WO2008119136A1

WO2008119136A1 - Improved methods and constructs for marker free agrobacterium mediated transformatiom

Info

Publication number: WO2008119136A1
Application number: PCT/AU2008/000478
Authority: WO
Inventors: James Langham Dale; Harjeet Khanna
Original assignee: Queensland University Of Technology
Priority date: 2007-04-03
Filing date: 2008-04-03
Publication date: 2008-10-09

Abstract

The present invention discloses improved methods and constructs for stably or transiently transforming plant cells using Agrobacterium mediated transformation, under conditions that inhibit apoptosis, without selecting for the presence of a marker gene.

Description

Improved Methods and Constructs for Marker Free Λgrobacterium Mediated Transformation

FIELD OF THE INVENTION

[0001] This invention relates generally to improved methods and constructs for stably or transiently transforming plant cells using Agrobacteήum mediated transformation without selecting for the presence of a marker gene.

BACKGROUND OF THE INVENTION

[0002] Genetic transformation is one of the most important crop improvement technologies and Agrobacterium-mediated transformation is one of the preferred methods of plant transformation. However, a large number of plant species, including monocots, are recalcitrant to Agrobαcterium tumefαciens, significantly reducing the applicability of Agrobacterium-mediated transformation for many important crop plants. Even in cases where this method is feasible, it is most often limited to certain lines or cultivars and protocols are difficult to extend to other cultivars of the same plant species. This has proved to be a major obstacle in developing transformation protocols that can be easily adapted to a wide range of plant genera and species, leaving this technique of gene transfer very genotype dependent.

[0003] Variations in the transformation efficiencies of plant tissues using Agrobαcterium has been attributed partly to differences in the ability of A. tumefαciens to attach to plant cells or differences in either bacterial- or plant-encoded T-DNA transfer machinery (Lippincott et αl., 1977, Plant Physiol., 59:388-390; Yanofsky et ah, 1985a, 1985b, J. Bacteriol, 163:341-348; Nam et al., 1997, Plant Cell, 9:317-333). However, a more significant cause is the cell death exhibited by many plant cells following exposure to Agrobacterium, which in turn reduces the transformation rate. Agrobacterium triggers many genes in plant cells including the plant defence machinery (Dirt et al., 2001, Proc. Natl. Acad. Sci. USA, 98:10954-10954; Veena et al., 2003, Plant J, 35:219-236). Modification of the tissue culture conditions during transformation can increase the probability of stably transforming some recalcitrant cell types. However, cell death following A. tumefaciens infection of plant cells still remains a limitation, and requires the use of selection markers to identify those plants which have been transformed (Gelvin, 2003, Microbiol. MoI. Biol, Rev, 67:16-37). Tissue browning and subsequent death following exposure to Agrobacterium has previously been reported in many monocot and dicot plants including aspen, poplar (de Block, 1990, Plant Physiol, 93:1110-1116), grape (Deng et al, 1995, MoI. Plant-Microbe. Interact, 8:538-548; Perl et al, 1996, Nat. Biotechnol. 14:624-628; Pu and Goodman, 1992, Physiol. MoI. Plant Pathol. , 41 :245-254), sorghum (Carvalho et. al, 2004, Genet. MoI. Biol, 27:259-269 and; Gao et al, 2005, Plant Biotechnol. J, 3(6):591-599), wheat (Parrott et al, 2002, Physiol. MoI Plant Pathol, 60:59-69) tomato, pepper and lettuce (Vander Hoorn et al, 2000, MoI Plant-Microbe Interact., 13:439-446 and; Wroblewski et al, 2005, Plant Biotechnol J, 3(2):259-273). [0004] Maize calli infected with A. tumefaciens were reported as undergoing a rapid, hypersensitive type of cell death in a study characterizing A. tumefaciens- induced apoptosis in maize (Hansen, 2000, MoI Plant-Microbe. Interact., 13:649-657) and this response was suppressed by the expression of two baculovirus cell death suppressor genes, p35 and iap. Cell death due to pathogen invasion, abiotic stress, or as part of normal development, has been found to trigger apoptotic mechanisms such as oligonucleosomal fragmentation in cells entering the cell death phase. DNA laddering and formation of apoptotic bodies have been observed in plant tissues exposed to biotic (Ryerson and Heath, 1996, Plant Cell, 8:393-402 and; Wang et al, 1996, Plant Cell, 8:375-391) or abiotic stress (Ryerson and Heath, 1996, supra and; Katsuhara, 1997, Plant Cell Physiol, 38:1091-1093). However, these studies were confined to suppression of cell death and did not relate to transformation.

