage product (e.g. SEQ ID NO: 2), e.g., an antibody to an cystatin C epitope within the C-terminal most 8 amino acids of the full-length polypeptide, without significant cross-hybridization to the cleavage product. Other antibodies may detect both types of proteins. An antibody that binds to both a cystatin C full-length and C-terminal cleavage product may bind to an epitope within the region of amino acids 1-138 of the full-length, such as an N-terminal region.

An antibody may specifically recognize the C-terminal cystatin C cleavage product. The antibody may only bind to the C-terminal cystatin C cleavage product (e.g., SEQ ID NO: 2), without significant cross-hybridization to the full-length cystatin C polypeptide (e.g, SEQ ID NO: 4). In a diagnostic assay the antibody may be used to determine the level of the C-terminal cleavage product.

As used herein, the term "antibody" is intended to refer broadly to any immunologic binding agent such as IgG, IgM, IgA, IgD and IgE. Generally, IgG and/or IgM are preferred because they are the most common antibodies in the physiological situation and because they are most easily made in a laboratory setting. The term "antibody" is used to refer to any antibody-like molecule that has an antigen binding region, and includes antibody fragments such as Fab', Fab, F(ab')2, single domain antibodies (DABs), Fv, scFv (single chain Fv), hybrid antibodies, chimeric antibodies, humanized antibodies and the like. The techniques for preparing and using various antibody-based constructs and fragments are well known in the art. Means for preparing and characterizing antibodies are also well known in the art (See, e.g., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, 1988).

"Humanized" antibodies are also contemplated, as are chimeric antibodies from mouse, rat, or other species, bearing human constant and/or variable region domains, bispecific antibodies, recombinant and engineered antibodies and fragments thereof.

Monoclonal antibodies (MAbs) are recognized to have certain advantages, e.g., reproducibility and large-scale production, and their use is generally preferred. The invention thus provides monoclonal antibodies of the human, murine, monkey, rat, hamster, rabbit and even chicken origin. Due to the ease of preparation and ready availability of reagents, murine monoclonal antibodies will often be preferred.

A wide range of animal species can be used for the production of antisera. Typically the animal used for production of antisera is a rabbit, a mouse, a rat, a hamster, a guinea pig or a goat. Because of the relatively large blood volume of rabbits, a rabbit is a preferred choice for production of polyclonal antibodies. Antibody Conjugates

The present invention further provides antibodies against cystatin C cleavage products, generally of the monoclonal type, that are linked to one or more other agents to form an antibody conjugate. Any antibody of sufficient selectivity, specificity and affinity may be employed as the basis for an antibody conjugate. Such properties may be evaluated using conventional immunological screening methodology known to those of skill in the art.

Certain examples of antibody conjugates are those conjugates in which the antibody is linked to a detectable label. "Detectable labels" are compounds or elements that can be detected due to their specific functional properties, or chemical characteristics, the use of which allows the antibody to which they are attached to be detected, and further quantified if desired. Another such example is the formation of a conjugate comprising an antibody linked to a cytotoxic or anti-cellular agent, as may be termed "immunotoxins" (described in U.S. Pat. Nos. 5,686,072, 5,578,706, 4,792,447, 5,045,451, 4,664,911 and 5,767,072, each incorporated herein by reference).

Antibody conjugates are thus preferred for use as diagnostic agents in the methods described herein. Antibody diagnostics generally fall within two classes, those for use in in vitro diagnostics, such as in a variety of immunoassays, and those for use in vivo diagnostic protocols, generally known as "antibody-directed imaging." Again, antibody-directed imaging is less preferred for use with this invention. Many appropriate imaging agents are known in the art, as are methods for their attachment to antibodies (see, e.g., U.S. Pat. Nos. 5,021,236 and 4,472,509, both incorporated herein by reference). Certain attachment methods involve the use of a metal chelate complex employing, for example, an organic chelating agent such a DTPA attached to the antibody (U.S. Pat. No. 4,472,509). Monoclonal antibodies may also be reacted with an enzyme in the presence of a coupling agent such as glutaraldehyde or periodate. Conjugates with fluorescein markers are prepared in the presence of these coupling agents or by reaction with an isothiocyanate.

Antibody conjugates may be used in vivo or in vitro. In vitro the antibody may be linked to a secondary binding ligand or to an enzyme (an enzyme tag) that will generate a colored product upon contact with a chromogenic substrate. Examples of suitable enzymes include urease, alkaline phosphatase, (horseradish) hydrogen peroxidase and glucose oxidase. Preferred secondary binding ligands are biotin and avidin or streptavidin compounds. The use of such labels is well known to those of skill in the art in light and is described, for example, in U.S. Pat. Nos. 3,817,837; 3,850,752; 3,939,350; 3,996,345; 4,277,437; 4,275,149 and 4,366,241; each incorporated herein by reference.

Also provided are screening methods. A method may comprise contacting cystatin C or a biologically active fragment thereof with an agent and determining whether (a) the agent binds to cystatin C or the biologically active fragment thereof and/or (b) the agent inhibits the activity of cystatin C. A biologically active fragment may be a cystatin fragment lacking one or more amino acids at its C-terminus, e.g., as further described herein. A method may further comprise determining whether it can prevent or treat MS, an early stage thereof, or a condition relating thereto, e.g., in an animal model. An agent may be, e.g., an antibody or a molecule, e.g., a small molecule. Methods for treating MS or a condition relating thereto

Provided herein are methods of treating or preventing multiple sclerosis, comprising administering to an individual afflicted therewith or in need thereof a therapeutically effective amount of an agent that modulates the expression, levels, or activity of a biomarker provided herein.

Further provided herein are methods of treating multiple sclerosis, comprising administering to an individual afflicted therewith or in need thereof a therapeutically effective amount of an agent which decreases cathepsin activity. In one embodiment, the cathepsin activity decreased is cathepsin B activity. In a preferred embodiment, the agent inhibits the activity of cystatin C.

In another embodiment, the agent inhibits the activity of cystatin C by inhibiting the proteolytic cleavage of cystatin C. The agent may be a protease inhibitor, which prevents cleavage of the 8 C-terminal most amino acids of cystatin C, thereby inhibiting the activity of cystatin C. In another embodiment, the agent may inhibit the production of SEQ ID NO: 2. The agent may be an antibody, peptide, small molecule, or mimetic which binds to the cleavage site, thereby blocking cleavage of the C terminus of cystatin C, which in turn inhibits the production of SEQ ID NO: 2. Kits

The present invention also provides kits for diagnosing MS, an early stage thereof, or a condition relating thereto, monitoring progression of the disease or assessing response to therapy. A kit may comprise an agent for detecting or measuring one marker or a combination of two or more markers. For example, a kit may comprise a reagent that specifically binds to a molecule selected from the group consisting of the molecules set forth in Table 2 and Table 4.

