WO2008045576A2 - Compositions and methods of rnai therapeutics for treatment of cancer and other neovascularization diseases - Google Patents

Abstract

The invention relates to oligonucleotide compositions for use in reducing the expression and activity of VEGF pathway genes and unwanted neovascularization, including tumor angiogenesis, by RNA interference and methods and compositions comprising the oligonucleotides.

Description

Compositions and Methods of RNAi Therapeutics for Treatment of Cancer and Other Neovascularization Diseases

Cross-reference to related applications

This application claims priority under 35 U.S.C.§ 119(e) from United States provisisional application 60/851,647, filed October 12, 2006, United States Provisional application 60/853,274, filed October 19, 2006, and United States provisional application 60/927,744, filed May 4, 2007.

Field of the Invention

The present invention is in the field of molecular biology and medicine and relates to interfering RNA (RNAi) compositions and methods of using them to reduce the expression of VEGF pathway genes in vitro and in vivo to treat conditions and diseases with unwanted neovascularization.

Background of the Invention

The invention provides compositions and methods for treatments of diseases with unwanted neovascularization (NV), often an abnormal or excessive proliferation and growth of blood vessels. The development of NV itself often times has adverse consequences or it can be an early pathological step in disease. Despite introduction of new therapeutic antagonists of angiogenesis including antagonists of the VEGF pathway, treatment options for controlling NV are inadequate and a large and growing unmet clinical need remains for effective treatments of NV, either to inhibit disease progression or to reverse unwanted angiogenesis. Since NV also can be a normal biological process, inhibition of unwanted NV is preferably accomplished with selectivity for a pathological tissue, which preferably requires selective delivery of therapeutic molecules to the pathological tissue. The present invention overcomes this hurdle by providing treatments to control NV through selective inhibition of pro- angiogenic biochemical pathways including inhibition of VEGF pathway gene expression and inhibition localized at pathological NV tissues. The present invention provides compositions and methods for using a tissue targeted nanoparticle composition comprising polymer conjugates and further comprising nucleic acid molecules that induce RNA interference (RNAi). The present invention provides compositions and methods for inhibition of individual or combinations of genes active in NV and more preferably in the VEGF pathway. The dsRNA nanoparticle compositions of the invention can be used alone or in combination with other therapeutic agents including targeted therapeutics including VEGF pathway antagonists, such as monoclonal antibodies and small molecule inhibitors, and targeted therapeutics inhibiting EGF and its receptor or PDGF and its receptors or MEK or Bcr-Abl, and immunotherapy and chemotherapy. The present invention also provides compositions and methods for the treatment of NV disease in a subject, including cancer, ocular disease, arthritis, and inflammatory diseases.

Recent US FDA approved therapeutic agents, including Avastin,and Macugen, provide some benefit for NV diseases. Some of these agents act by binding to and inhibiting the action of Vascular Endothelial Growth Factor (VEGF), but these agents are not effective for many patients. Other agents being evaluated in clinical studies show signs they may provide some benefit by binding to and inhibiting the action of the receptors for VEGF, or "down stream" proteins used by these receptors for signal transduction. The picture that has emerged is that means to control this VEGF "pathway" can provide a level of control of NV that provides benefit from some patients. In addition, studies of a series of small molecule kinase inhibitors found that one with multi-targeting, called sunitinib, with activity toward multiple kinase proteins, VEGF receptor, PDGF receptor, FLT3, and Kit, offers better clinical benefit for NV diseases. However, these benefits are still inadequate for most patients and better therapeutic means to control the VEGF pathway still are needed. The agents developed to date are mostly antagonists of VEGF or its receptors, VEGF Rl and VEGF R2. One problem that has emerged with use of antagonists appears to be a response by the pathological tissues to increase production of VEGF. Thus an attractive means to improve therapeutic control of NV is to inhibit production of the VEGF pathway proteins, i.e. down regulate their gene expression, and doing so by inducing RNA interference through in vivo delivery of small interfering dsRNA oligonucleotides (siRNA).

RNA interference (RNAi) is a post-transcriptional process where a double stranded RNA inhibits gene expression in a sequence specific fashion. The RNAi process occurs in at least two steps: During one step, a long dsRNA is cleaved by an endogenous ribonuclease into shorter, 21- or 23-nucleotide-long dsRNAs. In another second step, the smaller dsRNA mediates the degradation of an mRNA molecule with a matching sequence and as a result selectively down regulates expression of that gene. This RNAi effect can be achieved by introduction of either longer double- stranded RNA (dsRNA) or shorter small interfering RNA (siRNA) to the target sequence within cells. Recently, it was demonstrated that RNAi can also be achieved by introducing a plasmid that generate dsRNA complementary to target gene.

It is apparent, therefore, that improved methods for delivering RNAi molecules in vivo are of great importance. It is also apparent that tissue targeted delivery of nucleic acid molecules inducing RNAi are of great importance. It is also apparent that methods for delivering nucleic acid molecules inducing RNAi selective for VEGF pathway genes will be of great benefit for the treatment of NV diseases. These needs are addressed by the compositions and methods of the invention.

Summary of the Invention

It is therefore an object of present invention to provide oligonucleotides for use in inducing RNAi to modulate the angiogenesis process and/or to reverse the disease process by down regulating gene expression involved in NV pathogenesis, more specifically genes in the VEGF pathway.

It is therefore an object of the invention to provide compositions and methods for inhibiting expression of one or more VEGF pathway genes in a mammal. It is a further object of the invention to provide compositions and methods for treating NV disease by inhibiting expression of one or more VEGF pathway genes alone or in combination with other agents including antagonists of the same VEGF pathway.

In achieving these objects the invention provides compositions and methods for down regulating endogenous VEGF pathway genes, comprising administering to a tissue of the mammal a composition comprising a double-stranded RNA molecule wherein the RNA molecule specifically reduces or inhibits expression of an endogenous VEGF pathway gene. This down regulation of an endogenous gene may be used for treating a disease that is caused or exacerbated by activity of the VEGF pathway. The disease may be in a human.

Also provided are methods for treating a disease in a mammal associated with undesirable expression of a VEGF pathway gene, comprising administering a nucleic acid composition comprising a dsRNA oligonucleotide, as the active pharmaceutical ingredient (API), associated with a formulation, wherein the formulation can be comprised of a polymer, where the nucleic acid composition is capable of reducing expression of the VEGF pathway genes and inhibiting NV in the disease. The disease may be cancer or a precancerous growth and the tissue may be, for example, a kidney tissue, breast tissue, colon tissue, a prostate tissue, a lung tissue or an ovarian tissue.

As used herein, "oligonucleotides" and similar terms based on this relate to short oligos composed of naturally occurring nucleotides as well as to oligos composed of non-naturally occurring synthetic or modified nucleotides. Oligonucleotides may be 10 or more nucleotides in length, or 15, or 16, or 17, or 18, or 19, or 20 or more nucleotides in length, or 21, or 22, or 23, or 24 or more nucleotides in length, or 25, or 26, or 27, or 28 or 29, or 30 or more nucleotides in length, 35 or more, 40 or more, 45 or more, up to about 50, nucleotides in length.

An oligonucleotide that is an siRNA may have any number of nucleotides between 15 and 30 nucleotides. In many embodiments an siRNA may have any number of nucleotides between 19 and 27 nucleotides.

In many embodiments, an siRNA may have two blunt ends, or two sticky ends, or one blunt end with one sticky end. The over hang nucleotides of a sticky end can range from one to four or more.

In a preferred embodiment, the invention provides siRNA of 25 base pairs with blunt ends.

Any of the methods of the invention may be carried out using any of the active pharmaceutical ingredient (API) of the invention or any of the compositions provided herein for inhibiting or reducing expression of one or more VEGF pathway genes. In one embodiment, the API or composition for inhibiting or reducing expression of one or more VEGF pathway genes comprises at least one siRNA that inhibits or reduces expression of VEGF. In another embodiment the API or composition for inhibiting or reducing expression of one or more VEGF pathway genes comprises at least one siRNA that inhibits or reduces expression of VEGFRl . In yet another embodiment the API or composition for inhibiting or reducing expression of one or more VEGF pathway genes comprises at least one siRNA that inhibits or reduces expression of VEGFR2. In a further embodiment the API or composition for inhibiting or reducing expression of one or more VEGF pathway genes comprises at least one siRNA that inhibits or reduces expression of VEGF and at least one siRNA that inhibits or reduces expression of VEGFRl . In another embodiment the API or composition for inhibiting or reducing expression of one or more VEGF pathway genes comprises at least one siRNA that inhibits or reduces expression of VEGF and at least one siRNA that inhibits or reduces expression of VEGF and at least one siRNA that inhibits or reduces expression of VEGFR2. In another embodiment the API or composition for inhibiting or reducing expression of one or more VEGF pathway genes comprises at least one siRNA that inhibits or reduces expression of VEGFRl and at least one siRNA that inhibits expression of VEGFR2. In one embodiment the API or composition for inhibiting or reducing expression of one or more VEGF pathway genes comprises at least one siRNA that inhibits or reduces expression of VEGF, at least one siRNA that inhibits or reduces expression of VEGFRl and at least one siRNA that inhibits or reduces expression of VEGFR2. In all of the above API or composition for inhibiting or reducing expression of one or more VEGF pathway genes the siRNA that inhibits or reduces expression of VEGF, VEGFRl or VEGFR2 may be any of the siRNA listed herein.

In one embodiment the active pharmaceutical ingredient (API) or composition for inhibiting or reducing expression of one or more VEGF pathway genes comprises at least one siRNA selected from any of the siRNAs listed herein In another embodiment the API or composition for inhibiting or reducing expression of one or more VEGF pathway genes comprises at least two siRNAs selected from any of the siRNAs listed herein. In yet another embodiment the API or composition for inhibiting or reducing expression of one or more VEGF pathway genes comprises at least three siRNAs selected from any of the siRNAs listed herein.

The composition may further comprise a polymeric carrier. The polymeric carrier may comprise a cationic polymer that binds to the RNA molecule and forms nanoparticles. The cationic polymer may be an amino acid copolymer, containing, for example, histidine and lysine residues. The polymer may comprise a branched polymer. The composition may comprise a targeted synthetic vector. The synthetic vector may comprise a cationic polymer as a nucleic acid carrier, a hydrophilic polymer as a steric protective material, and a targeting ligand as a target cell selective agent. The cationic polymer may comprise a polyethyleneimine or a polyhistidine- lysine copolymer or a polylysine modified chemically or other effective polycationic carriers that can be used as the nucleic acid carrier module,. The hydrophilic polymer may comprise a polyethylene glycol or a polyacetal or a polyoxazoline and the targeting ligand may comprise a peptide comprising an RGD sequence or a sugar or a sugar analogue or an mAb or a fragment of an mAb, or any other effective targeting moieties.

