Recherche Images Maps Play YouTube Actualités Gmail Drive Plus »
Connexion
Les utilisateurs de lecteurs d'écran peuvent cliquer sur ce lien pour activer le mode d'accessibilité. Celui-ci propose les mêmes fonctionnalités principales, mais il est optimisé pour votre lecteur d'écran.

Brevets

  1. Recherche avancée dans les brevets
Numéro de publicationWO2008099396 A1
Type de publicationDemande
Numéro de demandePCT/IL2008/000191
Date de publication21 août 2008
Date de dépôt14 févr. 2008
Date de priorité15 févr. 2007
Numéro de publicationPCT/2008/191, PCT/IL/2008/000191, PCT/IL/2008/00191, PCT/IL/8/000191, PCT/IL/8/00191, PCT/IL2008/000191, PCT/IL2008/00191, PCT/IL2008000191, PCT/IL200800191, PCT/IL8/000191, PCT/IL8/00191, PCT/IL8000191, PCT/IL800191, WO 2008/099396 A1, WO 2008099396 A1, WO 2008099396A1, WO-A1-2008099396, WO2008/099396A1, WO2008099396 A1, WO2008099396A1
InventeursAbraham Hochberg
DéposantYissum Research Development Company Of The Hebrew University Of Jerusalem
Exporter la citationBiBTeX, EndNote, RefMan
Liens externes:  Patentscope, Espacenet
Use of h19-silencing nucleic acid agents for treating restenosis
WO 2008099396 A1
Résumé
The invention relates to the use of nucleic acid agents capable of silencing H19 for the treatment or prevention of restenosis, particularly to stents eluting nucleic acid agents capable of silencing H19 and uses thereof for the treatment of restenosis. The invention provides methods for ameliorating restenosis and symptoms associated therewith, utilizing gene silencing oligonucleotides such as small interfering RNA (siRNA) agents directed to H19.
Revendications  (Le texte OCR peut contenir des erreurs.)
CLAIMS:
1. A method for treating, reducing occurrence of or inhibiting the progression of restenosis in a subject in need thereof, comprising the step of administering to said subject a therapeutically effective amount of an H19-silencing oligonucleotide, thereby treating, reducing occurrence or inhibiting the progression of restenosis in the subject.
2. The method of claim 1, wherein the step of administering is performed following an angioplasty procedure.
3. The method of claim 1, wherein said H19-silencing oligonucleotide has a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-8 and 14-25.
4. The method of claim 3, wherein said H19-silencing oligonucleotide has a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-4.
5. The method of claim 1, wherein said H19-silencing oligonucleotide is selected from the group consisting of: a RNA interference (RNAi) molecule, an antisense molecule and an enzymatic nucleic acid molecule.
6. The method of claim 5, wherein said an H19-silencing oligonucleotide is a small interference RNA (siRNA) molecule.
7. The method of claim 6, wherein said siRNA molecule comprises a sense RNA strand and an antisense RNA strand, and wherein said sense RNA strand and said antisense RNA strand form an RNA duplex.
8. The method of claim 7, wherein at least one of said sense RNA strand and said antisense RNA strand comprises a 3' overhang.
9. The method of claim 8, wherein said overhang is about 1-5 nucleotides in length.
10. The method of claim 9, wherein said overhang is 2 nucleotides in length.
11. The method of claim 10, wherein said siRNA molecule comprises a sense strand selected from the group consisting of SEQ ID NOS: 5-8.
12. The method of claim 6, wherein said siRNA molecule comprises at least one modification selected from a modified internucleoside linkage and a 2'-sugar modification.
13. The method of claim 12, wherein the modified internucleoside linkage is a phosphorothioate linkage.
14. The method of claim 12, wherein said 2'-sugar modification is a 2'-O-methyl modification.
15. The method of claim 1, wherein said H19-silencing oligonucleotide is administered to said subject in the form of a pharmaceutical composition further comprising a pharmaceutically acceptable carrier, excipient or diluent.
16. The method of claim 1, wherein said H19-silencing oligonucleotide is administered to said subject from a drug-eluting stent.
17. A method for treating, reducing occurrence of or inhibiting the progression of restenosis in a subject in need thereof, comprising administering to said subject a therapeutically effective amount of a recombinant construct encoding a Hl 9- silencing oligonucleotide, said nucleic acid sequence being operably linked to a transcription-regulating sequence, thereby treating, reducing occurrence or
inhibiting the progression of restenosis in the subject.
18. The method of claim 17, wherein the step of administering is performed
following an angioplasty procedure.
19. The method of claim 17, wherein said H 19-silencing oligonucleotide has a
nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-8 and 14-25.
20. The method of claim 19, wherein said H 19-silencing oligonucleotide has a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-4.
21. The method of claim 20, wherein said H19-silencing oligonucleotide is selected from the group consisting of: a RNA interference (RNAi) molecule, an antisense molecule and an enzymatic nucleic acid molecule.
22. The method of claim 21, wherein said an H19-silencing oligonucleotide is a
small interference RNA (siRNA) molecule.
23. The method of claim 22, wherein said siRNA molecule comprises a sense RNA strand and an antisense RNA strand, and wherein said sense RNA strand and said antisense RNA strand form an RNA duplex.
24. The method of claim 23, wherein at least one of said sense RNA strand and said antisense RNA strand comprises a 3' overhang.
25. The method of claim 17, wherein the recombinant construct is administered to said subject in the form of a pharmaceutical composition further comprising a pharmaceutically acceptable carrier, excipient or diluent.
26. The method of claim 17, wherein the recombinant construct is administered to said subject from a drug-eluting stent.
27. A method for reducing Hl 9 expression in vascular smooth muscle cells of a subject following angioplasty, comprising the step of introducing into said subject a stent capable of eluting to the surrounding tissue a therapeutically effective amount of an H19-silencing oligonucleotide, thereby reducing Hl 9 expression in vascular smooth muscle cells of a subject following angioplasty.
28. The method of claim 27, wherein said H 19-silencing oligonucleotide has a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-8 and 14-25.
29. The method of claim 28, wherein said Hl 9-silencing oligonucleotide has a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-4.
30. The method of claim 29, wherein said an Hl 9-silencing oligonucleotide is a small interference RNA (siRNA) molecule.
31. The method of claim 30, wherein said siRNA molecule comprises a sense strand selected from the group consisting of SEQ ID NOS: 5-8.
32. A method for reducing H19 expression in vascular smooth muscle cells of a subject following angioplasty, comprising introducing into said subject a stent capable of eluting to the surrounding tissue a therapeutically effective amount of recombinant construct encoding a H 19-silencing oligonucleotide, said nucleic acid sequence being operably linked to a transcription-regulating sequence, thereby reducing Hl 9 expression in vascular smooth muscle cells of a subject following angioplasty.
33. The method of claim 32, wherein said Hl 9-silencing oligonucleotide has a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-8 and 14-25.
34. The method of claim 33, wherein said H 19-silencing oligonucleotide has a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-4.
35. The method of claim 34, wherein said an H19-silencing oligonucleotide is a small interference RNA (siRNA) molecule.
36. The method of claim 35, wherein said antisense RNA strand comprises a 3' overhang.
37. A stent capable of eluting to the surrounding tissue an oligonucleotide capable of hybridizing with an Hl 9 transcript, or a recombinant construct encoding an oligonucleotide capable of hybridizing with an H19 transcript.
38. The stent according to claim 37, wherein said Hl 9-silencing oligonucleotide has a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-8 and 14-25.
39. The stent according to any one of claim 38, wherein said H 19-silencing oligonucleotide has a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-4.
40. The stent of claim 39, wherein said H 19-silencing oligonucleotide is selected from the group consisting of: a RNA interference (RNAi) molecule, an antisense molecule and an enzymatic nucleic acid molecule.
41. The stent of claim 40, wherein said H 19-silencing oligonucleotide is a small interference RNA (siRNA) molecule.
42. The stent of claim 41, wherein said siRNA molecule comprises a sense strand selected from the group consisting of SEQ ID NOS: 5-8.
3. The stent of any of claim 42, wherein said siRNA molecule comprises at least one modification selected from a modified internucleoside linkage and a 2'- sugar modification.
Description  (Le texte OCR peut contenir des erreurs.)

USE OF H19-SILENCING NUCLEIC ACID AGENTS FOR TREATING

RESTENOSIS

FIELD OF THE INVENTION The invention is directed to compositions and methods for treating restenosis, utilizing H19-silencing nucleic acid agents.

BACKGROUND OF THE INVENTION

Most coronary artery-related deaths are caused by atherosclerotic lesions which limit or obstruct coronary blood flow to heart tissue. To address coronary artery disease, doctors often utilize percutaneous transluminal coronary angioplasty (PTCA) or coronary artery bypass graft (CABG). PTCA is a procedure in which a small balloon catheter is passed down a narrowed coronary artery and then expanded to re-open the artery. The major advantage of angioplasty is that patients in which the procedure is successful need not undergo the more invasive surgical procedure of coronary artery bypass graft. A major difficulty with PTCA is the problem of post-angioplasty closure of the vessel, both immediately after PTCA (acute reocclusion) and in the long term (restenosis).

Coronary stents are typically used in combination with PTCA to reduce reocclusion of the artery. Stents are introduced percutaneously, and transported transluminally until positioned at a desired location. The stents are then expanded either mechanically, such as by the expansion of a mandrel or balloon positioned inside the stent, or expand themselves by releasing stored energy upon actuation within the body. Once expanded within the lumen, stents become encapsulated within the body tissue and remain a permanent implant. Restenosis is a major complication that can arise following vascular interventions such as angioplasty and stent implantation. Simply defined, restenosis is a wound healing process that reduces the vessel lumen diameter by extracellular matrix deposition, neointimal hyperplasia, and vascular smooth muscle cell proliferation, and which may ultimately result in renarrowing or even reocclusion of the lumen. To treat restenosis, additional revascularization procedures are frequently required, thereby increasing trauma and risk to the patient. The term "neointimal hyperplasia" refers to the development of a proliferative lesion in the intimal layer of a blood vessel. Neointimal hyperplasia results, for example, from migration of smooth muscle cells of the tunica media layer of the blood vessel toward the lumen into the subintimal space below the endothelium (i.e., the inner lining of the blood vessel). These smooth muscle cells proliferate within the intimal space and create a "mass effect" that narrows the vessel lumen and reduces oxygenation and nutritive blood flow.

While the exact mechanisms of restenosis are still being determined, certain agents have been demonstrated to reduce restenosis in humans. Drug-eluting stents represent a leading current treatment to address restenosis. Two examples of agents that have been demonstrated to reduce restenosis when delivered from a stent are paclitaxel, a well-known compound that is commonly used in the treatment of cancerous tumors, and Rapamycin, an immunosuppressive compound used to prevent rejection of organ or tissue transplants. Currently marketed drug-eluting stents are bare metal stents coated on the surface with a drug and a biostable polymer to reduce restenosis by inhibiting the growth or proliferation of neointima. In addition to polymer-coated stents, other polymer and non-polymer drug delivery systems are in development to allow delivery of antiproliferative drugs from stents. Hl 9 in diagnosis and therapy

Hl 9 was the first human imprinted non-protein-coding gene to be identified showing expression of only the maternal allele. It is also imprinted in mice. Hl 9 was mapped on the short arm of the human chromosome 11, band 15.5, homologous to a region of murine chromosome 7. H19 gene is abundantly expressed during embryogenesis but is repressed in most tissues after birth. However, studies of various tumors have demonstrated re-expression or over-expression of the Hl 9 gene when compared to healthy tissues. Moreover, aberrant allelic expression patterns were observed in some cancers of varying etiologies and lineages. While Hl 9 exhibits mono- allelic expression in most tissues throughout development, with the exception of germ cells at certain stages of maturation, and in extra- villous trophoblasts, bi-allelic expression of this gene, referred as "relaxation of imprinting" or "loss of imprinting," have been found in an increasing number of cancers, for example, hepatocellular carcinoma, liver neoplasms, lung adenocarcinoma, esophageal, ovarian, rhabdomyosarcoma, cervical, bladder, head and neck squamous cell carcinoma, colorectal, uterus, and testicular germ cell tumors. Today nearly 30 types of cancers show dysregulated expression of Hl 9 gene as compared to healthy tissues, with or without loss of imprinting.

Gene expression analyses using cancer cell lines have identified a plethora of downstream effectors of Hl 9 RNA. Among these are group of genes that play crucial roles in some aspects of the tumorigenic process (Ayesh et al, 2002; Matouk et al, 2007; Lottin et al, 2002). Hl 9 RNA presence may enhance the invasive, migratory and angiogenic capacity of the cell by up regulating genes that function in those pathways, and thus could contribute at least to the initial steps of the metastatic cascade. Additional studies highlight the potential role of Hl 9 in promoting cancer progression and tumor metastasis by being a gene responsive to HGF/SF.

The specific expression of Hl 9 gene in cancer cells has prompted its use in clinical applications for diagnosing cancer. For example, U.S. Pat. No. 5,955,273, to some of the inventors of the present invention, teaches the use of Hl 9 gene as a tumor specific marker. PCT Pub. No. WO 2004/024957, to some of the inventors of the present invention, discloses the use of Hl 9 for the detection, in a patient suspected of having cancer, of the presence of residual cancer cells or micro-metastases originating from solid tumors.

WO 99/18195 teaches the specific expression of heterologous sequences, particularly genes encoding cytotoxic products (e.g. Diphtheria toxin), in tumor cells under the control of cancer specific promoters (e.g., Hl 9 promoters).

WO 04/031359 teaches a method for regulating the expression of angiogenesis- controlling genes in cells that are involved in neo-vascularization, comprising administering to the cells an effective amount of an Hl 9 modulator. WO 04/031359 provides a list of angiogenesis-associated conditions, which purportedly may potentially be treated by either increasing or decreasing Hl 9 expression. While a number of angiogenesis-associated genes were reported to be up-regulated in a carcinoma cell line transfected with an H19-expressing construct, down-regulation of

Hl 9 was not demonstrated. A publication by Berteaux et al. (2005) discloses two specific siRNA molecules targeted to Hl 9, which arrest in vitro growth of breast cancer cells.