In developing such kits, it is within the competence of one of ordinary skill in the art to perform validation studies that would use an optimal analytical platform for each marker. For a given marker, this may be an immunoassay or mass spectroscopy assay. Kit development may require specific antibody development, evaluation of the influence (if any) of matrix constituent ("matrix effects"), and assay performance specifications. A kit may comprise a container for sample collected from a patient and a marker specific reagent.

The present description is further illustrated by the following examples, which should not be construed as limiting in any way. The contents of all cited references (including literature references, issued patents, published patent applications and GenBank Accession numbers as cited throughout this application) are hereby expressly incorporated by reference. When definitions of terms in documents that are incorporated by reference herein conflict with those used herein, the definitions used herein govern. EXEMPLIFICATION

Example 1. Cleavage of Cystatin C in the CSF of Patients with Multiple Sclerosis

ABSTRACT

The diagnosis of multiple sclerosis (MS) can be challenging due to the lack of a specific diagnostic test. Recent advances in proteomics, however, offer new opportunities for biomarker discovery and the study of disease pathogenesis. We analyzed CSF samples from 29 patients with MS or clinically isolated syndromes (CIS), 27 patients with transverse myelitis (TM), 50 patients with HIV infection and 27 patients with other neurological diseases (OND) by surface enhanced laser desorption/ionization (SELDI) time of flight-mass spectroscopy. We found a unique protein of 12.5 kD that was 100% specific for MS/CIS compared with TM or OND. Low levels of this protein were found in some patients with HIV infection. Tandem mass spectroscopy of a tryptic digest of this 12.5 kD protein identified it as a cleavage product of full-length cystatin C (13.4 kD), an important inhibitor of cysteine proteases including the cathepsins. While total cystatin C levels in the MS patients was not different compared to controls, the patients with the highest 12.5/13.4 peak ratios also had the greatest cathepsin B inhibitory activity. This suggests that cleavage of cystatin C may be an adaptive host response and may identify a subgroup of patients with MS.

INTRODUCTION:

The accurate identification of patients with multiple sclerosis (MS) can be challenging at the time of disease onset. Even with magnetic resonance imaging (MRI), evoked potentials and cerebrospinal (CSF) studies, the diagnosis is still based on clinical criteria. While reliable serological tests are available for most autoimmune diseases, no such assay is available for the diagnosis of MS in part because no single antigen has been specifically associated with the disease. Nevertheless, the availability of effective immunomodulatory therapy makes it important to identify biological markers that reliably distinguish MS from other neurological diseases.

The recent development of a protein chip platform based on surface enhanced laser desorption/ionization (SELDI) time of flight mass spectroscopy allows for the high throughput analysis of complex protein mixtures. This method requires microliter amounts of sample and has a sensitivity in the sub femtomole range. Using this technique, specific biomarkers for some types of cancer have been reported \ However, tumors are cell-type specific and usually follow a predictable clinical course, hence bio marker discovery using cell extracts, serum or other body fluids has progressed rapidly in this field. In contrast, multiple immune cells, neuroglia and neurons have complex interactions with one another in MS and these interactions can vary over time. Thus, the clinical course of MS is both variable and unpredictable and biomarker discovery for this disease poses unique challenges. In a recent attempt to identify disease specific biomarkers for MS, CSF from five patients was analyzed by two dimensional gel electrophoresis. Despite the small sample size, 15 proteins were found to be differentially expressed in the CSF of MS patients compared to controls ². In the present study, we analyzed CSF samples by SELDI time of flight mass spectroscopy from a larger sample size of well-characterized patients and controls. Analysis of CSF has several advantages over serum for biomarker discovery in neurological disease. CSF better represents local events in the brain as compared to serum. Further, high abundance proteins in serum may mask the low abundant, low molecular weight proteins that are the likely candidates for biomarkers. We identified several proteins that were significantly dysregulated in patients with MS or CIS, one of which was a cleavage product of cystatin C. Our findings have important implications for the diagnosis of MS and for understanding disease pathogenesis.

METHODS

Patient selection

All CSF samples used in these studies were obtained from patients undergoing a lumbar puncture as part of their diagnostic evaluation being conducted through the Adult Neurology Clinic at The Johns Hopkins Hospital. A protocol approved by our Institutional Review Board for Human Subjects Research allowed us to collect a small additional sample along with each diagnostic specimen. Written informed consent was obtained from each patient before these samples were obtained. Individuals with definite MS (n=23) were diagnosed according to current criteria ³' ⁴. Six patients had clinically isolated syndromes (CIS) and abnormal cranial MRI scans consistent with MS⁴. Four of these patients have since had second clinical attacks and thus have confirmed MS. CSF samples from patients with various other neurological disorders (OND) (n=27) were used as controls. A diagnosis in each of these patients was defined according to individual disease criteria. These samples represented both inflammatory (n=12) (n=3 each with neurosarcoidosis and viral meningoencephalitis, n=l each with acute inflammatory demyelinating neuropathy, chronic inflammatory demyelinating neuropathy, primary central nervous system (CNS) lymphoma, HIV infection with progressive multifocal leukoencephlopathy, lumbosacral plexitis and CNS Lyme's disease) and non-inflammatory neurological diseases (n=15) (n=3 each with normal pressure hydrocephalus and amyotrophic lateral sclerosis, n=2 with pesudotumor cerebri, and n=l each with meningioma, drugs induced delirium, spinocerebellar degeneration, Alzheimer's disease, hereditary myelopathy and Parkinson's disease). For the purpose of this study, CSF was considered inflammatory in the control samples if one or more of the following abnormalities were present: white cell count >5 cells/mm³, detectable oligoclonal bands or IgG index >0.8. CSF samples from another 27 patients with acute transverse myelitis (TM) and 50 patients with HIV infection (22 without dementia and 28 with dementia) were used as other controls. All patients except three with TM had an inflammatory CSF but none had oligoclonal bands or an elevated IgG index. Samples from HIV infected patients were taken from the prospectively followed North Eastern AIDS dementia cohort⁵. None of the patients had opportunistic infections.

Demographic and clinical data on the patients with MS/CIS was obtained by direct patient interview or from the relevant medical records (Table 1 provided online). With the exception of two patients with secondary progressive MS who were already on disease modifying therapy, none of our patients had received any treatment other than corticosteroids before the time of CSF acquisition. An Expanded Disability Status Scale (EDSS) score was obtained at the time of CSF aquisition by an examiner who was blinded to the results of our analyses. Each patient also had an enhanced cranial MRI scan within 2 weeks of their lumbar puncture. The total number of T2 hyperintense lesions, Tl hypointense lesions, and gadolinium-enhancing Tl lesions meeting a > 3 mm size cutoff criteria was determined from each scan by a single blinded examiner. Each scan was also judged as to whether it met the formal requirements for an abnormality consistent with MS according to published criteria ³'⁴.