In any of these methods, an electric field may be applied to a tissue substantially contemporaneously with the composition or subsequent to application of the composition.

The composition and method of the invention comprises dsRNA oligonucleotides with a sequence that is identical, substantially identical, homologous or substantially homologous to a portion of a VEGF pathway gene. Said gene can be the wildtype gene or a mutated gene. In the case of the mutated gene at least one mutation in the mutated gene may be in a coding or regulatory region of the gene. In any of these methods, the endogenous gene may be selected from the group consisting of VEGF pathway genes including growth factor genes, protein serine/threonine kinase genes, protein tyrosine kinase genes, protein serine/threonine phosphatase genes, protein tyrosine phosphatase genes, receptor genes, and transcription factor genes. The selected gene may include one or more genes from the group consisting of VEGF, VEGF-Rl, VEGF-R2, VEGF-R3, VEGF121, VEGF165, VEGF189, VEGF206, RAF-a, RAF-c, AKT, Ras, NF-Kb., The selected gene may include one or more genes from other biochemical pathways associated with NV including HIF, EGF, EGFr, bFGF, bFGFr, PDGF, and PDGFr. The selected gene may include one or more genes from other biochemical pathways operative in concert with NV including Her-2, c-Met, c-Myc and HGF.

The present invention also provides compositions and methods comprising nucleic acid agents that induce RNAi for inhibiting multiple genes, including cocktails of siRNA (siRNA-OC). The compositions and methods of the invention may inhibit multiple genes substantially contemporaneously or they may inhibit multiple genes sequentially. In a preferred embodiment, siRNA-OC agents inhibit three VEGF pathway genes: VEGF, VEGF receptor 1, and VEGF receptor 2. In another preferred embodiment, siRNA-OC are administered substantially contemporaneously. The present invention provides agents with gene inhibition selectivity derived from matching the sequence of the siRNA largely to a sequence in the targeted gene mRNA. It also provides siRNA agents with substantially similar physiochemical properties that inhibit different genes in the VEGF pathway. It also provides nanoparticle compositions largely independent of the siRNA sequence. It also provides methods for treatment of human diseases, especially NV related diseases, which can be treated with inhibitors of multiple endogenous genes. It also provides methods for treatment of human diseases by combinations of therapeutic agents administered substantially contemporaneously in some cases and sequentially in other cases.

One aspect of the present invention provides compositions and methods for treatment of cancer, arthritis, blindness, infectious diseases and inflammatory diseases. In another aspect of the present invention, nucleic acid agents inducing RNAi are used in concert with other therapeutic agents, such as but not limited to small molecules and monoclonal antibodies (mAb), in the same therapeutic regimen.

Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.

Brief Description of Drawings

^■ Figure 1 shows photographs of 786-0 (human renal cell carcinoma cells) Matrigel plugs removed from mice after experimental treatment with VEGF pathway siRNA- containing nanoparticles.

Figure 2 shows photographs of LS174T (human colon cancer cells) Matrigel plugs removed from mice after experimental treatment with VEGF pathway siRNA- containing nanoparticles.

Figure 3 is a series of bar graphs depicting the effect of VEGF pathway siRNA- containing nanoparticle treatment on tumor induced angiogenesis, measured and shown as blood vessel density (vessel length, vessel node number and vessel end number) in 786-O human tumor cell Matrigel plugs. Treatment groups are described in Table 2 and Figure 1.

Figure 4 is a series of bar graphs depicting the effect of VEGF pathway siRNA- containing nanoparticle treatment on tumor induced angiogenesis, measured and shown as blood vessel density (vessel length, vessel node number and vessel end number) in LS174T human tumor cell Matrigel plugs. Treatment groups are described in Table 3 and Figure 2.

Figure δ.Human VEGF-siRNA (25 basepair blunt end) is more effective for silencing hVEGF expression in vitro and stronger than the 19 base pair siRNA.

Figure ό.Human VEGF-siRNA (25 basepair blunt end) is effective for silencing hVEGF expression in vitro and has longer duration than that of the 19 basepair siRNA.

Figure 7. Human VEGFRl -siRNA (25 base pair blunt end) is effective for silencing hVEGFRl expression in vitro after 48 hr.

Figure 8. Human VEGFRl -siRNA (25 base pair blunt end) is effective for silencing hVEGFRl expression in vitro after 72 hr.

Figure 9. Human VEGFR2-siRNA (25 base pair blunt end) is effective for silencing hVEGFR2 expression in vitro at two different time points.

Figure 10. Self-assembled nanoparticle for siRNA delivery. When the pre-made

RGD-PEG-PEI conjugate aqueous solution is mixed with the siRNA aqueous solution, the nanoparticles will be self-assembled as described. The nanoparticles are relatively even in size, from 50 ran to 100 nm.

Figure 11. siRNA nanoparticle targeting neovasculature demonstrated tumor targeting property using labeled siRNA payload (left) and plasmid payload expressing

Luciferase reporter gene (right).

Figure 12. 25mer hVEGF-siRNAs knocked down hVEGF secretion in MCF-

7/MV165 cells

Detailed Description

The present invention provides compositions and methods for treatment of NV diseases, which typically are characterized by the involvement of multiple proteins and abnormally over-expressed disease-causing genes and mutiple malfunctions of disease-causing proteins. The present invention provides nucleic acid agents, such as siRNA oligonucleotides, that activate RNA interference (RNAi) and are highly selective inhibitors of gene expression with a sequence specific manner. The present invention provides inhibition of NV by modulation of protein activity including reduction of protein expression levels and post transcriptional modification of proteins. Small molecule inhibitors of NV disease have suggested the enhanced clinical benefit of inhibiting multiple receptors achieve better inhibition of the VEGF pathway (Sugen's SU 11248). In cancer, the tumorigenesis process is thought to be the result of abnormal over-expression of oncogenes, angiogenesis factors, growth factors, and mutant tumor suppressors, even though under-expression of other proteins also plays a critical role. Increasing evidences supports the notion that siRNA are able to "knockdown" tumorigenic genes both in vitro and in vivo, resulting in significant antitumor effects. The present invention has demonstrated substantial knockdown of human VEGF in

achieving tumor growth inhibition of 40-80%, using intratumoral delivery of siRNA specifically targeting human VEGF pathway gene sequences. It is appreciated that inhibition of VEGF pathway gene expression induced anti-angiogenesis effect alters the microvasculature in tumors and activates tumor cell apoptosis and can enhance efficacy of the cytotoxic chemotherapeutic drugs. However, to achieve significantly improved antitumor efficacy of anti-angiogenesis agents and chemotherapeutic drugs, a highly effective delivery method is necessary so that elevated concentrations of the drugs accumulate in the local tumor tissue, and in many instances through a systemic administration.

The present inventors have described a method of validating drug targets (see PCT/US02/31554). The present inventors also have described nucleic acid delivery technologies suitable for delivery into animal tissues (see WOO 1/47496, the contents of which are hereby incorporated by reference in their entirety). These methods enable administration of nucleic acids and achieve a significant (for example, sevenfold) increase in efficiency compared to "gold standard" nucleotide delivery reagents. Accordingly, the methods provide strong activity of nucleic acids in tissues including activity of candidate target proteins. This platform is a powerful tool for validation of candidate genes in a tissue.

In addition, the present inventors have used these methods to achieve gene silencing in animal tissues, which is highly desired for validation of candidate target genes and as a therapeutic modality. Recently, double stranded RNA has been demonstrated to induce gene-specific silencing by a phenomenon called RNA interference (RNAi). It has also been shown that RNAi-mediated gene silencing may be achieved in vitro in various cell types including mammalian cells. A double stranded RNA targeted against a target mRNA results in the degradation of the target, thereby causing the silencing of the corresponding gene. Large double stranded RNA is cleaved into smaller fragments of 21-23 nucleotides long by a RNase Ill-like activity involving the enzyme Dicer. These shorter fragments known as siRNA (small interfering RNA) are believed to mediate the cleavage of mRNA. Although gene down regulation by the RNAi mechanism was initially studied in C. elegans and other lower organisms, its effectiveness in mammalian cells in culture has recently been demonstrated. An RNAi effect recently was demonstrated in mice using the firefly luciferase gene reporter system. To develop an RNAi technology platform for in vivo gene inhibition for reserch and for clinical application of nucleic acid therapeutics to treat human diseases, the present inventors performed several in vivo studies in mouse models of disease. In those experiments, either siRNA or dsRNA targeting a tumor related ligand (human VEGF) or receptor (mouse VEGFR2) was delivered to nude mice bearing xenografted human MCF-7 derived tumor or human MDA-MB-435 tumors. For the first time we were able to demonstrate that RNAi can effectively silence a target gene in tumor cells in vivo and that, as a result, tumor growth was inhibited.

The present inventors have achieved for the first time therapeutic compositions and methods for treatment of a wide variety of NV diseases using dsRNA oligonucleotides inhibiting VEGF pathway genes. The invention is described here in detail, but one skilled in the art will appreciate the full extent of the invention.