[0005] Studies using transgenics have demonstrated that characteristic features of mammalian apoptosis also occur in susceptible tobacco plants infected with certain necrotrophic fungi and constitutive expression of anti-apoptotic proteins of the Bcl-2 gene family has been shown to result in resistance to these fungi (Dickman et al, 2001, Proc. Natl Acad. Sci. USA, 98:6957-6962). In tomato, expression of Bcl-xL, an anti-apoptotic member of the Bcl-2 family and Ced-9, a Bcl-2 analogue from Caenorhabditis elegans genes has been reported to improve plant survival under abiotic and biotic stresses (Xu et al, 2004, Proc. Natl. Acad. Sci. USA, 101:15805-15810). Apoptotic regulators such as those coded by the Ced-91 Bcl-21 Bax gene family of animals can either induce or suppress cell death in transgenic plants exposed to stress (Dickman et al, 2001, supra; Lacomme and Cruz, 1999, Proc. Natl Acad. Sci. USA,

96:7956-7961 ; Mitsuhara et al, 1999, Curr. Biol, 9:775-778 and; Xu et al, 2004, supra). Again, these studies were concerned with the study of apoptosis in plants and do not relate to plant transformation.

[0006] An improved method of Agrobacterium transformation is described in U.S. Patent Application Number 20020088029 (2002, Hansen) in which a plant cell is exposed to Agrobacterium under conditions that inhibit Agrobacterium induced necrosis (AIN) such as in the presence of an AIN-inhibiting agent. The AIN-inhibiting agent is disclosed as a mammalian bcl-1 gene, a coding region of an apoptosis-inhibiting gene from baculovirus such as p35 or pIAP, or a gene capable of suppressing a gene response in plants. The method further comprises selecting transformed plant cells that contain a marker gene that confers resistance or tolerance to a selection agent such as phosphinothricin, hygromycin and mannose.

[0007] The present invention is predicated in part on the discovery that expression of an anti-apoptotic gene such as Bcl-xL, Ced-9 and the 3' non-translated region oϊBcl-2 in plant cells improves Agrobacterium transformation efficiency by more than about 100-fold as compared to control transformations in the absence of an anti-apoptosis gene, which permits plant transformations to be carried out without screening for the presence of a co-transformed marker gene. This discovery is highly advantageous as it permits plant transformations to be carried out in the absence of a positive or negative selection step, which is very time-consuming, laborious and expensive.

SUMMARY OF THE INVENTION

[0008] Accordingly, in one aspect, the present invention provides methods for introducing a polynucleotide of interest into a plant cell. These methods generally comprise exposing plant cells to an Agrobacterium that contains the polynucleotide of interest under conditions that inhibit apoptosis in the cells, and identifying a transformed plant cell that contains the polynucleotide of interest without selecting for the presence of a marker gene in that cell. Illustrative apoptosis-inhibiting conditions include the use of apoptosis-inhibiting agents, which are suitably selected from: chemical inhibitors including small molecule compounds such as silver nitrate and ethylene inhibitors; apoptosis-inhibiting polynucleotides that may be stably integrated or transiently operative in the cells to be transformed; and apoptosis-inhibiting polypeptides. The plants cells may be exposed to an apoptosis-inhibiting agent either before or after or at the same time as exposing the cells to the Agrobacterium.