Protein chip assay

All CSF samples were handled equally and placed immediately on ice and centrifuged at 3000 rpm for 10 min. The cell free samples were then stored at -8O⁰C in 0.5 ml aliquots. For protein chip analysis, a single aliquot of CSF was thawed and immediately realiquoted into 50μl volumes and refrozen at -8O⁰C. Each sample was thawed once more before analysis. CSF samples were initially analyzed using the weak cation exchange (CMlO) and the hydrophobic chip (H50) protein chips (Ciphergen Biosystems, Freemont, CA). These chips bound proteins with specific physio-chemical properties, which were then resolved by SELDI time of flight mass spectroscopy (Ciphergen Biosystems, Freemont CA). Spectra derived from CMlO chips showed a greater number of peaks and a better resolution of low molecular mass species and were used in all subsequent assays. The protein chip arrays were assembled into a deep well type Bioprocessor assembly (Ciphergen Biosystems). Prior to sample loading, the arrays were equilibrated with 150 μl of binding buffer (50 mM ammonium acetate buffer, pH=4.0). Each spot on the array was then incubated with 15 μl ofCSF diluted in binding buffer to a final volume of 150 μl with gentle agitation for one hour at room temperature. The spots were washed in the same buffer three times, after which lμl of 50% saturated sinapinic acid (SPA) dissolved in 50% acetonitrile, 0.5% trifluro acetic acid solution was added. The chips were air-dried and SPA reapplied. The protein chips were analyzed in the ProteinChip® biology systems reader (model PBSIIc, Ciphergen Biosystems) using a laser intensity of 2.6 microJoules and a sensitivity setting of 5. Resulting spectra were noise filtered, baseline substracted, and calibrated with Ciphergen's "All-in-One Protein standard" consisting of cytochrome C (12,360.2 Daltons), myoglobin (16,951.5 Daltons), and GAPDH (35,688 Daltons). Biochemical properties of the unique peaks identified in CSF samples were further characterized by changing the pH of the binding buffer (range 4.0-9.0). The stability of these peaks was also determined by monitoring the effects of freeze/ thaw cycles on the CSF, heating of samples to 5O⁰C for 30 min or leaving them at room temperature for 16 hrs. Each sample was analyzed in duplicate. All peaks obtained through the peak detection process were aligned using the Biomarker Wizard tool in the Ciphergen ProteinChip software (version 3.1). Peaks of similar (0.3%) mass/charge (m/z) ratio were clustered across all spectra. Each cluster then represented a particular protein.

Data analysis:

All data were internally normalized by total ion current. Spectra used for further analysis had normalization factors <2 standard deviations from the mean. The comparison of peak intensities and the ratios of the 12.5kD and 13.4kD peak amongst the patient groups was done by a one way ANOVA using a Tukey Kramer comparison test. Linear regression curves were generated using Graph Pad Prizm™ to determine if there was a correlation between cystatin C levels and cathepsin B activity. Enrichment of 12.5 kD protein

A single CSF sample (MS267) that had a prominent 12.5 kD peak was selected for further study. One ml of CSF was semi-purified in 100 μl aliquots. 100 μl CSF was incubated with 50 μl of equilibrated protein A beads for 5 min at room temperature to remove IgG. The supernatant was collected and diluted 1 :5 with 5OmM Tris, pH=9.0. Ten μl of Q Hyper D strong anion exchange beads (Ciphergen) equilibrated with 5OmM Tris pH=9.0 was incubated with each sample aliquot for 5 min at room temperature. The supernatant was collected and dialyzed in 4 changes of 1 L ultrapure water overnight. Purification of the 12.5 kD peak was confirmed by SELDI time of flight mass spectrometry.

Tris-Tricine Gel electrophoresis:

All 10 aliquots processed in a manner described above were combined, lyophilized and resuspended in 45 ul ultrapure water to which 45 μl of Tricine sample buffer (Biorad, Hercules, CA.) with 2% β-mercaptoethanol was added. Proteins were resolved using precast 16.5% Tris-Tricine SDS-PAGE gels (BioRad, Hercules, CA). The anode buffer consisted of 0.2 M Tris-HCl, pH 8.9, and the cathode buffer consisted of 0.1 M Tris-HCl, 0.1 M Tricine, 0.1% SDS, pH 8.3. Samples were diluted in 10 mL of 50 mM Tris-HCl, 4% w/v SDS, 12% w/v sucrose, 5% v/v β-mercaptoethanol, and a trace of bromophenol blue, pH 6.8. After denaturation at 97⁰C for 5 min, samples were loaded onto the gel with 30 μl/lane. Gels were run at 200 mamps for 3 hr. After electrophoresis, gels were fixed, stained with a Silver Stain Plus Kit (Biorad, Hercules, CA), and dried between 2 pieces of cellophane.

Protein digestion and peptide extraction

The 12.5 kD band was excised following silver staining of the gel. Tryptic digestion and peptide extraction were performed on the excised band⁶. The gel band was destained in 15 mM potassium ferricyanide/ 50 mM sodium thio sulfate followed by washing with water and dehydration with acetonitrile. The isolated gel band was then incubated for 45 min at 55°C with 10 mM dithithreitol followed by incubation with 55 mM iodoacetamide for 30 min at room temperature. The sample was then washed and dehydrated with alternating washes of 5mM ammonium bicarbonate followed by acentonitrile. After drying the extract in a speedvac for 15 min, tryptic digestion was performed with 12.5 μg/ml trypsin in 5 mM ammonium bicarbonate overnight at 37°C. Peptides were extracted with successive incubations of 25 mM ammonium bicarbonate, followed by 5% formic acid and then acetonitrile. Samples were dried, cleaned and concentrated using an OMIX C₁₈ pipette tip according to manufacturer's instructions (Varian, Palo Alto, CA).

Protein identification by tandem mass spectrometry

An Axima CFR MALDI-TOF mass spectrometer (Kratos, Manchester, UK) was used for protein identification and accurate mass measurements. 2 μl of the cleaned peptides along with 125 fmol of a three-point calibrant mixture were spotted via the dried droplet method with 0.3 μl saturated α-Cyano-4-hydroxycinnamic acid (CHCA) (Sigma, St. Louis, MO) in 50% ethanol/50% ddF^O. Internal calibration was applied and the monoisotopic masses of the tryptic digest peaks were acquired. Tandem mass spectrometry (MS/MS) was performed on selected peaks. The monoisotopic masses of the tryptic digest peaks were combined with fragment data from the MS/MS into a single Mascot (www.matrixscience.com) search. To obtain an accurate mass of the peaks 12.5 kDa and 13.4 kDa, a CSF sample containing these peaks was processed as described above on a CM-IO chip. Prior to the addition of matrix, a three-point mass calibrant mixture was added directly to the sample spot to allow for internal calibration. Using a modified holder (with permission of Ciphergen Biosystems, Inc.) these chips were then analyzed for accurate mass using an Axima CFR MALDI-TOF mass spectrometer.