A. Potent siRNA for VEGF Pathway Gene Inhibition

The present invention has discovered nucleic acid agents variety of physicochemical structures for targeting and inhibiting VEGF pathway genes. One preferred embodiment of the present invention uses nucleic acid agents called siRNA. In one embodiment the siRNA is a 19 basepair double stranded RNA with 3' overhangs. In another embodiment the siRNA is a 25 basepair double stranded RNA with blunt ends. The siRNA of the invention with 25 basepair double stranded RNA with blunt ends were found to be some of the most potent inhibitors with some of the greatest duration of inhibition. Additionally, incorporation of non-naturally occurring chemical analogues are useful in the invention, including 2'-O-Methyl ribose analogues of RNA, DNA and RNA chimeric oligonucleotides, and other chemical analogues of nucleic acid oligonucleotides. The 25 basepair siRNA with and without 2'-O-Methyl ribose in the sense strand of the siRNA and targeting human VEGF sequence provided a strong and durable inhibitory effect, up to 70-80% in MCF- 7/VEGF 165 cells and in tumors growing in animals. This inhibitory effect in MCF- 7/VEGF165 cell culture lasted for at least 5 days. One aspect provided for by the invention is siRNA targeting human genes and the encoded sequence also targets other mammalian species such as other primates, mice, and rats but not limited to these species.

a. Human VEGF specific siRNA:

25 basepairs blunt ends: hVEGF-25-siRNA-a:

Sense strand: 5 '-r(CCUGAUGAGAUCGAGUAC AUCUUC A)-3'

Antisense strand: 5'-r(UGAAGAUGUACUCGAUCUCAUCAGG)-3'.

hVEGF-25-siRNA-b:

Sense strand: 5'-r(GAGAGAUGAGCUUCCUACAGCACAA)-3'

Antisense strand : 5 ' -r(UUGUGCUGUAGGAAGCUC AUCUCUC)-3 ' .

hVEGF-25-siRNA-c:

Sense Strand: 5'-r(CACAACAAAUGUGAAUGCAGACCAA)-3'

Antisense strand: 5'-r(UUGGUCUGCAUUCACAUUUGUUGUG)-3'

19 basepairs with two nucleotide overhangs at 3': hVEGF165 5'-r (UCGAGACCCUGGUGGACAUTT) -3'

b. Human VEGF receptor 1 specific siRNA:

25 basepairs blunt ends: hVEGFRl-25-siRNA-a,

Sense strand: 5'-r(GCCAACAUAUUCUACAGUGUUCUUA)-3'

Antisense strand: 5 '-r(UAAGAACACUGUAGAAUAUGUUGGC ) -3 '

hVEGFRl -25-siRNA-b,

Sense strand: 5 '-r(CCCUCGCCGGAAGUUGUAUGGUUAA)-3 '

Antisense strand: 5 '- r(UUAACCAUACAACUUCCGGCGAGGG)-3 ' .

19 basepairs with 2 3' nucleotide overhangs:

VEGF Rl (FLT) 5'-GGAGAGGACCUGAAACUGUTT c. Human VEGF receptor 2 specific siRNA: 25 basepairs blunt ends: hVEGFR2-25-siRNA-a,

Sense strand: 5 ' - r ( CCUCUUCUGUAAGACACUCACAAUU ) -3 '

Antisense strand: 5 ' - r ( AAUUGUGAGUGUCUUACAGAAGAGG ) -3 ' .

hVEGFR2-25-siRNA-b,

Sense strand: 5'-r (CCCUUGAGUCCAAUCACACAAUUAA) -3'

Antisense strand: 5'-r (UUAAUUGUGUGAUUGGACUCAAGGG) -3'.

hVEGFR2-25-siRNA-c,

Sense strand: 5'-r ( CCAAGUGAUUGAAGCAGAUGCCUUU ) -3 '

Antisense strand: 5'- r ( AAAGGCAUCUGCUUCAAUCACUUGG ) -3 '

19 basepairs with 2 3' nucleotide overhangs: hVEGF R2 (KDR) 5'-CAGUAAGCGAAAGAGCCGGTT-S '

B. Combined VEGF Pathway Gene Inhibition

The compositions and methods of present invention for inhibition of NV is based on several fundamental aspects. First, NV diseases are complex and the result of multiple proteins and abnormally over-expressed disease-causing genes and mutiple malfunctions of disease-causing proteins. Second, nucleic acid agents that activate RNA interference (RNAi) are highly selective inhibitors of gene expression in a sequence specific manner. Third, inhibition of NV by modulation of protein activity can be operative by many methods, including but not limited to an inhibition of protein function (antagonists), stimulation of protein function (agonists), reduction of protein expression levels, and post transcriptional modification of proteins. Importantly, it may be desirable in the treatment of disease to effectively shut down a particular biological pathway that is critical for disease progression, by simultaneously blocking functions of ligands and their receptors, simultaneously blocking receptor activity and the activity of down stream signaling proteins, and/or simultaneously blocking redundant elements of a pathway. Such methods may be used for treating NV disease including those that involve the VEGF pathway.

However, identification of a single agent selective for two or three or more proteins is difficult and oftentimes impractical, if not impossible. To overcome this difficulty, the combining of drugs has been common practice for years, with the combination of three or more drugs in one treatment regimen becoming a new trend of modern medicine. In oncology applications, combined chemotherapies have achieved remarkable anti-cancer efficacy. One example is the use of docetaxel, ifosfamide and cisplatin combination therapy for treatment of oropharyngeal cancer with multiple bone metastases from prostate cancer (2). Another example is the treatment of ulcerative colitis with combination of Corticosteroids, Metronidazole and Vancomycin (3). For treatment of insufficiently controlled type 2 diabetes, the efficacy and safety of adding rosiglitazone to a combination of glimepiride and metformin therapy were evaluated (4). Although those clinical studies have demonstrated remarkable therapeutic efficacies, the toxicities of higher dosage and long time safeties are always the major concerns, due to their different sources of origins, different manufacturing processes and different chemistry properties.

To overcome these problems, an aspect of the present invention is using siRNA oligonucleotide gene inhibitors to provide a unique advantage, i.e., to achieve combination effects with a combination of siRNA that target multiple disease causing genes in the same treatment. One advantage provided by the present invention is that all siRNA oligonucleotides are very similar chemically, pharmacologically, and can be from the same source of origin and same manufacturing process. Another advantage provided by the present invention is that multiple siRNA oligonucleotides can be formulated in a single preparation such as a nanoparticle preparation.

Therefore, an aspect of the present invention is to combine siRNA agents so as to achieve specific and selective inhibition of multiple VEGF pathway genes and as a result achieve a inhibition of NV disease and a better clinical benefit. The present invention provides for many combinations of siRNA targets including combinations of two or more targets selected from: VEGF and its receptors including VEGF Rl (Fltl) and VEGF R2 (KDR), parallel growth factors including PDGF and EGF and their receptors, down stream signaling factors including RAF and AKT, and transcription factors including NFKB, and their combination. In one embodiment a combination of siRNA inhibiting VEGF and two of its receptors VEGF Rl (Fltl) and VEGF R2 (KDR) is used. Another embodiment is a combination of siRNA inhibiting VEGF and its receptors, PDGF and its receptors, and EGF and its receptors. Yet another embodiement is a combination of siRNA inhibiting VEGF and its receptors and down stream signaling.

The dsRNA oligonucleotides can be combined for a therapeutic for the treatment of NV disease, In one embodiement of the present invention they can be mixed together as a cocktail and in another embodiement they can be administered sequentially by the same route or by different routes and formulations and in yet another embodiement some can be administered as a cocktail and some administered sequentially. Other combinations of siRNA and methods for their combination will be understood by one skilled in the art to achieve treatment of NV diseases.

C. Combined VEGF Pathway Antagonist and Gene Inhibition

Disease is complicated and often involves multiple pathological processes as well as variations in severity of disease symptoms and often variations from one patient to another. Many diseases are caused by abnormal over expressions of disease causing or disease control genes, or from foreign infectious organisms, or both. The disease progression and development of reduced response to treatments and drug resistance also limit clinical benefit of a single treatment or modality. One means to overcome such limitations is through use of combinations of treatments and drugs.

The combination of two drugs has been common practice for years, and the combination of three or more drugs in one treatment regimen is becoming a new trend of modern medicine. In the oncology applications, the combined chemotherapies have achieved remarkable anti-cancer efficacy. One example is the use of docetaxel, ifosfamide and cisplatin combination therapy for treatment of oropharyngeal cancer with multiple bone metastases from prostate cancer (2). Another example is the treatment of ulcerative colitis with combination of Corticosteroids, Metronidazole and Vancomycin (3). For treatment of insufficiently controlled type 2 diabetes, the efficacy and safety of adding rosiglitazone to a combination of glimepiride and metformin therapy were evaluated (4).

Therefore, an aspect of the present invention is to combine siRNA agents with other agents so as to achieve a strong, durable, and robust inhibition of NV disease and a better clinical benefit. The present invention provides for many combinations of siRNA agents and other agents including combinations of therapeutic siRNA for VEGF and its receptors with antagonists of VEGF and its receptors (such as Avastin). The present invention also provides for combinations of therapeutic siRNA agents with kinase inhibitors, e.g., orally available kinase inhibitors (such as SUl 1248). The present invention also provides for combinations of therapeutic siRNA agents with immunotherapy. Yet another embodiment of the present invention is to combine siRNA with antiproliferative agents. Other combinations of siRNA agents and other agents will be understood by one skilled in the art to achieve treatment of NV diseases.

D. Formulation and Administration

Recent efforts towards developing tissue targetable nucleic acid delivery systems based on synthetic reagents have produced promising results To be robust, effective delivery systems should have multiple levels of selectivity, i.e. selective localization at the disease tissue and selective inhibition of biochemical pathways driving the pathology. Moreover, the most effective therapies require "multi- targeted" therapeutics, i.e. designer "dirty" drugs with multiple mechanisms of activity, blocking redundant pathological pathways. What we need are "smart" nanoparticles that will simultaneously target disease and deliver nucleic acid agents into the target cells and into the correct subcellular compartment.

In one embodiement, the present invention provides for formulations for siRNA dsRNA oligonucleotides that comprise tissue-targetable delivery with three properties. These are nucleic acid binding into a core that can release the siRNA into the cytoplasm, protection from non-specific interactions, and tissue targeting that provides cell uptake. No one material has all of these required properties in one molecule. The invention provides for compositions and methods that use modular conjugates of three materials to combine and assemble the multiple properties required. They can be designed and synthesized to incorporate various properties and then mixed with the siRNA payload to form the nanoparticles. Based on these embodiements, a preferred embodiement comprises a modular polymer conjugate targeting neovasculature by coupling a peptide ligand specific for those cells to one end of a protective polymer, coupled at its other end to a cationic carrier for nucleic acids. This polymer conjugate has three functional domains, sometimes referred to as a tri-functional polymer (TFP). The modular design of this conjugate allows replacement and optimization of each component separately. An alternative approach has been to attach surface coatings onto preformed nanoparticles. Adsorption of a steric polymer coating onto polymers is self-limiting; once a steric layer begins to form it will impede further addition of polymer. The compositions and methods of the invention permit an efficient method for optimization of each of the three functions, largely independent of the other two functions.

