WO2008099396A1 - Utilisation d'agents à base d'acides nucléiques réduisant h19 au silence pour traiter la resténose - Google Patents

Utilisation d'agents à base d'acides nucléiques réduisant h19 au silence pour traiter la resténose Download PDF

Info

Publication number
WO2008099396A1
WO2008099396A1 PCT/IL2008/000191 IL2008000191W WO2008099396A1 WO 2008099396 A1 WO2008099396 A1 WO 2008099396A1 IL 2008000191 W IL2008000191 W IL 2008000191W WO 2008099396 A1 WO2008099396 A1 WO 2008099396A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
seq
silencing
rna
sirna
Prior art date
Application number
PCT/IL2008/000191
Other languages
English (en)
Inventor
Abraham Hochberg
Original Assignee
Yissum Research Development Company Of The Hebrew University Of Jerusalem
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yissum Research Development Company Of The Hebrew University Of Jerusalem filed Critical Yissum Research Development Company Of The Hebrew University Of Jerusalem
Publication of WO2008099396A1 publication Critical patent/WO2008099396A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C12N2310/111—Antisense spanning the whole gene, or a large part of it
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/12—Type of nucleic acid catalytic nucleic acids, e.g. ribozymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.

Definitions

  • the invention is directed to compositions and methods for treating restenosis, utilizing H19-silencing nucleic acid agents.
  • PTCA percutaneous transluminal coronary angioplasty
  • CABG coronary artery bypass graft
  • PTCA is a procedure in which a small balloon catheter is passed down a narrowed coronary artery and then expanded to re-open the artery.
  • the major advantage of angioplasty is that patients in which the procedure is successful need not undergo the more invasive surgical procedure of coronary artery bypass graft.
  • a major difficulty with PTCA is the problem of post-angioplasty closure of the vessel, both immediately after PTCA (acute reocclusion) and in the long term (restenosis).
  • Coronary stents are typically used in combination with PTCA to reduce reocclusion of the artery. Stents are introduced percutaneously, and transported transluminally until positioned at a desired location. The stents are then expanded either mechanically, such as by the expansion of a mandrel or balloon positioned inside the stent, or expand themselves by releasing stored energy upon actuation within the body. Once expanded within the lumen, stents become encapsulated within the body tissue and remain a permanent implant. Restenosis is a major complication that can arise following vascular interventions such as angioplasty and stent implantation.
  • restenosis is a wound healing process that reduces the vessel lumen diameter by extracellular matrix deposition, neointimal hyperplasia, and vascular smooth muscle cell proliferation, and which may ultimately result in renarrowing or even reocclusion of the lumen.
  • neointimal hyperplasia refers to the development of a proliferative lesion in the intimal layer of a blood vessel.
  • Neointimal hyperplasia results, for example, from migration of smooth muscle cells of the tunica media layer of the blood vessel toward the lumen into the subintimal space below the endothelium (i.e., the inner lining of the blood vessel). These smooth muscle cells proliferate within the intimal space and create a "mass effect" that narrows the vessel lumen and reduces oxygenation and nutritive blood flow.
  • Drug-eluting stents represent a leading current treatment to address restenosis.
  • Two examples of agents that have been demonstrated to reduce restenosis when delivered from a stent are paclitaxel, a well-known compound that is commonly used in the treatment of cancerous tumors, and Rapamycin, an immunosuppressive compound used to prevent rejection of organ or tissue transplants.
  • paclitaxel a well-known compound that is commonly used in the treatment of cancerous tumors
  • Rapamycin an immunosuppressive compound used to prevent rejection of organ or tissue transplants.
  • Currently marketed drug-eluting stents are bare metal stents coated on the surface with a drug and a biostable polymer to reduce restenosis by inhibiting the growth or proliferation of neointima.
  • other polymer and non-polymer drug delivery systems are in development to allow delivery of antiproliferative drugs from stents. Hl 9 in diagnosis and therapy
  • Hl 9 was the first human imprinted non-protein-coding gene to be identified showing expression of only the maternal allele. It is also imprinted in mice. Hl 9 was mapped on the short arm of the human chromosome 11, band 15.5, homologous to a region of murine chromosome 7. H19 gene is abundantly expressed during embryogenesis but is repressed in most tissues after birth. However, studies of various tumors have demonstrated re-expression or over-expression of the Hl 9 gene when compared to healthy tissues. Moreover, aberrant allelic expression patterns were observed in some cancers of varying etiologies and lineages.
  • Hl 9 exhibits mono- allelic expression in most tissues throughout development, with the exception of germ cells at certain stages of maturation, and in extra- villous trophoblasts, bi-allelic expression of this gene, referred as "relaxation of imprinting" or "loss of imprinting,” have been found in an increasing number of cancers, for example, hepatocellular carcinoma, liver neoplasms, lung adenocarcinoma, esophageal, ovarian, rhabdomyosarcoma, cervical, bladder, head and neck squamous cell carcinoma, colorectal, uterus, and testicular germ cell tumors.
  • Today nearly 30 types of cancers show dysregulated expression of Hl 9 gene as compared to healthy tissues, with or without loss of imprinting.
  • Hl 9 RNA presence may enhance the invasive, migratory and angiogenic capacity of the cell by up regulating genes that function in those pathways, and thus could contribute at least to the initial steps of the metastatic cascade. Additional studies highlight the potential role of Hl 9 in promoting cancer progression and tumor metastasis by being a gene responsive to HGF/SF.
  • Hl 9 gene has prompted its use in clinical applications for diagnosing cancer.
  • U.S. Pat. No. 5,955,273 to some of the inventors of the present invention, teaches the use of Hl 9 gene as a tumor specific marker.
  • PCT Pub. No. WO 2004/024957 to some of the inventors of the present invention, discloses the use of Hl 9 for the detection, in a patient suspected of having cancer, of the presence of residual cancer cells or micro-metastases originating from solid tumors.
  • WO 99/18195 teaches the specific expression of heterologous sequences, particularly genes encoding cytotoxic products (e.g. Diphtheria toxin), in tumor cells under the control of cancer specific promoters (e.g., Hl 9 promoters).
  • cytotoxic products e.g. Diphtheria toxin
  • cancer specific promoters e.g., Hl 9 promoters
  • WO 04/031359 teaches a method for regulating the expression of angiogenesis- controlling genes in cells that are involved in neo-vascularization, comprising administering to the cells an effective amount of an Hl 9 modulator.
  • WO 04/031359 provides a list of angiogenesis-associated conditions, which purportedly may potentially be treated by either increasing or decreasing Hl 9 expression. While a number of angiogenesis-associated genes were reported to be up-regulated in a carcinoma cell line transfected with an H19-expressing construct, down-regulation of
  • Hl 9 was not demonstrated.
  • a publication by Berteaux et al. (2005) discloses two specific siRNA molecules targeted to Hl 9, which arrest in vitro growth of breast cancer cells.
  • siRNA intended for silencing Hl 9 are now also available from commercial sources, including Invitrogen, Dharmacon and Qiagen. The efficacy of these commercially available Hl 9 siRNA is putative, and their utility remains to be established. Certain commercially available molecules correspond to SEQ ID NOs: 14-
  • WO 2007/034487 discloses a nucleic acid construct comprising: (i) a first nucleic acid sequence encoding TNF alpha; (ii) a second nucleic acid sequence encoding a Diphtheria toxin; and (iii) at least one additional nucleic acid sequence comprising a cancer specific promoter (e.g. an Hl 9 promoter); the TNF alpha and Diphtheria toxin encoding sequences being under an expression control of the cancer specific promoter. Also provided are construct systems and methods and uses of same.
  • a cancer specific promoter e.g. an Hl 9 promoter
  • WO 2007/007317 discloses isolated oligonucleotides capable of down- regulating a level of Hl 9 mRNA in cancer cells, and demonstrates in vitro and in vivo anti-cancer effects using siRNA agents comprising SEQ ID NOS: 5-8 of the present invention. Also disclosed are articles of manufacture comprising agents capable of downregulating Hl 9 mRNA in combination with an additional anti-cancer treatment as well as methods of treating cancer by administering same.
  • Neointimal formation after vascular injury may require the re-expression of a smooth muscle developmental sequence.
  • Kim et al. (1994) examined expression of Hl 9 in rat blood vessels. Hl 9 was highly expressed in the 1 -day-old rat aorta but was undetectable in the adult. Hl 9 transcripts were only minimally detected in uninjured carotid artery but were abundant at 7 and 14 d after injury and were localized by in situ hybridization, primarily to the neointima. Hl 9 transcripts were undetectable in proliferating neointimal cells in culture but became highly abundant in postconfluent, differentiated neointimal cells. Hl 9 transcripts were only minimally expressed in adult medial smooth muscle cells grown under identical conditions.
  • Hl 9 may play an important role in the normal development and differentiation of the blood vessel and in the phenotypic changes of the smooth muscle cells, which are associated with neointimal lesion formation.
  • Vascular smooth muscle cell migration, proliferation, and differentiation are central to blood vessel development.
  • Silencing or down-regulation of specific gene expression in a cell can be carried out by oligonucleotides using techniques such as antisense therapy, RNA interference (RNAi), and enzymatic nucleic acid molecules.
  • RNAi RNA interference
  • Antisense therapy refers to the process of inactivating target DNA or mRNA sequences through the use of complementary DNA or RNA oligonucleic acids, thereby inhibiting gene transcription or translation.
  • An antisense molecule can be single stranded, double stranded, or triple helix.
  • agents capable of inhibiting expression are for example enzymatic nucleic acid molecules such as DNAzymes and ribozymes, capable of specifically cleaving an mRNA transcript of interest.
  • DNAzymes are single-stranded deoxyribonucleotides that are capable of cleaving both single- and double-stranded target sequences.
  • Ribozymes are catalytic ribonucleic acid molecules that are increasingly being used for the sequence-specific inhibition of gene expression by the cleavage of mRNAs encoding proteins of interest.
  • RNA interference is a method of post-transcriptional inhibition of gene expression that is conserved among many eukaryotic organisms. RNAi is induced by short (i.e., ⁇ 30 nucleotide) double stranded RNA (“dsRNA”) molecules present in the cell. These short dsRNA molecules, called “short interfering RNA” or “siRNA”, induce degradation of messenger RNAs (“mRNAs”) that share sequence homology with the siRNA to within one nucleotide resolution. It is believed that the siRNA and the targeted mRNA bind to an "RNA-induced. silencing complex” or "RISC,” which cleaves the targeted mRNA.
  • RISC messenger RNAs
  • siRNA-mediated RNAi degradation of mRNA is therefore more effective than currently available technologies for inhibiting expression of a target gene.
  • U.S. Patent No. 6,506,559 to Fire et al. teaches genetic inhibition by double- stranded RNA, particularly a process for inhibition of gene expression of a target gene in a cell using RNA having a region with double-stranded structure, wherein the nucleotide sequences of the duplex region of the RNA and of a portion of the target gene are identical.
  • PCT Pub. No. WO 01/75164 to Tuschl et al. discloses that synthetic siRNA of 21 and 22 nucleotides in length, and which have short 3' overhangs, are able to induce RNAi of target niRNA in a Drosophila cell lysate. Cultured mammalian cells also exhibit RNAi degradation with synthetic siRNA.
  • PCT Pub. No. WO 02/44321 relates to sequence and structural features of double-stranded (ds) RNA molecules required to mediate target-specific nucleic acid modifications such as RNA-interference and/or DNA methylation.
  • PCT Pub. No. WO 2006/060454 teaches methods of designing small interfering RNAs, antisense polynucleotides, and other hybridizing nucleotides.
  • US Patent Application Publication No. 2006/0217331 discloses chemically modified double stranded nucleic acid molecules for RNA interference.
  • Drug-eluting stents for delivering nucleic acid agents Drug-eluting stents for delivering nucleic acid agents
  • U.S. Pat. No. 6,746,686 discloses an implant having a coating on its external surface comprising a crosslinked, water swellable polymer matrix and a pharmaceutically active compound comprising a nucleic acid, in which the polymer has pendant zwitterionic groups and pendant cationic groups.
  • U.S. Patent No. 6,506,408 discloses an implantable or insertable therapeutic agent delivery device comprising a coating material provided on at least a portion of said device, of a pH-sensitive polymer that allows release therefrom of a negatively charged therapeutic agent when contacted with a fluid at or above about a physiological pH.
  • the negatively charged therapeutic agent may be a nucleic acid agent such as an antisense molecule.
  • U.S. Pat. No. 6,468,304 discloses a device which can be implanted in the body, which comprises an electrically conducting support covered with a layer of electrically conducting polymer, to which layer is attached at least one biologically active substance of an anionic or cationic nature.
  • the biologically active substance may be a phosphorylated nucleic base, an antisense oligonucleotide or a vector for plasmid genes.
  • nucleic acid agents that inhibit Hl 9 expression may be applied effectively in prevention of restenosis, nor does the art teach or suggest drug-eluting stents comprising these agents. There remains an unmet medical need for therapeutic modalities useful for treating restenosis and inhibiting symptoms associated therewith.
  • the invention provides compositions and methods useful for inhibiting or preventing restenosis, particularly to nucleic acid agents capable of silencing or reducing the expression of the Hl 9 gene for the treatment of restenosis.