Immuno depletion of cystatin C

20 μl of rabbit anti-human cystatin C or rabbit anti-fusin antisera (DakoCytomation, Carpinteria, CA) was bound to 10 μl of protein A beads equilibrated in PBS, pH 7.4, by rocking at room temperature for 1 hr. 10 μl of equilibrated protein A beads alone were used as another control. Each sample was washed three times with PBS pH=7.4. A CSF sample was selected that contained both the 13.4 kD and the 12.5 kD peaks. 30 μl of this CSF was added to each of the above sample and rocked for 1 hr at room temperature. 15 μl of the supernatant was applied to CM-IO arrays and analyzed as described above.

Cystatin C levels

A sandwich ELISA was used to measure cystatin C levels in the CSF samples according to the manufacturers instructions (Alexis Biochemicals, San Diego, CA). Each CSF sample and standard was analyzed in duplicate. Concentration of cystatin C in each CSF sample was determined using a standard curve and expressed as relative fluorescence units. Cathepsin B activity: Cathepsin B activity, a known substrate of cystatin C, was measured using an activity assay kit (Bio vision Research Products, Mountain View, CA). This fluorescence-based assay utilizes the preferred cathepsin-B substrate sequence Arg-Arg labeled with amino-4-trifluoromethyl coumarin (AFP). Cathepsin-B cleaves the synthetic substrate RR-AFC to release free AFC. THP-I cells (a monocytic cell line) were used as a source of cathepsin B. Cell lysates were prepared using a lysis buffer provided with the assay kit. Cell lysates from 1x10⁶ cells were added to 50 μl of CSF in a microtiter plate (q.s. 100 μl). Two μl of substrate Ac- Arg-Arg- AFC was added to each well and incubated for 1 hr at 37⁰C. Absorbance was measured using a fluorescent plate reader with a 400 nm excitation filter and 505 nm emission filter. Controls included reaction buffer alone and a cathepsin B inhibitor provided in the kit. All samples were analyzed in duplicate.

RESULTS:

A total of 217 peaks with a signal to noise ratio of 5:1 in the mass range of 3-100 kD were identified in the CSF samples. SELDI mass spectra for 12,000 to 13,500 m/z range from a representative control and MS patient is shown in Figure 1. Replicate samples were averaged and then analyzed by a Mann Whitney U test, using a P value cut off of 0.01. We found two peaks that were significantly elevated and another two peaks that were significantly diminished in the MS/CIS samples (Table 2 provided online). Interestingly, two of these peaks appeared to have a reciprocal arrangement, such that all MS/CIS patients in whom the 12.5 kD peak was elevated, the 13.4 peak was diminished. The 13.6 kD peak was a broad peak and may represent a complex mixture of proteins. A peak at 3.9 kD (Table 2 provided on line) was also significantly elevated in the patients with MS/CIS, however the peak height was small and had only a two-fold increase in the MS/CIS patients compared to controls. Hence we have not pursued the identity of these proteins at this point. The 12.5 kD peak was present in 19/29 MS/CIS patients and in none of the patients with OND or TM. Its presence alone provided 100% specificity but only 66% sensitivity for diagnosis of MS when compared to these diseases. The 12.5 kD peak was found in some patients with HIV infection, the levels were small and significantly lower when compared to the MS/CIS patients. Due to a reciprocal relationship between the 12.5 and 13.4 kD peaks, we calculated a ratio of the 12.5kD to 13.4 kD peak for comparison purposes. The ratios of the two peaks were significantly elevated in the MS/CIS group (mean +SE = 4.632±0.909) compared to OND (mean±SE = 0.109±0.011; PO.001), TM patients (mean ± SE = 0.068±0.006; PO.001), HIV ND (mean ±SE=1.646±0.124; P<0.05) and HIVD (mean±SE=1.815±0.187; P<0.05) (Figure 2). To examine the stability of this protein in CSF we reanalyzed three samples after leaving them at room temperature for four hours and overnight. We found that the 12.5 kD peak was stable with no change in CSF stored at room temperature for up to four hours and only a slight increase following overnight storage of CSF at room temperature. The peak was also not affected by heat treatment.

Despite the small samples sizes, we analyzed our data to determine if there was a correlation between the intensity of the 12.5 kD peak and the clinical pattern of MS (CIS, remitting relapsing, secondary progressive), measures of disease activity (duration since last attack, total lesion burden or contrast enhancement on MRI) or effect of treatment (Table 1). Although no correlation could be found with any of these parameters, there were significantly higher levels in those patients whose last attack involved infratentorial regions (brain stem, cerebellum and spinal cord) when compared to those individuals whose last attack involved supratentorial regions (P=O.02) (Figure 3). Interestingly, however, CSF from patients with acute transverse myelitis showed a prominent 13.4 kD peak in all samples, while the 12.5kD peak was not visualized in any of them.

To identify the protein corresponding to the 12.5 kD peak, we studied its binding properties to CM-IO chips at different pH. We found that the overall binding properties of the 12.5 kD and 13.4 kD peaks were similar, as decreased binding with increasing pH was observed (data not shown). Although maximal binding was seen at pH=4.0, small amounts of this protein were still bound to the cation exchange chip even at pH 9.0 suggesting that the pi of this protein is >9.0. For purification purposes, we chose a CSF that showed high levels of the 12.5 kD protein. This sample was first run through a protein A column to remove IgG, followed by treatment using a strong anion exchange spin column. Proteins that passed through these columns were collected and analysis by the CMlO chip showed the 12.5 kD peak had been enriched (Figure 4). This protein was then resolved by a tris- tricine gel and the corresponding band sequenced by MALDI MS/MS. Combining the monoisotopic masses of the tryptic peptides with the MS/MS fragment data yielded a Mascot score of 166 for human cystatin C (Accession # 14278690) with 51% sequence coverage. The MS/MS data from two peptides (1226.68 Da, 2060.92 Da) yielded Mascot ion scores greater than 40 (Table 3). This combination of sequence and mass fingerprint information allowed for an unambiguous identification of human cystatin C. Intact MW measurements of the 12.5 kDa and 13.4 kDa peaks obtained via the Axima CFR werel2,538 Da and 13,361 Da respectively. The difference of 823 Da between the two peaks corresponds to the mass of the last eight amino acids at the carboxy terminal of cystatin C (accession# 14278690), consistent with the conclusion that 12.5 kDa is a cleavage product of cystatin C.

The identity of this 12.5 kD protein was further confirmed by immuno depletion from CSF samples using antisera to cystatin C followed by SELDI time of flight mass spectroscopy analysis. We chose CSF known to have both the 12.5 kD and 13.4 kD peaks. As shown in figure 5, exposure of the CSF to either protein A beads alone (Figure 5A) or to protein A beads bound to rabbit anti-fusin antisera used as a control antisera to an irrelevant antigen (Figure 5 B) had no effect on the detection of these proteins. However, protein A beads bound to anti-cystatin C antisera (Figure 5C) immuno depleted both the 12.5 kD and the 13.4 kD peaks confirming that both of them are cystatin C. A new peak at 12.1 kD was now seen likely represents a protein unmasked protein by the removal of cystatin C.