Formation of Nucleic Acid Core Particle

Delivery agents for nucleic acids must assist their gaining access to the interior of cells and in a manner such that they can exert their biological activity. Efforts to address this challenge for nucleic acid therapeutics with synthetic materials include use of simple cationic lipid and polymer complexes developed as in vitro DNA transfection reagents. It was quickly found that both getting nucleic acids into cells and obtaining biological activity is extremely difficult. For example, achieving a stable nucleic acid package for transport is possible but not always easy to reconcile with the need to release the nucleic acid into the nucleus, or in the case of siRNA into the cytoplasm. Also, a large number of cationic lipids and polymers effective in vitro do not retain activity when administered in vivo, unfortunately for reasons still largely unknown, providing little predictive value for developing complexes active in vivo. Interest in studies with RNA have lagged far behind, until now with the recent eruption of interest in siRNA. Nonetheless, lung tissue can often be transfected from an intravenous administration of DNA complexes. Similar biological activity has been observed when siRNA has been used as the payload.

Recent studies have identified one class of cationic polymers composed of defined polypeptide structures that appear to have broad capabilities. A large number of members of this class can be synthesized with defined structures covering linear and branched forms and have been found to offer biological activity both in vitro and in vivo. They have been shown to have activity with several types of nucleic acids, including plasmids and DNA or RNA oligonucleotides. The success with this class of cationic polymer appears to result from design allowing specific structures, including branching, and using a mixture of hard and weak bases to form a polymer with mixed cationic properties. Another advantage of this particular class is its biodegradable nature, being constructed entirely from natural amino acids, albeit non-natural branching. Protective Steric Coating

Even liposomes with an external lipid bilayer resembling the outer cellular membrane are rapidly recognized and cleared from blood. Nanotechnology offers a broad range of synthetic polymer chemistry. Hydrophilic polymers, such as PEG and polyacetals and polyoxazolines, have proven effective to form a "steric" protective layer on the surface of colloidal drug delivery systems whether liposomes, polymer or electrostatic nanoparticles, reducing immune clearance from blood. The use of this steric PEG layer was first developed and most extensively studied with sterically stabilized liposomes. The present invention provides for alternative approaches, such as chemical reduction of surface charge, in addition to a steric polymer coating.

The steric barrier and biological consequences appear to derive from physical, not chemical, properties. Several other hydrophilic polymers have been reported as alternatives to PEG. Physical studies on sterically stabilized liposomes have provided a strong mechanistic underpinning for physical behavior of the polymer layer and can be used to achieve similar coatings on other types of particles. However, while physical studies have shown formation of a similar polymer layer on the surface of polymer complexes with nucleic acids, and achievement of similar biological properties, we lack sufficient information today to use of the physical properties to accurately predict the desired biological properties, protection from immune clearance from blood. Liposome studies indicate that physical properties with the greatest impact on biological activity can be obtained by synthesis of a matrix of conjugates varying size of the two polymers and the grafting density. Note that while the surface steric layer function is due to physical properties, the optimal conjugation chemistry still depends on the specific chemical nature of the steric polymer and the carrier to which it is coupled.

Methods for formation of the nanoparticles with the surface steric polymer layer are also an important parameter. One embodiment the steric polymer is coupled to the carrier polymer to give a conjugate that self-assembles with the nucleic acid forming a nanoparticle with the steric polymer surface layer. In another embodiment surface coatings are attached onto preformed nanoparticles. In self-assembly, formation of the surface steric layer depends on interactions of the carrier polymer with the payload, not on penetration through a forming steric layer to react with the particle surface. In this case, effects of the steric polymer on the ability of the carrier polymer to bind the nucleic acid payload may have adverse effects on particle formation, and thus the surface steric layer. If this occurs, the grafting density of the steric polymer on the carrier will have exceeded its maximum, or the structural nature of the grafting is not adequate.

Surface Exposed Ligands Targeting Specific Tissues

The ability of the nanoparticle to selectively reach the interior of the target cells resides in its ability to induce a specific receptor mediated uptake. This is provided in the present invention by exposed ligands which provide the binding specificity. While many types of ligands exist for targeting colloidal delivery systems. One such method involves coupling antibodies to the surface of liposomes, usually referred to as immunoliposomes. One important parameter that has emerged is the impact of ligand density. The extensive studies achieved good success in vitro and have begun to produce positive results in vivo, now reaching the stage of clinical development for delivery of small molecule drugs . Antibodies tend to meet many requirements for use as the ligand, including good binding selectivity and nearly routine preparation for nearly any receptor and broad applicability of protein coupling methods regardless of nanoparticle type. Monoclonal antibodies even show signs of utility to cross the blood-brain-barrier. Other proteins that are the natural ligands also have been considered for targeting nanoparticles, such as transferrin or transferrin receptor.

A preferred class of ligands are small molecular weight compounds with strong selective binding affinity for internalizing receptors. Studies have evaluated natural metabolites including vitamins such as folate and thiamine, polysaccharides such as wheat germ agglutinin or sialyl Lewis for e-selectin, and peptide binding domains such as RGD for integrins. Peptides offer a versatile class of ligand, since phage display libraries can be used to screen for natural or unnatural sequences, even with in vivo panning methods. Such phage display methods can permit retention of an unpaired Cys residue at one end for ease of coupling regardless of sequence. Use of an RGD peptide for targeted delivery of nanoparticles to neo vasculature can be very effective to meet the major requirements for effective ligands: specific chemistry that doesn't interfere in ligand binding or induce immune clearance yet enables selective receptor mediated uptake at the target cells.

The compositions and methods of the present invention provide for administration of RNAi comprising polymers, polymer conjugates, lipids, micelles, self-assembly colloids, nanoparticles, sterically stablized nanoparticles, or ligand- directed nanoparticles. Targeted synthetic vectors of the type described in WOO 1/49324, which is hereby incorporated by reference in its entirety, may be used for systemic delivery of nucleic acids of the present invention inducing RNAi. hi one embodiment, a PEI-PEG-RGD (polyethyleneimine-polyethylene glycol-argine- glycine-aspartic acid) synthetic vector can be prepared and used, for example as in Examples 53 and 56 of WO01/49324. This vector was used to deliver RNAi systemically via intravenous injection. Other targeted synthetic vector molecules known in the art may also be used. For example, the vector may have an inner shell made up of a core complex comprising the RNAi and at least one complex forming reagent. The vector also may contain a fusogenic moiety, which may comprise a shell that is anchored to the core complex, or may be incorporated directly into the core complex. The vector may further have an outer shell moiety that stabilizes the vector and reduces nonspecific binding to proteins and cells. The outer shell moiety may comprise a hydrophilic polymer, and/or may be anchored to the fusogenic moiety. The outer shell moiety may be anchored to the core complex. The vector may contain a targeting moiety that enhances binding of the vector to a target tissue and cell population. Suitable targeting moieties are known in the art and are described in detail in WOOl/49324. a. Preparation of RGD-targeted nanoparticles containing VEGF pathway siRNA:

One embodiment of the present invention provides compositions and methods for RGD-mediated ligand-directed nanoparticle preparations of anti- VEGF pathway siRNA short double stranded RNA molecules. In one method for the manufacture of RGD-mediated tissue targeted nanoparticles containing siRNA, the targeting ligand, an RGD containing peptide (ACRGDMFGCA) is conjugated to a steric polymer such as polyethylene glycol, or other polymers with similar properties (see PCT/US2006/013645 incorporated herein in its entirety). This ligand-steric polymer conjugate is further conjugated to a polycation such as polyethyleneimine or other effective material such as a histidine-lysine copolymer. The conjugation can be by covalent or non-covalent bonds and the covalent bonds can be non-cleavable or they can be cleavable such as by hydrolysis or by reducing agents. A solution comprising the polymer conjugate, or comprising a mixture of a polymer conjugate with other polymer, lipid, or micelle such as materials comprising a ligand or a steric polymer or fusogen, is mixed with a solution comprising the nucleic acid, in one embodiement an siRNA targeted against specific genes of interest, in desirable ratios to obtain nanoparticles that contain siRNA.

In this embodiment, nanoparticles are formed by layered nanoparticle self- assembly comprising mixing the polymer conjugate and the nucleic acid. Non- covalent electrostatic interactions between the negatively charged nucleic acid and the positively charged segment of the polymer conjugate drive the self-assembly process that leads to formation of nanoparticles. This process involves simple mixing of two solutions where one of the solutions containing the nucleic acid is added to another solution containing the polymer conjugate followed by or concurrently with stirring. In one embodiment, the ratio between the positively charged components and the negatively charged components in the mixture is determined by appropriately adjusting the concentrations of each solution or by adjusting the volume of solution added. In another embodiment, the two solutions are mixed under continuous flow conditions using mixing apparatus such as static mixer (Figure 18). In this embodiment, two or more solutions are introduced into a static mixer at rates and pressures giving a ratio of the solutions, where the streams of solutions get mixed within the static mixer. Arrangements are possible for mixers to be arranged in parallel or in series.

E. Combined Formulation and Electric Field

For certain applications, siRNA may be administered with or without application of an electric field. This can be used, for example, to deliver the siRNA molecules of the invention via direct injections into, for example, tumor tissue and directly into or nearby an angiogenic tissue or a tissue with undesirable neovasculature. The siRNA may be in a suitable pharmaceutical carrier such as, for example, a saline solution or a buffered saline solution.

The present invention, thus generally described, will be understood more readily by reference to the following examples, which are provided by way of illustration and are not intended to be limiting of the present invention.

The invention is illustrated by the following examples but one skilled in the art will appreciate that the invention is not limited. Example 1: Effect of VEGF pathway siRNA nanoparticles on tumor-mediated angiogenesis in Matrigel plug model.

Tumor cell injection and siRNA treatment of mice

Female athymic nude mice (nu/nu) 6-8 weeks old were obtained from Charles River Laboratories and quarantined for a minimum of 7 days under Specific Pathogen Free conditions. Mice were randomized into 5 animals per cage. On day 0, mice were anesthetized with a Ketamine/xylazine mixture. The surface of the skin was cleaned with alcohol pads. Sterile Matrigel preparations containing either 1x10⁶ human 786-0 renal tumor cells or 1x10⁶ human LS174T colon tumor cells were subcutaneously injected into the right flank of the animals (one site per animal). Each animal received 0.5 ml of Matrigel solution (Wild et al., 2000, Microvascular Research 59: 368-376; Ramakrishnan et al., 1996, Cancer Res. 56: 1324-1330).

The siRNA sequences used in the following experiments are provided in Table 1. Nanoparticles containing siRNA were prepared as described in Example 53 of WO01/49324.

Table 1. siRNA sequences.