Additional species of siRNA intended for silencing Hl 9 are now also available from commercial sources, including Invitrogen, Dharmacon and Qiagen. The efficacy of these commercially available Hl 9 siRNA is putative, and their utility remains to be established. Certain commercially available molecules correspond to SEQ ID NOs: 14-

25 of the present application.

WO 2007/034487 discloses a nucleic acid construct comprising: (i) a first nucleic acid sequence encoding TNF alpha; (ii) a second nucleic acid sequence encoding a Diphtheria toxin; and (iii) at least one additional nucleic acid sequence comprising a cancer specific promoter (e.g. an Hl 9 promoter); the TNF alpha and Diphtheria toxin encoding sequences being under an expression control of the cancer specific promoter. Also provided are construct systems and methods and uses of same.

WO 2007/007317 discloses isolated oligonucleotides capable of down- regulating a level of Hl 9 mRNA in cancer cells, and demonstrates in vitro and in vivo anti-cancer effects using siRNA agents comprising SEQ ID NOS: 5-8 of the present invention. Also disclosed are articles of manufacture comprising agents capable of downregulating Hl 9 mRNA in combination with an additional anti-cancer treatment as well as methods of treating cancer by administering same.

Neointimal formation after vascular injury may require the re-expression of a smooth muscle developmental sequence. Kim et al. (1994) examined expression of Hl 9 in rat blood vessels. Hl 9 was highly expressed in the 1 -day-old rat aorta but was undetectable in the adult. Hl 9 transcripts were only minimally detected in uninjured carotid artery but were abundant at 7 and 14 d after injury and were localized by in situ hybridization, primarily to the neointima. Hl 9 transcripts were undetectable in proliferating neointimal cells in culture but became highly abundant in postconfluent, differentiated neointimal cells. Hl 9 transcripts were only minimally expressed in adult medial smooth muscle cells grown under identical conditions.

Thus, Hl 9 may play an important role in the normal development and differentiation of the blood vessel and in the phenotypic changes of the smooth muscle cells, which are associated with neointimal lesion formation. Vascular smooth muscle cell migration, proliferation, and differentiation are central to blood vessel development.

Silencing oligonucleic acids

Silencing or down-regulation of specific gene expression in a cell can be carried out by oligonucleotides using techniques such as antisense therapy, RNA interference (RNAi), and enzymatic nucleic acid molecules.

"Antisense therapy" refers to the process of inactivating target DNA or mRNA sequences through the use of complementary DNA or RNA oligonucleic acids, thereby inhibiting gene transcription or translation. An antisense molecule can be single stranded, double stranded, or triple helix.

Other agents capable of inhibiting expression are for example enzymatic nucleic acid molecules such as DNAzymes and ribozymes, capable of specifically cleaving an mRNA transcript of interest. DNAzymes are single-stranded deoxyribonucleotides that are capable of cleaving both single- and double-stranded target sequences. Ribozymes are catalytic ribonucleic acid molecules that are increasingly being used for the sequence-specific inhibition of gene expression by the cleavage of mRNAs encoding proteins of interest.

RNA interference (hereinafter "RNAi") is a method of post-transcriptional inhibition of gene expression that is conserved among many eukaryotic organisms. RNAi is induced by short (i.e., <30 nucleotide) double stranded RNA ("dsRNA") molecules present in the cell. These short dsRNA molecules, called "short interfering RNA" or "siRNA", induce degradation of messenger RNAs ("mRNAs") that share sequence homology with the siRNA to within one nucleotide resolution. It is believed that the siRNA and the targeted mRNA bind to an "RNA-induced. silencing complex" or "RISC," which cleaves the targeted mRNA. The siRNA is apparently recycled much like a multiple-turnover enzyme, with 1 siRNA molecule capable of inducing cleavage of approximately 1000 mRNA molecules. siRNA-mediated RNAi degradation of mRNA is therefore more effective than currently available technologies for inhibiting expression of a target gene. U.S. Patent No. 6,506,559 to Fire et al. teaches genetic inhibition by double- stranded RNA, particularly a process for inhibition of gene expression of a target gene in a cell using RNA having a region with double-stranded structure, wherein the nucleotide sequences of the duplex region of the RNA and of a portion of the target gene are identical.

PCT Pub. No. WO 01/75164 to Tuschl et al. discloses that synthetic siRNA of 21 and 22 nucleotides in length, and which have short 3' overhangs, are able to induce RNAi of target niRNA in a Drosophila cell lysate. Cultured mammalian cells also exhibit RNAi degradation with synthetic siRNA. PCT Pub. No. WO 02/44321 relates to sequence and structural features of double-stranded (ds) RNA molecules required to mediate target-specific nucleic acid modifications such as RNA-interference and/or DNA methylation.

PCT Pub. No. WO 2006/060454 teaches methods of designing small interfering RNAs, antisense polynucleotides, and other hybridizing nucleotides. US Patent Application Publication No. 2006/0217331 discloses chemically modified double stranded nucleic acid molecules for RNA interference.

Drug-eluting stents for delivering nucleic acid agents

Delivery of sense and anti-sense nucleic acid agents from stents has been suggested. For example, U.S. Pat. No. 6,746,686 discloses an implant having a coating on its external surface comprising a crosslinked, water swellable polymer matrix and a pharmaceutically active compound comprising a nucleic acid, in which the polymer has pendant zwitterionic groups and pendant cationic groups.

U.S. Patent No. 6,506,408 discloses an implantable or insertable therapeutic agent delivery device comprising a coating material provided on at least a portion of said device, of a pH-sensitive polymer that allows release therefrom of a negatively charged therapeutic agent when contacted with a fluid at or above about a physiological pH. Optionally, the negatively charged therapeutic agent may be a nucleic acid agent such as an antisense molecule.

U.S. Pat. No. 6,468,304 discloses a device which can be implanted in the body, which comprises an electrically conducting support covered with a layer of electrically conducting polymer, to which layer is attached at least one biologically active substance of an anionic or cationic nature. Optionally, the biologically active substance may be a phosphorylated nucleic base, an antisense oligonucleotide or a vector for plasmid genes.

None of the prior art discloses or suggests that nucleic acid agents that inhibit Hl 9 expression may be applied effectively in prevention of restenosis, nor does the art teach or suggest drug-eluting stents comprising these agents. There remains an unmet medical need for therapeutic modalities useful for treating restenosis and inhibiting symptoms associated therewith.

SUMMARY OF THE INVENTION

The invention provides compositions and methods useful for inhibiting or preventing restenosis, particularly to nucleic acid agents capable of silencing or reducing the expression of the Hl 9 gene for the treatment of restenosis. In particular, the invention is directed to novel therapeutic uses for H19-silencing oligonucleotides for the preparation of pharmaceutical compositions useful for inhibiting the progression of restenosis and ameliorating symptoms thereof. The invention further provides novel drug-eluting stents, as detailed herein.

Silencing of Hl 9 has not previously been demonstrated to be beneficial for ameliorating the clinical signs of restenosis or inhibiting its progression. The present invention discloses for the first time that small interfering RNA (siRNA) agents directed to Hl 9 can exert a beneficial effect in restenosis. It is further disclosed for the first time that these agents are useful for silencing Hl 9 in drug eluting stents.

According to a first aspect, the invention provides compositions, devices and methods for treating and preventing the progression of restenosis, utilizing H 19- silencing oligonucleotides or recombinant constructs encoding them, as detailed herein. In certain embodiments, the H19-silencing oligonucleotides of the invention are selected from the group consisting of: antisense molecules, RNA interference (RNAi) molecules (e.g. small interfering RNAs (siRNAs) and hairpin RNAs) and enzymatic nucleic acid molecules (e.g. ribozymes and DNAzymes).

Non-limiting examples of H19-silencing oligonucleotides that may be used in the methods of the invention are those having a nucleic acid sequence asset forth in any one of SEQ ID NOS: 1-8 and 14-25, as detailed hereinbelow. According to some embodiments, H19-silencing oligonucleotides of the invention comprise a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1- 4, and analogs and derivatives thereof, as follows:

UAAGUCAUUUGCACUGGUU (SEQ ID NO: 1); GCAGGACAUGACAUGGUCC (SEQ ID NO: 2);

CCAACAUCAAAGACACCAU (SEQ ID NO: 3); and CCAGGCAGAAAGAGCAAGA (SEQ ID NO: 4).

In a preferable embodiment, the oligonucleotide is a small interfering RNA (siRNA) molecule, having a sense nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-4.

In certain embodiments, the siRNA molecules of the invention comprise a sense RNA strand and an antisense RNA strand, wherein the sense and the antisense RNA strands form an RNA duplex. Typically, each strand of the siRNA molecule is no more than 30 nucleotides in length, and is preferably about 20-25 or 21-23 nucleotides in length. The siRNA molecules may further comprise 3' nucleotide overhangs on either or both strands, i.e. terminal portions of the nucleotide sequence that are not base paired between the two strands of the double stranded siRNA molecule. Preferably, the overhang is about 1-5 nucleotides in length, e.g. 2 nucleotides in length.

Exemplary encoded H19-specific siRNA are those set forth in any one of SEQ ID NOS : 1 -8 and 14-25, as detailed hereinbelow.

In certain embodiments, the siRNA molecules comprise two 3' deoxythymidine overhangs, thus containing a sense strand having a nucleic acid sequence as set forth in any one of SEQ ID NOS: 5-8, as follows:

UAAGUCAUUUGCACUGGUUdTdT (SEQ ID NO: 5); GCAGGACAUGACAUGGUCCdTdT (SEQ ID NO: 6);

CCAACAUCAAAGACACCAUdTdT (SEQ ID NO: 7); and CCAGGCAGAAAGAGCAAGAdTdT (SEQ ID NO: 8).

In another embodiment, said siRNA molecules comprise at least one modified internucleoside linkage. In a particular embodiment, said modified internucleoside linkage is a phosphorothioate linkage. For example, in certain particular embodiments, said siRNA molecule comprises one or two phosphorothioate linkages at the 3' termini of each strand.

In another embodiment, said siRNA molecules comprise at least one 2'-sugar modification. In a particular embodiment, said 2'-sugar modification is a 2'-O-methyl modification.

In another particular embodiment, said siRNA molecules comprise both modified internucleoside linkages (e.g. phosphorothioate linkages) and 2'-sugar modification (e.g. 2'-O-methyl modifications).

The methods of the invention are effected by administering to or expressing in cells of the subject a therapeutically effective amount of at least one H19-silencing oligonucleotide of the invention, as detailed herein.

In one aspect, there is provided a method for treating restenosis in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of at least one H19-silencing oligonucleotide of the invention. In one aspect, there is provided a method for reducing the incidence of restenosis in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of at least one H19-silencing oligonucleotide of the invention.

In another aspect, there is provided a method for inhibiting the progression of restenosis in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of at least one H19-silencing oligonucleotide of the invention.

In another aspect, there is provided a method for ameliorating or preventing the symptoms of restenosis in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of at least one H19-silencing oligonucleotide of the invention.

In some embodiments, the at least one H19-silencing oligonucleotide is administered to said subject in the form of a pharmaceutical composition further comprising a pharmaceutically acceptable carrier, excipient or diluent. In other embodiments, the recombinant construct is administered to said subject from a drug- eluting stent. In another aspect, there is provided a method for specifically reducing Hl 9 expression in vascular smooth muscle cells of a subject afflicted with vascular occlusion or reocclusion following angioplasty, comprising the step of introducing into the occluded vessel a stent capable of eluting to the surrounding tissue an oligonucleotide capable of hybridizing with an Hl 9 transcript. In another embodiment, a therapeutically effective amount of the oligonucleotide is administered. In another embodiment, the oligonucleotide is an H19-silencing oligonucleotide of the invention.

In another embodiment, the stent is introduced as part of an angioplasty procedure (e.g. the stent is associated with the balloon). Each possibility represents a separate embodiment of the present invention.

In another aspect, there is provided a method for treating restenosis in a subject in need thereof, comprising administering to the subject a nucleic acid molecule or sequence encoding an oligonucleotide capable of hybridizing with an Hl 9 transcript. In another embodiment, a therapeutically effective amount of the nucleic acid molecule is administered. In another embodiment, the oligonucleotide encoded by the nucleic acid molecule is an H19-silencing oligonucleotide. In another embodiment, the nucleic acid sequence encoding the oligonucleotide is operably linked to at least one transcription regulating sequence. Each possibility represents a separate embodiment of the present invention. "Capable of hybridizing with an Hl 9 transcript," as used herein, refers to an ability to hybridize to a measurable extent under physiological conditions.

In a further aspect, there is provided a method for inhibiting the progression of restenosis in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of at least one recombinant construct comprising a nucleic acid sequence encoding an H19-silencing oligonucleotide of the invention, the nucleic acid sequence being operably linked to at least one transcription regulating sequence.

In another aspect, there is provided a method for ameliorating or preventing the symptoms of restenosis in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of at least one recombinant construct comprising a nucleic acid sequence encoding an H19-silencing oligonucleotide of the invention, the nucleic acid sequence being operably linked to at least one transcription regulating sequence.

According to yet a further aspect, there is provided a method for specifically reducing Hl 9 expression in vascular smooth muscle cells of a subject following angioplasty, comprising introducing a stent capable of eluting to the surrounding tissue a therapeutically effective amount of at least one recombinant construct comprising a nucleic acid sequence encoding an H19-silencing oligonucleotide of the invention, the nucleic acid sequence being operably linked to at least one transcription regulating sequence. In another aspect, the invention provides a stent capable of eluting to the surrounding tissue a therapeutically effective amount of at least one H19-silencing oligonucleotide of the invention.

In another aspect, the invention provides a stent capable of eluting to the surrounding tissue a therapeutically effective amount of at least one recombinant construct comprising a nucleic acid sequence encoding an H19-silencing oligonucleotide of the invention, the nucleic acid sequence being operably linked to at least one transcription regulating sequence.