We next measured total cystatin C levels in the CSF of the patients with MS/CIS (mean±SEM=9.3±0.3 units) and compared it to that of patients with OND (11.1+0.4 units). No significant differences were found between the two groups. Since cystatin C is a protease inhibitor that specifically blocks cathepsin B activity, we also measured cathepsin B activity in the CSF of patients with MS/CIS. A significant inverse correlation (P<0.05) between the cystatin C levels and cathepsin B activity was found suggesting that the cystatin C in the CSF of MS/CIS patients is bioactive (Figure 6A). To determine if cleavage of cystatin C alters its ability to inhibit cathepsin B, we compared the 12.5/13.4 kD peak ratio with cathepsin B activity in the MS patients. MS patients with peak ratio >0.1 the cathepsin B levels were 486+68.8 units (mean +SEM) and in MS patients with peak ratio <0.1 the levels were 697±52.8 (mean ±SEM; P value=0.06). Further analysis of the MS group that showed a 12.5/13.4 kD peak ratio of >0.1 shows that patients with the highest CSF 12.5/13.4 ratios also exhibited the greatest inhibition of cathepsin B activity (Figure 6B) suggesting the possibility that cleavage at the C terminal region may actually enhance its inhibitory function.

DISCUSSION:

Identification of biomarkers for MS is not only of diagnostic importance but such markers could be used to predict future clinical events, and may also be used for monitoring the effect of treatment. We demonstrate that CSF samples are a reliable biological specimen for SELDI analysis in search for biomarkers of MS. A distinct technical advantage of using CSF over serum is that it does not require pre-clearing of large and abundant proteins in serum that may mask the proteins of interest, which are usually present at much lower concentrations. The samples are also more likely to represent local events within the CNS compared to serum.

We used SELDI-time of flight mass spectrometry to identify several novel protein peaks in the CSF of patients with MS/CIS compared to other controls. We focused in the mass range of 3-3OkD and compared only those proteins that bound to the weak cation chip. We identified a unique peak at 12.5kD in the CSF of patients with MS/CIS. The identity of the 12.5 kD protein was established as a cleavage product of cystatin C formed by the removal of the last 8 amino acids from the carboxy terminal of the protein. Since this 12.5 kD peak was found in two thirds of MS/CIS samples and not in any of the controls with OND or TM, this maybe a novel biomarker for MS and hence of diagnostic and pathogenic significance. Higher concentrations of this protein in patients with infratentorial lesions maybe due to the anatomical proximity of the lesions to the lumbar thecal sac from where the CSF was withdrawn or due to unique features of MS lesions at these sites. However, the absence of the peak in patients with transverse myelitis may suggest that the pathophysiology of the lesions in the spinal cord of patients with TM and MS may be different. A previous study that included CSF samples from normal controls did not identify a 12.5 kD peak ⁷.

Several lines of evidence suggest that the 12.5 kD peak is a breakdown product of the 13.4 kD peak. The intensity of the 12.5 kD peak and that of the 13.4 kD peak seem to be reciprocally related to each other and the sequence analysis of the 12.5 kD peak revealed that it corresponds to cystatin C, which is known to have a molecular mass of 13.4 kD ⁷. Heating the CSF had no effect on the levels of the 12.5 kD and 13.4 kD peaks, while repeated freeze thaw cycles and overnight storage of CSF at room temperature resulted in a slight increase in the 12.5 peak intensity which suggests that heat treatment may denature the protease that cleaves the 13.4 kD protein into the 12.5 kD form (the 12.5 kDa peak resulting from the freeze/thaw is a different species than the peak in CSF of MS patients). These observations have important implications for future studies for biomarker discovery efforts in MS that will require the use of prospectively collected samples with strict adherence to uniform protocols for the collection, centrifugation and storage of CSF samples. Cystatin C is an inhibitor of cysteine proteases including cathepsins B, H, K, L and S. ⁸ It is present in high concentrations in CSF compared to serum and other body fluids ⁹. The protein is a non-glycosylated molecule of 120 amino acids formed after removal of a 26 amino acid signal peptide ¹⁰. Thus any altered activity or levels of cystatin C would also result in dysregulation of cathepsin function which have been implicated in a variety of effects including degranulation of cytotoxic lymphocytes ^πand in processing of MHC class II antigen in monocytes¹². A previous study that measured cystatin C levels in CSF of MS patients by ELISA also found diminished levels in patients compared to healthy controls. Conversely, levels of cathepsin B were increased in CSF and brain of patients with MS ¹³' ¹⁴ In contrast, while we did not have access to totally normal CSF, our studies did not show any significant difference between the cystatin C levels in the MS patients compared to patients with OND. Interestingly, other studies have shown that cystatin C levels are increased in the CSF of patients with Alzheimer's disease ⁷ and Creutzfeldt- Jacob disease ¹⁵. In both these studies, CSF was analyzed by SELDI and the 13.4 kD protein was further sequenced to identify it as cystatin C. In Icelandic patients with a hereditary form of amyloid angiopathy a mutated form of cystatin C (Leu68Gln substitution) has been found. This protein accumulates in the amyloid deposits and is truncated by 10 amino acids at the amino terminal ¹⁶. This region is critical for the functional activity of cystatin C ¹⁰. Leukocyte elastase has been shown to cleave cystatin C at Valio-Glyπ resulting in loss of its ability to bind to cathepsins ¹⁷. In our experiments, one of the peptides from the tryptic digest of the 12.5 kD protein that matched to cystatin C contained an intact Leucr VaI₁₀- Glyn and an intact amino terminal region suggesting the presence of a novel cleavage site at the carboxy terminal in the MS patients. The mass differences between the 12.5 kD and 13.4 kD proteins suggest that the cleavage site is at eight amino acids from the carboxy terminal end of the protein.