[0009] In some embodiments, the apoptosis-inhibiting agent is an apoptosis- inhibiting polynucleotide, which inhibits apoptosis directly or which encodes an apoptosis-inhibiting RNA or an apoptosis-inhibiting polypeptide. The apoptosis- inhibiting RNA or polypeptide may be of any suitable origin including prokaryotic {e.g., viral, bacterial) and eukaryotic (e.g., animal and plant) origin. Illustrative apoptosis- inhibiting polypeptides include Bcl-xL, Bcl-2, BI-I, Hsp70, AtILP-I, AtBAGl, AtBAG2, AtBAG3, AtBAG4, AtBAG5, AtBAGό, AtBAG7, p35, pIAP, DAD-I, CED- 9 and synthetic peptide analogs of caspases capable of triggering apoptosis. The apoptosis-inhibiting polynucleotide may be introduced into the plant cells or may be expressed in a host cell to produce an apoptosis-inhibiting polypeptide to which the plant cells are subsequently exposed. Generally, the apoptosis-inhibiting polynucleotide is in the form of a construct, typically a chimeric construct, in which the apoptosis- inhibiting polynucleotide is operably connected to a regulatory element (e.g., a promoter) that modulates its expression (e.g., constitutive, tissue specific or conditional expression). In contrast to conventional transformation methods, the methods of the present invention do not require the step of selecting transformed plant cells on the basis that they express an identifying characteristic (e.g. , antibiotic resistance, antibiotic sensitivity, cell death, enzymatic activity and light emission or absorbance) conferred by a marker gene that they contain. Accordingly, in some embodiments, the construct does not contain a marker gene. However, it shall be understood that a marker gene may be present in the construct, provided that it is not used for identifying or selecting plant cells that contain the apoptosis-inhibiting polynucleotide.

[0010] The apoptosis-inhibiting polynucleotide may be introduced into the plant cells (e.g., by Agrobacterium mediated transformation, microprojectile particle bombardment or electrophoresis) either before or after or at the same time as exposing the plant cells to the Agrobacterium to facilitate introduction of the polynucleotide of interest. In illustrative examples of this type, the apoptosis-inhibiting polynucleotide is stably introduced into the genome of the plant cells. In other illustrative examples, the apoptosis-inhibiting polynucleotide is transiently present and operable, for example, at or around the time the cell is exposed to the Agrobacterium. Transient expression of the apoptosis-inhibiting polynucleotide can be obtained, for example, using an agroinfection system. In some embodiments, a plurality of apoptosis-inhibiting polynucleotides is introduced into the plant cells and these polynucleotides may be the same or different. [0011] In some embodiments, the apoptosis-inhibiting polynucleotide is expressed by the same Agrobacterium that contains the polynucleotide of interest. In illustrative examples of this type, the apoptosis-inhibiting polynucleotide and the polynucleotide of interest may be present on the same construct or on different constructs. When using different constructs, the one comprising the apoptosis-inhibiting polynucleotide and the other comprising the polynucleotide of interest may be contained on different vectors or on the same vector. In other embodiments, the apoptosis- inhibiting polynucleotide is expressed by a different Agrobacterium than the one containing the polynucleotide of interest. In these embodiments, the Agrobacterium containing the apoptosis-inhibiting polynucleotide may be the same type of Agrobacterium as the one containing the polynucleotide of interest, or may be a different type.

[0012] In some embodiments, the apoptosis-inhibiting agent is an apoptosis- inhibiting polypeptide. In illustrative examples of this type, the polypeptide is in the form of a fusion protein that comprises a virulence protein (e.g., an Agrobacterium VirF protein) fused directly or indirectly to the apoptosis-inhibiting polypeptide. The fusion protein may be produced from a construct which comprises a fusion protein coding sequence that is operably connected to a regulatory element. In illustrative examples of this type, the regulatory element drives expression of the coding sequence in a bacterium to produce the fusion protein and the virulence protein portion of the fusion protein directs the protein to the nucleus of the plant cells.