Other objects, features and advantages of the present invention will become clear from the following description and drawings.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 is a schematic representation of an Hl 9 shRNA construct. A construct encoding a stem-loop RNA duplex containing sense and antisense strands corresponding to SEQ ID NO: 3 is illustrated. The expression cassette is followed by a terminator ("term") and an enhancer. The shRNA precursor is constructed with a GC overhang (and additional 3' overhang residues may include poly- A residues, introduced by the vector). For purposes of illustration only, an H19 promoter-driven construct is depicted; however, any promoter suitable for expression in vascular smooth muscle cells can be used. DETAILED DESCRIPTION OF THE INVENTION

The present invention relates to the treatment of restenosis, particularly to the use of nucleic acid agents capable of reducing, inhibiting, silencing or otherwise downregulating the expression of Hl 9 RNA, and in particular the use of these agents in drug eluting stents for prevention of restenosis. The invention provides methods for ameliorating restenosis and symptoms associated therewith, utilizing gene silencing oligonucleotides such as small interfering RNA (siRNA) agents directed to Hl 9 and nucleic acid constructs encoding them.

In one embodiment, the present invention provides a method for reducing occurrence of restenosis in a subject in need thereof, the method comprising the step of administration to the subject of an H19-silencing oligonucleotide, thereby reducing occurrence of restenosis in a subject. Preferably, the H19-silencing oligonucleotide is specifically hybridizable with an Hl 9 RNA. Each possibility represents a separate embodiment of the present invention. In another embodiment, the H19-silencing oligonucleotide is administered directly to the target blood vessel. In another embodiment, the H19-silencing oligonucleotide is administered to the subject systemically and reaches the target blood vessel via active transport (e.g. diffusion or circulation). In another embodiment, the H19-silencing oligonucleotide is administered to the subject via a stent capable of eluting the H19-silencing oligonucleotide. Each possibility represents a separate embodiment of the present invention.

In one embodiment, the present invention provides a method for inhibiting the progression of restenosis in a subject in need thereof, the method comprising the step of administration to the subject of an H19-silencing oligonucleotide, thereby inhibiting the progression of restenosis in a subject.

Therapeutic methods for use of inhibitory RNA (e.g. siRNA) are well known in the art. Inhibitory RNA has been used, for example, in treating Hepatitis B Virus in animal models (Morrissey D et al, Nature Biotechnology, 23(8), 1002-1007, 2005;

Morrissey D et al, Hepatology 41 (6): 1349-56, 2005). Each model represents a separate embodiment of the present invention.

"Treating" restenosis, as used herein, refers to inhibiting the progression of restenosis in a subject in need thereof, preferably following an angioplasty procedure. In some embodiments, the compositions and methods of the invention are useful for reducing the risk (incidence) or severity (extent of stenosis), of restenosis, particularly following balloon angioplasty, or in response to other vessel trauma, such as following an arterial bypass operation. In certain embodiments, a method for decreasing the level of restenosis following a stent placement medical intervention involves the continuous administration of a dose of an anti-restenotic agent or drug from the stent to vascular tissue in need of treatment in a controlled and extended in vivo drug release profile. It is envisioned that the vascular tissue in need of treatment is arterial tissue, specifically coronary arterial tissue. The method of extended in vivo release increases the therapeutic effectiveness of administration of a given dose of an anti-restenotic agent and more specifically a nucleic acid agent that reduces the proliferation of injured vascular cells involved in an angioplasty and stenting procedure.

Nucleic acid synthesis The nucleic acid agents designed according to the teachings of the present invention can be generated according to any nucleic acid synthesis method known in the art, including both enzymatic syntheses or solid-phase syntheses, as well as using recombinant methods well known in the art.

Equipment and reagents for executing solid-phase synthesis are commercially available from, for example, Applied Biosystems. Any other means for such synthesis may also be employed; the actual synthesis of the nucleic acid agents is well within the capabilities of one skilled in the art and can be accomplished via established methodologies as detailed in, for example: Sambrook, J. and Russell, D. W. (2001), "Molecular Cloning: A Laboratory Manual"; Ausubel, R. M. et al, eds. (1994, 1989), "Current Protocols in Molecular Biology," Volumes I-III, John Wiley & Sons, Baltimore, Maryland; Perbal, B. (1988), "A Practical Guide to Molecular Cloning," John Wiley & Sons, New York; utilizing solid-phase chemistry, e.g. cyanoethyl phosphoramidite followed by deprotection, desalting, and purification by, for example, an automated trityl-on method or HPLC. It will be appreciated that nucleic acid agents of the present invention can be also generated using an expression vector as is further described hereinbelow. 000191

Optionally and preferably, the nucleic acid agents of the present invention are modified. Nucleic acid agents can be modified using various methods known in the art.

In certain embodiments, nucleic acid agents are modified either in backbone, internucleoside linkages, or bases, as is broadly described hereinunder. Specific examples of nucleic acid agents useful according to this aspect of the present invention include oligonucleotides or polynucleotides containing modified backbones or non-natural internucleoside linkages. Examples of oligonucleotides or polynucleotides having modified backbones include those that retain a phosphorus atom in the backbone, as disclosed in U.S. Pat. Nos.: 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; and 5,625,050.

Other modified oligonucleotide backbones include, for example: phosphorothioates; chiral phosphorothioates; phosphorodithioates; phosphotriesters; aminoalkyl phosphotriesters; methyl and other alkyl phosphonates, including 3'- alkylene phosphonates and chiral phosphonates; phosphinates; phosphoramidates, including 3 '-amino phosphoramidate and aminoalkylphosphoramidates; thionophosphoramidates; thionoalkylphosphonates; thionoalkylphosphotriesters; and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogues of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts, and free acid forms of the above modifications can also be used.

Alternatively, modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short-chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short-chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide, and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene-containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts, as disclosed in U.S. Pat. Nos.: 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439.

Other nucleic acid agents which may be used according to the present invention are those modified in both sugar and the internucleoside linkage, i.e., the backbone of the nucleotide units is replaced with novel groups. The base units are maintained for complementation with the appropriate polynucleotide target. An example of such an oligonucleotide mimetic includes a peptide nucleic acid (PNA). A PNA oligonucleotide refers to an oligonucleotide where the sugar-backbone is replaced with an amide- containing backbone, in particular an aminoethylglycine backbone. The bases are retained and are bound directly or indirectly to aza-nitrogen atoms of the amide portion of the backbone. United States patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262; each of which is herein incorporated by reference. Other backbone modifications which may be used in the present invention are disclosed in U.S. Pat. No. 6,303,374.

Nucleic acid agents of the present invention may also include base modifications or substitutions. As used herein, "unmodified" or "natural" bases include the purine bases adenine (A) and guanine (G) and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). "Modified" bases include but are not limited to other synthetic and natural bases, such as: 5-methylcytosine (5-me-C); 5 -hydroxy methyl cytosine; xanthine; hypoxanthine; 2-aminoadenine; 6-methyl and other alkyl derivatives of adenine and guanine; 2-propyl and other alkyl derivatives of adenine and guanine; 2-thiouracil, 2-thiothymine, and 2-thiocytosine; 5-halouracil and cytosine; 5- propynyl uracil and cytosine; 6-azo uracil, cytosine, and thymine; 5-uracil (pseudouracil); 4-thiouracil; 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, and other 8-substituted adenines and guanines; 5-halo, particularly 5-bromo, 5-trifluoromethyl, and other 5-substituted uracils and cytosines; 7-methylguanine and 7-methyladenine; 8- azaguanine and 8-azaadenine; 7-deazaguanine and 7-deazaadenine; and 3- deazaguanine and 3-deazaadenine. Additional modified bases include those disclosed in: U.S. Pat. No. 3,687,808; Kroschwitz, J. L, ed. (1990), pages 858-859; Englisch et al. (1991); and Sanghvi (1993). Such modified bases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5- substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and 0-6-substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. 5- methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.20C (Sanghvi et al, 1993, pages 276-278), and are presently preferred base substitutions, even more particularly when combined with 2'-O-methoxyethyl sugar modifications.

RNA interference and small interfering RNA (siRNA) agents

In certain embodiments, the RNA-interfering oligonucleotide of the present invention is selected from the group consisting of: an antisense molecule, a RNA interference (RNAi) molecule (e.g. small interfering RNAs (siRNAs) and hairpin RNAs) and an enzymatic nucleic acid molecule (e.g. ribozymes and DNAzymes), as detailed hereinbelow. In a preferable embodiment, the oligonucleotide is a siRNA molecule. In one embodiment, the constructs of the invention direct expression in cells of the subject of an siRNA molecule that inhibits or reduces Hl 9 RNA levels via RNA interference.

"RNA interference" or "RNAi" is a term initially applied to a phenomenon observed in plants and worms where double-stranded RNA (dsRNA) blocks gene expression in a specific and post-transcriptional manner. RNA interference is a two-step process. It is believed that during the first step, which is termed the initiation step, input dsRNA is digested into 21-23 nucleotide (nt) small interfering RNAs (siRNA) by the enzyme Dicer, a member of the RNase III family of dsRNA-specific ribonucleases, which cleaves dsRNA (introduced directly or via an expressing vector, cassette or virus) in an ATP-dependent manner. Successive cleavage events degrade the RNA to 19-21 bp siRNA duplexes, each strand with 2-nucleotide 3' overhangs.

In the effector step, the siRNA duplexes bind to a nuclease complex to form the

RNA-induced silencing complex (RISC). An ATP-dependent unwinding of the siRNA duplex is believed to be required for activation of the RISC. The active RISC then targets the homologous transcript by base pairing interactions and cleaves the mRNA into 12 nucleotide fragments from the 3' terminus of the siRNA. Although the mechanism of cleavage is still to be elucidated, research indicates that each RISC contains a single siRNA and an RNase.

It is possible to eliminate the "initiation step" by providing siRNA a priori. An amplification step within the RNAi pathway has been suggested to explain the remarkable potency of RNAi. Amplification could occur by copying of the input dsRNAs, which would generate more siRNAs, or by replication of the siRNAs formed. Alternatively or additionally, amplification could be effected by multiple turnover events of the RISC.

The siRNA molecules of the present invention preferably comprise sense and antisense strands having nucleic acid sequence complementarity, wherein each strand is typically about 18-30 nucleotides in length. For example, each strand of the double stranded region may be e.g. 19-28, 19-26, 20-25, or 21-23 nucleotides in length.

In some embodiments, the sense and antisense strands of the present siRNA comprise two complementary, single-stranded RNA molecules or comprise a single molecule in which two complementary portions are base-paired and are covalently linked by a single-stranded "hairpin" area (e.g. a shRNA molecule). Without wishing to be bound by any theory, it is believed that the hairpin area of the latter type of siRNA molecule is cleaved intracellularly by Dicer (or its equivalent) to form a siRNA of two individual base-paired RNA molecules. Preferably, one or both strands of the siRNA of the invention also comprise a 3' overhang. As used herein, "3' overhang" refers to at least one unpaired nucleotide extending from the 3 '-end of an RNA strand. Thus in one embodiment, the siRNA of the invention comprises at least one 3' overhang of from 1 to about 6 nucleotides (which includes ribonucleotides or deoxynucleotides) in length, from 1 to about 5 nucleotides in length, from 1 to about 4 nucleotides in length, or from about 2 to about 4 nucleotides in length.

In the embodiment in which both strands of the siRNA molecule comprise a 3' overhang, the length of the overhangs can be the same or different for each strand. In a most preferred embodiment, the 3' overhang is present on both strands of the siRNA, and is 2 nucleotides in length. For example, each strand of the siRNA of the invention can comprise 3' overhangs of dithymidylic acid ("TT") or diuridylic acid ("UU"). For example, without limitation, synthesis of RNAi molecules suitable for use with the present invention can be carried out as follows. First, the Hl 9 nucleic acid sequence target is optionally scanned downstream for AA di-nucleotide sequences.

Each AA and the 3' adjacent 19 nucleotides is recorded as a potential siRNA target site.

Second, potential target sites are compared to an appropriate genomic database

(e.g., human, mouse, rat etc.) using any sequence alignment software, such as the

BLAST software available from the NCBI server (www.ncbi.nlm.nih.gov/BLASTΛ.

Putative target sites that exhibit significant homology to other coding sequences are filtered out.

Qualifying target sequences are selected as template for siRNA synthesis. Preferred sequences are those including low G/C content as these have proven to be more effective in mediating gene silencing as compared to those with G/C content higher than 55 %. Several target sites are preferably selected along the length of the target gene for evaluation. For better evaluation of the selected siRNAs, a negative control is preferably used in conjunction. Negative control siRNA preferably include the same nucleotide composition as the siRNAs but lack significant homology to the genome. Thus, a scrambled nucleotide sequence of the siRNA is preferably used, provided it does not display any significant homology to any other gene. An encoded siRNA agent of the present invention are of at least 10, at least 15, at least 17 or at least 19 bases specifically hybridizable with Hl 9 RNA, but excluding the full length Hl 9 RNA transcript or known variants thereof. The H19-silencing oligonucleotides of the invention are preferably no more than about 1000 bases in length, more preferably no more than about 100 bases in length. In other preferable embodiments, the oligonucleotides are no more than 30 nucleotides (or base pairs) in length.

As used herein the phrase "Hl 9 mRNA" (or "Hl 9 RNA") refers to a transcriptional product of the Hl 9 gene (see for example GenBank Accession No. M32053 - SEQ ID NO: 26). The terms "oligonucleotide" and "oligonucleic acid" are used interchangeably and refer to an oligomer or polymer of ribonucleic acid (ribo-oligonucleotide or ribo- oligonucleoside) or deoxyribonucleic acid. These terms include nucleic acid strands 008/000191

composed of naturally occurring nucleobases, sugars and covalent intersugar linkages as well as oligonucleotides having non-naturally occurring portions which function similarly. Such modified or substituted oligonucleotides may be preferred over native forms because of the valuable characteristics including, for example, increased stability in the presence of plasma nucleases and enhanced cellular uptake.