  • the invention is directed to novel therapeutic uses for H19-silencing oligonucleotides for the preparation of pharmaceutical compositions useful for inhibiting the progression of restenosis and ameliorating symptoms thereof.
  • the invention further provides novel drug-eluting stents, as detailed herein.
  • siRNA small interfering RNA
  • the invention provides compositions, devices and methods for treating and preventing the progression of restenosis, utilizing H 19- silencing oligonucleotides or recombinant constructs encoding them, as detailed herein.
  • the H19-silencing oligonucleotides of the invention are selected from the group consisting of: antisense molecules, RNA interference (RNAi) molecules (e.g. small interfering RNAs (siRNAs) and hairpin RNAs) and enzymatic nucleic acid molecules (e.g. ribozymes and DNAzymes).
  • H19-silencing oligonucleotides that may be used in the methods of the invention are those having a nucleic acid sequence asset forth in any one of SEQ ID NOS: 1-8 and 14-25, as detailed hereinbelow.
  • H19-silencing oligonucleotides of the invention comprise a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1- 4, and analogs and derivatives thereof, as follows:
  • the oligonucleotide is a small interfering RNA (siRNA) molecule, having a sense nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-4.
  • siRNA small interfering RNA
  • the siRNA molecules of the invention comprise a sense RNA strand and an antisense RNA strand, wherein the sense and the antisense RNA strands form an RNA duplex.
  • each strand of the siRNA molecule is no more than 30 nucleotides in length, and is preferably about 20-25 or 21-23 nucleotides in length.
  • the siRNA molecules may further comprise 3' nucleotide overhangs on either or both strands, i.e. terminal portions of the nucleotide sequence that are not base paired between the two strands of the double stranded siRNA molecule.
  • the overhang is about 1-5 nucleotides in length, e.g. 2 nucleotides in length.
  • Exemplary encoded H19-specific siRNA are those set forth in any one of SEQ ID NOS : 1 -8 and 14-25, as detailed hereinbelow.
  • the siRNA molecules comprise two 3' deoxythymidine overhangs, thus containing a sense strand having a nucleic acid sequence as set forth in any one of SEQ ID NOS: 5-8, as follows:
  • said siRNA molecules comprise at least one modified internucleoside linkage.
  • said modified internucleoside linkage is a phosphorothioate linkage.
  • said siRNA molecule comprises one or two phosphorothioate linkages at the 3' termini of each strand.
  • said siRNA molecules comprise at least one 2'-sugar modification.
  • said 2'-sugar modification is a 2'-O-methyl modification.
  • said siRNA molecules comprise both modified internucleoside linkages (e.g. phosphorothioate linkages) and 2'-sugar modification (e.g. 2'-O-methyl modifications).
  • modified internucleoside linkages e.g. phosphorothioate linkages
  • 2'-sugar modification e.g. 2'-O-methyl modifications
  • the methods of the invention are effected by administering to or expressing in cells of the subject a therapeutically effective amount of at least one H19-silencing oligonucleotide of the invention, as detailed herein.
  • a method for treating restenosis in a subject in need thereof comprising administering to the subject a therapeutically effective amount of at least one H19-silencing oligonucleotide of the invention.
  • a method for reducing the incidence of restenosis in a subject in need thereof comprising administering to the subject a therapeutically effective amount of at least one H19-silencing oligonucleotide of the invention.
  • a method for inhibiting the progression of restenosis in a subject in need thereof comprising administering to the subject a therapeutically effective amount of at least one H19-silencing oligonucleotide of the invention.
  • a method for ameliorating or preventing the symptoms of restenosis in a subject in need thereof comprising administering to the subject a therapeutically effective amount of at least one H19-silencing oligonucleotide of the invention.
  • the at least one H19-silencing oligonucleotide is administered to said subject in the form of a pharmaceutical composition further comprising a pharmaceutically acceptable carrier, excipient or diluent.
  • the recombinant construct is administered to said subject from a drug- eluting stent.
  • a method for specifically reducing Hl 9 expression in vascular smooth muscle cells of a subject afflicted with vascular occlusion or reocclusion following angioplasty comprising the step of introducing into the occluded vessel a stent capable of eluting to the surrounding tissue an oligonucleotide capable of hybridizing with an Hl 9 transcript.
  • a therapeutically effective amount of the oligonucleotide is administered.
  • the oligonucleotide is an H19-silencing oligonucleotide of the invention.
  • the stent is introduced as part of an angioplasty procedure (e.g. the stent is associated with the balloon).
  • the stent is associated with the balloon.
  • a method for treating restenosis in a subject in need thereof comprising administering to the subject a nucleic acid molecule or sequence encoding an oligonucleotide capable of hybridizing with an Hl 9 transcript.
  • a therapeutically effective amount of the nucleic acid molecule is administered.
  • the oligonucleotide encoded by the nucleic acid molecule is an H19-silencing oligonucleotide.
  • the nucleic acid sequence encoding the oligonucleotide is operably linked to at least one transcription regulating sequence.
  • Capable of hybridizing with an Hl 9 transcript refers to an ability to hybridize to a measurable extent under physiological conditions.
  • a method for inhibiting the progression of restenosis in a subject in need thereof comprising administering to the subject a therapeutically effective amount of at least one recombinant construct comprising a nucleic acid sequence encoding an H19-silencing oligonucleotide of the invention, the nucleic acid sequence being operably linked to at least one transcription regulating sequence.
  • a method for ameliorating or preventing the symptoms of restenosis in a subject in need thereof comprising administering to the subject a therapeutically effective amount of at least one recombinant construct comprising a nucleic acid sequence encoding an H19-silencing oligonucleotide of the invention, the nucleic acid sequence being operably linked to at least one transcription regulating sequence.
  • a method for specifically reducing Hl 9 expression in vascular smooth muscle cells of a subject following angioplasty comprising introducing a stent capable of eluting to the surrounding tissue a therapeutically effective amount of at least one recombinant construct comprising a nucleic acid sequence encoding an H19-silencing oligonucleotide of the invention, the nucleic acid sequence being operably linked to at least one transcription regulating sequence.
  • the invention provides a stent capable of eluting to the surrounding tissue a therapeutically effective amount of at least one H19-silencing oligonucleotide of the invention.
  • the invention provides a stent capable of eluting to the surrounding tissue a therapeutically effective amount of at least one recombinant construct comprising a nucleic acid sequence encoding an H19-silencing oligonucleotide of the invention, the nucleic acid sequence being operably linked to at least one transcription regulating sequence.
  • FIG. 1 is a schematic representation of an Hl 9 shRNA construct.
  • a construct encoding a stem-loop RNA duplex containing sense and antisense strands corresponding to SEQ ID NO: 3 is illustrated.
  • the expression cassette is followed by a terminator ("term") and an enhancer.
  • the shRNA precursor is constructed with a GC overhang (and additional 3' overhang residues may include poly- A residues, introduced by the vector).
  • an H19 promoter-driven construct is depicted; however, any promoter suitable for expression in vascular smooth muscle cells can be used.
  • the present invention relates to the treatment of restenosis, particularly to the use of nucleic acid agents capable of reducing, inhibiting, silencing or otherwise downregulating the expression of Hl 9 RNA, and in particular the use of these agents in drug eluting stents for prevention of restenosis.
  • the invention provides methods for ameliorating restenosis and symptoms associated therewith, utilizing gene silencing oligonucleotides such as small interfering RNA (siRNA) agents directed to Hl 9 and nucleic acid constructs encoding them.
  • siRNA small interfering RNA
  • the present invention provides a method for reducing occurrence of restenosis in a subject in need thereof, the method comprising the step of administration to the subject of an H19-silencing oligonucleotide, thereby reducing occurrence of restenosis in a subject.
  • the H19-silencing oligonucleotide is specifically hybridizable with an Hl 9 RNA.
  • H19-silencing oligonucleotide is administered directly to the target blood vessel.
  • the H19-silencing oligonucleotide is administered to the subject systemically and reaches the target blood vessel via active transport (e.g. diffusion or circulation).
  • the H19-silencing oligonucleotide is administered to the subject via a stent capable of eluting the H19-silencing oligonucleotide.
  • a stent capable of eluting the H19-silencing oligonucleotide.
  • the present invention provides a method for inhibiting the progression of restenosis in a subject in need thereof, the method comprising the step of administration to the subject of an H19-silencing oligonucleotide, thereby inhibiting the progression of restenosis in a subject.
  • inhibitory RNA e.g. siRNA
  • Inhibitory RNA has been used, for example, in treating Hepatitis B Virus in animal models (Morrissey D et al, Nature Biotechnology, 23(8), 1002-1007, 2005;
  • Treating restenosis refers to inhibiting the progression of restenosis in a subject in need thereof, preferably following an angioplasty procedure.
  • the compositions and methods of the invention are useful for reducing the risk (incidence) or severity (extent of stenosis), of restenosis, particularly following balloon angioplasty, or in response to other vessel trauma, such as following an arterial bypass operation.
  • a method for decreasing the level of restenosis following a stent placement medical intervention involves the continuous administration of a dose of an anti-restenotic agent or drug from the stent to vascular tissue in need of treatment in a controlled and extended in vivo drug release profile.
  • the vascular tissue in need of treatment is arterial tissue, specifically coronary arterial tissue.
  • the method of extended in vivo release increases the therapeutic effectiveness of administration of a given dose of an anti-restenotic agent and more specifically a nucleic acid agent that reduces the proliferation of injured vascular cells involved in an angioplasty and stenting procedure.
  • nucleic acid synthesis The nucleic acid agents designed according to the teachings of the present invention can be generated according to any nucleic acid synthesis method known in the art, including both enzymatic syntheses or solid-phase syntheses, as well as using recombinant methods well known in the art.
  • nucleic acid agents of the present invention can be also generated using an expression vector as is further described hereinbelow. 000191
  • nucleic acid agents of the present invention are modified.
  • Nucleic acid agents can be modified using various methods known in the art.
  • nucleic acid agents are modified either in backbone, internucleoside linkages, or bases, as is broadly described hereinunder.
  • Specific examples of nucleic acid agents useful according to this aspect of the present invention include oligonucleotides or polynucleotides containing modified backbones or non-natural internucleoside linkages.
  • Examples of oligonucleotides or polynucleotides having modified backbones include those that retain a phosphorus atom in the backbone, as disclosed in U.S. Pat.
  • modified oligonucleotide backbones include, for example: phosphorothioates; chiral phosphorothioates; phosphorodithioates; phosphotriesters; aminoalkyl phosphotriesters; methyl and other alkyl phosphonates, including 3'- alkylene phosphonates and chiral phosphonates; phosphinates; phosphoramidates, including 3 '-amino phosphoramidate and aminoalkylphosphoramidates; thionophosphoramidates; thionoalkylphosphonates; thionoalkylphosphotriesters; and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogues of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'.
  • Various salts, mixed salts, and free acid forms of the above modifications can also be used.
  • modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short-chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short-chain heteroatomic or heterocyclic internucleoside linkages.
  • morpholino linkages formed in part from the sugar portion of a nucleoside
  • siloxane backbones sulfide, sulfoxide, and sulfone backbones
  • formacetyl and thioformacetyl backbones methylene formacetyl and thioformacetyl backbones
  • alkene-containing backbones sulfamate backbones
  • sulfonate and sulfonamide backbones amide backbones; and others having mixed N, O, S and CH 2 component parts, as disclosed in U.S. Pat.
  • nucleic acid agents which may be used according to the present invention are those modified in both sugar and the internucleoside linkage, i.e., the backbone of the nucleotide units is replaced with novel groups.
  • the base units are maintained for complementation with the appropriate polynucleotide target.
  • An example of such an oligonucleotide mimetic includes a peptide nucleic acid (PNA).
  • PNA oligonucleotide refers to an oligonucleotide where the sugar-backbone is replaced with an amide- containing backbone, in particular an aminoethylglycine backbone.
  • the bases are retained and are bound directly or indirectly to aza-nitrogen atoms of the amide portion of the backbone.
  • Nucleic acid agents of the present invention may also include base modifications or substitutions.
  • "unmodified” or “natural” bases include the purine bases adenine (A) and guanine (G) and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).
  • Modified bases include but are not limited to other synthetic and natural bases, such as: 5-methylcytosine (5-me-C); 5 -hydroxy methyl cytosine; xanthine; hypoxanthine; 2-aminoadenine; 6-methyl and other alkyl derivatives of adenine and guanine; 2-propyl and other alkyl derivatives of adenine and guanine; 2-thiouracil, 2-thiothymine, and 2-thiocytosine; 5-halouracil and cytosine; 5- propynyl uracil and cytosine; 6-azo uracil, cytosine, and thymine; 5-uracil (pseudouracil); 4-thiouracil; 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, and other 8-substituted adenines and guanines; 5-halo, particularly 5-bromo, 5-trifluoromethyl,