[0013] In some embodiments in which the apoptosis-inhibiting agent (e.g., an apoptosis-inhibiting polynucleotide or polypeptide) is introduced into the plant cells, the methods further comprise modulating the level or functional activity of the apoptosis- inhibiting agent in the plant cells. These embodiments are particularly useful for reducing or abrogating the level or functional activity of an apoptosis-inhibiting polynucleotide or polypeptide after plant transformation, which may be desirable for maintaining the well being of plants that are grown or regenerated from the transformed plant cells or from a regulatory standpoint. In illustrative examples of this type, a modulator gene may be introduced into the plant cells either before or after or at the same time as introducing the apoptosis-inhibiting agent. Suitably, the modulator gene produces an expression product that has at least one activity selected from: a transcript- degrading activity that degrades a transcript product of the apoptosis-inhibiting polynucleotide; a transcript-interacting activity that inhibits translation of a transcript product of the apoptosis-inhibiting polynucleotide; a polypepti de-interacting activity that inhibits the functional activity of the apoptosis-inhibiting polypeptide; and a nucleic acid-excising activity that mediates excision of at least a portion of the apoptosis- inhibiting polynucleotide. In specific embodiments, the modulator gene expresses (e.g., constitutively or conditionally) a nucleic acid sequence that encodes a ribozyme or antisense nucleic acid which is specific to the transcript product of the anti-apoptosis polynucleotide employed for the transformation. In these embodiments, the modulator gene may cause post-transcriptional gene silencing. [0014] In some embodiments, the apoptosis-inhibiting polynucleotide and/or the polynucleotide of interest and/or modulator gene as broadly defined herein are replicated and amplified in a plant cell using rolling circle viral replication, as described for example by Dale et al. in International Publication No. WO 01/72996. Representative examples of rolling circle replication systems include the InPACT system developed by the present inventors.

[0015] In other embodiments, the apoptosis-inhibiting agent is a small molecule compound, illustrative examples of which include silver nitrate, ethylene inhibitors, ethylene synthesis inhibitors, gibberellin antagonists and phosphatase inhibitors.

[0016] Suitably, the polynucleotide of interest comprises a nucleotide sequence that encodes a polypeptide of interest for commercial manufacture, or encodes a product conferring a beneficial property to the transformed plant cells or a plant generated from the transformed plant cells.

[0017] The transformed plant cells can be identified using any suitable technique that detects the presence of the polynucleotide of interest in the plant cells, illustrative examples of which include: nucleic acid hybridization (e.g., Southern blotting or northern blotting), nucleic acid amplification (e.g. , polymerase chain reaction (PCR)), and detection of a polypeptide of interest using enzyme assays or antigen- binding molecules that are immuno-interactive with the polypeptide of interest.

[0018] Suitably, the plant cells are derived from or form at least part of an explant, stem, seed, seedling, shoot, root, leaf cutting, stem cutting, root cutting, tuber eye, stolon, flower, pollen or callus to name but a few. In certain embodiments, the plants cells to be transformed are regenerable plant cells from which differentiated genetically modified plants are producible. Accordingly, in another aspect, the invention provides methods for producing a differentiated genetically modified plant, wherein a polynucleotide of interest is introduced into regenerable plant cells according to the 'marker free' transformation methods broadly described above so as to yield a population of transformed plant cells and regenerating a differentiated genetically modified plant from the population. The regenerable plant cells may be selected from regenerable dicotyledonous cells and regenerable monocotyledonous plant cells (e.g., regenerable graminaceous monocotyledonous plant cells or regenerable non- graminaceous monocotyledonous plant cells).

[0019] In another aspect, the invention provides transformed plant cells and genetically modified plants resulting from the methods as broadly described above.

[0020] In yet another aspect, the invention contemplates the use of a vector or vector system for introducing a polynucleotide of interest in a plant cell by Agrobacterium-mediated transformation under conditions that inhibit apoptosis in the plant cell, wherein the vector or vector system comprises the polynucleotide of interest but lacks a marker gene that confers an identifying characteristic (e.g., antibiotic resistance, antibiotic sensitivity, cell death, enzymatic activity and light emission or absorbance) on the plant cell (i.e., containing the marker gene).