The role of cystatin C in the pathogenesis of MS is not understood. Elevated serum cystatin C levels have recently been shown to be a strong predictor of death in patients with cardiovascular disease¹⁸. We did not find any significant difference in the total cystatin levels in the MS/CIS patients compared to controls. Our data suggest that the total levels of cystatin C are inversely proportional to cathepsin B activity. Furthermore it appears that cleavage of cystatin C did not lead to any augmentation of cathepsin B activity. In fact, the patients with the highest 12.5/13.4 ratios seemed to have the highest cathepsin B inhibition activity as well. This raises the possibility that cleavage of cystatin C at the carboxy terminus may lead to enhanced activity of this protein. This is in keeping with previous studies where the protease inhibiting effects of the molecule have been ascribed to the amino terminal region of the molecule¹⁰. Cleavage of the carboxy terminus of cystatin C may thus be an adaptive host response in MS. If confirmed, this raises the possibility that development of other inhibitors of cysteine proteases may have some therapeutic potential. Short synthetic peptidyl-diazomethyl ketones have been developed that mimic the activity of the animo terminal domain of cystatin C and their in vitro use leads to inhibition of bone matrix degradation by cysteine proteases resulting in decreased bone resorption ¹⁹. E64 derived from Aspergillus joponicus is also a strong irreversible inhibitor of cysteine proteases ²⁰' ²¹. Several other compounds have been designed to inhibit the activity of cysteine proteases ⁸. Nonetheless, measurement of levels of cystatin C and its breakdown product in the CSF of MS patients may identify a subtype of MS. However, larger sample sizes from MS patients at different stages of disease are needed to further validate our observations. Still, the absence of the cystatin C cleavage product in the CSF of patients with TM and other neuroinflammatory diseases suggests that inflammation alone is not sufficient for cleavage of this protein. Therefore, this cleavage product may not only identify a subgroup of patients with MS/CIS but it may also be able to separate these patients from other inflammatory diseases.

REFERENCES

1. Petricoin EF, Liotta LA. SELDI-TOF-based serum proteomic pattern diagnostics for early detection of cancer. Curr Opin Biotechnol. 2004; 15:24-30

2. Dumont D, Noben JP, Raus J et al. Proteomic analysis of cerebrospinal fluid from multiple sclerosis patients. Proteomics. 2004;4:2117-2124

3. McDonald WI, Compston A, Edan G et al. Recommended diagnostic criteria for multiple sclerosis: guidelines from the International Panel on the diagnosis of multiple sclerosis. Ann Neurol. 2001;50:121-127

4. Frohman EM, Goodin DS, Calabresi PA et al. The utility of MRI in suspected MS: report of the Therapeutics and Technology Assessment Subcommittee of the American Academy of Neurology. Neurology. 2003;61 :602-611

5. Sacktor N, McDermott MP, Marder K et al. HIV-associated cognitive impairment before and after the advent of combination therapy. J Neurovirol. 2002;8: 136-142

6. Shevchenko A, WiIm M, Vorm O, Mann M. Mass spectrometric sequencing of proteins silver-stained polyacrylamide gels. Anal Chem. 1996;68:850-858

7. Carrette O, Demalte I, Scherl A et al. A panel of cerebrospinal fluid potential biomarkers for the diagnosis of Alzheimer's disease. Proteomics. 2003;3:1486-1494

8. Grzonka Z, Jankowska E, Kasprzykowski F et al. Structural studies of cysteine proteases and their inhibitors. Acta Biochim Pol. 2001;48: 1-20

9. Lofberg H, Grubb AO. Quantitation of gamma-trace in human biological fluids: indications for production in the central nervous system. Scand J Clin Lab Invest. 1979;39:619-626

10. Abrahamson M, Ritonja A, Brown MA et al. Identification of the probable inhibitory reactive sites of the cysteine proteinase inhibitors human cystatin C and chicken cystatin. J Biol Chem. 1987;262:9688-9694

11. Balaji KN, Schaschke N, Machleidt W et al. Surface cathepsin B protects cytotoxic lymphocytes from self-destruction after degranulation. J Exp Med. 2002;196:493- 503

12. Greiner A, Lautwein A, Overkleeft HS et al. Activity and subcellular distribution of cathepsins in primary human monocytes. J Leukoc Biol. 2003;73:235-242

13. Nagai A, Terashima M, Harada T et al. Cathepsin B and H activities and cystatin C concentrations in cerebrospinal fluid from patients with leptomeningeal metastasis. Clin Chim Acta. 2003;329:53-60

14. Bever CT, Jr., Garver DW. Increased cathepsin B activity in multiple sclerosis brain. J Neural Sci. 1995;131 :71-73

15. Sanchez JC, Guillaume E, Lescuyer P et al. Cystatin C as a potential cerebrospinal fluid marker for the diagnosis of Creutzfeldt- Jakob disease. Proteomics. 2004;4:2229-2233

16. Gerhartz B, Abrahamson M. Physico-chemical properties of the N-terminally truncated L68Q cystatin C found in amyloid deposits of brain haemorrhage patients. Biol Chem. 2002;383:301-305

17. Abrahamson M, Mason RW, Hansson H et al. Human cystatin C. role of the N- terminal segment in the inhibition of human cysteine proteinases and in its inactivation by leucocyte elastase. Biochem J. 1991;273 ( Pt 3):621-626

18. Shlipak MG, Sarnak MJ, Katz R et al. Cystatin C and the risk of death and cardiovascular events among elderly persons. N Engl J Med. 2005;352:2049-2060

19. Johansson L, Grubb A, Abrahamson M et al. A peptidyl derivative structurally based on the inhibitory center of cystatin C inhibits bone resorption in vitro. Bone. 2000;26:451-459

20. Barrett AJ, Kembhavi AA, Brown MA et al. L-trans-Epoxysuccinyl-leucylamido(4- guanidino)butane (E-64) and its analogues as inhibitors of cysteine proteinases including cathepsins B, H and L. Biochem J. 1982;201 : 189-198

21. Matsumoto K, Mizoue K, Kitamura K et al. Structural basis of inhibition of cysteine proteases by E-64 and its derivatives. Biopolymers. 1999;51 :99-107

Example 2. Novel Cystatin C cleavage site in patients with Multiple Sclerosis Abstract: The effect of storage and freeze thaw cycles on cystatin C was examined in CSF. This resulted in cleavage of the cystatin C at eight amino acids from the N terminal and a resulting loss in its effect on cathepsin B activity. In contrast, a distinct smaller peak was noted in the CSF of patients with remitting relapsing Multiple Sclerosis resulting from the cleavage of eight amino acids from the C terminal region of the protein. When recombinant cystatin C was cleaved the C terminal region, an enhancement of the cystatin C activity was noted. Thus the cystatin C fragment in patients with Multiple Sclerosis is molecularly and functionally distinct.