  • modified bases include those disclosed in: U.S. Pat. No. 3,687,808; Kroschwitz, J. L, ed. (1990), pages 858-859; Englisch et al. (1991); and Sanghvi (1993).
  • modified bases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention.
  • These include 5- substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and 0-6-substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine.
  • 5- methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2 0 C (Sanghvi et al, 1993, pages 276-278), and are presently preferred base substitutions, even more particularly when combined with 2'-O-methoxyethyl sugar modifications.
  • RNA interference and small interfering RNA (siRNA) agents are examples of RNA interference and small interfering RNA (siRNA) agents.
  • the RNA-interfering oligonucleotide of the present invention is selected from the group consisting of: an antisense molecule, a RNA interference (RNAi) molecule (e.g. small interfering RNAs (siRNAs) and hairpin RNAs) and an enzymatic nucleic acid molecule (e.g. ribozymes and DNAzymes), as detailed hereinbelow.
  • RNAi RNA interference
  • siRNAs small interfering RNAs
  • hairpin RNAs e.g. RNAs
  • enzymatic nucleic acid molecule e.g. ribozymes and DNAzymes
  • the oligonucleotide is a siRNA molecule.
  • the constructs of the invention direct expression in cells of the subject of an siRNA molecule that inhibits or reduces Hl 9 RNA levels via RNA interference.
  • RNA interference or "RNAi” is a term initially applied to a phenomenon observed in plants and worms where double-stranded RNA (dsRNA) blocks gene expression in a specific and post-transcriptional manner.
  • RNA interference is a two-step process. It is believed that during the first step, which is termed the initiation step, input dsRNA is digested into 21-23 nucleotide (nt) small interfering RNAs (siRNA) by the enzyme Dicer, a member of the RNase III family of dsRNA-specific ribonucleases, which cleaves dsRNA (introduced directly or via an expressing vector, cassette or virus) in an ATP-dependent manner. Successive cleavage events degrade the RNA to 19-21 bp siRNA duplexes, each strand with 2-nucleotide 3' overhangs.
  • nt nucleotide
  • siRNA small interfering RNAs
  • the siRNA duplexes bind to a nuclease complex to form the
  • RNA-induced silencing complex An ATP-dependent unwinding of the siRNA duplex is believed to be required for activation of the RISC.
  • the active RISC then targets the homologous transcript by base pairing interactions and cleaves the mRNA into 12 nucleotide fragments from the 3' terminus of the siRNA. Although the mechanism of cleavage is still to be elucidated, research indicates that each RISC contains a single siRNA and an RNase.
  • RNAi RNAi RNAi RNAi amplification step within the RNAi pathway has been suggested to explain the remarkable potency of RNAi. Amplification could occur by copying of the input dsRNAs, which would generate more siRNAs, or by replication of the siRNAs formed. Alternatively or additionally, amplification could be effected by multiple turnover events of the RISC.
  • siRNA molecules of the present invention preferably comprise sense and antisense strands having nucleic acid sequence complementarity, wherein each strand is typically about 18-30 nucleotides in length.
  • each strand of the double stranded region may be e.g. 19-28, 19-26, 20-25, or 21-23 nucleotides in length.
  • the sense and antisense strands of the present siRNA comprise two complementary, single-stranded RNA molecules or comprise a single molecule in which two complementary portions are base-paired and are covalently linked by a single-stranded "hairpin" area (e.g. a shRNA molecule).
  • a hairpin area e.g. a shRNA molecule
  • Dicer or its equivalent
  • one or both strands of the siRNA of the invention also comprise a 3' overhang.
  • the siRNA of the invention comprises at least one 3' overhang of from 1 to about 6 nucleotides (which includes ribonucleotides or deoxynucleotides) in length, from 1 to about 5 nucleotides in length, from 1 to about 4 nucleotides in length, or from about 2 to about 4 nucleotides in length.
  • each strand of the siRNA of the invention can comprise 3' overhangs of dithymidylic acid ("TT") or diuridylic acid ("UU").
  • TT dithymidylic acid
  • UU diuridylic acid
  • synthesis of RNAi molecules suitable for use with the present invention can be carried out as follows. First, the Hl 9 nucleic acid sequence target is optionally scanned downstream for AA di-nucleotide sequences.
  • Each AA and the 3' adjacent 19 nucleotides is recorded as a potential siRNA target site.
  • sequence alignment software e.g., human, mouse, rat etc.
  • Putative target sites that exhibit significant homology to other coding sequences are filtered out.
  • Qualifying target sequences are selected as template for siRNA synthesis.
  • Preferred sequences are those including low G/C content as these have proven to be more effective in mediating gene silencing as compared to those with G/C content higher than 55 %.
  • Several target sites are preferably selected along the length of the target gene for evaluation.
  • a negative control is preferably used in conjunction.
  • Negative control siRNA preferably include the same nucleotide composition as the siRNAs but lack significant homology to the genome.
  • a scrambled nucleotide sequence of the siRNA is preferably used, provided it does not display any significant homology to any other gene.
  • An encoded siRNA agent of the present invention are of at least 10, at least 15, at least 17 or at least 19 bases specifically hybridizable with Hl 9 RNA, but excluding the full length Hl 9 RNA transcript or known variants thereof.
  • the H19-silencing oligonucleotides of the invention are preferably no more than about 1000 bases in length, more preferably no more than about 100 bases in length. In other preferable embodiments, the oligonucleotides are no more than 30 nucleotides (or base pairs) in length.
  • Hl 9 mRNA refers to a transcriptional product of the Hl 9 gene (see for example GenBank Accession No. M32053 - SEQ ID NO: 26).
  • oligonucleotide and oligonucleic acid are used interchangeably and refer to an oligomer or polymer of ribonucleic acid (ribo-oligonucleotide or ribo- oligonucleoside) or deoxyribonucleic acid. These terms include nucleic acid strands 008/000191
  • oligonucleotides composed of naturally occurring nucleobases, sugars and covalent intersugar linkages as well as oligonucleotides having non-naturally occurring portions which function similarly.
  • modified or substituted oligonucleotides may be preferred over native forms because of the valuable characteristics including, for example, increased stability in the presence of plasma nucleases and enhanced cellular uptake.
  • H19-silencing oligonucleic acid denotes an oligonucleic acid capable of specifically reducing the level or expression of the gene product, i.e. the level of Hl 9 RNA, below the level that is observed in the absence of the oligonucleic acid.
  • gene expression is down-regulated by at least 25%, preferably at least 50%, at least 70%, 80% or at least 90%.
  • Expression-inhibiting (down-regulating or silencing) oligonucleic acids include, for example, RNA interfering molecules (RNAi) as detailed herein.
  • RNAi RNA interfering molecules
  • the phrase "specifically hybridizable” as used herein indicates a sufficient degree of complementarity such that stable and specific binding occurs between the target and the oligonucleotide.
  • a nucleic acid sequence specifically hybridizable with Hl 9 RNA has a preference for hybridizing (in cells, under physiological conditions) with H19 RNA as opposed to a non-related RNA molecule (e.g. GAPDH).
  • said sequence has at least a 5-fold preference for hybridizing with Hl 9 RNA as opposed to a non-related RNA molecule.
  • siRNA agents directed to Hl 9 are known in the art, and their nucleic acid sequences may be used in preparing the recombinant constructs and vectors of the invention.
  • certain H19-specific siRNA molecules are commercially available, e.g. those having a nucleic acid sequence as denoted by SEQ ID NOs: 14-25, as follows:
  • SEQ IDNO: 14 CCUCUAGCUUGGAAAUGAAUAUGCU (Exon4, 1617-1641); SEQ IDNO: 15 - CCUGACUCAGGAAUCGGCUCUGGAA (Exon4, 1664-1688); SEQ IDNO: 16 - CCCAACAUCAAAGACACCAUCGGAA (Exon 5, 1719-1743); SEQ IDNO: 17 - CACCGCAAUUCAUUUAGUAUU (Exon 1, 775-793); SEQ ID NO: 18 - GAUCGGUGCCUCAGCGUUCUU (Exon 1, 1285-1303); SEQ ID NO: 19 - UGUAUGCCCUCACCGCUCAUU (Exon 1, 1050-1068); SEQ ID NO: 20 - GGAGCAGCCUUCAAGCAUUUU (Exon 5, 2201-2219); SEQ ID NO: 21 - CCACGGAGUCGGCACACUAdTdT (Exon 1, 1509-1527); SEQ ID NO: 22 - CAGCCUUCAAGCAUUCCAU
  • the siRNA comprises a sense strand as set forth in any one of SEQ ID NOS: 14-16. In certain other embodiments, the siRNA comprises a sense strand as set forth in any one of SEQ ID NOS: 18 and 20. In other particular embodiments, the siRNA comprises a sense strand as set forth in any one of SEQ ID NOS: 22-24.
  • silencing oligonucleotides of the invention are targeted to (hybridizable with) specific areas of the Hl 9 transcript identified in exons I 5 2, and 5, and substantially comprise a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-4.
  • the siRNA oligonucleotides are 19 base pairs in length with two 3' overhangs on each strand: Table 1 - exemplary H19-downregulating sequences (sense strand)
  • nucleotide positions are relative to the H19 transcript as set forth in Accession No. NR_002196 (SEQ ID NO: 9).
  • exemplary siRNA molecules of the present invention comprise a sense strand and an antisense strand, the sense strand having a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-4, wherein the sense and/or the antisense strand optionally comprises a 3' overhang.
  • the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 1. In another embodiment, the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 2. In another embodiment, the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 3. In another embodiment, the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 4. Each possibility represents a separate embodiment of the present invention.
  • siRNAs that are capable of down-regulating Hl 9 that may be used in the present invention are those set forth by SEQ ID NOs: 5-8, as illustrated in Table 2 hereinbelow.
  • these exemplary siRNA oligonucleotides are 19 base pairs in length with two 3' overhangs on each strand:
  • the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 5. In another embodiment, the nucleic acid sequence of the sense strand is as set forth in SEQ ID NO: 5. In another embodiment, the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 6. In another embodiment, the nucleic acid sequence of the sense strand is as set forth in SEQ ID NO: 6. In another embodiment, the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 7. In another embodiment, the nucleic acid sequence of the sense strand is as set forth in SEQ ID NO7. In another embodiment, the sense strand has a nucleic acid sequence as set forth in SEQ ID NO: 8. In another embodiment, the nucleic acid sequence of the sense strand is as set forth in SEQ ID NO: 8. Each possibility represents a separate embodiment of the present invention.
  • the encoded siRNA comprises a nucleic acid sequence as set forth in any one of SEQ ID NOs: 1-8 and 14-25, wherein each possibility represents a separate embodiment of the present invention.
  • said siRNA consists of a nucleic acid sequence as set forth in any one of SEQ ID NOs: 1-8 and 14-25, wherein each possibility represents a separate embodiment of the present invention.
  • said siRNA is a homolog, variant, fragment or variant of a fragment of these sequences as detailed herein, wherein each possibility represents a separate embodiment of the present invention.
  • siRNA molecules wherein the two 3' nucleotides are deoxythymidine residues, as illustrated in Table 2, it is to be understood that other modifications are within the scope of the present invention.
  • the use of analogs, variants and derivatives of the sequences set forth in any one of SEQ ID NOS: 1-8 and 14-25 is contemplated, as long as the inhibitory activity of the H19-downregulating oligonucleotide is retained.
  • the siRNA may contain 2'-O-methyl and/or phosphorothioate substituent nucleotides.
  • the siRNA is a variant, homolog or derivative of any one of SEQ ID NOs: 1-8 and 14-25.
  • DNAzyme molecule capable of specifically cleaving its encoding polynucleotides.
  • DNAzymes are single-stranded nucleic acid agents that are capable of cleaving both single and double stranded target sequences.
  • a general model (the "10-23" model) for the DNAzyme has been proposed.
  • "10-23" DNAzymes have a catalytic domain of 15 deoxyribonucleotides, flanked by two substrate-recognition domains of seven to nine deoxyribonucleotides each. This type of DNAzyme can effectively cleave its substrate RNA at purine:pyrimidine junctions (for a review of DNAzymes see Khachigian, 2002). Examples of construction and amplification of synthetic, engineered
  • Ribozyme molecule capable of specifically cleaving its encoding polynucleotides. Ribozymes are being increasingly used for the sequence-specific inhibition of gene expression by the cleavage of mRNAs encoding proteins of interest (Welch et ah, 1998). The possibility of designing ribozymes to cleave any specific target RNA has rendered them valuable tools in both basic research and therapeutic applications. In the therapeutics area, ribozymes have been exploited to target viral RNAs in infectious diseases, dominant oncogenes in cancers and specific somatic mutations in genetic disorders.
  • ribozyme gene therapy protocols for HIV-I, cancer, and other diseases are already in clinical or pre-clinical trials. More recently, ribozymes have been used for transgenic animal research, gene target validation and pathway elucidation. Several ribozymes are in various stages of clinical trials.
  • ANGIOZYME was the first chemically synthesized ribozyme to be studied in human clinical trials. ANGIOZYME specifically inhibits formation of the VEGF-r (Vascular Endothelial Growth Factor receptor), a key component in the angiogenesis pathway. Ribozyme Pharmaceuticals, Inc., as well as other firms have demonstrated the importance of anti-angiogenesis therapeutics in animal models.
  • HEPTAZYME a ribozyme designed to selectively destroy Hepatitis C Virus (HCV) RNA, was found effective in decreasing Hepatitis C viral RNA in cell culture assays (Ribozyme Pharmaceuticals, Incorporated http://www.rpi.com/index.htmD.
  • TFOs TFOs