The terms "H19-silencing oligonucleic acid," "Hl 9 expression-inhibiting oligonucleic acid," "Hl 9 expression-inhibiting oligonucleotide," or "oligonucleic acid that inhibits or reduces Hl 9 expression," as used herein, denote an oligonucleic acid capable of specifically reducing the level or expression of the gene product, i.e. the level of Hl 9 RNA, below the level that is observed in the absence of the oligonucleic acid. In some embodiments gene expression is down-regulated by at least 25%, preferably at least 50%, at least 70%, 80% or at least 90%. Expression-inhibiting (down-regulating or silencing) oligonucleic acids include, for example, RNA interfering molecules (RNAi) as detailed herein. The phrase "specifically hybridizable" as used herein indicates a sufficient degree of complementarity such that stable and specific binding occurs between the target and the oligonucleotide. A nucleic acid sequence specifically hybridizable with Hl 9 RNA has a preference for hybridizing (in cells, under physiological conditions) with H19 RNA as opposed to a non-related RNA molecule (e.g. GAPDH). Preferably, said sequence has at least a 5-fold preference for hybridizing with Hl 9 RNA as opposed to a non-related RNA molecule. Thus, a siRNA specifically hybridizable with Hl 9 RNA has sufficient complementarity to an RNA product of the Hl 9 gene for the siRNA molecule to direct cleavage of said RNA via RNA interference. siRNA agents directed to Hl 9 are known in the art, and their nucleic acid sequences may be used in preparing the recombinant constructs and vectors of the invention. For example, certain H19-specific siRNA molecules are commercially available, e.g. those having a nucleic acid sequence as denoted by SEQ ID NOs: 14-25, as follows:

SEQ IDNO: 14 - CCUCUAGCUUGGAAAUGAAUAUGCU (Exon4, 1617-1641); SEQ IDNO: 15 - CCUGACUCAGGAAUCGGCUCUGGAA (Exon4, 1664-1688); SEQ IDNO: 16 - CCCAACAUCAAAGACACCAUCGGAA (Exon 5, 1719-1743); SEQ IDNO: 17 - CACCGCAAUUCAUUUAGUAUU (Exon 1, 775-793); SEQ ID NO: 18 - GAUCGGUGCCUCAGCGUUCUU (Exon 1, 1285-1303); SEQ ID NO: 19 - UGUAUGCCCUCACCGCUCAUU (Exon 1, 1050-1068); SEQ ID NO: 20 - GGAGCAGCCUUCAAGCAUUUU (Exon 5, 2201-2219); SEQ ID NO: 21 - CCACGGAGUCGGCACACUAdTdT (Exon 1, 1509-1527); SEQ ID NO: 22 - CAGCCUUCAAGCAUUCCAUUA (Exon 5, 2205-2225); SEQ ID NO: 23 - CUGCACUACCUGACUCAGGAA (Exon 4, 1656-1676); SEQ ID NO: 24 - CUCCACGGAGUCGGCACACUA (Exon 3, 1507-1527); SEQ ID NO: 25 - CCUCUAGCUUGGAAAUGAAdTdT (1617-1635).

These sequences, or sequences derived therefrom (e.g. variants), may be expressed in the target cells, with or without 3' overhang residues, as detailed herein. In certain embodiments, the siRNA comprises a sense strand as set forth in any one of SEQ ID NOS: 14-16. In certain other embodiments, the siRNA comprises a sense strand as set forth in any one of SEQ ID NOS: 18 and 20. In other particular embodiments, the siRNA comprises a sense strand as set forth in any one of SEQ ID NOS: 22-24. As illustrated in Table 1 hereinbelow, preferable silencing oligonucleotides of the invention are targeted to (hybridizable with) specific areas of the Hl 9 transcript identified in exons I5 2, and 5, and substantially comprise a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-4. In certain embodiments, the siRNA oligonucleotides are 19 base pairs in length with two 3' overhangs on each strand: Table 1 - exemplary H19-downregulating sequences (sense strand)

In Table 1 and with respect to SEQ ID NOs: 14-25, the nucleotide positions are relative to the H19 transcript as set forth in Accession No. NR_002196 (SEQ ID NO: 9).

Thus, exemplary siRNA molecules of the present invention comprise a sense strand and an antisense strand, the sense strand having a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-4, wherein the sense and/or the antisense strand optionally comprises a 3' overhang.

In one embodiment, the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 1. In another embodiment, the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 2. In another embodiment, the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 3. In another embodiment, the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 4. Each possibility represents a separate embodiment of the present invention.

Additional examples of siRNAs that are capable of down-regulating Hl 9 that may be used in the present invention are those set forth by SEQ ID NOs: 5-8, as illustrated in Table 2 hereinbelow. Preferably, these exemplary siRNA oligonucleotides are 19 base pairs in length with two 3' overhangs on each strand:

Table 2 - Exemplary siRNA sequences (sense strand)

In one embodiment, the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 5. In another embodiment, the nucleic acid sequence of the sense strand is as set forth in SEQ ID NO: 5. In another embodiment, the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 6. In another embodiment, the nucleic acid sequence of the sense strand is as set forth in SEQ ID NO: 6. In another embodiment, the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 7. In another embodiment, the nucleic acid sequence of the sense strand is as set forth in SEQ ID NO7. In another embodiment, the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 8. In another embodiment, the nucleic acid sequence of the sense strand is as set forth in SEQ ID NO: 8. Each possibility represents a separate embodiment of the present invention.

In another embodiment, the encoded siRNA comprises a nucleic acid sequence as set forth in any one of SEQ ID NOs: 1-8 and 14-25, wherein each possibility represents a separate embodiment of the present invention. In other embodiments, said siRNA consists of a nucleic acid sequence as set forth in any one of SEQ ID NOs: 1-8 and 14-25, wherein each possibility represents a separate embodiment of the present invention. In other embodiments, said siRNA is a homolog, variant, fragment or variant of a fragment of these sequences as detailed herein, wherein each possibility represents a separate embodiment of the present invention.

While a preferable embodiment of the invention is directed to double-stranded siRNA molecules wherein the two 3' nucleotides are deoxythymidine residues, as illustrated in Table 2, it is to be understood that other modifications are within the scope of the present invention. Thus, the use of analogs, variants and derivatives of the sequences set forth in any one of SEQ ID NOS: 1-8 and 14-25 is contemplated, as long as the inhibitory activity of the H19-downregulating oligonucleotide is retained. For example, in a particular embodiment, the siRNA may contain 2'-O-methyl and/or phosphorothioate substituent nucleotides. In other particular embodiments, the siRNA is a variant, homolog or derivative of any one of SEQ ID NOs: 1-8 and 14-25.

Another agent capable of silencing the expression of a Hl 9 RNA is a DNAzyme molecule capable of specifically cleaving its encoding polynucleotides. DNAzymes are single-stranded nucleic acid agents that are capable of cleaving both single and double stranded target sequences. A general model (the "10-23" model) for the DNAzyme has been proposed. "10-23" DNAzymes have a catalytic domain of 15 deoxyribonucleotides, flanked by two substrate-recognition domains of seven to nine deoxyribonucleotides each. This type of DNAzyme can effectively cleave its substrate RNA at purine:pyrimidine junctions (for a review of DNAzymes see Khachigian, 2002). Examples of construction and amplification of synthetic, engineered

DNAzymes recognizing single and double-stranded target cleavage sites have been disclosed in U.S. Pat. No. 6,326,174 to Joyce et al.

Another agent capable of silencing Hl 9 is a ribozyme molecule capable of specifically cleaving its encoding polynucleotides. Ribozymes are being increasingly used for the sequence-specific inhibition of gene expression by the cleavage of mRNAs encoding proteins of interest (Welch et ah, 1998). The possibility of designing ribozymes to cleave any specific target RNA has rendered them valuable tools in both basic research and therapeutic applications. In the therapeutics area, ribozymes have been exploited to target viral RNAs in infectious diseases, dominant oncogenes in cancers and specific somatic mutations in genetic disorders. Most notably, several ribozyme gene therapy protocols for HIV-I, cancer, and other diseases are already in clinical or pre-clinical trials. More recently, ribozymes have been used for transgenic animal research, gene target validation and pathway elucidation. Several ribozymes are in various stages of clinical trials. ANGIOZYME was the first chemically synthesized ribozyme to be studied in human clinical trials. ANGIOZYME specifically inhibits formation of the VEGF-r (Vascular Endothelial Growth Factor receptor), a key component in the angiogenesis pathway. Ribozyme Pharmaceuticals, Inc., as well as other firms have demonstrated the importance of anti-angiogenesis therapeutics in animal models. HEPTAZYME, a ribozyme designed to selectively destroy Hepatitis C Virus (HCV) RNA, was found effective in decreasing Hepatitis C viral RNA in cell culture assays (Ribozyme Pharmaceuticals, Incorporated http://www.rpi.com/index.htmD.

An additional method of silencing Hl 9 is via triplex forming oligonucleotides

(TFOs). In the last decade, studies have shown that TFOs can be designed which can recognize and bind to polypurine/polypirimidine regions in double-stranded helical

DNA in a sequence-specific manner. Thus the DNA sequence encoding the Hl 9 RNA of the present invention can be targeted thereby down-regulating the RNA molecule.

The recognition rules governing TFOs are outlined e.g. by EP Publication 375408. Modification of the oligonucleotides, such as the introduction of intercalators and backbone substitutions, and optimization of binding conditions (pH and cation concentration) have aided in overcoming inherent obstacles to TFO activity such as charge repulsion and instability, and it was recently shown that synthetic oligonucleotides can be targeted to specific sequences (for a recent review see Seidman and Glazer, 2003).

In general, the triplex-forming oligonucleotide has the sequence correspondence: oligo 3'~A G G T duplex 5?~A G C T duplex 3'~T C G A

However, it has been shown that the A-AT and G-GC triplets have the greatest triple helical stability. The same authors have demonstrated that TFOs designed according to the A-AT and G-GC rule do not form non-specific triplexes, indicating that the triplex formation is indeed sequence specific.

Thus for any given sequence in the regulatory region a triplex forming sequence may be devised. Triplex-forming oligonucleotides preferably are at least 15, more preferably 25, still more preferably 30 or more nucleotides in length, up to 50 or 100 bp.

Transfection of cells (for example, via cationic liposomes) with TFOs, and subsequent formation of the triple helical structure with the target DNA, induces steric and functional changes, blocking transcription initiation and elongation, allowing the introduction of desired sequence changes in the endogenous DNA and results in the specific downregulation of gene expression. In addition, Vuyisich and Beal have recently shown that sequence specific TFOs can bind to dsRNA, inhibiting activity of dsRNA-dependent enzymes such as RNA-dependent kinases (Vuyisich and Beal, 2000). Additionally, TFOs designed according to the abovementioned principles can induce directed mutagenesis capable of effecting DNA repair, thus providing both downregulation and upregulation of expression of endogenous genes (Seidman and Glazer, 2003). Detailed description of the design, synthesis and administration of effective TFOs can be found in U.S. Patent Application Nos. 2003 017068 and 2003 0096980 to Froehler et ah, and 2002 0128218 and 2002 0123476 to Emanuele et al., and U.S. Pat. No. 5,721,138 to Lawn.

It will be appreciated that nucleic acid agents capable of hybridizing to Hl 9 RNA may down-regulate an activity thereof by preventing binding of Hl 9 RNA to another downstream agent.

Recombinant constructs, vectors and host cells

As mentioned hereinabove, the nucleic acid agents of the present invention (e.g., an siRNA molecule such as those set forth by any one of SEQ ID Nos: 1-8) can be expressed in cells.

It will be appreciated that the agents of the present invention may be expressed directly in the subject (i.e. in vivo gene therapy) or may be expressed ex vivo in a cell system (autologous or non-autologous) and then administered to the subject. 0191

The term "construct" as used herein includes a nucleic acid sequence encoding silencing oligonucleic acid according to the present invention, the nucleic acid sequence operably linked to a promoter and optionally other transcription regulation sequences.

To express such an agent (i.e., to produce an RNA molecule) in mammalian cells, a nucleic acid sequence encoding the agents of the present invention is preferably ligated into a nucleic acid construct suitable for mammalian cell expression. Such a nucleic acid construct includes a promoter sequence for directing transcription of the polynucleotide sequence in the cell in a constitutive or inducible manner.

The constructs of the present invention may be produced using standard recombinant and synthetic methods well known in the art. An isolated nucleic acid sequence can be obtained from its natural source, either as an entire (i.e., complete) gene or a portion thereof. A nucleic acid molecule can also be produced using recombinant DNA technology (e.g., polymerase chain reaction (PCR) amplification, cloning) or chemical synthesis (see e.g. Sambrook et al., 2001; Ausubel, et al., 1989, Chapters 2 and 4). Nucleic acid sequences include natural nucleic acid sequences and homologs thereof, including, but not limited to, natural allelic variants and modified nucleic acid sequences in which nucleotides have been inserted, deleted, substituted, and/or inverted in such a manner that such modifications do not substantially interfere with the nucleic acid molecule's ability to encode a functional oligonucleotide of the invention.