On day 2 and day 5, mice were weighed and received i.v. injections of either control formulation-containing or siRNA-containing nanoparticles (Table 2 and Table 3). Mice in Group S (Table 3) received Avastin i.p.

Table 2. siRNA treatments of mice injected with 786-O tumor cells.

Table 3. siRNA treatments of mice injected with LS174T tumor cells.

Control siRNA was directed to GFP. Cocktail- 1 consists of Mouse- VEGFRl (1 mg/kg), mouse- VEGFR2 (1 mg/kg) and human VEGF (1 mg/kg). Cocktail-2 consists of Mouse- VEGFR2 (1 mg/kg), mouse- VEGF (1 mg/kg) and human VEGF (1 mg/kg).

Tissue harvest of Matrigel plugs for data analysis

On day 8, mice were anaesthetized. Matrigel plugs were removed using sterile microsurgical instruments. Recovered samples were placed in cold, sterile Hank's balanced salt solution containing Mg++ and Ca++. Digital images of the matrigel plugs were recorded.

Each Matrigel plug was cut into two. One part of the Matrigel plug was fixed in buffered formalin and then embedded in paraffin. Three sections of 7 μm thickness were made and examined with phase contrast microscopy. The other part was snap- frozen in liquid nitrogen using OCT compound. Four frozen sections of 10 μm thickness were sectioned in a Leica cryotome and used for CD31 staining.

Histological analysis of angiogenesis

Formalin-fixed Matrigel sections were stained with hematoxylin and Eosin. Sections were examined under a phase contrast microscope. Representative photomicrographs were recorded (10OX and 200X). Infiltration of nucleated cells and vessels was recorded (Figures 1 and 2). Figures 1 and 2 show the morphology of the Matrigel plugs. The dark color represents blood vessels which formed within the Matrigel. Increased color indicates more blood vessels. The Matrigel plugs from VEGF-pathway siRNA or Avastin-treated mice showed reduced color, suggesting that these treatments may have resulted in the inhibition of tumor-induced angiogenesis.

Morphometric analysis of vessel density

Frozen Matrigel sections were incubated with monoclonal antibody reactive to mouse CD31 (a specific endothelial cell marker) conjugated to Phycoerythrin (1 :50 dilution in BSA-HBSS) for 1 hour at room temperature. Immunofluorescence images of CD31 staining were analyzed by the Skeletonization program as described by Wild et al., supra. Data were processed to provide mean vessel density, node, and length for each group. mVEGF, mVEGFRl, mVEGFR2, or hVEGF siRNA nanoparticles either as single agents or in combination as cocktails decreased vessel length, vessel node number and vessel end number in both 786-0 and LS174T tumor Matrigel plug models (Figures 3 and 4). Values from 8 - 10 independent images per sample were computed for statistical analysis by the simple t-test (one tailed/one paired). mVEGF, mVEGFRl, mVEGFR2, or hVEGF siRNA nanoparticles either as single agents or in combination as cocktails significantly decreased vessel length, vessel node number and vessel end number in both 786-0 and LS174T Matrigel plug models (p<0.05, compared to the negative control GFP siRNA).

In the 786-0 model, the p- value analysis revealed that (1) all VEGF pathway siRNA or Avastin treatments led to significant inhibition of angiogenesis; (2) compared with Cocktail- 1, mVEGFRl and hVEGF were less effective while other single siRNA treatment were as effective as Cocktail- 1; (3) compared with Cocktail- 2, all the single siRNA treatment except hVEGF siRNA were as effective as Cocktail- 2; and (4) comparison with Matrigel-only control suggested that all the treatments except Cocktail- 1 did not inhibit the angiogenesis completely. Cocktail- 1 completely blocked angiogenesis, as there was no significant difference between the Matrigel- only control and the Cocktail- 1 treated groups.

In the LS174T model, mVEGF, Cocktail- 1, Cocktail-2 and Avastin as a single agent completely blocked tumor cell-induced angiogenesis (no significant differences between the treatment groups and the Matrigel-only background, p value >0.05). The single agent (mVEGFR2 and mVEGF), Cocktail- 1 and cocktail-2 siRNA nanoparticles were as potent as Avastin in inhibiting LS174T tumor-driven angiogenesis.

Example 2. Application of Q-PCR technique on the study of RNAi efficacy of 25-mer blunt-ended siRNAs targeting both human and mouse VEGF, VEGFRl and VEGFR2

Q-PCR was used to quantify the siRNA-mediated RNA interference and to measure the efficacy of the 25-mer blunt-ended siRNAs targeting VEGF pathway gene sequences that are 100% homologous to both mouse and human. These siRNAs are advantageous because they are dual-specific.

Cell culture: SVR (mouse pancreas endothelial cell line, expressing mVEGFRl and mVEGFR2), RAW264.7 gamma NO (-) (mouse monocyte/macrophage cell line, expressing mVEGF), and HUVEC (human umbilical vein endothelial cells, expressing h VEGFRl and mVDGFR2) are cultivated and plated into 6- well plates for transfection. Cellular RNAs: Cytoplasmic RNAs from transfected cells were isolated using RNAwiz or TRI Reagent (Ambion) according to manufacturer's manual.

Reagents

1) LipofectAmine: Invitrogen, #18324-012.

2) TaqMan Real-Time reagents:

Probe/primer mixes: FAM/MGB probes specific for mVEGFA, mVEGFRl, mVEGFR2, and VIC/MGB probes specific for eukaryotic 18s rRNA and moue β- Actin (mACTB) were used. The probe/primers all were designed as "spanning exon- exon junction" to assure mRNA-specificity. Primer/probe mixes and other Q-PCR reagents (e.g. High Capacity cDNA Archive Kit, TaqMan Univ PCR Master Mix, etc.) were all purchased from Applied Biosystems.

3) 25-mer blunt-ended siRNAs were designed. The names of these siRNAs and the target sequences of interested genes(s) are listed in the table below.

25-mer Blunt-ended siRNAs Targeting VEGF Pathway Gene Sequences Homologous to Mouse and Human

mh VEGFRl -25-4, and mhVEGFR2-25-4 are specific to their target sequences (VEGFRl and VEGFR2, respectively) of mouse, rat, dog, monkey, chimpanzee, and human origins. In the transfection/Q-PCR experiments, the 25-mer blunt-ended siRNAs that demonstrated efficacy in ELISA experiments as positive inner controls were included. The sequences of these control 25-mer siRNAs are listed in the table below:

25-mer siRNAs (ELISA positive) Used As Control in Q-PCR Experiments

Methods

Cells were first transfeced by lipofection using siRNA (up to 1 μg/well) mediated by lipofectAmine (8 μl/well). Cytoplasmic RNAs were then isolated and subjected to Relative Quantification Real-Time-PCR (RQ).

Lipofection: LipofectAmine (Invitrogen, 18324-012) was used essentially according to the manufacturer's protocol.

Real-time PCR: Relative quantification Q-PCR (RQ) was performed using ABI's 7500 Standard system, according to manufacturer's manuals and protocols. The Two- step Q-PCR (RT and PCR performed consequentially) were always performed. The "Relative Standard Curve Method" was performed where the "standard curves" was incorporated in each single 96-well plate along with tested samples. All the fluorescence-labeled probes span the exon-exon junctions in tested cDNAs, excluding genomic DNA being a template in the Q-PCR reaction. A "multiplex" method was adopted where primers and probes (FAM labeled) specific for tested gene sequences and that for a chosen endogenous "housekeeper" gene sequence (e.g., VIC labeled β- Actin probes with either mouse- or human- specificity) exist in a single test vial, resulting signals from reactions with both genes. When RNAi efficacy was to be measured, a "calibrator" group was always set which includes the "mock" transfection sample, the sample from cells being treated only by lipofectAmine in the absence of siRNAs. Un-related siRNAs were used in a separate control transfection experiment. Therefore, as a RNAi efficacy application of Q-PCR, the detected signals were subjected to two adjustments: normalization with the housekeeper gene and calibration with the mock transfection.

Q-PCR was performed to measure the efficacy of siRNA on inhibition of the expression of targeted genes and to quantitate the knockdown of targeted genes at the mRNA level. Relative Standard Curve method, one of the methods to perform relative quantification Q-PCR was ued. The "two-step" Q-PCR procedure was chosen, where the RT and Q-PCR are separated. Reactions were stopped after RT, making the reactions easy to perform, and could be stopped after the first step (RT reaction). The RT and PVR reactions all were set up in a 20 μl volume. mACTB was used as the endogenous gene control for the relative standard curve method.

Multiplex method was also adopted where the reactions relative to interested gene (using FAM fluorescent labeling) and housekeeper gene (VIC labeled) were performed in one vial.

Efficacy of 25-mer Blunt-ended siRNAs on the Inhibition of Targeted Genes in Mouse or Human Tissue Cultures

Z THE MVEGF WAS DETECTED IN RAW264.7 CELLS, MVEGFRl AND MVEGFR2 WERE DETECTED IN SVR CELLS. THE HVEGFRl AND HVEGFR2 WERE DETECTED IN HUVEC CELLS. NA, NOT AVAILABLE

Example 3. 25 basepair blunted double-stranded siRNA is more potent than regular 19 basepair siRNA with 3'-overhangs in silencing target gene expression

In one of the in vitro siRNA transfection studies, MCF/165 breast cancer cells overexpressing human VEGF (hVEGF) were transfected with either 25 basepair blunted double-stranded siRNA (hVEGF-25-siRNA-a, hVEGF-25-siRNA-b, hVEGF- 25-siRNA-c, Luc-25-siRNA) or 19 basepair siRNA with 3' overhangs (h VEGF- siRNA-a, GFP-siRNA-a) using an electroporation mediated transfection method. 4x10⁶ MCF7/165 cells were resuspended in 200 ul of siPORT siRNA Electroporation Buffer (Ambion) mixed with 5 ug siRNA and then subjected to electroporation treatment using an Electro Square Porator ECM830 (BTX, Fisher Scientific). The parameters for the electroporation were: voltage 500 v; duration of pulse 60 us; pulse number 2; pulse interval 1 second. The transfected cells were seeded to 24-well plate at a density of 5xlO⁴ cell/well and cultured at 37⁰C incubator with 5% CO₂. At 24 hours post transfection, the culture media from each well were harvested and the concentration of human VEGF protein in the media was measured using a commercial hVEGF ELISA kit (R&D Systems).