  • studies have shown that TFOs can be designed which can recognize and bind to polypurine/polypirimidine regions in double-stranded helical
  • DNA in a sequence-specific manner.
  • the DNA sequence encoding the Hl 9 RNA of the present invention can be targeted thereby down-regulating the RNA molecule.
  • the recognition rules governing TFOs are outlined e.g. by EP Publication 375408. Modification of the oligonucleotides, such as the introduction of intercalators and backbone substitutions, and optimization of binding conditions (pH and cation concentration) have aided in overcoming inherent obstacles to TFO activity such as charge repulsion and instability, and it was recently shown that synthetic oligonucleotides can be targeted to specific sequences (for a recent review see Seidman and Glazer, 2003).
  • the triplex-forming oligonucleotide has the sequence correspondence: oligo 3' ⁇ A G G T duplex 5 ? ⁇ A G C T duplex 3' ⁇ T C G A
  • triplex-forming oligonucleotides preferably are at least 15, more preferably 25, still more preferably 30 or more nucleotides in length, up to 50 or 100 bp.
  • Transfection of cells for example, via cationic liposomes
  • TFOs Transfection of cells (for example, via cationic liposomes) with TFOs, and subsequent formation of the triple helical structure with the target DNA, induces steric and functional changes, blocking transcription initiation and elongation, allowing the introduction of desired sequence changes in the endogenous DNA and results in the specific downregulation of gene expression.
  • Vuyisich and Beal have recently shown that sequence specific TFOs can bind to dsRNA, inhibiting activity of dsRNA-dependent enzymes such as RNA-dependent kinases (Vuyisich and Beal, 2000).
  • TFOs designed according to the abovementioned principles can induce directed mutagenesis capable of effecting DNA repair, thus providing both downregulation and upregulation of expression of endogenous genes (Seidman and Glazer, 2003).
  • Detailed description of the design, synthesis and administration of effective TFOs can be found in U.S. Patent Application Nos. 2003 017068 and 2003 0096980 to Froehler et ah, and 2002 0128218 and 2002 0123476 to Emanuele et al., and U.S. Pat. No. 5,721,138 to Lawn.
  • nucleic acid agents capable of hybridizing to Hl 9 RNA may down-regulate an activity thereof by preventing binding of Hl 9 RNA to another downstream agent.
  • nucleic acid agents of the present invention e.g., an siRNA molecule such as those set forth by any one of SEQ ID Nos: 1-8) can be expressed in cells.
  • agents of the present invention may be expressed directly in the subject (i.e. in vivo gene therapy) or may be expressed ex vivo in a cell system (autologous or non-autologous) and then administered to the subject.
  • construct includes a nucleic acid sequence encoding silencing oligonucleic acid according to the present invention, the nucleic acid sequence operably linked to a promoter and optionally other transcription regulation sequences.
  • a nucleic acid sequence encoding the agents of the present invention is preferably ligated into a nucleic acid construct suitable for mammalian cell expression.
  • a nucleic acid construct includes a promoter sequence for directing transcription of the polynucleotide sequence in the cell in a constitutive or inducible manner.
  • constructs of the present invention may be produced using standard recombinant and synthetic methods well known in the art.
  • An isolated nucleic acid sequence can be obtained from its natural source, either as an entire (i.e., complete) gene or a portion thereof.
  • a nucleic acid molecule can also be produced using recombinant DNA technology (e.g., polymerase chain reaction (PCR) amplification, cloning) or chemical synthesis (see e.g. Sambrook et al., 2001; Ausubel, et al., 1989, Chapters 2 and 4).
  • PCR polymerase chain reaction
  • Nucleic acid sequences include natural nucleic acid sequences and homologs thereof, including, but not limited to, natural allelic variants and modified nucleic acid sequences in which nucleotides have been inserted, deleted, substituted, and/or inverted in such a manner that such modifications do not substantially interfere with the nucleic acid molecule's ability to encode a functional oligonucleotide of the invention.
  • a nucleic acid molecule homolog can be produced using a number of methods known to those skilled in the art (see, for example, Sambrook et al., 2001).
  • nucleic acid molecules can be modified using a variety of techniques including, but not limited to, classic mutagenesis techniques and recombinant DNA techniques, such as site-directed mutagenesis, chemical treatment of a nucleic acid molecule to induce mutations, restriction enzyme cleavage of a nucleic acid fragment, ligation of nucleic acid fragments, polymerase chain reaction (PCR) amplification and/or mutagenesis of selected regions of a nucleic acid sequence, synthesis of oligonucleotide mixtures and ligation of mixture groups to "build" a mixture of nucleic acid molecules and combinations thereof.
  • classic mutagenesis techniques and recombinant DNA techniques such as site-directed mutagenesis
  • chemical treatment of a nucleic acid molecule to induce mutations
  • nucleic acid molecule homologs can be selected from a mixture of modified nucleic acids by screening for the function of the oligonucleic acid encoded by the nucleic acid with respect to occurrence of restenosis, for example by the methods described herein.
  • the phrase "operably linked” refers to linking a nucleic acid sequence to a transcription control sequence in a manner such that the molecule is able to be expressed when transfected (i.e., transformed, transduced, infected or transfected) into a host cell.
  • Transcription control sequences are sequences, which control the initiation, elongation, and termination of transcription.
  • transcription control sequences are those that control transcription initiation, such as promoter, enhancer, operator and repressor sequences.
  • Suitable transcription control sequences include any transcription control sequence that can function in at least one of the recombinant cells of the present invention. A variety of such transcription control sequences are known to those skilled in the art. Exemplary suitable transcription control sequences include those that function in animal, bacteria, helminth, yeast and insect cells.
  • the constructs of the invention comprise mammalian transcription control sequences, more preferably human regulatory sequences, and, optionally and additionally, other regulatory sequences.
  • Constitutive promoters suitable for use with the present invention are promoter sequences that are active under most environmental conditions and most types of cells such as the cytomegalovirus (CMV) and Rous sarcoma virus (RSV). Inducible promoters are induced in particular cell types or under certain conditions.
  • CMV cytomegalovirus
  • RSV Rous sarcoma virus
  • a vector comprising at least one recombinant construct comprising at least one nucleic acid sequence encoding a small interfering
  • the transcription-regulating sequence is a promoter.
  • the transcription-regulating sequence is another type of transcription-regulating sequence.
  • the transcription-regulating sequence is an H19-specific promoter.
  • the H19-specific promoter has a nucleic acid sequence as set forth in SEQ ID NO: 29. In another embodiment, the H19-specific promoter is a homolog of SEQ ID NO: 29. In another embodiment, the promoter is a variant of SEQ ID NO: 29. In another embodiment, the promoter is a fragment of SEQ ID NO: 29. In another embodiment, the promoter is a homolog of a fragment of SEQ ID NO: 29. In different embodiments, "homolog" may refer e.g. to any degree of homology disclosed 000191
  • the promoter is a variant of a fragment of SEQ ID NO: 29.
  • variant refers to substantially similar sequences possessing common qualitative biological activities.
  • An oligonucleotide variant includes a pharmaceutically acceptable salt, homolog, analog, extension or fragment of a nucleotide sequence useful for the invention.
  • variant are chemically modified natural and synthetic nucleotide molecules (derivatives).
  • substitutions conservative or non- conservative, additions or deletions within the nucleotide sequence of the molecule, as long as the required function is sufficiently maintained.
  • Oligonucleotide and polynucleotides variants may share at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity (homology).
  • homolog may refer e.g. to any degree of homology disclosed herein.
  • the H19-specific promoter has a nucleic acid sequence as set forth in SEQ ID NO: 30. In another embodiment, the H19-specific promoter is a homolog of SEQ ID NO: 30. In another embodiment, the promoter is a variant of SEQ ID NO: 30. In another embodiment, the promoter is a fragment of SEQ
  • the promoter is a homolog of a fragment of SEQ ID NO: 30.
  • the promoter is a homolog of a fragment of SEQ ID NO: 30.
  • homolog may refer e.g. to any degree of homology disclosed herein.
  • the promoter is a variant of a fragment of
  • SEQ ID NO: 30 Each possibility represents a separate embodiment of the present invention.
  • the transcription-regulating sequence is a tissue-specific promoter (e.g. a vascular smooth muscle cell promoter).
  • the sequence is a tumor necrosis factor alpha promoter (Monraats et al, FASEB J 19(14): 1998-2004, 2005).
  • the sequence is an Interleukin 18 promoter (Chandrasekar et al, J Biol Chem 281(22): 15099-109, 2006).
  • the sequence is a nitric oxide synthase promoter (Gomma et al, Eur Heart J ;23(24): 1955-62, 2002).
  • the sequence is a RASLIlB promoter.
  • the sequence is a Platelet-derived growth factor promoter (Li et al, J Cardiovasc Pharmacol 48(4): 184-90, 2006).
  • the sequence is a RASLIlB promoter.
  • the sequence is an ICAM-I (intracellular adhesion molecule 1) promoter (Kollum et al, Coron Artery Dis 18(2): 117-23, 2007).
  • the sequence is a bFGF (Basic fibroblast growth factor) promoter (Wildgruber et al, Eur J Vase Endovasc Surg 34(1): 35-43, 2007).
  • the sequence is a smooth muscle alpha-actin promoter.
  • the sequence is a Myocardin (Myocd) promoter.
  • the sequence is a Myocardin-related transcription factor A (MRTF-A) promoter.
  • the sequence is a MRTF-B promoter.
  • the sequence is a smooth muscle myosin heavy-chain promoter (Franz et al, Cardiovasc Res 43(4): 1040-8, 1999).
  • the sequence is a TGFB (Transforming growth factor beta) promoter (Wildgruber et al, Eur J Vase Endovasc Surg 34(1): 35-43, 2007).
  • the sequence is a serum response factor (SRF) promoter.
  • the sequence is a MEF2B promoter. In another embodiment, the sequence is a MEF2C promoter. In another embodiment, the sequence is a Phoxl/Mhox promoter. In another embodiment, the sequence is a Barxlb promoter. In another embodiment, the sequence is a Barx2b promoter. In another embodiment, the sequence is a Nkx3.1 promoter. In another embodiment, the sequence is a Nkx3.2 promoter. In another embodiment, the sequence is a Hox B7 promoter. In another embodiment, the sequence is a Hex promoter. In another embodiment, the sequence is a Gax (Mox2) promoter. In another embodiment, the sequence is a GATA 4 promoter.
  • the sequence is a GATA 5 promoter. In another embodiment, the sequence is a GATA 6 promoter. Each possibility represents a separate embodiment of the present invention.
  • the transcription-regulating sequence is any promoter known in the art capable of directing expression of a gene in a vascular smooth muscle cell.
  • the transcription-regulating sequence is an H19-specific enhancer element.
  • the enhancer has a nucleic acid sequence as set forth in SEQ ID NO: 31.
  • the enhancer is a homolog of SEQ
  • the enhancer is a variant of SEQ ID NO: 31.
  • the enhancer is a fragment of SEQ ID NO: 31.
  • the enhancer is a homolog of a fragment of SEQ ID NO: 31.
  • "homolog” may refer e.g. to any degree of homology disclosed herein.
  • the enhancer is a variant of a fragment of SEQ ID NO: 31.
  • the enhancer has a nucleic acid sequence as set forth in SEQ ID NO: 32.
  • the enhancer is a homolog of SEQ ID NO: 32.
  • the enhancer is a variant of SEQ ID NO: 32. In another embodiment, the enhancer is a fragment of SEQ ID NO: 32. In another embodiment, the enhancer is a homolog of a fragment of SEQ ID NO: 32. In different embodiments, "homolog" may refer e.g. to any degree of homology disclosed herein. In another embodiment, the enhancer is a variant of a fragment of SEQ ID NO: 32. Each possibility represents a separate embodiment of the present invention.
  • the enhancer has a nucleic acid sequence as set forth in SEQ ID NO: 33. In another embodiment, the enhancer is a homolog of SEQ ID NO: 33.
  • the enhancer is a variant of SEQ ID NO: 33. In another embodiment, the enhancer is a fragment of SEQ ID NO: 33. In another embodiment, the enhancer is a homolog of a fragment of SEQ ID NO: 33. In different embodiments,
  • homolog may refer e.g. to any degree of homology disclosed herein.
  • the enhancer is a variant of a fragment of SEQ ID NO: 33. Each possibility represents a separate embodiment of the present invention.
  • the transcription-regulating sequence is a tissue specific enhancer element (e.g. a vascular smooth muscle cell enhancer element).
  • the enhancer is from the promoter region of one of the vascular smooth muscle cell-expressed genes in the above paragraph.
  • the transcription-regulating sequence is a serum response factor (SRF) enhancer element.
  • the sequence is a MEF2B enhancer element.
  • the sequence is a MEF2C enhancer element.
  • the sequence is a Phoxl/Mhox enhancer element.
  • the sequence is a Barxlb enhancer element.
  • the sequence is a Barx2b enhancer element.
  • the sequence is a Nkx3.1 enhancer element.
  • the sequence is a Nkx3.2 enhancer element.
  • the sequence is a Hox B 7 enhancer element.
  • the sequence is a Hex enhancer element.
  • the sequence is a Gax (Mox2) enhancer element. In another embodiment, the sequence is a GATA 4 enhancer element. In another embodiment, the sequence is a GATA 5 enhancer element. In another embodiment, the sequence is a GATA 6 enhancer element. In another embodiment, the transcription-regulating sequence is any enhancer element known in the art capable of enhancing expression of a gene in a vascular smooth muscle cell.
  • the term "vector” refers to a construct comprising a regulatory sequence operatively linked to a heterologous polynucleotide that is administered to target cells.
  • the vector can be a viral expression vector, a plasmid or a construct of naked DNA, and, optionally, can include additional sequences required for construction, selection, stability, penetration, etc.