A nucleic acid molecule homolog can be produced using a number of methods known to those skilled in the art (see, for example, Sambrook et al., 2001). For example, nucleic acid molecules can be modified using a variety of techniques including, but not limited to, classic mutagenesis techniques and recombinant DNA techniques, such as site-directed mutagenesis, chemical treatment of a nucleic acid molecule to induce mutations, restriction enzyme cleavage of a nucleic acid fragment, ligation of nucleic acid fragments, polymerase chain reaction (PCR) amplification and/or mutagenesis of selected regions of a nucleic acid sequence, synthesis of oligonucleotide mixtures and ligation of mixture groups to "build" a mixture of nucleic acid molecules and combinations thereof. For example, nucleic acid molecule homologs can be selected from a mixture of modified nucleic acids by screening for the function of the oligonucleic acid encoded by the nucleic acid with respect to occurrence of restenosis, for example by the methods described herein. The phrase "operably linked" refers to linking a nucleic acid sequence to a transcription control sequence in a manner such that the molecule is able to be expressed when transfected (i.e., transformed, transduced, infected or transfected) into a host cell. Transcription control sequences are sequences, which control the initiation, elongation, and termination of transcription. Particularly important transcription control sequences are those that control transcription initiation, such as promoter, enhancer, operator and repressor sequences. Suitable transcription control sequences include any transcription control sequence that can function in at least one of the recombinant cells of the present invention. A variety of such transcription control sequences are known to those skilled in the art. Exemplary suitable transcription control sequences include those that function in animal, bacteria, helminth, yeast and insect cells. Preferably, the constructs of the invention comprise mammalian transcription control sequences, more preferably human regulatory sequences, and, optionally and additionally, other regulatory sequences. Constitutive promoters suitable for use with the present invention are promoter sequences that are active under most environmental conditions and most types of cells such as the cytomegalovirus (CMV) and Rous sarcoma virus (RSV). Inducible promoters are induced in particular cell types or under certain conditions.

In another aspect, there is provided a vector comprising at least one recombinant construct comprising at least one nucleic acid sequence encoding a small interfering

RNA (siRNA) molecule directed to Hl 9, the nucleic acid sequence being operably linked to at least one transcription-regulating sequence. In another embodiment, the transcription-regulating sequence is a promoter. In another embodiment, the transcription-regulating sequence is another type of transcription-regulating sequence. In another embodiment, the transcription-regulating sequence is an H19-specific promoter.

In another embodiment, the H19-specific promoter has a nucleic acid sequence as set forth in SEQ ID NO: 29. In another embodiment, the H19-specific promoter is a homolog of SEQ ID NO: 29. In another embodiment, the promoter is a variant of SEQ ID NO: 29. In another embodiment, the promoter is a fragment of SEQ ID NO: 29. In another embodiment, the promoter is a homolog of a fragment of SEQ ID NO: 29. In different embodiments, "homolog" may refer e.g. to any degree of homology disclosed 000191

herein. In another embodiment, the promoter is a variant of a fragment of SEQ ID NO: 29. Each possibility represents a separate embodiment of the present invention.

As used herein, the term "variant" refers to substantially similar sequences possessing common qualitative biological activities. An oligonucleotide variant includes a pharmaceutically acceptable salt, homolog, analog, extension or fragment of a nucleotide sequence useful for the invention. Encompassed within the term "variant" are chemically modified natural and synthetic nucleotide molecules (derivatives). Also encompassed within the term "variant" are substitutions (conservative or non- conservative), additions or deletions within the nucleotide sequence of the molecule, as long as the required function is sufficiently maintained. Oligonucleotide and polynucleotides variants may share at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity (homology). In different embodiments, "homolog" may refer e.g. to any degree of homology disclosed herein.

In another particular embodiment, the H19-specific promoter has a nucleic acid sequence as set forth in SEQ ID NO: 30. In another embodiment, the H19-specific promoter is a homolog of SEQ ID NO: 30. In another embodiment, the promoter is a variant of SEQ ID NO: 30. In another embodiment, the promoter is a fragment of SEQ

ID NO: 30. In another embodiment, the promoter is a homolog of a fragment of SEQ ID

NO: 30. In different embodiments, "homolog" may refer e.g. to any degree of homology disclosed herein. In another embodiment, the promoter is a variant of a fragment of

SEQ ID NO: 30. Each possibility represents a separate embodiment of the present invention.

In another embodiment, the transcription-regulating sequence is a tissue-specific promoter (e.g. a vascular smooth muscle cell promoter). In another embodiment, the sequence is a tumor necrosis factor alpha promoter (Monraats et al, FASEB J 19(14): 1998-2004, 2005). In another embodiment, the sequence is an Interleukin 18 promoter (Chandrasekar et al, J Biol Chem 281(22): 15099-109, 2006). In another embodiment, the sequence is a nitric oxide synthase promoter (Gomma et al, Eur Heart J ;23(24): 1955-62, 2002). In another embodiment, the sequence is a RASLIlB promoter. In another embodiment, the sequence is a Platelet-derived growth factor promoter (Li et al, J Cardiovasc Pharmacol 48(4): 184-90, 2006). In another embodiment, the sequence is a RASLIlB promoter. In another embodiment, the sequence is an ICAM-I (intracellular adhesion molecule 1) promoter (Kollum et al, Coron Artery Dis 18(2): 117-23, 2007). In another embodiment, the sequence is a bFGF (Basic fibroblast growth factor) promoter (Wildgruber et al, Eur J Vase Endovasc Surg 34(1): 35-43, 2007). In another embodiment, the sequence is a smooth muscle alpha-actin promoter. In another embodiment, the sequence is a Myocardin (Myocd) promoter. In another embodiment, the sequence is a Myocardin-related transcription factor A (MRTF-A) promoter. In another embodiment, the sequence is a MRTF-B promoter. In another embodiment, the sequence is a smooth muscle myosin heavy-chain promoter (Franz et al, Cardiovasc Res 43(4): 1040-8, 1999). In another embodiment, the sequence is a TGFB (Transforming growth factor beta) promoter (Wildgruber et al, Eur J Vase Endovasc Surg 34(1): 35-43, 2007). In another embodiment, the sequence is a serum response factor (SRF) promoter. In another embodiment, the sequence is a MEF2B promoter. In another embodiment, the sequence is a MEF2C promoter. In another embodiment, the sequence is a Phoxl/Mhox promoter. In another embodiment, the sequence is a Barxlb promoter. In another embodiment, the sequence is a Barx2b promoter. In another embodiment, the sequence is a Nkx3.1 promoter. In another embodiment, the sequence is a Nkx3.2 promoter. In another embodiment, the sequence is a Hox B7 promoter. In another embodiment, the sequence is a Hex promoter. In another embodiment, the sequence is a Gax (Mox2) promoter. In another embodiment, the sequence is a GATA 4 promoter. In another embodiment, the sequence is a GATA 5 promoter. In another embodiment, the sequence is a GATA 6 promoter. Each possibility represents a separate embodiment of the present invention. In another embodiment, the transcription-regulating sequence is any promoter known in the art capable of directing expression of a gene in a vascular smooth muscle cell.

In another embodiment, the transcription-regulating sequence is an H19-specific enhancer element. In another embodiment, the enhancer has a nucleic acid sequence as set forth in SEQ ID NO: 31. In another embodiment, the enhancer is a homolog of SEQ

ID NO: 31. In another embodiment, the enhancer is a variant of SEQ ID NO: 31. In another embodiment, the enhancer is a fragment of SEQ ID NO: 31. In another embodiment, the enhancer is a homolog of a fragment of SEQ ID NO: 31. In different embodiments, "homolog" may refer e.g. to any degree of homology disclosed herein. In another embodiment, the enhancer is a variant of a fragment of SEQ ID NO: 31. Each possibility represents a separate embodiment of the present invention. In another embodiment, the enhancer has a nucleic acid sequence as set forth in SEQ ID NO: 32. In another embodiment, the enhancer is a homolog of SEQ ID NO: 32. In another embodiment, the enhancer is a variant of SEQ ID NO: 32. In another embodiment, the enhancer is a fragment of SEQ ID NO: 32. In another embodiment, the enhancer is a homolog of a fragment of SEQ ID NO: 32. In different embodiments, "homolog" may refer e.g. to any degree of homology disclosed herein. In another embodiment, the enhancer is a variant of a fragment of SEQ ID NO: 32. Each possibility represents a separate embodiment of the present invention.

In another embodiment, the enhancer has a nucleic acid sequence as set forth in SEQ ID NO: 33. In another embodiment, the enhancer is a homolog of SEQ ID NO: 33.

In another embodiment, the enhancer is a variant of SEQ ID NO: 33. In another embodiment, the enhancer is a fragment of SEQ ID NO: 33. In another embodiment, the enhancer is a homolog of a fragment of SEQ ID NO: 33. In different embodiments,

"homolog" may refer e.g. to any degree of homology disclosed herein. In another embodiment, the enhancer is a variant of a fragment of SEQ ID NO: 33. Each possibility represents a separate embodiment of the present invention.

In another embodiment, the transcription-regulating sequence is a tissue specific enhancer element (e.g. a vascular smooth muscle cell enhancer element). In another embodiment, the enhancer is from the promoter region of one of the vascular smooth muscle cell-expressed genes in the above paragraph.

In another embodiment, the transcription-regulating sequence is a serum response factor (SRF) enhancer element. In another embodiment, the sequence is a MEF2B enhancer element. In another embodiment, the sequence is a MEF2C enhancer element. In another embodiment, the sequence is a Phoxl/Mhox enhancer element. In another embodiment, the sequence is a Barxlb enhancer element. In another embodiment, the sequence is a Barx2b enhancer element. In another embodiment, the sequence is a Nkx3.1 enhancer element. In another embodiment, the sequence is a Nkx3.2 enhancer element. In another embodiment, the sequence is a Hox B 7 enhancer element. In another embodiment, the sequence is a Hex enhancer element. In another embodiment, the sequence is a Gax (Mox2) enhancer element. In another embodiment, the sequence is a GATA 4 enhancer element. In another embodiment, the sequence is a GATA 5 enhancer element. In another embodiment, the sequence is a GATA 6 enhancer element. In another embodiment, the transcription-regulating sequence is any enhancer element known in the art capable of enhancing expression of a gene in a vascular smooth muscle cell.

Each possibility represents a separate embodiment of the present invention.

As used herein, the term "vector" refers to a construct comprising a regulatory sequence operatively linked to a heterologous polynucleotide that is administered to target cells. The vector can be a viral expression vector, a plasmid or a construct of naked DNA, and, optionally, can include additional sequences required for construction, selection, stability, penetration, etc.

The nucleic acid construct (also referred to herein as an "expression vector") of the present invention include, in another embodiment, additional sequences, which render this vector suitable for replication and integration in prokaryotes, eukaryotes, or preferably both (e.g., shuttle vectors). In addition, typical cloning vectors may also contain a transcription and translation initiation sequence, a transcription and translation terminator, and/or a polyadenylation signal. Eukaryotic promoters typically contain two types of recognition sequences, the

TATA box and upstream promoter elements. The TATA box, located 25-30 base pairs upstream of the transcription initiation site, is thought to be involved in directing RNA polymerase to begin RNA synthesis. The other upstream promoter elements determine the rate at which transcription is initiated. Preferably, the promoter utilized by the nucleic acid construct of the present invention is active in the specific target cell population. For example, without limitation, the construct may comprise any promoter or enhancer element known in the art that functions in vascular smooth muscle cells.

Enhancer elements can stimulate transcription up to 1, 000-fold from linked homologous or heterologous promoters. Enhancers are active when placed downstream or upstream from the transcription initiation site. Many enhancer elements derived from viruses have a broad host range and are active in a variety of tissues. For example, the SV40 early gene enhancer is suitable for many cell types. Other enhancer/promoter combinations that are suitable for the present invention include those derived from polyoma virus, human or murine cytomegalovirus (CMV), the long term repeat from various retroviruses such as murine leukemia virus, murine or Rous sarcoma virus and HIV. See, Enhancers and Eukaryotic Expression, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. 1983, which is incorporated herein by reference.

In the construction of the expression vector, the promoter is preferably positioned approximately the same distance from the heterologous transcription start site as it is from the transcription start site in its natural setting. As is known in the art, however, some variation in this distance can be accommodated without loss of promoter function.

Polyadenylation sequences can also be added to the expression vector in order to increase RNA stability. Two distinct sequence elements are required for accurate and efficient polyadenylation: GU or U rich sequences located downstream from the polyadenylation site and a highly conserved sequence of six nucleotides, AAUAAA, located 11-30 nucleotides upstream. Exemplary termination and polyadenylation signals that are suitable for the present invention include those derived from SV40.

In addition to the elements already described, the expression vector of the present invention may typically contain other specialized elements intended to increase the level of expression of cloned nucleic acids or to facilitate the identification of cells that carry the recombinant DNA. For example, a number of animal viruses contain

DNA sequences that promote the extra chromosomal replication of the viral genome in permissive cell types. Plasmids bearing these viral replicons are replicated episomally as long as the appropriate factors are provided by genes either carried on the plasmid or with the genome of the host cell.

The vector may or may not include a eukaryotic replicon. If a eukaryotic replicon is present, then the vector is amplifiable in eukaryotic cells using the appropriate selectable marker. If the vector does not comprise a eukaryotic replicon, no episomal amplification is possible. Instead, the recombinant DNA integrates into the genome of the engineered cell, where the promoter directs expression of the desired nucleic acid.

The type of vector may be selected e.g. for producing single-stranded or double- stranded RNA or DNA. Suitable vectors for producing various silencing oligonucleic acids are known in the art. For example, RNAi expression vectors (also referred to as a dsRNA-encoding plasmid) are replicable nucleic acid constructs used to express (transcribe) RNA which produces siRNA moieties in the cell in which the construct is expressed. Such vectors include a transcriptional unit comprising an assembly of (1) genetic element(s) having a regulatory role in gene expression, for example, promoters, operators, or enhancers, operatively linked to (2) a "coding" sequence which is transcribed to produce a double-stranded RNA (two RNA moieties that anneal in the cell to form an siRNA, or a single hairpin RNA which can be processed to an siRNA), and (3) appropriate transcription initiation and termination sequences.

Some of these vectors have been engineered to express small hairpin RNAs (shRNAs), which are processed in vivo into siRNA-like molecules capable of carrying out gene-specific silencing. Another type of siRNA expression vector encodes the sense and antisense siRNA strands under control of separate pol III promoters. The siRNA strands from this vector, like the shRNAs of the other vectors, may have 3' thymidine termination signals. Silencing efficacy by both types of expression vectors was comparable to that induced by transiently transfecting siRNA.

Expression vectors containing regulatory elements from eukaryotic viruses such as retroviruses can be also used.