[0021] In still another aspect, the present invention provides a culture of plant cells for Agrobacterium-mediaϊed transformation, wherein the plant cells comprise in their nucleome an apoptosis-inhibiting polynucleotide that is operably connected to a regulatory element. In specific embodiments, the regulatory element comprises a regulatable promoter that conditionally expresses the apoptosis-inhibiting polynucleotide. In illustrative examples of this type, the regulatory element is used to control expression of the apoptosis-inhibiting polynucleotide so it is expressed for the transformation but is not expressed at other times (e.g. , before and/or after the transformation). In a related aspect, the present invention contemplates the use of a culture of plant cells as broadly described above for introducing a polynucleotide of interest in those cells by Agrobαcterium-mQdiated transformation. Suitably, the plant cells of the culture are transformed using the methods broadly described above. In a related aspect, the present invention provides a use of a culture of plant cells for marker free Agrobαcterium-mediated transformation (i.e., transformation in the absence of selecting for the presence of a marker gene in the plant cells), wherein the plant cells comprise in their nucleome an apoptosis-inhibiting polynucleotide that is operably connected to a regulatory element.

BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 is a photographic representation showing Agrobacterium tumefaciens induced cell death in banana suspension cultures. Trypan blue staining of cell suspensions: (a) before co-culture with A. tumefaciens strain AGLl (OD (600nm) = 0.5) and; (b) after 3 days of co-culture with A. tumefaciens strain AGLl.

[0023] Figure 2 is a photographic representation illustrating Agrobacterium induced fragmentation of nuclear DNA in banana suspension cultures that can be inhibited by anti-apoptosis gene expression. Untransformed banana suspension cell cultures are shown in images (a-d) and transformed banana cell cultures are shown in images (e-j). Furthermore, images (a and b) represent banana suspension cells before 48 hours of A. tumefaciens infection and images (c- j) represent banana suspension cells after 48 hours of A. tumefaciens infection. Images a, c, e, g and i show propidium iodide stained nuclei and images b, d, f, h and j show the same nuclei with TUNEL labeling. Untransformed suspension cells prior to Agrobacterium infection show only an occasional TUNEL positive cell (illustrated by image b) whereas a large proportion of the cells become TUNEL-positive (illustrated by image d) after exposure to Agrobacterium (arrow shows apoptotic bodies). Suspension cells harboring Bcl-xL (an anti apoptosis gene, in images e and f) show only an occasional TUNEL positive cell (illustrated in image f) whereas most of the cells transformed with Bcl-xL (Gl 38A) illustrated in images (g and h) and pPTN290 illustrated in images (i and j) become

TUNEL-positive illustrated in images (h and j) after exposure to Agrobacterium strain AGLl at (OD (600nm) = 0.5).

[0024] Figure 3 is a photographic representation of an agarose gel illustrating Agrobacterium-indvLCQd nuclear DNA fragmentation in embryogenic cell suspensions of banana detected by gel electrophoresis of genomic DNA after 12 hours (lanes 2-4), 24 hours (lanes 5-7), 48 hours (lanes 8-10) and 72 hours (lanes 11-13) of Agrobacterium infection; lane 1, is an unexposed control. Three different inoculum concentrations of Agrobacterium were tested at an (OD_60O=O.1). For example, in lanes 2, 5, 8, and 11 the concentration was 0.1; in lanes 3, 6, 9, 12, the concentration was 0.5 and in lanes 4, 7, 10 and 13, the concentration was 1.0. High inoculum (OD₆oo=1.0) exposed cells showed DNA smearing by 72 hours indicating DNA degradation in a large number of the embryogenic cell suspensions. [0025] Figure 4 is a photographic representation of an agarose gel illustrating inhibition of Agrobacterium induced nuclear DNA fragmentation in embryogenic cell suspensions of banana detected by gel electrophoresis of genomic DNA after 72 hours of exposure to Agrobacterium (AGLl) at an OD₆oo- The samples loaded into the lanes of the agarose gel are as follows: lane 1, untransformed cells (cv. Grand Nain); lane 2, untransformed cells (cv. Lady finger 3 and 4); lane 3, pPTN290 (GUS) transformed cells; lane 4, Bcl-xL(G\38A) transformed cells; lane 5, untransformed Grand Nain cells not exposed to Agrobacterium; lane 6, untransformed Lady finger cells not exposed to Agrobacterium; lane 7, Bcl-xL 3' non-translated region transformed cells; lane 8, Ced-9 3 'non-translated region transformed cells and; lane 9, Bcl-2 3' non-translated region transformed cells respectively.