INTRODUCTION:

We thank Nakashima et al., Del Boccio et al., and Hansson et al., ^1>2' ³for their interest in our manuscript, which demonstrated the presence of a cleavage product of cystatin C in the CSF of two thirds of patients with remitting relapsing multiple sclerosis (MS) with a high degree of specificity⁴. We also appreciate their cautionary note regarding sample storage and their concern that the identified cleavage product might be an artifact of sample handling. Obviously protein cleavage occurs via proteases that are abundant in biological fluids. However, these proteases can also be differentially regulated in disease states. For example, both matrix metalloproteases (MMPs) ⁵' ⁶and cathepsins⁷ have been shown to be altered in patients with remitting relapsing MS. All CSF samples used in our work were centrifuged immediately upon collection and then frozen at -8O⁰C within 2 hours until used for this analysis. Each sample was collected from the same clinic at our institution and handled and stored by the personnel in our laboratories using the same protocol. As mentioned in our manuscript ⁴, we examined the endogenous degradation of cystatin C. No changes in cystatin C were noted for up to 4 hours at room temperature. While cleavage of cystatin C was noted by leaving the sample overnight, no changes were noted in the protein with heating at 6O⁰C for one hour. Hansson et al, Del Biccio et al, and Carrette et al., show that prolonged storage of CSF at -2O⁰C can result in cleavage of cystatin C ³²' ⁸ at the eight amino acid N terminus. As shown by MALDI analysis, the cleavage site we identified as unique to remitting relapsing MS patients was at the C terminal region of the protein. A tryptic digest of the 12.5 kD protein that we isolated contained the N terminal peptide (table 3 in ⁴). There was no trypsin cleavage site in the C terminal region of the 13.4kD cystatin C that would yield a fragment of a similar size. Hence we are certain that the cleavage of cystatin C in patients with MS occurs at the C terminal region (Figure 7). This suggests that the mechanism of cystatin C cleavage in MS and upon prolonged storage may be different and that the proteases responsible for these different cleavage events may also be different. To further explore this possibility, we have performed several additional experiments to examine the effects of freeze thaw cycles and various proteases on cystatin C cleavage and function.

METHODS AND RESULTS

Effect of freeze thaw of CSF on cystatin C cleavage: A CSF sample from a control patient who had only the 13.4 kD peak was subjected to seven freeze thaw cycles and another CSF sample from patient with remitting relapsing MS who had the 12.5kD peak was stored at - 2O⁰C for 4 months and reanalyzed by Axima CFR MALDI-TOF mass spectrometer (Kxatos, Manchester, UK). Two microliters of the desalted solution were spotted on a stainless steel plate via the sandwich layering method with O.όμL saturated alpha-cyanto-4- hydroxycinnamic acid in 50% acetonitri3e_''^'50% 0.1 % trifluoroacetic acid. 100 profiles containing 10 shots each were acquired for all sample spots. A new peak at M/Z of 12,543.3 emerged in the control CSF which corresponds to the N terminal cleavage product of cystatin C. The MS CSF had a peak at M/Z 12,527.6 which corresponds to the C- terminal cleavage product of cystatin C. Following prolonged storage, both the N terminal and the C-terminal products are noted (Figure 7). These findings conclusively demonstrate that the cleavage site of cystatin C in CSF of MS patients is different than that seen by prolonged storage and by freeze thaw cycles.

Effect of protease inhibitors on cystatin C cleavage: Since the N-terminal cleavage of cystatin C occurs at a tryptic site (R-L) and the C-terminal cleavage occurs at a known cathepsin D cleavage site ⁹, we proposed the degradation to be protease dependant. We incubated control CSF which contained only the full length cystatin C at room temperature for 48 hours in the presence of various protease inhibitors and monitored it for the presence of the 12.5 kD fragment. As seen in figure 8, the protein inhibitor cocktail (Sigma) had no significant effect on the cleavage of cystatin C, while both FN-439 (500ug/ml), a MMP specific inhibitor, and pepstatin A (500ug/ml), a cathepsin D specific inhibitor, showed inhibition of the breakdown of cystatin C.

Inhibition of cathepsin B by cystatin C cleavage products:

Recombinant cystatin C was produced and the ability of MMP-2 and cathepsin D to cleave the recombinant protein was confirmed. As expected, cathepsin D cleaved cystatin C at four different sites, and yielded a 12.5 kD fragment following cleavage from the C terminal region⁹. In contrast, MMP-2 cleaved cystatin C at three unique sites (GK, FC, and GT which correspond to amino acids 4,5; 96,97 and 108,109). Recombinant cystatin C was treated with either MMP-2 or cathepsin D and its activity monitored by a cathepsin B functional assay using a kit from Biovision Research Products, Mountain View, CA. The assay was performed as previously described ⁴. As expected, full length cystatin C showed significant inhibition of cathepsin B. Treatment of cystatin C with cathepsin D showed further decrease in cathepsin B activity; in keeping with our previous observation that CSF of MS patients with the 12.5 kD fragment also showed a similar enhancement of cystatin C activity. In contrast treatment of cystatin C with MMP-2 lead to a decrease in its ability to inhibit cathepsin B activity. Cathepsin D and MMP-2 alone had no effect on cathepsin B activity (Figure 9). These observations confirm that C terminal fragmentation of cystatin C leads to a gain in activity while cleavage in other regions including the N terminal region leads to a loss or decrease of activity of cystatin C.

DISCUSSION

Our observations are consistent with those of other laboratories ³⁸ that show suggest that prolonged storage of CSF at -2O⁰C can result in N terminal cleavage of cystatin C. We have further extended these observations to show that incubation of CSF at room temperature for several hours and repeat freeze thaw cycles can also result in a similar cleavage of cystatin C. We thus suggest that for proteomics studies of the CSF, cell free CSF be collected following centrifugation to remove cells and the CSF be aliquoted and stored at -8O⁰C. Close attention is also needed to the time interval between CSF collection and storage. The unique observation made in our study is that in some patients with remitting relapsing MS, cleavage of cystatin C may occur from the C terminal region. This cleavage product also has an apparent mass of 12.5 kD which is similar to the mass of the fragment generated by N terminal cleavage and the resolution of the mass spectrometer by Ciphergen is not sufficient to clearly distinguish between the two peaks. This may explain the rather broad base of the peaks seen by both Nakashima et al, and Hansson et al, which could represent the combination of the N and C terminal products¹³. In contrast, the peaks that we found with the CMlO chip were sharper, much larger and more distinct⁴. We further used an Axima CFR MALDl-TOF mass spectrometer to distinguish between the two peaks, since this instrument provides a much greater mass accuracy. We (bund that the N terminal cleavage product had a measured mass of 12,543.3 Daltons while the C terminal region had a measured mass of 12,527.6 Daltons and they could be clearly distinguished as separate peaks in the same CSF sample. We have further identified that cathepsin D can cleave full- length cystatin C to yield the C terminal fragment and that such cleavage changes its functional properties. Interestingly, upon C terminal cleavage, the inhibitory properties of cystatin C are enhanced. In contrast N terminal cleavage results in the loss of its functional properties.

In summary, we have conclusively shown that a unique C terminal fragment of cystatin C can be found in some patients with remitting relapsing MS. The role of this protein in the pathophysiology of MS needs to be further studied.