  • the nucleic acid construct (also referred to herein as an "expression vector") of the present invention include, in another embodiment, additional sequences, which render this vector suitable for replication and integration in prokaryotes, eukaryotes, or preferably both (e.g., shuttle vectors).
  • additional sequences which render this vector suitable for replication and integration in prokaryotes, eukaryotes, or preferably both (e.g., shuttle vectors).
  • typical cloning vectors may also contain a transcription and translation initiation sequence, a transcription and translation terminator, and/or a polyadenylation signal.
  • Eukaryotic promoters typically contain two types of recognition sequences, the
  • the TATA box located 25-30 base pairs upstream of the transcription initiation site, is thought to be involved in directing RNA polymerase to begin RNA synthesis.
  • the other upstream promoter elements determine the rate at which transcription is initiated.
  • the promoter utilized by the nucleic acid construct of the present invention is active in the specific target cell population.
  • the construct may comprise any promoter or enhancer element known in the art that functions in vascular smooth muscle cells.
  • Enhancer elements can stimulate transcription up to 1, 000-fold from linked homologous or heterologous promoters. Enhancers are active when placed downstream or upstream from the transcription initiation site. Many enhancer elements derived from viruses have a broad host range and are active in a variety of tissues. For example, the SV40 early gene enhancer is suitable for many cell types. Other enhancer/promoter combinations that are suitable for the present invention include those derived from polyoma virus, human or murine cytomegalovirus (CMV), the long term repeat from various retroviruses such as murine leukemia virus, murine or Rous sarcoma virus and HIV. See, Enhancers and Eukaryotic Expression, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. 1983, which is incorporated herein by reference.
  • CMV cytomegalovirus
  • the promoter is preferably positioned approximately the same distance from the heterologous transcription start site as it is from the transcription start site in its natural setting. As is known in the art, however, some variation in this distance can be accommodated without loss of promoter function.
  • Polyadenylation sequences can also be added to the expression vector in order to increase RNA stability. Two distinct sequence elements are required for accurate and efficient polyadenylation: GU or U rich sequences located downstream from the polyadenylation site and a highly conserved sequence of six nucleotides, AAUAAA, located 11-30 nucleotides upstream. Exemplary termination and polyadenylation signals that are suitable for the present invention include those derived from SV40.
  • the expression vector of the present invention may typically contain other specialized elements intended to increase the level of expression of cloned nucleic acids or to facilitate the identification of cells that carry the recombinant DNA.
  • other specialized elements intended to increase the level of expression of cloned nucleic acids or to facilitate the identification of cells that carry the recombinant DNA.
  • a number of animal viruses contain
  • Plasmids bearing these viral replicons are replicated episomally as long as the appropriate factors are provided by genes either carried on the plasmid or with the genome of the host cell.
  • the vector may or may not include a eukaryotic replicon. If a eukaryotic replicon is present, then the vector is amplifiable in eukaryotic cells using the appropriate selectable marker. If the vector does not comprise a eukaryotic replicon, no episomal amplification is possible. Instead, the recombinant DNA integrates into the genome of the engineered cell, where the promoter directs expression of the desired nucleic acid.
  • RNAi expression vectors are replicable nucleic acid constructs used to express (transcribe) RNA which produces siRNA moieties in the cell in which the construct is expressed.
  • Such vectors include a transcriptional unit comprising an assembly of (1) genetic element(s) having a regulatory role in gene expression, for example, promoters, operators, or enhancers, operatively linked to (2) a "coding" sequence which is transcribed to produce a double-stranded RNA (two RNA moieties that anneal in the cell to form an siRNA, or a single hairpin RNA which can be processed to an siRNA), and (3) appropriate transcription initiation and termination sequences.
  • a transcriptional unit comprising an assembly of (1) genetic element(s) having a regulatory role in gene expression, for example, promoters, operators, or enhancers, operatively linked to (2) a "coding" sequence which is transcribed to produce a double-stranded RNA (two RNA moieties that anneal in the cell to form an siRNA, or a single hairpin RNA which can be processed to an siRNA), and (3) appropriate transcription initiation and termination sequences.
  • siRNAs small hairpin RNAs
  • Another type of siRNA expression vector encodes the sense and antisense siRNA strands under control of separate pol III promoters.
  • the siRNA strands from this vector like the shRNAs of the other vectors, may have 3' thymidine termination signals. Silencing efficacy by both types of expression vectors was comparable to that induced by transiently transfecting siRNA.
  • Expression vectors containing regulatory elements from eukaryotic viruses can be also used.
  • RNA molecules such as siRNAs
  • plasmid vectors for example plasmid vectors, inducible vectors, adenoviral vectors, retroviral vectors and lentiviral vectors and CMV-based vectors.
  • exemplary vectors include pSilencerTM vectors (Ambion), Genescript siRNA vectors, Imagenex vectors (e.g. IMG-1000, IMG-700 and IMG-1200), among others.
  • viruses are very specialized infectious agents that have evolved, in many cases, to elude host defense mechanisms.
  • viruses infect and propagate in specific cell types.
  • the targeting specificity of viral vectors utilizes its natural specificity to specifically target predetermined cell types and thereby introduce a recombinant gene into the infected cell.
  • the type of vector used by the present invention will depend on the cell type transformed.
  • the ability to select suitable vectors according to the cell type transformed is well within the capabilities of the ordinary skilled artisan and as such no general description of selection consideration is provided herein.
  • Recombinant viral vectors are useful for in vivo expression of the H19-silencing agents of the present invention since they offer advantages such as lateral infection and targeting specificity.
  • Lateral infection is inherent in the life cycle of, for example, retrovirus and is the process by which a single infected cell produces many progeny virions that bud off and infect neighboring cells. The result is that a large area becomes rapidly infected, most of which was not initially infected by the original viral particles. This is in contrast to vertical-type of infection in which the infectious agent spreads only through daughter progeny. Viral vectors can also be produced that are unable to spread laterally. This characteristic can be useful if the desired purpose is to introduce a specified gene into only a localized number of targeted cells.
  • nucleic acids by viral infection offers several advantages over other methods such as lipofection and electroporation, since higher transfection efficiency can be obtained due to the infectious nature of viruses.
  • the expression construct of the present invention can also include sequences engineered to enhance stability, production, purification, yield or toxicity of the expressed RNA.
  • the vector is constructed so as to enable stable expression of the siRNA agent in the target cell.
  • the vector may be integrated to the genome of the target cell using viral vectors (e.g. lentiviral vectors) or specific recombination (e.g. by the Cre/lox site-specific recombination system known in the art may be conveniently used which employs the bacteriophage Pl protein Cre recombinase and its recognition sequence loxP).
  • the invention provides an isolated host cell comprising at least one recombinant construct comprising at least one nucleic acid sequence encoding a small interfering RNA (siRNA) molecule directed to Hl 9.
  • siRNA small interfering RNA
  • Useful lipids for lipid-mediated transfer of the gene are, for example, DOTMA,
  • DOPE DOPE
  • DC-Choi Teonkinson et al., 1996.
  • Other vectors can be used, such as cationic lipids, poly Iy sine, and dendrimers.
  • the expression construct of the present invention can also include sequences engineered to enhance stability, production, purification, yield or toxicity of the expressed RNA.
  • agents of the present invention can be administered to a subject per se, or in a pharmaceutical composition where they are mixed with suitable carriers or excipients.
  • the composition comprises as an active agent an Hl 9- silencing oligonucleotide of the invention.
  • Hl 9 silencing agents e.g. siRNA
  • H19-silencing oligonucleotides e.g. siRNA having a nucleic acid sequence as set forth in any one of SEQ ID NOs: 1-8 and 14-25, including variants, analogs and derivatives thereof, may be used.
  • sequences in which a deoxythymidine (dT) residue has been substituted for a uracil residue or is absent may be used (for example, when expressing an siRNA molecule from a nucleic acid construct of the invention).
  • pharmaceutical composition refers to a preparation of one or more of the active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients. The purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism.
  • active ingredient refers to the agent accountable for the reduction or prevention of restenosis (Hl 9-silencing agent).
  • physiologically acceptable carrier and “pharmaceutically acceptable carrier” which may be interchangeably used refer to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound.
  • excipient refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient. Examples, without limitation, of excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols.
  • nucleic acid molecules Methods for the delivery of nucleic acid molecules is described in Akhtar et al., 1992, Trends Cell Biol., 2, 139; and Delivery Strategies for Antisense Oligonucleotide Therapeutics, ed. Akhtar, 1995 which are both incorporated herein by reference.
  • Sullivan et al., WO 94/02595 further describes the general methods for delivery of enzymatic RNA molecules. These protocols can be utilized for the delivery of virtually any nucleic acid molecule.
  • Nucleic acid molecules can be administered to cells by a variety of methods known to those familiar to the art, including, but not restricted to, encapsulation in liposomes, by iontophoresis, or by incorporation into other vehicles, such as hydrogels, cyclodextrins, biodegradable nanocapsules, and bioadhesive microspheres.
  • nucleic acid molecules can be directly delivered ex vivo to cells or tissues with or without the aforementioned vehicles.
  • the nucleic acid/vehicle combination is locally delivered by direct injection or by use of a catheter, infusion pump or stent.
  • routes of delivery include, but are not limited to, intravascular, intramuscular, subcutaneous or joint injection, aerosol inhalation, oral (tablet or pill form), topical, systemic, ocular, intraperitoneal and/or intrathecal delivery. More detailed descriptions of nucleic acid delivery and administration are provided in Sullivan et al., WO 94/02595 and Draper et al., WO 93/23569 which have been incorporated by reference herein. The molecules of the instant invention can be used as pharmaceutical agents.
  • Pharmaceutical agents prevent, inhibit the occurrence, or treat (alleviate a symptom to some extent, preferably all of the symptoms) of the disease state in a patient.
  • the nucleic acid is locally delivered in a sustained or extended release manner in particular by means of a drug-eluting stent.
  • administering is carried out by injecting the nucleic acid agent from an injection balloon catheter directly into the vascular injury site, under pressure, through injectors contained on the surface of the catheter balloon.
  • compositions for use in accordance with the present invention thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations that can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.
  • the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological salt buffer.
  • physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological salt buffer.
  • penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
  • the pharmaceutical composition can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art.
  • Such carriers enable the pharmaceutical composition to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for oral ingestion by a patient.
  • Pharmacological preparations for oral use can be made using a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries if desired, to obtain tablets or dragee cores.
  • Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carbomethylcellulose; and/or physiologically acceptable polymers such as polyvinylpyrrolidone (PVP).
  • disintegrating agents may be added, such as cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
  • Dragee cores are provided with suitable coatings.
  • suitable coatings For this purpose, concentrated sugar solutions may be used which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures.
  • Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
  • compositions which can be used orally include push-fit capsules made of gelatin as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol.
  • the push-fit capsules may contain the active ingredients in admixture with filler such as lactose, binders such as starches, lubricants such as talc or magnesium stearate and, optionally, stabilizers.
  • the active ingredients may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols.
  • stabilizers may be added. All formulations for oral administration should be in dosages suitable for the chosen route of administration.
  • compositions may take the form of tablets or lozenges formulated in conventional manner.
  • the active ingredients for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from a pressurized pack or a nebulizer with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluorornethane, dichloro- tetrafluoroethane or carbon dioxide.
  • a suitable propellant e.g., dichlorodifluoromethane, trichlorofluorornethane, dichloro- tetrafluoroethane or carbon dioxide.
  • the dosage unit may be determined by providing a valve to deliver a metered amount.
  • Capsules and cartridges of, e.g., gelatin for use in a dispenser may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