[0026] Figure 5 is a photographic representation of transformed embryos from banana cell suspensions, wherein anti-apoptosis genes are shown to enhance recovery. Embryogenesis (see images a-d) and regeneration (see image e) on selection media in banana cell suspensions transformed with Bcl-xL (Gl 38A) (image a); BcI- xL(image b); Bcl-2 3' non-translated region (images c and e) and; Ced-9 (image d).

[0027] Figure 6 is a photographic representation of a Southern blot of transgenic banana plants. The banana plants were analyzed to detect transgene copy number. Lanes 1-5 indicate independent transgenic plants transformed with (a) Bcl-xL (Gl 38A); (b) Bcl-xL; (c) Bcl-2 3 'non-translated region and (d) Ced-9. Transgenics were digested with restriction enzymes Sad (a, b, c) or EcoRY (d) that digest the binary plasmid in the T-DNA region only once. "N" indicates untransformed plants and, "P" indicates the respective binary plasmid used as a positive control. The probe used corresponds to the coding region of the respective transgene. [0028] Figure 7 is a photographic representation of an agarose gel, showing

RT PCR detection of transgene specific RNA from banana transgenics using for (a) 5c/- xL(G138A); (b) Bcl-xL; (c) Bcl-2 3 'non-translated region and (d) CW-9.Transgene specific primers and five banana transgenic lines (lanes 1-5) were used for each transgene. The lanes are illustrated as follows: lane N, untransformed control; lane P, PCR amplification product from transgene coding DNA sequence. RNA samples were treated with Dnase and subjected to PCR amplification without reverse transcription to ascertain the absence of genomic DNA contamination that could produce a false positive signal; these samples were then used for RT-PCR analysis.

[0029] Figure 8 is a photographic representation of banana root cells. The banana root cells demonstrate that cells transformed with an anti-apoptosis gene are not affected by Agrobacterium induced fragmentation of nuclear DNA. Untransformed cells (images a-d) and transformed cells (images e-j) banana root cells before Agrobacterium infection (images a and b) and after 48 hours of Agrobacterium infection (images c-j). Images a, c, e, g and i show propidium iodide stained nuclei and images b, d, f, h and j show the same nuclei with TUNEL labeling. Untransformed root cells prior to Agrobacterium infection did not show any TUNEL positive cells (image b), whereas TUNEL-positive nuclei could be seen after Agrobacterium infection (image d). Root cells harboring the anti-apoptosis gene Bcl-xL (images e and f) did not show any TUNEL positive cells (image f), whereas cells transformed with Bcl-xL (Gl 38A), (images g and h) and; pPTN290, the vector control (images i and j) showed TUNEL- positive nuclei (images g and j) after exposure to Agrobacterium strain AGLl at (OD₆₀₀ = 0.5).

[0030] Figure 9 is a photographic representation of an agarose gel illustrating inhibition of Agrobacterium induced nuclear DNA fragmentation in root cells of banana, after 72 hours of exposure to Agrobacterium at an OD₆₀₀. The samples in each lane are set out as follows: lane 1, untransformed banana roots not exposed to

Agrobacterium (control); lane 2, Bcl-xL 3' non-translated region transformed root cells exposed to Agrobacterium; lane 3, Ced-9 3' non-translated region transformed root cells exposed to Agrobacterium; lane 4, Bcl-2 3' non-translated region transformed root cells exposed to Agrobacterium; lane 5, Bcl-xL(G\38A) transformed roots, not exposed to Agrobacterium; lane 6, untransformed root cells (cv. Grand Nain) exposed to Agrobacterium; lane 7, untransformed root cells (cv. Grand Nain) exposed to Agrobacterium; lane 8, untransformed root cells (cv. Lady finger) exposed to Agrobacterium and; lane 9, pPTN290 (GUS) transformed root cells and Bcl-xL (Gl 38A) transformed root cells respectively, exposed to Agrobacterium. [0031] Figure 10 is a photographic representation showing the results of a sugarcane tissue culture. Leaf whorl (A), Callus induction (B), regeneration Ql 17 (C) regeneration Q208 (D) and rooting (Ql 17). [0032] Figure 11 is a photographic representation showing the results of a sugarcane callus (Ql 17) (34 day old) before (A) and after (B) exposure to Agrobacterium.