Various vectors for delivering and expressing silencing RNA molecules such as siRNAs are known in the art, and include for example plasmid vectors, inducible vectors, adenoviral vectors, retroviral vectors and lentiviral vectors and CMV-based vectors. Exemplary vectors include pSilencer™ vectors (Ambion), Genescript siRNA vectors, Imagenex vectors (e.g. IMG-1000, IMG-700 and IMG-1200), among others.

As described above, viruses are very specialized infectious agents that have evolved, in many cases, to elude host defense mechanisms. Typically, viruses infect and propagate in specific cell types. The targeting specificity of viral vectors utilizes its natural specificity to specifically target predetermined cell types and thereby introduce a recombinant gene into the infected cell. Thus, the type of vector used by the present invention will depend on the cell type transformed. The ability to select suitable vectors according to the cell type transformed is well within the capabilities of the ordinary skilled artisan and as such no general description of selection consideration is provided herein. Recombinant viral vectors are useful for in vivo expression of the H19-silencing agents of the present invention since they offer advantages such as lateral infection and targeting specificity. Lateral infection is inherent in the life cycle of, for example, retrovirus and is the process by which a single infected cell produces many progeny virions that bud off and infect neighboring cells. The result is that a large area becomes rapidly infected, most of which was not initially infected by the original viral particles. This is in contrast to vertical-type of infection in which the infectious agent spreads only through daughter progeny. Viral vectors can also be produced that are unable to spread laterally. This characteristic can be useful if the desired purpose is to introduce a specified gene into only a localized number of targeted cells.

Various methods can be used to introduce the expression vector of the present invention into cells. Such methods are generally described in Sambrook et al, (1989, 1992), in Ausubel et al., (1989), Chang et al., (1995), Vega et al., (1995), and Gilboa et at. (1986), and include, for example, stable or transient transfection, lipofection, electroporation and infection with recombinant viral vectors. In addition, see U.S. Pat. Nos. 5,464,764 and 5,487,992 for positive-negative selection methods.

Introduction of nucleic acids by viral infection offers several advantages over other methods such as lipofection and electroporation, since higher transfection efficiency can be obtained due to the infectious nature of viruses.

Other than containing the necessary elements for the transcription of the inserted coding sequence, the expression construct of the present invention can also include sequences engineered to enhance stability, production, purification, yield or toxicity of the expressed RNA.

In certain embodiments, the vector is constructed so as to enable stable expression of the siRNA agent in the target cell. For example, the vector may be integrated to the genome of the target cell using viral vectors (e.g. lentiviral vectors) or specific recombination (e.g. by the Cre/lox site-specific recombination system known in the art may be conveniently used which employs the bacteriophage Pl protein Cre recombinase and its recognition sequence loxP).

In another aspect, the invention provides an isolated host cell comprising at least one recombinant construct comprising at least one nucleic acid sequence encoding a small interfering RNA (siRNA) molecule directed to Hl 9. Useful lipids for lipid-mediated transfer of the gene are, for example, DOTMA,

DOPE, and DC-Choi (Tonkinson et al., 1996). Other vectors can be used, such as cationic lipids, poly Iy sine, and dendrimers. Other than containing the necessary elements for the transcription of the inserted coding sequence, the expression construct of the present invention can also include sequences engineered to enhance stability, production, purification, yield or toxicity of the expressed RNA.

Pharmaceutical compositions

The agents of the present invention can be administered to a subject per se, or in a pharmaceutical composition where they are mixed with suitable carriers or excipients.

In various embodiments, the composition comprises as an active agent an Hl 9- silencing oligonucleotide of the invention. It should further be noted, that Hl 9 silencing agents (e.g. siRNA) used in the compositions and methods of the present invention may contain a nucleic acid sequence as denoted herein, including analogs, variants and derivatives thereof as detailed herein, with or without a 3' overhang. In certain embodiments, H19-silencing oligonucleotides (e.g. siRNA) having a nucleic acid sequence as set forth in any one of SEQ ID NOs: 1-8 and 14-25, including variants, analogs and derivatives thereof, may be used. Thus, for example, sequences in which a deoxythymidine (dT) residue has been substituted for a uracil residue or is absent may be used (for example, when expressing an siRNA molecule from a nucleic acid construct of the invention). As used herein, "pharmaceutical composition" refers to a preparation of one or more of the active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients. The purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism.

Herein the term "active ingredient" refers to the agent accountable for the reduction or prevention of restenosis (Hl 9-silencing agent).

Hereinafter, the phrases "physiologically acceptable carrier" and "pharmaceutically acceptable carrier" which may be interchangeably used refer to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound. Herein the term "excipient" refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient. Examples, without limitation, of excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols.

Techniques for formulation and administration of drugs may be found in "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, PA, latest edition, which is incorporated herein by reference.

Methods for the delivery of nucleic acid molecules is described in Akhtar et al., 1992, Trends Cell Biol., 2, 139; and Delivery Strategies for Antisense Oligonucleotide Therapeutics, ed. Akhtar, 1995 which are both incorporated herein by reference. Sullivan et al., WO 94/02595, further describes the general methods for delivery of enzymatic RNA molecules. These protocols can be utilized for the delivery of virtually any nucleic acid molecule. Nucleic acid molecules can be administered to cells by a variety of methods known to those familiar to the art, including, but not restricted to, encapsulation in liposomes, by iontophoresis, or by incorporation into other vehicles, such as hydrogels, cyclodextrins, biodegradable nanocapsules, and bioadhesive microspheres. For some indications, nucleic acid molecules can be directly delivered ex vivo to cells or tissues with or without the aforementioned vehicles. Alternatively, the nucleic acid/vehicle combination is locally delivered by direct injection or by use of a catheter, infusion pump or stent. Other routes of delivery include, but are not limited to, intravascular, intramuscular, subcutaneous or joint injection, aerosol inhalation, oral (tablet or pill form), topical, systemic, ocular, intraperitoneal and/or intrathecal delivery. More detailed descriptions of nucleic acid delivery and administration are provided in Sullivan et al., WO 94/02595 and Draper et al., WO 93/23569 which have been incorporated by reference herein. The molecules of the instant invention can be used as pharmaceutical agents.

Pharmaceutical agents prevent, inhibit the occurrence, or treat (alleviate a symptom to some extent, preferably all of the symptoms) of the disease state in a patient.

Alternately, one may administer the pharmaceutical composition in a local rather than systemic manner, for example by direct injection or by means of a catheter, infusion pump or stent. Alternatively, the nucleic acid is locally delivered in a sustained or extended release manner in particular by means of a drug-eluting stent. In another particular embodiment, administering is carried out by injecting the nucleic acid agent from an injection balloon catheter directly into the vascular injury site, under pressure, through injectors contained on the surface of the catheter balloon.

Pharmaceutical compositions for use in accordance with the present invention thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations that can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.

For injection, the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological salt buffer. For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.

For oral administration, the pharmaceutical composition can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art. Such carriers enable the pharmaceutical composition to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for oral ingestion by a patient. Pharmacological preparations for oral use can be made using a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carbomethylcellulose; and/or physiologically acceptable polymers such as polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.

Dragee cores are provided with suitable coatings. For this purpose, concentrated sugar solutions may be used which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.

Pharmaceutical compositions which can be used orally, include push-fit capsules made of gelatin as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules may contain the active ingredients in admixture with filler such as lactose, binders such as starches, lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active ingredients may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added. All formulations for oral administration should be in dosages suitable for the chosen route of administration.

For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner.

For administration by nasal inhalation, the active ingredients for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from a pressurized pack or a nebulizer with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluorornethane, dichloro- tetrafluoroethane or carbon dioxide. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of, e.g., gelatin for use in a dispenser may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.

The pharmaceutical composition described herein may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multidose containers with optionally, an added preservative. The compositions may be suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.

Pharmaceutical compositions for parenteral administration include aqueous solutions of the active preparation in water-soluble form. Additionally, suspensions of the active ingredients may be prepared as appropriate oily or water based injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes. Aqueous injection suspensions may contain substances, which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the active ingredients to allow for the preparation of highly concentrated solutions.

Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water based solution, before use.

The pharmaceutical composition of the present invention may also be formulated in rectal compositions such as suppositories or retention enemas, using, e.g., conventional suppository bases such as cocoa butter or other glycerides.

Preferably the pharmaceutical composition can also include a transfection agent such as DOTMA, DOPE, and DC-Choi (Tonkinson et al., 1996). A preferred example of a transfection agent is poly(ethylamine) (PEI).

Pharmaceutical compositions suitable for use in context of the present invention include compositions wherein the active ingredients are contained in an amount effective to achieve the intended purpose. More specifically, a therapeutically effective amount means an amount of active ingredients (nucleic acid agent) effective to prevent, alleviate or ameliorate symptoms of a disorder or prolong the survival of the subject being treated. Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.

For any preparation used in the methods of the invention, the therapeutically effective amount or dose can be estimated initially from in vitro and cell culture assays.

For example, a dose can be formulated in animal models to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans.

Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals. The data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human. The dosage may vary depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can 1

be chosen by the individual physician in view of the patient's condition. (See e.g., Fingl, et al., 1975).

Dosage amount and interval may be adjusted individually to provide plasma or tissue levels of the active ingredient are sufficient to induce or suppress the biological effect (minimal effective concentration or "MEC"). The MEC will vary for each preparation, but can be estimated from in vitro data. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations.

Depending on the severity and responsiveness of the condition to be treated, dosing can be of a single or a plurality of administrations, with course of treatment lasting from several days to several weeks or until cure is effected or diminution of the disease state is achieved.

The amount of a composition to be administered will, of course, be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc.

Compositions of the present invention may, if desired, be presented in a pack or dispenser device, such as an FDA approved kit, which may contain one or more unit dosage forms containing the active ingredient. The pack may, for example, comprise metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration. The pack or dispenser may also be accommodated by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions or human or veterinary administration. Such notice, for example, may be of labeling approved by the U.S. Food and Drug Administration for prescription drugs or of an approved product insert. Compositions comprising a preparation of the invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition, as if further detailed above.

Drug-eluting stents

In another aspect, the invention provides an implantable or insertable medical device or apparatus such as a surgical stent that allows release therefrom of an Hl 9- silencing agent of the invention. The drug-eluting stents of the invention are useful e.g. for inhibiting or preventing restenosis, e.g. following cardiac angioplasty.

Methods for assessing the release profile of a bioactive agent from a stent are known in the art. In one example described in detail in U.S. Patent Application Publication number 2006/0204547 the agent or drug will be contained in reservoirs in the stent body prior to release. In the reservoir example, the drug will be held within the reservoirs in the stent in a drug delivery matrix comprised of the drug and a polymeric material and optionally additives to regulate the drug release. Preferably the polymeric material is a bioresorbable polymer. The drug delivery stent of the present invention can include matrices fixed to a stent in a variety of manners including reservoirs, coatings, microspheres, affixed with adhesion materials or combinations thereof.

Each patent and published patent application cited herein is incorporated herein by reference. Stent designs and materials, including biodegradable stents which release compound upon biodegradation, or which include a coating containing the compound in diffusable form, are known (U.S. Pat. Nos. 5,997,468; 5,871,535 and 7,056,339).

Preparation of a stent and its coating with an H19-silencing agent-containing formulation is performed by methods known in the art. For example, methods for preparing drug-eluting stents for delivering nucleic acid agents is described in U.S. Patent Nos. 6,468,304 (coating by electropolymerization or deposition of the polymer in solution on the support, followed by electrochemical oxidation or reduction); 6,746,686 (coating with a water swellable polymer matrix); and 6,506,408 (coating with a pH- sensitive polymer). The medical device can also be coated with a formulation comprising the H19-silencing nucleic acid agents of the invention, as described, for example, in U.S. Pat. No. 6,395,029.

In certain embodiments wherein the stent comprises a support coated by a formulation comprising the H19-silencing nucleic acid agents, it is advantageous to use a metallic support made, for example, of steel, of metal alloy or of a metal which is biocompatible and more particularly of stainless steel, tantalum, platinum, gold, nickel- titanium alloy or platinum-indium alloy. A support made of stainless steel can be advantageously used when the coating reagents (e.g. electrolytic media) do not comprise chloride. It is also possible to use a nonmetallic support. For example, biologically compatible electrically conducting charged polymers can be coated according to the methods described in U.S. Patent Nos. 6,468,304.

Additional platforms for the invention include polymeric biodegradable stents and scaffolds, including synthetic biodegradable or bioerodible porous scaffolds produced using solid free-form fabrication techniques which include selective laser sintering, three-dimensional printing, fused deposition manufacturing, and stereolithography for micro- or nano-fabrication.

The H19-silencing agent may be inserted into reservoirs in the stent in their pure form, as a liquid solution or gel, or they may be encapsulated within or by a release system, e.g. in a matrix formed of degradable material or a material which releases incorporated molecules by diffusion out of or disintegration of the matrix. The molecules can be sometimes contained in a release system because the degradation, dissolution, or diffusion properties of the release system provide a method for controlling the release rate of the molecules. The molecules can be homogeneously or heterogeneously distributed within the release system. Selection of the release system is dependent on the desired rate of release of the molecules. Both non-degradable and degradable release systems can be used for delivery of molecules. Suitable release systems include polymers and polymeric matrices, non-polymeric matrices, or inorganic and organic excipients and diluents such as, but not limited to, calcium carbonate and sugar. Release systems may be natural or synthetic, although synthetic release systems typically are preferred due to the better characterization of release profiles (see, for example, U.S. Pat. No. 6,656,162).

Thus, there is provided in another aspect an intracoronary stent capable of eluting to the surrounding tissue a therapeutically effective amount of at least one Hl 9- silencing oligonucleotide.