  • compositions described herein may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion.
  • Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multidose containers with optionally, an added preservative.
  • the compositions may be suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • compositions for parenteral administration include aqueous solutions of the active preparation in water-soluble form. Additionally, suspensions of the active ingredients may be prepared as appropriate oily or water based injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes. Aqueous injection suspensions may contain substances, which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the active ingredients to allow for the preparation of highly concentrated solutions.
  • the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water based solution, before use.
  • a suitable vehicle e.g., sterile, pyrogen-free water based solution
  • compositions of the present invention may also be formulated in rectal compositions such as suppositories or retention enemas, using, e.g., conventional suppository bases such as cocoa butter or other glycerides.
  • the pharmaceutical composition can also include a transfection agent such as DOTMA, DOPE, and DC-Choi (Tonkinson et al., 1996).
  • a transfection agent such as DOTMA, DOPE, and DC-Choi (Tonkinson et al., 1996).
  • a preferred example of a transfection agent is poly(ethylamine) (PEI).
  • compositions suitable for use in context of the present invention include compositions wherein the active ingredients are contained in an amount effective to achieve the intended purpose. More specifically, a therapeutically effective amount means an amount of active ingredients (nucleic acid agent) effective to prevent, alleviate or ameliorate symptoms of a disorder or prolong the survival of the subject being treated. Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.
  • the therapeutically effective amount or dose can be estimated initially from in vitro and cell culture assays.
  • a dose can be formulated in animal models to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans.
  • Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals.
  • the data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human.
  • the dosage may vary depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can 1
  • Dosage amount and interval may be adjusted individually to provide plasma or tissue levels of the active ingredient are sufficient to induce or suppress the biological effect (minimal effective concentration or "MEC").
  • MEC minimum effective concentration
  • the MEC will vary for each preparation, but can be estimated from in vitro data. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations.
  • dosing can be of a single or a plurality of administrations, with course of treatment lasting from several days to several weeks or until cure is effected or diminution of the disease state is achieved.
  • compositions to be administered will, of course, be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc.
  • compositions of the present invention may, if desired, be presented in a pack or dispenser device, such as an FDA approved kit, which may contain one or more unit dosage forms containing the active ingredient.
  • the pack may, for example, comprise metal or plastic foil, such as a blister pack.
  • the pack or dispenser device may be accompanied by instructions for administration.
  • the pack or dispenser may also be accommodated by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions or human or veterinary administration. Such notice, for example, may be of labeling approved by the U.S. Food and Drug Administration for prescription drugs or of an approved product insert.
  • Compositions comprising a preparation of the invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition, as if further detailed above.
  • the invention provides an implantable or insertable medical device or apparatus such as a surgical stent that allows release therefrom of an Hl 9- silencing agent of the invention.
  • the drug-eluting stents of the invention are useful e.g. for inhibiting or preventing restenosis, e.g. following cardiac angioplasty.
  • the agent or drug will be contained in reservoirs in the stent body prior to release.
  • the drug will be held within the reservoirs in the stent in a drug delivery matrix comprised of the drug and a polymeric material and optionally additives to regulate the drug release.
  • the polymeric material is a bioresorbable polymer.
  • the drug delivery stent of the present invention can include matrices fixed to a stent in a variety of manners including reservoirs, coatings, microspheres, affixed with adhesion materials or combinations thereof.
  • Preparation of a stent and its coating with an H19-silencing agent-containing formulation is performed by methods known in the art.
  • methods for preparing drug-eluting stents for delivering nucleic acid agents is described in U.S. Patent Nos. 6,468,304 (coating by electropolymerization or deposition of the polymer in solution on the support, followed by electrochemical oxidation or reduction); 6,746,686 (coating with a water swellable polymer matrix); and 6,506,408 (coating with a pH- sensitive polymer).
  • the medical device can also be coated with a formulation comprising the H19-silencing nucleic acid agents of the invention, as described, for example, in U.S. Pat. No. 6,395,029.
  • the stent comprises a support coated by a formulation comprising the H19-silencing nucleic acid agents
  • a metallic support made, for example, of steel, of metal alloy or of a metal which is biocompatible and more particularly of stainless steel, tantalum, platinum, gold, nickel- titanium alloy or platinum-indium alloy.
  • a support made of stainless steel can be advantageously used when the coating reagents (e.g. electrolytic media) do not comprise chloride. It is also possible to use a nonmetallic support.
  • biologically compatible electrically conducting charged polymers can be coated according to the methods described in U.S. Patent Nos. 6,468,304.
  • Additional platforms for the invention include polymeric biodegradable stents and scaffolds, including synthetic biodegradable or bioerodible porous scaffolds produced using solid free-form fabrication techniques which include selective laser sintering, three-dimensional printing, fused deposition manufacturing, and stereolithography for micro- or nano-fabrication.
  • the H19-silencing agent may be inserted into reservoirs in the stent in their pure form, as a liquid solution or gel, or they may be encapsulated within or by a release system, e.g. in a matrix formed of degradable material or a material which releases incorporated molecules by diffusion out of or disintegration of the matrix.
  • the molecules can be sometimes contained in a release system because the degradation, dissolution, or diffusion properties of the release system provide a method for controlling the release rate of the molecules.
  • the molecules can be homogeneously or heterogeneously distributed within the release system. Selection of the release system is dependent on the desired rate of release of the molecules. Both non-degradable and degradable release systems can be used for delivery of molecules.
  • Suitable release systems include polymers and polymeric matrices, non-polymeric matrices, or inorganic and organic excipients and diluents such as, but not limited to, calcium carbonate and sugar. Release systems may be natural or synthetic, although synthetic release systems typically are preferred due to the better characterization of release profiles (see, for example, U.S. Pat. No. 6,656,162).
  • an intracoronary stent capable of eluting to the surrounding tissue a therapeutically effective amount of at least one Hl 9- silencing oligonucleotide.
  • an intracoronary stent capable of eluting to the surrounding tissue a therapeutically effective amount of at least one recombinant construct comprising a nucleic acid sequence encoding an H19-silencing oligonucleotide, the nucleic acid sequence being operably linked to at least one transcription regulating sequence.
  • the at least one H19-silencing oligonucleotide is selected from the group consisting of: an antisense molecule, a RNA interference (RNAi) molecule and an enzymatic nucleic acid molecule, preferably a small interference RNA (siRNA) molecule.
  • the H19-silencing oligonucleotide has a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-4.
  • the siRNA molecule comprises a sense strand selected from the group consisting of SEQ ID NOS: 5-8.
  • the H19-silencing oligonucleotide is specifically hybridizable with an Hl 9 RNA comprising a sequence according to any one of SEQ ID NOS: 1-8 and 14-25.
  • the H19-silencing oligonucleotides of the invention are useful in prevention or reduction of restenosis in particular in drug eluting stents.
  • the invention is directed to the use of a H19-silencing oligonucleotide of the invention for the preparation of a stent, medical device, or medicament useful for treating restenosis, for inhibiting the progression thereof, for ameliorating or preventing the symptoms associated therewith and/or for specifically reducing Hl 9 expression in vascular smooth muscle cells of a subject afflicted with restenosis as detailed herein.
  • the invention is directed to the use of a recombinant construct encoding an H19-silencing oligonucleotide of the invention for the preparation of a medicament or medical device useful for treating restenosis, for inhibiting the progression thereof, for ameliorating or preventing the symptoms associated therewith, and/or for specifically reducing Hl 9 expression in intimal tissue of a subject afflicted with restenosis, as detailed herein.
  • H19-silencing oligonucleotide or a recombinant construct encoding same, for the preparation of a medicament for treating, reducing occurrence or inhibiting the progression of restenosis in a subject in need thereof.
  • the H19-silencing oligonucleotide is specifically hybridizable with an Hl 9 RNA comprising a sequence according to any one of SEQ ID NOS: 1-8 and 14-25.
  • the H19-silencing oligonucleotide is a siRNA comprising a nucleic acid sequence as set forth in any one of SEQ ID NOs: 1-8 and 14-
  • said siRNA consists of a nucleic acid sequence as set forth in any one of SEQ ID NOs: 1-8 and 14-25, wherein each possibility represents a separate embodiment of the present invention.
  • said siRNA is a homolog, variant, fragment or variant of a fragment of these sequences as detailed herein, wherein each possibility represents a separate embodiment of the present invention.
  • a method for preventing restenosis in a subject in need thereof comprising administering to, or expressing in cells of the subject a therapeutically effective amount of at least one H19-silencing oligonucleotide.
  • the Hl 9-silencing oligonucleotide has a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-4.
  • a method for inhibiting the progression of restenosis in a subject in need thereof comprising administering to, or expressing in cells of the subject a therapeutically effective amount of at least one Hl 9-silencing oligonucleotide.
  • the Hl 9-silencing oligonucleotide has a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-4.
  • a method for ameliorating or preventing the symptoms of restenosis in a subject in need thereof comprising administering to, or expressing in cells of the subject a therapeutically effective amount of at least one Hl 9- silencing oligonucleotide.
  • the Hl 9-silencing oligonucleotide has a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-4.
  • a method for specifically reducing Hl 9 expression in vascular smooth muscle cells comprising administering to, or expressing in cells of the subject a therapeutically effective amount of at least one Hl 9-silencing nucleotide.
  • the H19-silencing nucleotide is expressed from an H19-specific promoter.
  • the H19-silencing nucleotide is expressed from a vascular smooth muscle cell promoter.
  • the H19-silencing nucleotide is expressed from any promoter known in the art that functions in vascular smooth muscle cells. Each possibility represents a separate embodiment of the present invention.
  • the H19-silencing oligonucleotide has a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-4.
  • the H19-silencing agents of the invention may be administered systemically, or, in other embodiments, locally, e.g. by direct injection or by means of a catheter, infusion pump or stent.
  • the invention provides delivery of the H 19- silencing agent by contacting the treated region with a reservoir containing an Hl 9- silencing agent and introducing the H19-silencing agent from the reservoir into the vessel by iontophoresis.
  • Optimal iontophoresis requires that the agent being administered have an overall net charge.
  • the H19-silencing agent may be modified to impart at least group that is charged at physiological or near-physiological pH.
  • a pulsed electric field may be effective to facilitate the entry of uncharged nucleic acid agents into cells through an electroporesis effect.
  • Devices for use in carrying out iontophoretic drug delivery at a vessel site e.g., by a balloon-catheter device have been described. In general, such devices include a reservoir for compound solution contained in a outer shell of the catheter's distal-tip balloon, an outer-balloon membrane allowing passage of the compound from the reservoir to the vessel wall, and an electrode communicating with the internal reservoir.
  • a second counter-electrode is placed on the body, and a pulsed voltage is applied across the two electrodes to create a field that operates to draw charged compounds into vessel site.
  • Devices, and electric pulse voltages and times follow those disclosed in the art, e.g., U.S. Pat. Nos. 5,593,974, 5,628,730, and 5,425,703).
  • a pulsed-field device designed for diffusion or injection of uncharged compound into the site, with cell uptake facilitated by pulsed- field induced electroporation is also contemplated.
  • administering is carried out by injecting the H19-silencing agent from an injection balloon catheter directly into the vascular injury site, under pressure, through injectors contained on the surface of the catheter balloon (see, e.g. U.S. Pat. No. 7,094,765).
  • the H19-silencing agent is injected into the vessel, that it, below the vessel surface, by means of an injection balloon catheter, such has been described.
  • the catheter which is known commercially as an "Infiltrator Angioplasty Balloon Catheter" or "IABC" is a balloon catheter with 3 lumens: one for inflating the balloon, one central for a guidewire, and a third for drug delivery.