[0033] Figure 12 is a photographic representation showing DNA degradation induced by Agrobacterium in sugarcane suspension cells from cultivar Ql 17. Genomic DNA from unexposed suspension cells (lane 2), Agrobacterium strain LBA4404 exposed (lane 3) and AGLl exposed (lane 4) 48 hours after exposure. Lane 1 : 10kb ladder.

[0034] Figure 13 is a photographic representation showing that TUNEL labeling (column 1), propidium iodide counterstaining (column 2) and overlay (column 3) of sugarcane suspension cells (Q208) following exposure to Agrobacterium indicate that intra-nucleosomal fragmentation of DNA increases with increase in the inoculum density. Al, A2 and A3: Q208 exposed to Agrobacterium AGLl OD₆₆₀ = 0.1. A4, A5 and A6: Q208 exposed to Agrobacterium AGLl OD₆₆₀ = 1.0. Bl, B2 and B3: Q208 exposed to Agrobacterium LBA4404 OD₆₆₀ = 0.1. B4, B5 and B6: Q208 exposed to Agrobacterium LBA4404 OD₆₆₀= 1.0. -ve,T, -ve,PI and -ve,C: control Q208 cells, not exposed to Agrobacterium.

[0035] Figure 14 is a photographic representation showing that TUNEL labeling (column 1), propidium iodide counterstaining (column 2) and overlay (column 3) of sugarcane suspension cells (Ql 17) following exposure to Agrobacterium indicate that intra-nucleosomal fragmentation of DNA increases with increase in the inoculum density. Cl, C2 and C3: Q117 exposed to Agrobacterium AGLl OD₆₆₀ = 0.1. C4, C5 and C6: Q117 exposed to Agrobacterium AGLl OD₆₆₀ = 1.0. Dl, D2 and D3: Q117 exposed to Agrobacterium LBA4404 OD₆₆₀ = 0.1. D4, D5 and D6: Ql 17 exposed to Agrobacterium LBA4404 OD₆₆₀= 1.0. -ve,T, -ve,PI and -ve,C: control Q208 cells, not exposed to Agrobacterium.

[0036] Figure 15 is a photographic representation illustrating the protective effect of expression of cell death inhibitor genes on Agrobacterium-induced cell death leads to improved embryogenic response from 14 day old Ql 17 explants after Agrobacterium-mediated transformation with LBA4404 (pUGfpnptll). The explants were bombarded with (A) Bcl-xL, (B) Hsp70h (S) (C) AtBαg4 (D) Ql 17 Bcl-xL G138A and (E) Gfp before exposure to Agrobacterium (F) is untransformed and unexposed control. Photographs were taken two weeks after Agrobacterium exposure. Results for Q208 were identical.

[0037] Figure 16 is a photographic representation showing the effect of expression of cell death inhibitor genes on survival of 34 day old explants of Q 117 after exposure to Agrobacterium (1) unexposed and untransformed control and (2) untransformed but exposed, 3-9 were transformed with: Bcl-xL (3) Bcl-xL G138A (4) , AtBag4 (5), Hsp70h (S) (6), Hsp70h (M) (7), AtBag4 + Hsp70h (S) (8), AtBag4 + Hsp70h (M) (9) before transformation with Agrobacterium LBA4404 (pUGfpnptll(S). Photographs were taken two weeks later. [0038] Figure 17 is a photographic representation showing the effect of expression of cell death inhibitor genes on survival of 34 day old explants of Q208 after exposure to Agrobacterium (1) unexposed and untransformed control and (2) untransformed but exposed, 3-9 were transformed with: Bcl-xL (3) Bcl-xL G 138 A (4), AtBag4 (5), Hsp70h (S) (6), Hsp70h (M) (7), AtBag4 + Hsp70h (S) (8), AtBag4 + Hsp70h (M) (9) before transformation with Agrobacterium LBA4404 (pUGfpnptll(S). Photographs were taken two weeks later.