In another aspect, there is provided an intracoronary stent capable of eluting to the surrounding tissue a therapeutically effective amount of at least one recombinant construct comprising a nucleic acid sequence encoding an H19-silencing oligonucleotide, the nucleic acid sequence being operably linked to at least one transcription regulating sequence. In certain embodiments, the at least one H19-silencing oligonucleotide is selected from the group consisting of: an antisense molecule, a RNA interference (RNAi) molecule and an enzymatic nucleic acid molecule, preferably a small interference RNA (siRNA) molecule. In a preferable embodiment, the H19-silencing oligonucleotide has a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-4.

In another preferred embodiment, the siRNA molecule comprises a sense strand selected from the group consisting of SEQ ID NOS: 5-8.

In another preferred embodiment, the H19-silencing oligonucleotide is specifically hybridizable with an Hl 9 RNA comprising a sequence according to any one of SEQ ID NOS: 1-8 and 14-25.

Therapeutic use

According to certain embodiments, the H19-silencing oligonucleotides of the invention are useful in prevention or reduction of restenosis in particular in drug eluting stents. Thus, the invention is directed to the use of a H19-silencing oligonucleotide of the invention for the preparation of a stent, medical device, or medicament useful for treating restenosis, for inhibiting the progression thereof, for ameliorating or preventing the symptoms associated therewith and/or for specifically reducing Hl 9 expression in vascular smooth muscle cells of a subject afflicted with restenosis as detailed herein. In other embodiments the invention is directed to the use of a recombinant construct encoding an H19-silencing oligonucleotide of the invention for the preparation of a medicament or medical device useful for treating restenosis, for inhibiting the progression thereof, for ameliorating or preventing the symptoms associated therewith, and/or for specifically reducing Hl 9 expression in intimal tissue of a subject afflicted with restenosis, as detailed herein.

Yet certain other embodiments of the present invention are directed to the use of an H19-silencing oligonucleotide, or a recombinant construct encoding same, for the preparation of a medicament for treating, reducing occurrence or inhibiting the progression of restenosis in a subject in need thereof. 000191

In various embodiments, the H19-silencing oligonucleotide is specifically hybridizable with an Hl 9 RNA comprising a sequence according to any one of SEQ ID NOS: 1-8 and 14-25.

In various embodiments, the H19-silencing oligonucleotide is a siRNA comprising a nucleic acid sequence as set forth in any one of SEQ ID NOs: 1-8 and 14-

25, wherein each possibility represents a separate embodiment of the present invention.

In other embodiments, said siRNA consists of a nucleic acid sequence as set forth in any one of SEQ ID NOs: 1-8 and 14-25, wherein each possibility represents a separate embodiment of the present invention. In other embodiments, said siRNA is a homolog, variant, fragment or variant of a fragment of these sequences as detailed herein, wherein each possibility represents a separate embodiment of the present invention.

In one aspect, there is provided a method for preventing restenosis in a subject in need thereof, comprising administering to, or expressing in cells of the subject a therapeutically effective amount of at least one H19-silencing oligonucleotide. In a preferred embodiment, the Hl 9-silencing oligonucleotide has a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-4.

In another aspect, there is provided a method for inhibiting the progression of restenosis in a subject in need thereof, comprising administering to, or expressing in cells of the subject a therapeutically effective amount of at least one Hl 9-silencing oligonucleotide.

In a preferred embodiment, the Hl 9-silencing oligonucleotide has a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-4.

In another aspect, there is provided a method for ameliorating or preventing the symptoms of restenosis in a subject in need thereof, comprising administering to, or expressing in cells of the subject a therapeutically effective amount of at least one Hl 9- silencing oligonucleotide.

In a preferred embodiment, the Hl 9-silencing oligonucleotide has a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-4.

In another aspect, there is provided a method for specifically reducing Hl 9 expression in vascular smooth muscle cells, comprising administering to, or expressing in cells of the subject a therapeutically effective amount of at least one Hl 9-silencing nucleotide. In another embodiment, the H19-silencing nucleotide is expressed from an H19-specific promoter. In another embodiment, the H19-silencing nucleotide is expressed from a vascular smooth muscle cell promoter. In another embodiment, the H19-silencing nucleotide is expressed from any promoter known in the art that functions in vascular smooth muscle cells. Each possibility represents a separate embodiment of the present invention.

In a preferred embodiment, the H19-silencing oligonucleotide has a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-4.

The H19-silencing agents of the invention may be administered systemically, or, in other embodiments, locally, e.g. by direct injection or by means of a catheter, infusion pump or stent.

In one particular embodiment, the invention provides delivery of the H 19- silencing agent by contacting the treated region with a reservoir containing an Hl 9- silencing agent and introducing the H19-silencing agent from the reservoir into the vessel by iontophoresis.

Optimal iontophoresis requires that the agent being administered have an overall net charge. In certain embodiments, the H19-silencing agent may be modified to impart at least group that is charged at physiological or near-physiological pH. Alternatively, a pulsed electric field may be effective to facilitate the entry of uncharged nucleic acid agents into cells through an electroporesis effect. Devices for use in carrying out iontophoretic drug delivery at a vessel site, e.g., by a balloon-catheter device have been described. In general, such devices include a reservoir for compound solution contained in a outer shell of the catheter's distal-tip balloon, an outer-balloon membrane allowing passage of the compound from the reservoir to the vessel wall, and an electrode communicating with the internal reservoir. A second counter-electrode is placed on the body, and a pulsed voltage is applied across the two electrodes to create a field that operates to draw charged compounds into vessel site. Devices, and electric pulse voltages and times follow those disclosed in the art, e.g., U.S. Pat. Nos. 5,593,974, 5,628,730, and 5,425,703). Alternatively, a pulsed-field device designed for diffusion or injection of uncharged compound into the site, with cell uptake facilitated by pulsed- field induced electroporation is also contemplated. In another particular embodiment, administering is carried out by injecting the H19-silencing agent from an injection balloon catheter directly into the vascular injury site, under pressure, through injectors contained on the surface of the catheter balloon (see, e.g. U.S. Pat. No. 7,094,765). According to some embodiments, the H19-silencing agent is injected into the vessel, that it, below the vessel surface, by means of an injection balloon catheter, such has been described. The catheter, which is known commercially as an "Infiltrator Angioplasty Balloon Catheter" or "IABC", is a balloon catheter with 3 lumens: one for inflating the balloon, one central for a guidewire, and a third for drug delivery. On the surface of the balloon there are several longitudinal strips or channels, each having a plurality of injection needles, e.g., six needles, which upon inflation stand project above the channel surface and are connected to the drug-delivery lumen. When the balloon inflates, the needles penetrate the lesion, allowing drug delivery into the tunica media of the vessel wall. This mode of administration provides the advantage of high efficiency of uptake of the compound into the vessel tissue (20% or greater).

In another delivery approach, the H19-silencing agent is embedded or dissolved in a diffusable medium, typically hydrogel, that coats the outer surface of a balloon, e.g., on a balloon catheter used for angioplasty. Methods for making and using such hydrogel coating on a catheter balloon have been described. The hydrogel coating is formulated to include the H19-silencing agent, and to release the selected dose of the compound for a period of about 5-60 minutes. The hydrogel diffusion method may be combined with iontophoresis or electroporation, as described above, to enhance uptake of the compound from the gel into the tissue. In this case, the amount of material in the gel may be reduced substantially, in view of the enhanced efficiency of uptake.

The method has the advantages of maintaining intimate contact between the compound reservoir and vessel wall during the compound delivery period, allowing a relatively slow rate of drug release and uptake by cells, and avoiding elevated injection pressures. In another embodiment, the H19-silencing agent is delivered via drug-eluting stents, as described hereinabove. In one embodiment, the H19-silencing agent is contained in diffϊisable form in a hydrogel coating contained on an intravascular stent. The stent may be placed at the vessel site at the time of balloon angioplasty, or placed at the site during coronary bypass surgery. An implanted stent provides two advantages in practicing the present invention.

First, it allows short term dosing, as with the other methods, and also continued dosing at a lower level over an extended period, e.g., 1-14 days, to block the early events of restenosis. Secondly, the stent itself may be effective in reducing the risk of restenosis, as has been reported. In another embodiment, microparticles, such as polystyrene microparticles

(Seradyn, Indianapolis, Ind.), biodegradable particles, liposomes or microbubbles containing the H19-silencing agents in releasable form may be used for direct delivery of the compound into the vessel tissue.

Methods for delivery the particles include injection of a particle suspension, or physical pressing the particles against the vessel wall, e.g., by balloon pressure in a balloon containing a outer coating of particles, e.g., in a hydrogel medium, or by embedding the particles in releasable form in a stent. Where the particles are microbubbles, the method additional includes exposing the administered particles to ultrasonic energy to explode the bubbles and release the bubbles at the particle sites. Particle delivery of the compound has the advantage of high uptake, particular where the particles are injected, and the potential for both high, short-term drug release and extended release from depot-release particles, e.g., biodegradable particles. The particles may also be coated with a binding agent, e.g., antibodies specific against growth factors or other proteins that are actively synthesized by endothelial cells during early cellular events leading to restenosis, to enhance the efficiency of compound uptake. Finally, the H19-silencing agent may be selectively released from the particles at a desired time, as in the case for microbubbles.

In another embodiment, the invention provides a pharmaceutical composition comprising a H19-silencing oligonucleotide having a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-4 for treating restenosis.

In another embodiment, the invention provides a pharmaceutical composition comprising a H19-silencing oligonucleotide having a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-4 for inhibiting the progression of restenosis in a subject in need thereof.

In another embodiment, the invention provides a pharmaceutical composition comprising a H19-silencing oligonucleotide having a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-4 for ameliorating or preventing the symptoms of restenosis.

In another embodiment, the invention provides a pharmaceutical composition comprising a H19-silencing oligonucleotide having a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-4 for specifically reducing H19 expression in intimal tissue of a subject afflicted with restenosis.

In one embodiment, the at least one H19-silencing oligonucleotide is a small interference RNA (siRNA) molecule.

In another embodiment, the siRNA molecule comprises a sense RNA strand and an antisense RNA strand wherein the sense and the antisense RNA strands form an RNA duplex, and wherein at least one strand comprises a 3 ' overhang.

In another embodiment, the overhang is about 1-5 nucleotides in length. In a particular embodiment, the overhang is 2 nucleotides in length.

In another embodiment, the siRNA molecule comprises a sense strand selected from the group consisting of SEQ ID NOS: 5-8. In another embodiment, the siRNA molecule comprises at least one modified internucleoside linkage. In a particular embodiment, the modified internucleoside linkage is a phosphorothioate linkage.

In another embodiment, the siRNA molecule comprises at least one 2'-sugar modification. Thus, in certain embodiments, RNA analogs comprising substitutions for the hydroxyl group on the T- carbon atom of the ribose ring (e.g. 2'-0-methyl RNA,

2'-O-methoxyethyl (2'-MOE) RNA and 2'-fluoro RNA) may be used. In a particular embodiment, the 2'-sugar modification is a 2'-O-methyl modification.

In one aspect, there is provided a method for treating restenosis in a subject in need thereof, comprising administering to, or expressing in cells of the subject a therapeutically effective amount of at least one H19-silencing oligonucleotide having a nucleic acid sequence as set forth in any one of SEQ ID NOS: 14-25. In another aspect, there is provided a method for inhibiting the progression of restenosis in a subject in need thereof, comprising administering to, or expressing in cells of the subject a therapeutically effective amount of at least one H19-silencing oligonucleotide having a nucleic acid sequence as set forth in any one of SEQ ID NOS: 14-25.

In another aspect, there is provided a method for ameliorating or preventing the symptoms of restenosis in a subject in need thereof, comprising administering to, or expressing in cells of the subject a therapeutically effective amount of at least one Hl 9- silencing oligonucleotide having a nucleic acid sequence as set forth in any one of SEQ ID NOS: 14-25.

In another aspect, there is provided a method for specifically reducing Hl 9 expression in intimal tissue of a subject afflicted with restenosis, comprising administering to, or expressing in cells of the subject a therapeutically effective amount of at least one H19-silencing oligonucleotide having a nucleic acid sequence as set forth in any one of SEQ ID NOS: 14-25.

In another aspect, the invention provides a pharmaceutical composition comprising a H19-silencing oligonucleotide having a nucleic acid sequence as set forth in any one of SEQ ID NOS: 14-25 for treating restenosis.

In another aspect, the invention provides a pharmaceutical composition comprising a H19-silencing oligonucleotide having a nucleic acid sequence as set forth in any one of SEQ ID NOS: 14-25 for inhibiting the progression of restenosis in a subject in need thereof.

In another aspect, the invention provides a pharmaceutical composition comprising a H19-silencing oligonucleotide having a nucleic acid sequence as set forth in any one of SEQ ID NOS: 14-25 for ameliorating or preventing the symptoms of restenosis.

In another aspect, the invention provides a pharmaceutical composition comprising a H19-silencing oligonucleotide having a nucleic acid sequence as set forth in any one of SEQ ID NOS: 14-25 for specifically reducing Hl 9 expression in intimal tissue of a subject afflicted with restenosis.

In another embodiment, the at least one H19-silencing oligonucleotide (or recombinant construct encoding same) is administered to said subject in the form of a pharmaceutical composition further comprising a pharmaceutically acceptable carrier, excipient or diluent.

Preferably, the subject is human.

In another embodiment, the at least one H19-silencing oligonucleotide (or recombinant construct encoding same) may be administered to said subject locally, e.g. by intra-articular injections, or by microinjections into the intimal tissue.

The compositions of the invention can be administered alone or in conjunction with other therapeutic modalities. It is appropriate to administer the pharmaceutical compositions of the invention as part of a treatment regimen involving other therapies, such as drug therapy, which comprises e.g. DMARDs, NSAIDs and/or other agents used for the treatment of restenosis as known in the art.

The following examples are presented in order to more fully illustrate some embodiments of the invention. They should, in no way be construed, however, as limiting the broad scope of the invention.