  • each longitudinal strip or channel having a plurality of injection needles, e.g., six needles, which upon inflation stand project above the channel surface and are connected to the drug-delivery lumen.
  • the needles penetrate the lesion, allowing drug delivery into the tunica media of the vessel wall. This mode of administration provides the advantage of high efficiency of uptake of the compound into the vessel tissue (20% or greater).
  • the H19-silencing agent is embedded or dissolved in a diffusable medium, typically hydrogel, that coats the outer surface of a balloon, e.g., on a balloon catheter used for angioplasty.
  • a diffusable medium typically hydrogel
  • the hydrogel coating is formulated to include the H19-silencing agent, and to release the selected dose of the compound for a period of about 5-60 minutes.
  • the hydrogel diffusion method may be combined with iontophoresis or electroporation, as described above, to enhance uptake of the compound from the gel into the tissue. In this case, the amount of material in the gel may be reduced substantially, in view of the enhanced efficiency of uptake.
  • the method has the advantages of maintaining intimate contact between the compound reservoir and vessel wall during the compound delivery period, allowing a relatively slow rate of drug release and uptake by cells, and avoiding elevated injection pressures.
  • the H19-silencing agent is delivered via drug-eluting stents, as described hereinabove.
  • the H19-silencing agent is contained in diff ⁇ isable form in a hydrogel coating contained on an intravascular stent.
  • the stent may be placed at the vessel site at the time of balloon angioplasty, or placed at the site during coronary bypass surgery.
  • An implanted stent provides two advantages in practicing the present invention.
  • microparticles such as polystyrene microparticles
  • biodegradable particles, liposomes or microbubbles containing the H19-silencing agents in releasable form may be used for direct delivery of the compound into the vessel tissue.
  • Methods for delivery the particles include injection of a particle suspension, or physical pressing the particles against the vessel wall, e.g., by balloon pressure in a balloon containing a outer coating of particles, e.g., in a hydrogel medium, or by embedding the particles in releasable form in a stent.
  • the method additional includes exposing the administered particles to ultrasonic energy to explode the bubbles and release the bubbles at the particle sites.
  • Particle delivery of the compound has the advantage of high uptake, particular where the particles are injected, and the potential for both high, short-term drug release and extended release from depot-release particles, e.g., biodegradable particles.
  • the particles may also be coated with a binding agent, e.g., antibodies specific against growth factors or other proteins that are actively synthesized by endothelial cells during early cellular events leading to restenosis, to enhance the efficiency of compound uptake.
  • a binding agent e.g., antibodies specific against growth factors or other proteins that are actively synthesized by endothelial cells during early cellular events leading to restenosis.
  • the H19-silencing agent may be selectively released from the particles at a desired time, as in the case for microbubbles.
  • the invention provides a pharmaceutical composition comprising a H19-silencing oligonucleotide having a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-4 for treating restenosis.
  • the invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a H19-silencing oligonucleotide having a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-4 for inhibiting the progression of restenosis in a subject in need thereof.
  • the invention provides a pharmaceutical composition comprising a H19-silencing oligonucleotide having a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-4 for ameliorating or preventing the symptoms of restenosis.
  • the invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a H19-silencing oligonucleotide having a nucleic acid sequence as set forth in any one of SEQ ID NOS: 1-4 for specifically reducing H19 expression in intimal tissue of a subject afflicted with restenosis.
  • the at least one H19-silencing oligonucleotide is a small interference RNA (siRNA) molecule.
  • siRNA small interference RNA
  • the siRNA molecule comprises a sense RNA strand and an antisense RNA strand wherein the sense and the antisense RNA strands form an RNA duplex, and wherein at least one strand comprises a 3 ' overhang.
  • the overhang is about 1-5 nucleotides in length. In a particular embodiment, the overhang is 2 nucleotides in length.
  • the siRNA molecule comprises a sense strand selected from the group consisting of SEQ ID NOS: 5-8.
  • the siRNA molecule comprises at least one modified internucleoside linkage.
  • the modified internucleoside linkage is a phosphorothioate linkage.
  • the siRNA molecule comprises at least one 2'-sugar modification.
  • RNA analogs comprising substitutions for the hydroxyl group on the T- carbon atom of the ribose ring (e.g. 2'-0-methyl RNA,
  • 2'-O-methoxyethyl 2'-MOE RNA and 2'-fluoro RNA
  • the 2'-sugar modification is a 2'-O-methyl modification.
  • a method for treating restenosis in a subject in need thereof comprising administering to, or expressing in cells of the subject a therapeutically effective amount of at least one H19-silencing oligonucleotide having a nucleic acid sequence as set forth in any one of SEQ ID NOS: 14-25.
  • a method for inhibiting the progression of restenosis in a subject in need thereof comprising administering to, or expressing in cells of the subject a therapeutically effective amount of at least one H19-silencing oligonucleotide having a nucleic acid sequence as set forth in any one of SEQ ID NOS: 14-25.
  • a method for ameliorating or preventing the symptoms of restenosis in a subject in need thereof comprising administering to, or expressing in cells of the subject a therapeutically effective amount of at least one Hl 9- silencing oligonucleotide having a nucleic acid sequence as set forth in any one of SEQ ID NOS: 14-25.
  • a method for specifically reducing Hl 9 expression in intimal tissue of a subject afflicted with restenosis comprising administering to, or expressing in cells of the subject a therapeutically effective amount of at least one H19-silencing oligonucleotide having a nucleic acid sequence as set forth in any one of SEQ ID NOS: 14-25.
  • the invention provides a pharmaceutical composition comprising a H19-silencing oligonucleotide having a nucleic acid sequence as set forth in any one of SEQ ID NOS: 14-25 for treating restenosis.
  • the invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a H19-silencing oligonucleotide having a nucleic acid sequence as set forth in any one of SEQ ID NOS: 14-25 for inhibiting the progression of restenosis in a subject in need thereof.
  • the invention provides a pharmaceutical composition comprising a H19-silencing oligonucleotide having a nucleic acid sequence as set forth in any one of SEQ ID NOS: 14-25 for ameliorating or preventing the symptoms of restenosis.
  • the invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a H19-silencing oligonucleotide having a nucleic acid sequence as set forth in any one of SEQ ID NOS: 14-25 for specifically reducing Hl 9 expression in intimal tissue of a subject afflicted with restenosis.
  • the at least one H19-silencing oligonucleotide (or recombinant construct encoding same) is administered to said subject in the form of a pharmaceutical composition further comprising a pharmaceutically acceptable carrier, excipient or diluent.
  • the subject is human.
  • the at least one H19-silencing oligonucleotide may be administered to said subject locally, e.g. by intra-articular injections, or by microinjections into the intimal tissue.
  • compositions of the invention can be administered alone or in conjunction with other therapeutic modalities. It is appropriate to administer the pharmaceutical compositions of the invention as part of a treatment regimen involving other therapies, such as drug therapy, which comprises e.g. DMARDs, NSAIDs and/or other agents used for the treatment of restenosis as known in the art.
  • therapies such as drug therapy, which comprises e.g. DMARDs, NSAIDs and/or other agents used for the treatment of restenosis as known in the art.
  • Example 1 Expression of Hl 9 RNA in human coronary SMC cells
  • RNAs are extracted from the cells using RNeasyTM mini kit (Qiagen, Germany), and levels of
  • Hl 9 mRNA therein are measured using semi-quantitative RT-PCR technique as follows:
  • RNA 1 ⁇ g total RNA is used to initiate cDNA synthesis using the p(dT)15 primer (Roche, Germany), with 400 units of Reverse Transcriptase (Gibco BRL), according to manufacturer's instructions.
  • the PCR reaction for Hl 9 is carried out using Taq polymerase (Takara, Otsu, Japan) for 29 cycles (94oC for 30 s, 58oC for 30 s, and 72oC for 30 s) preceded by 94 0 C for 5 min, and a final extension of 5 min at 72 0 C.
  • PCR for GAPDH is performed as internal control to verify RT-PCR integrity.
  • Sense primer and antisense primer sequences used in RT-PCR are as follows: Sense primer specific for H19: 5'- ccggccttcctgaaca-3' (SEQ ID NO: 10).
  • Antisense primer specific for Hl 9 5'- ttccgatggtgtctttgatgt-3' (SEQ ID NO: 11).
  • Sense primer specific for GAPDH 5'- ggctctccagaacatcatccctgc-3' (SEQ ID NO: 12).
  • Antisense primer specific for GAPDH 5'-gggtgtcgctgttgaagtcagagg-3' (SEQ ID NO:
  • Example 2 Generation of human coronary artery SMC cells over-expressing H19 RNA
  • SMC cells over-expressing Hl 9 RNA are obtained by stable transfection using the expression vector, in which about 2.3 Kb entire H19 gene was placed under the constitutive transcriptional control of the Cytomegalovirus promoter.
  • cells are also transfected with the same vector containing a part of Hl 9 gene placed in an anti-sense direction. Twenty-four hours before transfection, cells are plated into 6 wells plate at a density of 100,000 cells per well in antibiotic-free medium. Transfections are carried out using Lipofectamine 2000TM and 2 ⁇ g plasmid per well. Forty-eight hours after transfection, cells are diluted and divided into new culture dishes. Cells are selected after incubation for 15 days in a medium containing 500 ⁇ g/ml G418 sulfate
  • Hl 9 in sense and antisense direction are seeded in 96 well plates in quadruples in
  • DMEM media containing either 10% FCS or 0.1% FCS 24 hours later, an MTS assay is performed (Promega, USA). Absorbance at 490 run is recorded with an ELISA plate reader.
  • Hl 9 RNA SMC cells over-expressing the Hl 9 RNA are seeded in 12- well plates and incubated for twenty-four hours in antibiotic-free medium (DMEM) so that they are at 80% confluent at transfection. Transfection is performed using 3 ⁇ l Lipofectamine 2000TM and 2 ⁇ g of the plasmid expressing either Hl 9 shRNA (or siRNA).
  • DMEM antibiotic-free medium
  • GFP shRNA GCAAGCUGACCCUGAAGUUCAU; SEQ ID NO: 27
  • luciferase shRNA having a sense strand with the sequence 5'- CUUACGCUGAGUACUUCGAdTdT-3'; SEQ ID NO: 28 is used.
  • RNA is extracted, and Hl 9 expression is measured as in Example 1 to determine ability of the Hl 9 shRNA plasmid to silence Hl 9 expression.
  • Cells are washed with PBS and equal numbers of cells (expressing either Hl 9 shRNA or GFP shRNA) are transferred to 96 well plates containing either 10% FCS or 0.1% FCS. MTS assay is performed as described hereinabove.
  • Example 4 H19 Stimulates Human Coronary Artery SMC Migration
  • SMC cells over-expressing Hl 9 RNA and its control are seeded in 12- wells plate. After a 24-h incubation, a single uniform scratch is made using a 1000 ⁇ l plastic pipet tip, generating a cell-free gap of approximately 1.0 mm between two adjoining areas of SMC. SMC are then incubated in a 95% air/5% CO 2 environment. Each scratch is randomly photographed at four separate sites along the length of the scratch, starting proximally and ending distally. The photographs are taken on an inverted microscope immediately after the scratch and then again at 24 and 48 h. Migrating cells across the wound edges are counted manually.
  • Three-dimensional cell migration is determined using transwells with a gelatin- coated membrane (Corning Life Science).
  • the lower chamber contains either no chemo-attractant (control) or 100 ng/ml of TNF- ⁇ in Dulbecco's modified Eagle's medium (DMEM)-F-12 medium.
  • DMEM Dulbecco's modified Eagle's medium
  • Example 5 H19 Stimulates proteases / protease receptors expression and secretion
  • a customized Affymetrix protease microarray is utilized to measure expression levels of human proteases, proteases inhibitors, and their receptors.
  • Total RNA from SMC cells over-expressing the Hl 9 RNA or its control (described hereinabove) are subjected to reverse transcription, labeling, and hybridization to gene chip arrays (Affymetrix, Santa Clara, CA) containing well-characterized human protease genes. Experiments were performed non-simultaneously in duplicates.
  • Up- and down-regulated genes are selected different from the list of differentially expressed genes modulated by Hl 9 overexpression, and microarray data is verified by RT-PCR analyses. Some of the modulated genes that are known to be secreted are chosen for ELISA analyses.
  • Example 6 Testing anti-restenosis activity of H19 shRNA in an animal model
  • the injured segment is transiently isolated by temporary ligatures.
  • 200 ⁇ L of a combination of Lipofectamine 2000TM and Hl 9 shRNA-encoding plasmid (40 ⁇ g) are incubated in the isolated segment for 15 minutes, after which ligatures are removed.
  • As a negative control GFP- shRNA-encoding plasmid is utilized.
  • the external carotid artery is ligated, and blood flow is restored in the common carotid and the internal carotid artery. The skin wound is repaired, and animals are transferred to their cages.
  • Example 7 Clinical testing of H19 shRNA-coated stents for Deterrence or Prevention of Post- Angioplasty Restenosis
  • H19-silencing nucleic acid agents produced in sterile, endotoxin-free environment are incorporated into stents introduced into patients undergoing angioplasty procedures in order to suppress the growth of vascular smooth muscle cells and restenosis.
  • the stents are coated with the H19-silencing agents using known techniques previously employed with other drug-eluting stents, e.g. for PDGF RNAi (Li et al 2006) or c-myc RNAi (Kipshidze et al, 2004); also see Jewell CM 2006.
  • a stent deployed in conjunction with conventional PCI methods to address restenosis can be readily coated with H19-silencing agents using known techniques or modifications thereof as appropriate for H19-silencing agents.