We observed a significantly stronger hVEGF target gene inhibition in 25 basepair hVEGF-siRNA treated cells than that in regular 19 basepair hVEGF siRNA treated cells. There was a more than 75% reduction of the secreted hVEGF protein in the culture media of cells transfected with 25 basepair blunted double-stranded hVEGF-25-siRNA molecules at 24 hours post siRNA transfection, compared to an about 60% hVEGF protein reduction observed in cells transfected with regular 19 basepair hVEGF-siRNA-a. Both non-specific sequence control 25 basepair blunted double-stranded siRNA (Luc-25-siRNA) or regular GFP-siRNA with 3'- overhangs did not affect VEGF expression under the same siRNA transfection condition (llS|ι5Ji

P9-' Example 4. 25 basepair blunted double-stranded siRNA mediated an elongated target gene silencing

In another in vitro siRNA transfection study, the MCF/165 breast cancer cells overexpressing human VEGF (h VEGF) were transfected with either 25 basepair blunted double-stranded siRNA (hVEGF-25-siRNA-a, hVEGF-25-siRNA-b, hVEGF- 25-siRNA-c, Luc-25-siRNA) or 19 basepair siRNA with 3' overhangs (h VEGF- siRNA-a, GFP-siRNA-a) using an electroporation mediated transfection method. 4x10⁶ MCF7/165 cells were resuspended in 200 ul of siPORT siRNA Electroporation Buffer (Ambion) mixed with 2 ug or 5 ug siRNA and then subjected to electroporation treatment using an Electro Square Porator ECM830 (BTX, Fisher Scientific). The parameters for the electroporation are: voltage 500 v; duration of pulse 60 us; pulse number 2; pulse interval 1 second. The transfected cells were seeded to 24-well plate at a density of 5x10⁴ cell/well and cultured at 37⁰C incubator with 5% CO₂. At 24, 48, 72, 96, and 120 hours post transfection, the culture media from each well were harvested and replaced with fresh culture media. The concentration of human VEGF protein in the media harvested at various time points was measured using a commercial hVEGF EKISA kit (R&D). The siRNA mediated hVEGF knockdown was normalized with the hVEGF protein levels measured in cells treated with respective non-specific control siRNA.

We observed a significant stronger and elongated hVEGF target gene inhibition in 25 basepair hVEGF-siRNA treated cells than that in regular 19 basepair hVEGF siRNA treated cells at every time points tested. At 120 hours post siRNA treatment, there was still a more than 60% reduction of the secreted hVEGF protein in the culture media of cells transfected with 5 ug of 25 basepair blunted double- stranded hVEGF-25-siRNA molecules, compared to an less than 20% hVEGF protein reduction observed in cells transfected with 5 ug of regular 19 basepair hVEGF-siRNA-a (llJaSilll We also observed a dose-dependent siRNA mediated hVEGF gene inhibition for the 25 basepair blunted double-stranded hVEGF-25- siRNA molecules.

Base on our observation, the 25 basepair blunted double-stranded hVEGF-25- siRNA molecules not only gives a stronger target VEGF gene inhibition, but also results in a significant longer duration of effective target VEGF gene inhibition. For example, compared to only 48 hours of more than 60% hVEGF protein reduction achieved using 5 ug of regular 19 basepair hVEGF siRNA, at least 120 hours of more 60% reduction of protein was achieved using 25 basepair blunted double-stranded hVEGF siRNA. Therefore, the 25 basepair blunted double-stranded siRNA are more potent target gene inhibitor that can lead to more significant therapeutic efficacy.

Additional information includes (1) Luc-25-siRNA has the sequence of (sense strand 5 '-rGG AACCGCUGG AG AGC AACUGC AU A-3' and antisense strand 5'-rCCUUGGCGACCUCUCGUUGACGUAU-3'); (2) hVEGF-siRNA-a has the sequence of (sense strand, 5'-rUCGAGACCCUGGUGGACAUdTT-3' and antisense strand, 5 '-r AUGUCC ACC AGGGUCUCGAdTT-3'); (3) GFP-siRNA has the sequence of (sense strand, 5 ' -rGCUG ACCCUG AAGUUC AUCdTT-3' and (antisense strand, 5'-rGAUGAACUUCAGGGUCAGCdTT-3'); (4) hVEGFR2-25-siRNA-c: 5'-r(CCAAGUGAUUGAAGCAGAUGCCUUU)-3'.

Example 5. 25 base pair blunted double-stranded siRNA efficiently reduced human VEGFRl and VEGFR2 expression in vitro.

Three 25 basepair blunted double-stranded siRNA specifically targeting human VEGFRl were transfected in HUVEC cells through electroporation. The membrane bound VEGFRl and free extracellular fragment of VEGFRl were measured 96 hours post transfection by ELISA. The VEGFRl -siRNA duplex a demonstrated the strongest VEGFRl silencing activity, compared to two other siRNA, for both cell lysate protein and the free fragments in the cell culture supernatant solution ^^^^^^^^^ When using the same approach to evaluate three 25 base pair blunted double-stranded siRNA targeting human VEGFR2 gene, we found all three duplexes exhibiting potent silencing activity at both 24 hours and 72 hours post transfection time points ('^^^P^

Example 6. 25mer hVEGF-siRNAs knocked down hVEGF secretion in MCF- 7/MV165 cells

MCF-7/MV165 cells were transfected with 25 mer hVEGF-siRNAs or control 25-mer Luc-siRNA using an electroporation mediated method. At 24, 48, 72, 96 and 120 hours post transfection, culture supernatants were collected and hVEGF concentrations in the media were measured using a human VEGF ELISA Assay. The percentage of inhibition for individual siRNA candidate was presented as the average percentage inhibition of VEGF expression from each time point measured. Table 4. siRNA sequences

u>

Legend for Table 4:

Only the sense strand sequence of each siRNA (which is identical to the target sequence on the target mRNA molecule) is listed in Table 4. The potencies of siRNA in inhibiting its target gene expression were measured as percentage of normalized target protein reduction in transfected cells compared to the levels of normalized target protein in cells transfected with control siRNA duplex (25mer double stranded RNA sequences of luciferase) at the same dose. Commercial ELISA kits were used to measure the reduction of target protein in siRNA transfected with siRNA using an electroporation mediated method.

For selection of hVEGF siRNA: siRNA was transfected into MV- 165 cells, a MCF-7 derivate over-expressing hVEGF. The supernatant of transfected MV- 165 cells was collected at preset time points (24h, 48h, 72h, 96h, and 12Oh post transfection) and the levels of secreted hVEGF protein were measured using a commercial hVEGF ELISA kit. The experiments were repeated 2-3 times and the maximum percentage of hVEGF protein reduction for each siRNA observed was reported in the table (Table 4).

For selection of hVEGFRl siRNA: siRNA was transfected into HUVEC cells. The supernatant of transfected HUVEC cells was collected at preset time points (48h, 72h, 96h, post transfection) and the levels of secreted h VEGFRl protein were measured using a commercial hVEGFRl ELISA kit. In addition, the transfected cells were harvested at each time points and cell lysate was subjected to the same hVEGFRl ELISA assay. The experiments were repeated 2-3 times and the maximum percentage of hVEGFRl protein reduction for each siRNA detected in either supernatant or cell lysate was reported in the table (Table 4).

For selection of hVEGFR2 siRNA: siRNA was transfected into HUVEC cells. The transfected HUVEC cells were collected at preset time points (48h, 72h, 96h, post transfection) and cell lysate was subjected to ELISA assay using a commercial hVEGFR2 ELISA kit. The experiments were repeated 2-3 times and the maximum percentage of hVEGFR2 protein reduction for each siRNA detected in cell lysate was reported in the table (Table 4). For selection of mVEGFRl siRNA: siRNA was transfected into mouse endothelial cells, SVR-bag4. The supernatant of transfected SVR-bag4 cells was collected at preset time points (48h, 72h, 96h, post transfection) and the levels of secreted mVEGFRl protein were measured using a commercial mVEGFRl ELISA kit. In addition, the transfected cells were harvested at each time points and cell lysate was subjected to the same mVEGFRl ELISA assay. The experiments were repeated 2-3 times and the maximum percentage of mVEGFRl protein reduction for each siRNA detected in either supernatant or cell lysate was reported in the table (Table 4).

For selection of mVEGFR2 siRNA: siRNA was transfected into mouse endothelial cells, SVR-bag4. The transfected SVR-bag4 cells werecollected at preset time points (48h, 72h, 96h, post transfection) and cell lysate was subjected to ELISA assay using a commercial mVEGFR2 ELISA kit. The experiments were repeated 2-3 times and the maximum percentage of mVEGFR2 protein reduction for each siRNA detected in cell lysate was reported in the table (Table 4).

Table 5

Table 6.

Table 7.

Effect of siRNAs which share 100% sequence homology between human and mouse VEGFon production of human VEGF by MV-165 cells In vitro

U)

OO

Effect of siRNAs which share 100% sequence homology between human and mouse VEGFR2 on production of human vitro VEGFR2 by HUVEC in vitro

Table 8. Human VEGF specific siRNA sequences (25 basepairs with blunt ends):

VEGF-I, CCUGAUGAGAUCGAGUACAUCUUCA

VEGF-2,GAGUCCAACAUCACCAUGCAGAUUA

VEGF-3, AGUCCAACAUCACCAUGCAGAUUAU

VEGF-4, CCAACAUCACCAUGCAGAUUAUGCG

VEGF-5, CACCAUGCAGAUUAUGCGGAUCAAA

VEGF-6, GCACAUAGGAGAGAUGAGCUUCCUA

VEGF-7, GAGAGAUGAGCUUCCUACAGCACAA

Table 9. Human VEGFRl specific siRNA sequences (25 basepairs with blunt ends):

VEGFRl-I, CAAAGGACUUUAUACUUGUCGUGUA

VEGFR1-2, CCCUCGCCGGAAGUUGUAUGGUUAA

VEGFR1-3, CAUCACUCAGCGCAUGGCAAUAAUA

VEGFR1-4, CCACCACUUUAGACUGUCAUGCUAA

VEGFR1-5, CGGACAAGUCUAAUCUGGAGCUGAU

VEGFR1-6, UGACCCACAUUGGCCACCAUCUGAA

VEGFR1-7, GAGGGCCUCUGAUGGUGAUUGUUGA

VEGFR1-8, CGAGCUCCGGCUUUCAGGAAGAUAA

VEGFR1-9, CAAUCAAUGCCAUACUGACAGGAAA

VEGFRl-10, GAAAGUAUUUCAGCUCCGAAGUUUA

Table 10. Human VEGFR2 specific siRNA sequences (25 basepairs with blunt ends):