REFERENCES

1. Nakashima I, Fujihara K, Fujinoki M et al. Alteration of Cystatin C in the cerebrospinal fluid of multiple sclerosis. Ann Neurol. 2006

2. Del Biccio P, Pieragostino D, Lugaresi A et al. Cleavage of cystatin C is not associated with multiple sclerosis. Ann Neurol. 2006

3. Hansson SF, Hviid-Simonsen A, Zetterberg H et al. Cystatin C in Cerebrospinal Fluid and Multiple Sclerosis. Ann Neurol. 2006

4. Irani DN, Anderson C, Gundry R et al. Cleavage of cystatin C in the cerebrospinal fluid of patients with multiple sclerosis. Ann Neurol. 2006;59:237-247

5. Fainardi E, Castellazzi M, Bellini T et al. Cerebrospinal fluid and serum levels and intrathecal production of active matrix metalloproteinase-9 (MMP-9) as markers of disease activity in patients with multiple sclerosis. Mult Scler. 2006;12:294-301 6. Kanesaka T, Mori M, Hattori T et al. Serum matrix metalloproteinase-3 levels correlate with disease activity in relapsing-remitting multiple sclerosis. J Neural Neurosurg Psychiatry. 2006;77:185-188

7. Roberts R. Lysosomal cysteine proteases: structure, function and inhibition of cathepsins. Drug News Perspect. 2005;18:605-614

8. Carrette O, Burkhard PR, Hughes S et al. Truncated cystatin C in cerebrospiral fluid: Technical [corrected] artefact or biological process? Proteomics. 2005;5:3060-3065

9. Lenarcic B, Krasovec M, Ritonja A et al. Inactivation of human cystatin C and kininogen by human cathepsin D. FEBS Lett. 1991;280:211-215

Claims

1. A method for determining whether a subject has or is likely to develop multiple sclerosis (MS) or a condition relating thereto, comprising determining in a biological sample of a subject, the ratio of the level of a cystatin C protein fragment lacking about 8 amino acids at its C-terminus to the level of cystatin C protein, wherein a significant increase in the ratio indicates that the subject has or is likely to develop MS or a condition relating thereto.

2. The method of claim 1, wherein cystatin C protein lacking about 8 amino acids at its C-terminus consists essentially of the amino acid sequence SEQ ID NO: 2.

3. The method of claim 1, wherein the biological sample is cerebrospinal fluid (CSF).

4. The method of claim 1, comprising

(a) obtaining CSF from a subject;

(b) determining the level of a cystatin C protein fragment lacking about 8 amino acids at its C-terminus;

(c) determining the level of a cystatin C protein that does not lack about 8 amino acids at its C-terminus; and

(d) establishing a ratio of the level determined in (b) to the level determined in (c).

5. The method of claim 1, wherein the method comprises

(a) contacting the biological sample or a portion thereof with an antibody that binds specifically to a cystatin C protein and to the cystatin C protein fragment to thereby obtain cystatin C and cystatin C protein fragment antibody complexes;

(b) isolating cystatin C and cystatin C protein fragment antibody complexes from the biological sample, to thereby obtain a composition enriched in cystatin C and cystatin C protein fragment;

(c) subjecting the composition enriched in cystatin C and cystatin C protein fragment to a size separation process, to thereby obtain a level of cystatin C protein and a level of cystatin C protein fragment; and

(d) determining the ratio of the level of cystatin C protein fragment to the level of cystatin C protein.

6. The method of claim 5, wherein the size separation process is a chromatography.

7. The method of claim 1, wherein the method comprises subject the biological sample to mass spectroscopy and comparing the size of the peaks corresponding to the cystatin C protein fragment and the cystatin C protein.

8. The method of claim 7, wherein the mass spectroscopy is SELDI time of flight mass spectroscopy.

9. A method for determining whether a subject has or is likely to develop MS or a condition relating thereto, comprising determining in a biological sample of a subject, the level of a cystatin C protein fragment lacking about 8 amino acids at its C-terminus, wherein a significant increase in the level indicates that the subject has or is likely to develop MS or a condition relating thereto.

10. The method of claim 9, comprising

(a) contacting the biological sample or a portion thereof with an antibody that binds specifically to the cystatin C protein fragment to thereby obtain cystatin C protein fragment antibody complexes;

(b) isolating cystatin C protein fragment antibody complexes from the biological sample, to thereby obtain a composition enriched in cystatin C protein fragment;

(c) subjecting the composition enriched in cystatin C protein fragment to a size separation process, to thereby obtain a level of cystatin C protein fragment.

11. A method for determining whether a subject has or is likely to develop MS or a condition relating thereto, comprising determining in a biological sample of a subject the level of one or more biomarkers identified in Table 2 or Table 4, wherein a different level of one or more biomarkers relative to the level in a control, indicates that the subject has or is likely to develop MS or a condition relating thereto.

12. The method of claim 11, wherein the biomarker corresponds to the 3.9kDa or 12.5kDa peak in Table 2, and a higher level of the biomarker indicates that the subject has or is likely to develop MS or a condition relating thereto.

13. The method of claim 11, wherein the biomarker corresponds to the 13.6kDa peak in Table 2, and a higher level of the biomarker indicates that the subject has or is likely to develop MS or a condition relating thereto.

14. An isolated protein comprising an amino acid sequence that is at least about 95% identical to SEQ ID NO: 2, wherein the protein does not comprise the last 8 amino acids of full-length cystatin C.

15. The isolated protein of claim 14, comprising an amino acid sequence that is identical to SEQ ID NO: 2.

16. The isolated protein of claim 14, comprising an amino acid sequence consisting essentially of SEQ ID NO: 2.

17. An isolated nucleic acid encoding the protein of claim 14.

18. An isolated nucleic acid comprising a nucleotide sequence that is at least about 95% identical to SEQ ID NO: 1, wherein the nucleic acid does not encode a protein comprising the last 8 amino acids of full-length cystatin C.

19. The isolated nucleic acid of claim 18, comprising a nucleotide sequence that is identical to SEQ ID NO: 1.

20. The isolated nucleic acid of claim 18, comprising a nucleotide sequence consisting essentially of SEQ ID NO: 1.

21. An isolated antibody that binds specifically to a cystatin C protein fragment lacking about 8 amino acids at its C-terminus and does not bind significantly to a full-length cystatin C protein.

22. An isolated antibody that binds specifically to a cystatin C protein fragment consisting of the C-terminal 8 amino acids of cystatin C and does not bind significantly to a full length cystatin C protein.

23. A kit comprising an antibody that binds specifically to a cystatin C protein and a reagent for use in the assay of claim 1.

24. A kit comprising an antibody that binds specifically to a cystatin C protein and one or more comparative values to which the results of an assay using the antibody can be compared.

25. A method of treating or preventing MS or a condition relating thereto in a subject, comprising administering to a subject in need thereof a therapeutically effective amount of an agent that decreases cathepsin activity.

26. The method of claim 25, wherein cathepsin is cathepsin B.

27. The method of claim 25, wherein the agent inhibits the activity of cystatin C.

28. The method of claim 27, wherein the agent inhibits the proteolytic cleavage of the last 8 amino acids of cystatin C.

29. The method of claim 1, wherein a ratio of at least about 2 indicates that the subject has or is likely to develop MS or a condition relating thereto.

30. The method of claim 9, wherein a difference in the level relative to a standard of at least about 2-fold indicates that the subject has or is likely to develop MS or a condition relating thereto.