EXAMPLES

Example 1: Expression of Hl 9 RNA in human coronary SMC cells

Normal human coronary artery SMCs are obtained from Clonetics Corp. (San

Diego CA) and grown in DMEM medium. At 70-80% confluency, total cellular RNAs are extracted from the cells using RNeasy™ mini kit (Qiagen, Germany), and levels of

Hl 9 mRNA therein are measured using semi-quantitative RT-PCR technique as follows:

1 μg total RNA is used to initiate cDNA synthesis using the p(dT)15 primer (Roche, Germany), with 400 units of Reverse Transcriptase (Gibco BRL), according to manufacturer's instructions. The PCR reaction for Hl 9 is carried out using Taq polymerase (Takara, Otsu, Japan) for 29 cycles (94oC for 30 s, 58oC for 30 s, and 72oC for 30 s) preceded by 940C for 5 min, and a final extension of 5 min at 720C. PCR for GAPDH is performed as internal control to verify RT-PCR integrity.

Sense primer and antisense primer sequences used in RT-PCR are as follows: Sense primer specific for H19: 5'- ccggccttcctgaaca-3' (SEQ ID NO: 10).

Antisense primer specific for Hl 9: 5'- ttccgatggtgtctttgatgt-3' (SEQ ID NO: 11).

Sense primer specific for GAPDH: 5'- ggctctccagaacatcatccctgc-3' (SEQ ID NO: 12).

Antisense primer specific for GAPDH: 5'-gggtgtcgctgttgaagtcagagg-3' (SEQ ID

NO: 13).

Example 2: Generation of human coronary artery SMC cells over-expressing H19 RNA

SMC cells over-expressing Hl 9 RNA are obtained by stable transfection using the expression vector, in which about 2.3 Kb entire H19 gene was placed under the constitutive transcriptional control of the Cytomegalovirus promoter. As a control, cells are also transfected with the same vector containing a part of Hl 9 gene placed in an anti-sense direction. Twenty-four hours before transfection, cells are plated into 6 wells plate at a density of 100,000 cells per well in antibiotic-free medium. Transfections are carried out using Lipofectamine 2000™ and 2 μg plasmid per well. Forty-eight hours after transfection, cells are diluted and divided into new culture dishes. Cells are selected after incubation for 15 days in a medium containing 500 μg/ml G418 sulfate

(Gibco-BRL) antibiotic.

Example 3: Characterization of SMC cells over-expressing sense or antisense H19 RNA

Cell proliferation analysis. Human coronary artery SMC cells over-expressing

Hl 9 in sense and antisense direction are seeded in 96 well plates in quadruples in

DMEM media containing either 10% FCS or 0.1% FCS. 24 hours later, an MTS assay is performed (Promega, USA). Absorbance at 490 run is recorded with an ELISA plate reader.

In a separate experiment, SMC cells over-expressing the Hl 9 RNA are seeded in 12- well plates and incubated for twenty-four hours in antibiotic-free medium (DMEM) so that they are at 80% confluent at transfection. Transfection is performed using 3 μl Lipofectamine 2000™ and 2 μg of the plasmid expressing either Hl 9 shRNA (or siRNA). As a negative control, GFP shRNA (GCAAGCUGACCCUGAAGUUCAU; SEQ ID NO: 27) or luciferase shRNA (having a sense strand with the sequence 5'- CUUACGCUGAGUACUUCGAdTdT-3'; SEQ ID NO: 28) is used. 24 hours post- transfection, RNA is extracted, and Hl 9 expression is measured as in Example 1 to determine ability of the Hl 9 shRNA plasmid to silence Hl 9 expression. Cells are washed with PBS and equal numbers of cells (expressing either Hl 9 shRNA or GFP shRNA) are transferred to 96 well plates containing either 10% FCS or 0.1% FCS. MTS assay is performed as described hereinabove.

Analysis of 5'-bromo-2-deoxyuridine incorporation. Differences in proliferative capacity of SMC cells over-expressing Hl 9 in the sense or antisense direction, under normal and serum starved conditions, are determined by measuring 5'-bromo-2- deoxyuridine (BrdU) incorporation, using growth conditions outlined above. After 72 h of serum deprivation, medium is refreshed, and cells are incubated with BrdU (Cell Proliferation Enzyme-Linked Immuno Sorbent Assay, BrdU Colorimetric; Hoffmann- La Roche, Basel, Switzerland) for 2 additional hours. Absorbance is measured with the enzyme-linked immunosorbent assay reader at 370 nm (reference wavelength, 490 nm).

Example 4: H19 Stimulates Human Coronary Artery SMC Migration

SMC cells over-expressing Hl 9 RNA and its control are seeded in 12- wells plate. After a 24-h incubation, a single uniform scratch is made using a 1000 μl plastic pipet tip, generating a cell-free gap of approximately 1.0 mm between two adjoining areas of SMC. SMC are then incubated in a 95% air/5% CO2 environment. Each scratch is randomly photographed at four separate sites along the length of the scratch, starting proximally and ending distally. The photographs are taken on an inverted microscope immediately after the scratch and then again at 24 and 48 h. Migrating cells across the wound edges are counted manually.

Three-dimensional cell migration is determined using transwells with a gelatin- coated membrane (Corning Life Science). The lower chamber contains either no chemo-attractant (control) or 100 ng/ml of TNF-α in Dulbecco's modified Eagle's medium (DMEM)-F-12 medium. After 6 h, cells over-expressing H19 in the sense or antisense direction are scraped from the upper surface, the membrane is fixed with formalin, and cells are stained with hematoxylin and eosin stain and analyzed using light microscopy to count cell numbers (with an average of four randomly chosen fields used for each).

Example 5: H19 Stimulates proteases / protease receptors expression and secretion

A customized Affymetrix protease microarray is utilized to measure expression levels of human proteases, proteases inhibitors, and their receptors. Total RNA from SMC cells over-expressing the Hl 9 RNA or its control (described hereinabove) are subjected to reverse transcription, labeling, and hybridization to gene chip arrays (Affymetrix, Santa Clara, CA) containing well-characterized human protease genes. Experiments were performed non-simultaneously in duplicates.

Up- and down-regulated genes are selected different from the list of differentially expressed genes modulated by Hl 9 overexpression, and microarray data is verified by RT-PCR analyses. Some of the modulated genes that are known to be secreted are chosen for ELISA analyses.

Example 6: Testing anti-restenosis activity of H19 shRNA in an animal model

Male Sprague-Dawley rats (400 to 500 g in weight) are anesthetized, and a cannula is introduced into the left common carotid artery via the external carotid artery. Vascular injury is induced in the common carotid artery by pulling an inflated #2 Fr fogarty catheter through it 3 times.

After vessel injury of the common carotid artery, the injured segment is transiently isolated by temporary ligatures. 200 μL of a combination of Lipofectamine 2000™ and Hl 9 shRNA-encoding plasmid (40 μg) are incubated in the isolated segment for 15 minutes, after which ligatures are removed. As a negative control, GFP- shRNA-encoding plasmid is utilized. The external carotid artery is ligated, and blood flow is restored in the common carotid and the internal carotid artery. The skin wound is repaired, and animals are transferred to their cages. Two weeks later, animals are euthanized, arteries are harvested and perfusion-fixed in formalin, and histopathology sections stained with hematoxylin-eosin (HE) are analyzed by quantitative histology. Using computer-facilitated planimetry, the lumen area, area of the intima, and area of the media are measured and intimal medial area ratio is calculated. Statistical comparison for each of these parameters is performed between all groups (see Clowes et al, 1983).

Example 7: Clinical testing of H19 shRNA-coated stents for Deterrence or Prevention of Post- Angioplasty Restenosis

H19-silencing nucleic acid agents produced in sterile, endotoxin-free environment are incorporated into stents introduced into patients undergoing angioplasty procedures in order to suppress the growth of vascular smooth muscle cells and restenosis.

The stents are coated with the H19-silencing agents using known techniques previously employed with other drug-eluting stents, e.g. for PDGF RNAi (Li et al 2006) or c-myc RNAi (Kipshidze et al, 2004); also see Jewell CM 2006.

In other experiments, a stent deployed in conjunction with conventional PCI methods to address restenosis can be readily coated with H19-silencing agents using known techniques or modifications thereof as appropriate for H19-silencing agents.

References

Ayesh et al, MoI Carcinog 35, 63-74, 2002. Matouk et al, PLoS One e845, 2007. Lottin g α/., Oncogene. Feb 28;21(10): 1625-31, 2002. Berteaux et al., J Biol Chem. 280(33):29625-36, 2005.

Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York, 2001.

Ausubel, et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md., 1989. Perbal, B., "A Practical Guide to Molecular Cloning," John Wiley & Sons, New York, 1988.

Kroschwitz, J. L, ed.,"The Concise Encyclopedia Of Polymer Science And Engineering," pages 858-859, John Wiley & Sons, 1990. Englisch et al., "Angewandte Chemie," International Edition, 30, 613, 1991.

Sanghvi, Y. S., "Antisense Research and Applications," Chapter 15, S. T. Crooke and B. Lebleu, eds., CRC Press, 1993.

Kliachigian, LM, Curr Opin MoI Ther 4:119-21, 2002. Welch et al, Curr Opin Biotechnol. 9:486-96, 1998.

Seidman and Glazer, J Clin Invest; 112:487-94, 2003.

Vuyisich and Beal, Nuc. Acids Res 28:2369-74, 2000.

Chang et al., Somatic Gene Therapy, CRC Press, Ann Arbor, Mich., 1995.

Vega et al., Gene Targeting, CRC Press, Ann Arbor Mich., 1995. Gilboa et at., Biotechniques 4 (6): 504-512, 1986.

Tonkinson et al., Cancer Investigation, 14(1): 54-65, 1996.

Fingl, et al., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 p.l.

Tuschl, ChemBiochem. 2:239-245, 2001.

Cullen, Nat. Immunol. 3:597-599, 2002. Brantl, Biochem. Biophys. Act. 1575:15-25, 2002.

Kim et al. J. Clin. Invest. 93:355-360, 1994.

Clowes et al "Kinetics of Cellular Proliferation After Arterial Injury. I. Smooth Muscle Growth in the Absence of Endothelium," Lab Invest. 49(3): 327-33, 1983.

Li Y et al. J Cardiovasc Pharmacol. 48(4): 184-90, 2006. Kipshidze NN et al, Catheter Cardiovasc Interv. 61(4):518-27, 2004. Jewell CM et al. Biomacromolecules. 7(9):2483-91, 2006.

The foregoing description of the specific embodiments will so fully reveal the general nature of the invention that others can, by applying current knowledge, readily modify and/or adapt for various applications such specific embodiments without undue experimentation and without departing from the generic concept, and, therefore, such adaptations and modifications should and are intended to be comprehended within the meaning and range of equivalents of the disclosed embodiments. It is to be understood that the phraseology or terminology employed herein is for the purpose of description and not of limitation. The means, materials, and steps for carrying out various disclosed functions may take a variety of alternative forms without departing from the invention.

Citations de brevets
Brevet cité Date de dépôt Date de publication Déposant Titre
WO2007007317A1 *6 juil. 200618 janv. 2007Yissum Research Development Company Of The Hebrew University Of JerusalemNucleic acid agents for downregulating h19, and methods of using same
Citations hors brevets
Référence
1 *KIM DUK-KYUNG ET AL: "H19, a developmentally regulated gene, is reexpressed in rat vascular smooth muscle cells after injury" JOURNAL OF CLINICAL INVESTIGATION, vol. 93, no. 1, 1994, pages 355-360, XP002484355 ISSN: 0021-9738 cited in the application
2 *KIPSHIDZE NICHOLAS N ET AL: "Advanced c-myc antisense (AVI-4126)-eluting phosphorylcholine-coated stent implantation is associated with complete vascular healing and reduced neointimal formation in the porcine coronary restenosis model." CATHETERIZATION AND CARDIOVASCULAR INTERVENTIONS : OFFICIAL JOURNAL OF THE SOCIETY FOR CARDIAC ANGIOGRAPHY & INTERVENTIONS APR 2004, vol. 61, no. 4, April 2004 (2004-04), pages 518-527, XP002484356 ISSN: 1522-1946 cited in the application
3 *LI YUXIN ET AL: "Stent-based delivery of antisense oligodeoxynucleotides targeted to the PDGF A-chain decreases in-stent restenosis of the coronary artery." JOURNAL OF CARDIOVASCULAR PHARMACOLOGY OCT 2006, vol. 48, no. 4, October 2006 (2006-10), pages 184-190, XP009101419 ISSN: 0160-2446 cited in the application
Référencé par
Brevet citant Date de dépôt Date de publication Déposant Titre
US917396423 oct. 20083 nov. 2015Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd.Diphtheria toxin first open reading frame operably linked to an H19 promoter and a diphtheria toxin second open reading frame operably linked to an IGF-II promoter as nucleic acid construct
US93812088 mai 20125 juil. 2016Rheinische Friedrich-Wilhelms-UniversitätStructure and use of 5′ phosphate oligonucleotides
US939965828 mars 201226 juil. 2016Rheinische Friedrich-Wilhelms-Universität BonnPurification of triphosphorylated oligonucleotides using capture tags
US940994120 mai 20099 août 2016Rheinische Friedrich-Wilhelms-Universität Bonn5′ triphosphate oligonucleotide with blunt end and uses thereof
US973868020 mai 200922 août 2017Rheinische Friedrich-Wilhelms-Universität Bonn5′ triphosphate oligonucleotide with blunt end and uses thereof
Classifications
Classification internationaleA61K31/7088, A61P9/00, C12N15/113
Classification coopérativeC12N2310/111, C12N2310/11, A61K31/7088, C12N2310/14, C12N15/113, C12N2310/12
Classification européenneA61K31/7088, C12N15/113
Événements juridiques
DateCodeÉvénementDescription
8 oct. 2008121Ep: the epo has been informed by wipo that ep was designated in this application
Ref document number: 08710191
Country of ref document: EP
Kind code of ref document: A1
18 août 2009NENPNon-entry into the national phase in:
Ref country code: DE
17 mars 2010122Ep: pct app. not ent. europ. phase
Ref document number: 08710191
Country of ref document: EP
Kind code of ref document: A1