VEGFR2-1, CCUCGGUCAUUUAUGUCUAUGUUCA

VEGFR2-2, CAGAUCUCCAUUUAUUGCUUCUGUU

VEGFR2-3, GACCAACAUGGAGUCGUGUACAUUA

VEGFR2-4, CCCUUGAGUCCAAUCACACAAUUAA

VEGFR2-5, CCAUGUUCUUCUGGCUACUUCUUGU

VEGFR2-6, UCAUUCAUAUUGGUCACCAUCUCAA

VEGFR2-7, GAGUUCUUGGCAUCGCGAAAGUGUA

VEGFR2-8, CAGCAGGAAUCAGUCAGUAUCUGCA

VEGFR2-9, CAGUGGUAUGGUUCUUGCCUCAGAA

VEGFR2-10, CCACACUGAGCUCUCCUCCUGUUUA

Table 11. a. Human VEGF specific siRNA:

25 base pair blunt ends: hVEGF-25-siRNA-a:

Sense strand: 5'-r(CCUGAUGAGAUCGAGUACAUCUUCA)-3'

Antisense strand: 5'-r(UGAAGAUGUACUCGAUCUCAUCAGG)-3'.

hVEGF-25-siRNA-b:

Sense strand: 5'-r(GAGAGAUGAGCUUCCUACAGCACAA)-3'

Antisense strand: 5'-r(UUGUGCUGUAGGAAGCUCAUCUCUC)-3'.

hVEGF-25-siRNA-c:

Sense strand: 5'-r(CACAACAAAUGUGAAUGCAGACCAA)-3'

Antisense strand: 5'-r(UUGGUCUGCAUUCACAUUUGUUGUG)-3'

19 base pairs with two nucleotide (TT) overhangs at 3': hVEGF 165 5 ' -r ( UCGAGACCCUGGUGGAC AUTT ) - 3 '

b. Human VEGF receptor 1 specific siRNA:

25 base pair blunt ends: hVEGFRl-25-siRNA-a,

Sense strand: 5 '-r(GCC AAC AUAUUCUAC AGUGUUCUUA)-3'

Antisense strand: 5 '-r(UAAGAAC ACUGUAG AAUAUGUUGGC ) -3 '

hVEGFRl-25-siRNA-b,

Sense strand: 5'-r(CCCUCGCCGGAAGUUGUAUGGUUAA)-3'

Antisense strand: 5'- r(UUAACCAUACAACUUCCGGCGAGGG)-3'.

19 basepairs with 2 3' (TT) nucleotide overhangs:

VEGF Rl (FLT) 5'-GGAGAGGACCUGAAACUGUTT

c. Human VEGF receptor 2 specific siRNA:

25 basepair blunt ends: hVEGFR2-25-siRNA-a, Sense strand: 5 ' - r ( CCUCUUCUGUAAGACACUC ACAAUU ) -3 ' Antisense strand: 5 ' - r ( AAUUGUGAGUGUCUUACAGAAGAGG ) -3 ' .

hVEGFR2-25-siRNA-b,

Sense strand: 5'-r (CCCUUGAGUCCAAUCACACAAUUAA) -3'

Antisense strand: 5 ' -r (UUAAUUGUGUGAUUGGACUC AAGGG) -3'.

hVEGFR2-25-siRNA-c,

Sense strand: 5 '-r ( CCAAGUGAUUGAAGCAGAUGCCUUU ) -3 '

Antisense strand: 5 '- r ( AAAGGCAUCUGCUUCAAUCACUUGG ) -3 '

19 basepairs with 2 3' (TT) nucleotide overhangs: hVEGF R2 (KDR) 5 '-CAGUAAGCGAAAGAGCCGGTT-S '

25 base pair VEGF siRNA targeting human, mouse, rat, macaque, dog VEGF mRNA sequences:

mhVEGF25-l : sense, 5'-CAAGAUCCGCAGACGUGUAAAUGUU-S'; antisense, 5 '-AACAUUUACACGUCUGCGGAUCUUG-3 ' mhVEGF25-2: sense, 5'-GCAGCUUGAGUUAAACGAACGUACU-S '; antisense, 5'- AGUACGUUCGUUUAACUCAAGCUGC-3 '

mhVEGF25-3: sense, 5' -C AGCUUG AGUU AAACG AACGUACUU-3'; antisense, 5'- AAGUACGUUCGUUUAACUCAAGCUG-3'

mhVEGF25-4: sense, 5'-CCAUGCCAAGUGGUCCCAGGCUGCA-S'; antisense, 5'- TGCAGCCTGGGACCACTTGGCATGG-3 '

mhVEGF25-4: sense, 5'-CACAUAGGAGAGAUGAGCUUCCUCA-S '; antisense, 5'-UGAGGAAGCUCAUCUCUCCUAUGUG-S '

25 base pair VEGF R2 siRNA sequences targeting both human and mouse VEGFR2 mRNA sequences:

mhVEGFR225-l : sense, 5'-CCUACGGACCGUUAAGCGGGCCAAU-S'; antisense: 5'-AUUGGCCCGCUUAACGGUCCGUAGG-3 ' mhVEGFR225-2: sense, 5'-CUCAUGUCUGUUCUCAAGAUCCUCA-S '; antisense: 5 '-UGAGGAUCUUGAGAACAGACAUGAG-S ' mhVEGFR225-3: sense, 5'-CUCAUGGUGAUUGUGGAAUUCUGCA -3'; antisense: 5 '-UGC AG A AUUCC AC AAUC ACC AUG AG-3 ' mhVEGFR225-4: sense, 5'-GAGCAUGGAAGAGGAUUCUGGACUC -3'; antisense: 5'-GAGUCCAGAAUCCTCUUCCAUGCTC-S '

mhVEGFR225-5: sense, 5'-CAGAACAGUAAGCGAAAGAGCCGGC-B '; antisense: 5'-GCCGGCUCUUUCGCUUACUGUUCUG-S '

mhVEGFR225-6: sense, 5'-GACUUCCUGACCUUGGAGCAUCUCA-S '; antisense: 5 '-UG AGAUGCUCC AAGGUC AGG AAGUC-3 '

mhVEGFR225-7: sense, 5'-CCUGACCUUGGAGCAUCUCAUCUGU-S '; antisense: 5'-ACAGAUGAGAUGCUCCAAGGUCAGG-S'

mhVEGFR225-8: sense, 5'-GCUAAGGGCAUGGAGUUCUUGGCAU-S '; antisense: 5 '- AUGCC AAG AACUCC AUGCCCUUAGC-3 '

25 base pairs VEGFRl siRNA sequences targeting both human and mouse VEGFRl mRNA sequences:

mhVEGFR125-l : sense, 5'- CACGCUGUUUAUUGA AAGAGUCACA-3'; antisense: 5'-UGUGACUCUUUCAAUAAACAGCGUG-S'

mhVEGFR125-2: sense, 5'- CGCUGUUUAUUGAAAGAGUCACAGA-S'; antisense: 5'-UCUGUGACUCUUUCAAUAAACAGCG-S'

mhVEGFR125-3: sense, 5'- CAAGGAGGGCCUCUGAUGGUGAUGU-S'; antisense: 5 '-ACAUCACCAUCAGAGGCCCUCCUUG-3 '

mhVEGFR125-4: sense, 5'-CCAACUACCUCAAGAGCAAACGUGA-S'; antisense: 5 '-UCACGUUUGCUCUUGAGGUAGUUGG-S '

mhVEGFR125-5: sense, 5'-CUACCUCAAGAGCAAACGUGACUUA-S '; antisense: 5 '-UAAGUCACGUUUGCUCUUGAGGUAG-S '

mhVEGFR125-6: sense, 5'-CCAGAAAGUGCAUUCAUCGGGACCU-S '; antisense: 5'-AGGUCCCGAUGAAUGCACUUUCUGG-S'

mhVEGFR125-7: sense, 5'-CAUUCAUCGGGACCUGGCAGCGAGA -3'; antisense: 5'-UCUCGCUGCCAGGUCCCGAUGAAUG-3 '

mhVEGFR125-8: sense, 5'-CAUCGGGACCUGGCAGCGAGAAACA -3'; antisense: 5'-UGUUUCUCGCUGCCAGGUCCCGAUG-S '

mhVEGFR125-9: sense, 5'-GAGCCUGGAAAGAAUCAAAACCUUU-S '; antisense: 5'-AAAGGUUUUGAUUCUUUCCAGGCUC-3' mhVEGFRl 25-10: sense, 5'-GCCUGGAAAGAAUCAAAACCUUUGA-S '; antisense: 5'-UCAAAGGUUUUGAUUCUUUCCAGGC-S' mhVEGFR125-l l : sense, 5'-GCCUGGAAAGAAUCAAAACCUUUGA-S '; antisense: 5 '-UCAAAGGUUUUGAUUCUUUCCAGGC-3 '

mhVEGFR125-12: sense, 5'-CUGAACUGAGUUUAAAAGGCACCCA-S'; antisense: 5'-UGGGUGCCUUUUAAACUGAGUUCAG-S'

mhVEGFR125-13: sense, 5'- GAACUGAGUUUAAAAGGCACCCAGC-3'; antisense: 5 '-GCUGGGUGCCUUUU AAACUC AGUUG-3 '

Table 12

25-merhVEGFsiRNAs

25-mer hVEGFRl siRNAs

Table 12 (continued)

25-merhVEGFR2 siRNAs

Incorporation by Reference

The following applications are herein incorporated by reference in their entirety:

1. PCT/US03/24587, Methods Of Down Regulating Target Gene Expression In Vivo By Introduction Of Interfering RNA.

2. PCT/US2005/003857, RNAi Therapeutics for Treatment of Eye Neovascularization Diseases.

3. PCT/US2005/003858, Compositions and Methods for Combination RNAi Therapeutics.

4. US application, 60/670,717, Compositions and Methods for Using siRNA Inhibitors to Enhance mAb Therapeutic Efficacy for Treatment of Cancer and Other Diseases.

5. US application, Composition and Methods for Down Regulation of Target Gene Expression Using 25 base pair, blunt end and double stranded siRNA oligos

6. PCT/US2006/013645 filed April 12, 2006.

References:

1. Peter A, Campochiaro . Retinal and choroidal neovascularization . J Cell Physiol , 2000 , 184 : 301-10 .

2. Smith LE, Wesolowski E, Mclellan A, et al . Oxygen-induced retinopathy in the mouse . Invest Ophthalmol Vis Sci , 1994 , 35 : 101-11 .