Abstract

Cette invention se rapporte à l'utilisation d'agents à base d'acides nucléiques capables de réduire au silence H19 en vue de traiter ou de prévenir la resténose. L'invention concerne en particulier des endoprothèses éluant des agents à base d'acides nucléiques capables de réduire au silence H19, et leurs utilisations dans le traitement de la resténose. L'invention concerne également des procédés permettant d'améliorer la resténose et les symptômes qui y sont associés, utilisant des oligonucléotides réduisant des gènes au silence comme les agents à base d'ARNsi (petits ARN interférents) dirigés contre le H19.
PCT/IL2008/000191 2007-02-15 2008-02-14 Utilisation d'agents à base d'acides nucléiques réduisant h19 au silence pour traiter la resténose WO2008099396A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US90134307P 2007-02-15 2007-02-15
US60/901,343 2007-02-15

Publications (1)

Publication Number Publication Date
WO2008099396A1 true WO2008099396A1 (fr) 2008-08-21

Family

ID=39472576

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IL2008/000191 WO2008099396A1 (fr) 2007-02-15 2008-02-14 Utilisation d'agents à base d'acides nucléiques réduisant h19 au silence pour traiter la resténose

Country Status (1)

Country Link
WO (1) WO2008099396A1 (fr)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9173964B2 (en) 2007-10-25 2015-11-03 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. Diphtheria toxin first open reading frame operably linked to an H19 promoter and a diphtheria toxin second open reading frame operably linked to an IGF-II promoter as nucleic acid construct
US9381208B2 (en) 2006-08-08 2016-07-05 Rheinische Friedrich-Wilhelms-Universität Structure and use of 5′ phosphate oligonucleotides
US9399658B2 (en) 2011-03-28 2016-07-26 Rheinische Friedrich-Wilhelms-Universität Bonn Purification of triphosphorylated oligonucleotides using capture tags
US9738680B2 (en) 2008-05-21 2017-08-22 Rheinische Friedrich-Wilhelms-Universität Bonn 5′ triphosphate oligonucleotide with blunt end and uses thereof
US10059943B2 (en) 2012-09-27 2018-08-28 Rheinische Friedrich-Wilhelms-Universität Bonn RIG-I ligands and methods for producing them
CN111050697A (zh) * 2017-07-31 2020-04-21 亚历山大·多坎托·扎戈 促进快速支柱覆盖和血管内皮覆盖的装置和方法

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007007317A1 (fr) * 2005-07-07 2007-01-18 Yissum Research Development Company Of The Hebrew University Of Jerusalem Agents de type acide nucleique pour la regulation a la baisse de h19 et methodes d'emploi desdits agents

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007007317A1 (fr) * 2005-07-07 2007-01-18 Yissum Research Development Company Of The Hebrew University Of Jerusalem Agents de type acide nucleique pour la regulation a la baisse de h19 et methodes d'emploi desdits agents

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
KIM DUK-KYUNG ET AL: "H19, a developmentally regulated gene, is reexpressed in rat vascular smooth muscle cells after injury", JOURNAL OF CLINICAL INVESTIGATION, vol. 93, no. 1, 1994, pages 355 - 360, XP002484355, ISSN: 0021-9738 *
KIPSHIDZE NICHOLAS N ET AL: "Advanced c-myc antisense (AVI-4126)-eluting phosphorylcholine-coated stent implantation is associated with complete vascular healing and reduced neointimal formation in the porcine coronary restenosis model.", CATHETERIZATION AND CARDIOVASCULAR INTERVENTIONS : OFFICIAL JOURNAL OF THE SOCIETY FOR CARDIAC ANGIOGRAPHY & INTERVENTIONS APR 2004, vol. 61, no. 4, April 2004 (2004-04-01), pages 518 - 527, XP002484356, ISSN: 1522-1946 *
LI YUXIN ET AL: "Stent-based delivery of antisense oligodeoxynucleotides targeted to the PDGF A-chain decreases in-stent restenosis of the coronary artery.", JOURNAL OF CARDIOVASCULAR PHARMACOLOGY OCT 2006, vol. 48, no. 4, October 2006 (2006-10-01), pages 184 - 190, XP009101419, ISSN: 0160-2446 *

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9381208B2 (en) 2006-08-08 2016-07-05 Rheinische Friedrich-Wilhelms-Universität Structure and use of 5′ phosphate oligonucleotides
US10238682B2 (en) 2006-08-08 2019-03-26 Rheinische Friedrich-Wilhelms-Universität Bonn Structure and use of 5′ phosphate oligonucleotides
US10004813B2 (en) 2007-10-25 2018-06-26 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. Constructs containing multiple expression cassettes for cancer therapy
US9173964B2 (en) 2007-10-25 2015-11-03 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. Diphtheria toxin first open reading frame operably linked to an H19 promoter and a diphtheria toxin second open reading frame operably linked to an IGF-II promoter as nucleic acid construct
US10036021B2 (en) 2008-05-21 2018-07-31 Rheinische Friedrich-Wilhelms-Universität Bonn 5′ triphosphate oligonucleotide with blunt end and uses thereof
US9738680B2 (en) 2008-05-21 2017-08-22 Rheinische Friedrich-Wilhelms-Universität Bonn 5′ triphosphate oligonucleotide with blunt end and uses thereof
US10196638B2 (en) 2008-05-21 2019-02-05 Rheinische Friedrich-Wilhelms-Universität Bonn 5′ triphosphate oligonucleotide with blunt end and uses thereof
US9896689B2 (en) 2011-03-28 2018-02-20 Rheinische Friedrich-Wilhelms-Universität Bonn Purification of triphosphorylated oligonucleotides using capture tags
US9399658B2 (en) 2011-03-28 2016-07-26 Rheinische Friedrich-Wilhelms-Universität Bonn Purification of triphosphorylated oligonucleotides using capture tags
US10059943B2 (en) 2012-09-27 2018-08-28 Rheinische Friedrich-Wilhelms-Universität Bonn RIG-I ligands and methods for producing them
US10072262B2 (en) 2012-09-27 2018-09-11 Rheinische Friedrich-Wilhelms-Universität Bonn RIG-I ligands and methods for producing them
US11142763B2 (en) 2012-09-27 2021-10-12 Rheinische Friedrich-Wilhelms-Universität Bonn RIG-I ligands and methods for producing them
CN111050697A (zh) * 2017-07-31 2020-04-21 亚历山大·多坎托·扎戈 促进快速支柱覆盖和血管内皮覆盖的装置和方法

Similar Documents

Publication Publication Date Title
JP5066095B2 (ja) 染色体ｄｎａに標的化されるオリゴマーによる遺伝子発現の調節
Branch A hitchhiker's guide to antisense and nonantisense biochemical pathways
ES2749374T3 (es) Compuestos inhibitorios dirigidos a conexina 43 y sus métodos de uso en el tratamiento del trauma ocular de la córnea
JP5383186B2 (ja) Ｈ１９をダウンレギュレートする核酸薬剤、及びそれを使用する方法
JP2013544511A (ja) 特異的内在性ｍｉＲＮＡにより発現を活性化する組成物および方法
JPH08505397A (ja) 平滑筋細胞の増殖を調節するためのｃ‐ｍｙｃのアンチセンス阻害
KR20100017422A (ko) 작은 간섭 ＲＮＡ(ｓｉＲＮＡ)를 이용하여 기억 형성에 관여하는 유전자를 확인하는 방법
Santiago et al. Nucleic acid based strategies as potential therapeutic tools: mechanistic considerations and implications to restenosis
WO2008099396A1 (fr) Utilisation d'agents à base d'acides nucléiques réduisant h19 au silence pour traiter la resténose
EP1147189A2 (fr) Ribozymotherapie destinee au traitement et/ou a la prevention de la restenose
Sioud Nucleic acid enzymes as a novel generation of anti-gene agents
Fahmy et al. Antisense Egr‐1 RNA driven by the CMV promoter is an inhibitor of vascular smooth muscle cell proliferation and regrowth after injury
Zon Brief overview of control of genetic expression by antisense oligonucleotides and in vivo applications: Prospects for neurobiology
Kausch et al. Antisense oligonucleotide therapy in urology
US20040220131A1 (en) Method for treatment of cancerous angiogenic disorders
EP1773993A2 (fr) METHODE DE REDUCTION OU PREVENTION DES FIBROSES LOCALISEES, UTILISANT LA TECHNOLOGIE L'ARNSi
KR101783444B1 (ko) miR-33-5p 를 이용한 뇌신경세포 보호 물질 스크리닝 방법
Prins et al. Antisense of oligonucleotides and the inhibition of oncogene expression
KR100848665B1 (ko) 서바이빈의 발현을 억제하는 ｓｉＲＮＡ
US20220259596A1 (en) Inhibitors of microRNA 451a for Treatment of Endometriosis
WO2012131673A2 (fr) Agents de type acides nucléiques inactivant le ccat-1 pour traiter le cancer
Takei et al. In vivo delivery technique of nucleic acid compounds using atelocollagen: its use in cancer therapeutics targeted at the heparin-binding growth factor midkine
Khachigian 9 DNAzymes Targeting Immediate-Early Genes as Inhibitors of Angiogenesis and Restenosis
Fukuda Therapeutic application of ribozymes for cardiovascular disease
Devlin Studies of catalytic nucleic acids targeted against the transcript of the PTEN tumor suppressor

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08710191

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 08710191

Country of ref document: EP

Kind code of ref document: A1