3. 3 D'Amato R, Wesolowski E, Smith LE. Microscopic visualization of the retina by angiography with high-molecular-weight fluorescein-labeled dextrans in the mouse. Micro vase Res 1993; 46:135-42.

4. Jikui shen, Rebecca samul, Joelle Zimmer, et al. Deficiency of Neuropilin 2 Suppresses VEGF-Induced Retinal NV .Molecular medicine, 2004,10:12-18.

5. Unsoeld AS, Junker B, Mazitschek R, et al. Local injection of receptor tyrosine kinase inhibitor MAE 87 reduces retinal neovascularization in mice. MoI Vis, 2004, 10:468-75.

6. Clauss M . Molecular biology of the VEGF and VEGF receptor family . Semin Thromb Hemost , 2000 , 26 : 561-9.

7. Eric AP, Robert LA, Eliot DF, et al. Vascular endothelial growth factor / vascular permeability factor expression in a mouse model of retinal neovascularization. Proc. Natl. Acad. Sci, 1995, 92:905-9.

8. Lu P.Y. et al., Keystone Symposia, Molecular Targets for Cancer Therapy, (2003, p219. Xu J. et al., Gene Suppression. (2003).

9. Lu, Patrick et al., (2002), Cancer Gene Therapy, Vol.10, Supplement 1, 011.

10. Lu, Patrick Y et al.., (2003), Current Opinion in Molecular Therapeutics, 5(3):225-234.

11. Cogoni C. et al., (2000), Genes Dev 10: 638-643.

12. Guru T., (2000), Nature 404: 804-808.

13. Hammond SM et al., (2001), Nature Rev Gen 2: 110-119.

14. Napoli C et al., (1990), Plant Cell 2: 279-289.

15. Jorgensen RA et al., (1996), Plant MoI Biol, 31 : 957-973.

16. Ingelbrecht I et al., (1994), Proc Natl Acad Sci USA, 91 : 10502-10506.

17. Cogoni C et al., EMBO J, 15: 3153-3163.

18. Palauqui JC et al., (1998), EMBOJ, 16: 4738-4745.

19. Guo S et al., (1995), Cell, 81 : 611-620.

20. Fire A et al., (1998), Nature 391 : 806-811.

21. Timmons L. et al., (1998), Nature 395: 854. 22. Timmons L et al., (2001), Gene 263:103-1 \2.

23. Hunter CP, (2000), Current Biology 10: R137-R140.

24. Tabara H et al., (1998), Science 282: 430-431.

25. Kamath RS et al., (2000), Genome Biology 2: 2.1-2.10.

26. Grishok A et al., (2000), Science 287: 2494-2497.

27. Sharp PA et al., (2000), Science 287: 2431-2433.

28. Sharp PA, (2001), Genes Dev \5: 485-490.

29. Kennerdell JR et al., (1998). Cell 95: 1017-1026.

30. Kennerdell JR et al., (2000), Nature Biotech 18: 896-898.

31. Dzitoyeva S et al., (2001), MoI Psychiatry 6(6):665-670.

32. Worby CA et al., (2001), Sci STKE Aug 14, 2001(95):PLl.

33. Schmid A et al., (2002), Trends Neurosci 25(2):71-74.)

34. Hamilton A. J. et al., (1999), Science 286: 950-952.

35. Hammond S et al., (2000), Nature, 404: 293-298.

36. Zamore PD et al., (2000), Cell 101 : 25-33.

37. Hutvagner G et al., (2002), Curr Opin Genetics & Development 12:225-232.

38. Bernstein E et al., (2001), Nature 409:363-366.

39. Nykanen A et al., (2001), Cell 107:309-321.

40. Lipardi C et al., (2001), Cell 107:297-307.

41. Ketting RF et al., (1999), Cell 99: 133-141.

42. Grishok A et al., (2001), Cell 106:23-34.

43. Hutvagner G et al., (2001), Science 293(5531):834-838.

44. Ketting RF et al., (2001), Genes Dev 15(20):2654-2659.

45. Lagos-Quintana M et al., (2001), Science 294:853-858.

46. Lau NC et al., (2001), Science 294:858-862.

47. Lee RC et al., (2001), Science 294:862-864.

48. Ruvkun G., (2001), Science 294:797-799.

49. Manche L et al., (1992), MoI. Cell. Biol. 12:5238-5248.

50. Minks MA et al., (1979), J. Biol. Chem. 254:10180-10183.

51. Yang S et al., (2001), MoI. Cell. Biol. 21(22):7807-7816.

52. Paddison PJ et al., (2002), Proc. Natl. Acad. Sci. USA 99(3): 1443-1448. Elbashir SM et al., (2001), Genes Dev 15(2): 188-200.

53. Elbashir SM et al., (2001), Nature 411 : 494-498.

54. Caplen NJ et al., (2001), Proc. Natl. Acad. Sci. USA 98: 9746-9747. 55. Holen T et al., (2002), Nucleic Acids Research 30(8):1757-1766.

56. Elbashir SM et al., (2001), EMBO J 20: 6877-6888.

57. Jarvis RA et al., (2001), TechNotes 8(5): 3-5.

58. Brown D et al., (2002), TechNotes 9(1): 3-5.

59. Brummelkamp TR et al., (2002), Science 296:550-553.

60. Lee NS et al., (2002), Nature Biotechnol. 20:500-505.

61. Miyagishi M et al., (2002), Nature Biotechnol. 20:497-500.

62. Paddison PJ et al., (2002), Genes & Dev. 16:948-958.

63. Paul CP et al., (2002), Nature Biotechnol. 20:505-508.

64. Sui G et al., (2002), Proc. Natl. Acad. Sci. USA 99(6):5515-5520.

65. Yu J-Y et al., (2002), Proc. Natl. Acad. Sci. USA 99(9):6047-6052.

66. McCaffrey, A. P. et al., (2002), Nature, Vol. 418, July, 2002.

67. Watanabe A, Taniguchi M. (2005). A case of oropharyngeal cancer with multiple bone metastases from prostate cancer that responded to docetaxel, ifosfamide and cisplatin combination therapy. Gan To Kagaku Ryoho. 32(l):65-7.

68. Miner J, Gillan MM, Alex P, Centola M. (2005). Steroid-Refractory Ulcerative Colitis Treated with Corticosteroids, Metronidazole and Vancomycin: a Case Report. BMC Gastroenterol. 5(1):3.

69. Orbay E, Sargin M, Sargin H, Gozu H, Bayramicli OU, Yayla A. (2004). Addition of rosiglitazone to glimepirid and metformin combination therapy in type 2 diabetes. Endocr J. 51(6):521-7.

70. Smith LE, Wesolowski E, Mclellan A, et al . Oxygen-induced retinopathy in the mouse . Invest Ophthalmol Vis Sci , 1994 , 35 : 101-11 .

Claims

We claim:

1. An antisense nucleic acid molecule for targeting VEGF, wherein the antisense nucleic acid comprises a sequence that is complementary to a sense strand selected from the group consisting of: a) aaucgagacccugguggacau; b) aaggccagcacauaggagaga; c) auccaaucgagacccugguggacau; d) uccaaucgagacccugguggacauc; e) ccaaucgagacccugguggacaucu; f) caaucgagacccugguggacaucuu; g) aaucgagacccugguggacaucuuc; h) ccgcagacguguaaauguuccugca; i) gcagacguguaaauguuccugcaaa; j) gcaaggcgaggcagcuugaguuaaa; and k) cccugguggacaucuuccaggagua.

2. A double stranded nucleic acid molecule comprising the antisense nucleic acid of claim 1 and its corresponding sense strand.

3. An antisense nucleic acid molecule for targeting VEGFRl, wherein the antisense nucleic acid comprises a sequence that is complementary to sense strand selected from the group consisting of: a) gcuguuuauugaaagagucacagaa; b) ccucaagagcaaacgugacuuauuu; and c) accucaagagcaaacgugacuuauu.

4. A double stranded nucleic acid molecule comprising the antisense nucleic acid of claim 3 and its corresponding sense strand.

5. An antisense nucleic acid molecule for targeting VEGFR2, wherein the antisense nucleic acid comprises a sequence that is complementary to a sense strand selected from the group consisting of: a) caucucaucuguuacagcuuccaag; b) cauggaagaggauucuggacucucu; c) caaguggcuaagggcauggaguucu; d) gggaacugaagacaggcuacuuguc; and e) gacuggcuuuggcccaauaauca.

6. A double stranded nucleic acid molecule comprising the antisense nucleic acid of claim 5 and its corresponding sense strand.

7. A composition comprising a nucleic acid molecule according to any one of claims 1-6 and a pharmaceutically acceptable carrier.

8. The composition of claim 7, comprising further comprising an antisense nucleic acid selected from the group consisting of: a) one or more antisense nucleic acids of claim 1 ; b) one or more antisense nucleic acids of claim 3; c) one or more antisense nucleic acids of claim 5; d) one or more double-stranded nucleic acids of any one of claims 2, 4 or 6; and e) any combination of a) through d).

9. A synthetic nucleic acid delivery vehicle comprising the antisense nucleic acid of any one of claims 1-6.

10. The synthetic nucleic acid delivery vehicle of claim 9 which comprises a cationic polymer complexed with the nucleic acid.

11. The synthetic nucleic acid delivery vehicle of claim 10, wherein the cationic polymer is PEI or a histidine-lysine copolymer.

12. A method for reducing VEGF expression in a cell comprising the step of introducing into the cell the antisense nucleic acid of claim 1 or double stranded nucleic acid of claim 2.

13. A method for reducing VEGFRl expression in a cell comprising the step of introducing into the cell the antisense nucleic acid of claim 3 or double stranded nucleic acid of claim 4.

14. A method for reducing VEGFR2 expression in a cell comprising the step of introducing into the cell the antisense nucleic acid of claim 5 or double stranded nucleic acid of claim 6.

15. A method for reducing VEGF, VEGFRl or VEGFR3 expression in a cell comprising the step of introducing into the cell the antisense nucleic acid of claim 1, 3 and 5.

16. A method for reducing neovascularization in a subject in need thereof comprising the step of administering to the subject a nucleic acid molecule according to any one of claims 1-6.

17. The method of claim 16, wherein the neovascularization is in a tumor.