[0039] Figure 18 is a photographic representation of Agrobacterium-mediattd transformation of cv. Ql 17 and Q208 using superbinary vector carrying gfp reporter gene, showing stably transformed embryos, (A) 34 days old Ql 17 (B) 34 days old Ql 17 expressing Bcl-xL (C) 34 days old Ql 17 expressing AtBαg4. Photographs were taken two weeks after Agrobacterium LBA4404/ pUGfpnptll (OD₆₆₀ = 0.7) exposure.

DETAILED DESCRIPTION OF THE INVENTION

1. Definitions

[0040] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, preferred methods and materials are described. For the purposes of the present invention, the following terms are defined below.

[0041] The articles "a" and "an" are used herein to refer to one or to more than one (i.e. to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.

[0042] The term "about" is used herein to refer to conditions (e.g., amounts, concentrations, time etc.) that vary by as much as 30%, preferably by as much as 20%, and more preferably by as much as 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 1% to a specified condition.

[0043] The term "antigen-binding molecule" means a molecule that has binding affinity for a target antigen. It will be understood that this term extends to immunoglobulins, immunoglobulin fragments and non-immunoglobulin derived protein frameworks that exhibit antigen-binding activity. [0044] The terms "cells," "plant cells," "transformed plant cells,"

"regenerable plant cells" and the like are terms that not only refer to the particular subject cells but to the progeny or potential progeny of the plant cells. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent plant cells, but are still included within the scope of the term as used herein.

[0045] Throughout this specification, unless the context requires otherwise, the words "comprise," "comprises" and "comprising" will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements. [0046] By "coding sequence" is meant any nucleic acid sequence that contributes to the code for the polypeptide product of a gene. [0047] The terms "complementary" and "complementarity" refer to polynucleotides (i.e., a sequence of nucleotides) related by the base-pairing rules. For example, for the sequence "A-G-T," is complementary to the sequence "T-C-A." Complementarity may be "partial," in which only some of the nucleic acids' bases are matched according to the base pairing rules. Or, there may be "complete" or "total" complementarity between the nucleic acids. The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands.

[0048] The term "constitutive promoter" refers to a promoter that directs expression of an operably connected transcribable sequence in many or all tissues of a plant.

[0049] The terms "chimeric construct," "chimeric gene," "chimeric nucleic acid" and the like are used herein to refer to a gene or nucleic acid sequence or segment comprising at least two nucleic acid sequences or segments from species which do not combine those sequences or segments under natural conditions, or which sequences or segments are positioned or linked in a manner which does not normally occur in the native genome or nucleome of the untransformed host. Thus, a "chimeric gene" refers to any gene that is not a native gene, comprising regulatory and coding or non-coding sequences that are not found together in nature. In this light, a chimeric gene may comprise regulatory sequences and coding or non-coding sequences that are derived from different sources, or regulatory sequences and coding or non-coding sequences derived from the same source, but arranged in a manner different than that found in nature.

[0050] By "corresponds to" or "corresponding to" is meant a polynucleotide (a) having a nucleotide sequence that is identical or substantially identical (e.g., one displaying at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 % sequence identity) or complementary to all or a portion of a reference polynucleotide sequence or (b) encoding an amino acid sequence identical to an amino acid sequence in a peptide or protein. This phrase also includes within its scope a peptide or polypeptide having an amino acid sequence that is identical or substantially identical (e.g., one displaying at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 % sequence identity) to a sequence of amino acids in a reference peptide or protein.

[0051] The term "endogenous" refers to a gene or nucleic acid sequence or segment that is normally found in a host cell of interest. [0052] The terms "expression," "expressed" and "express" related to genes is intended to mean the translation of genetic information encoded in a gene into RNA or protein. Expressed genes include genes that are transcribed into messenger RNA (mRNA) and then translated into protein, as well as genes that are transcribed into types of RNA such as transfer RNA (tRNA) and ribosomal RNA (rRNA) that are not translated into protein.

[0053] The terms "flanked by," "flanking" and the like as they apply to relationships between two or more nucleotide sequences in the first and second constructs of the invention. Accordingly, the term "flanked by" is equivalent to being "in between" two target sites and the term "flanking" is equivalent to the target sites being upstream or downstream of a specific nucleotide sequence.

[0054] The term "foreign" or "exogenous" or "heterologous" refers to any molecule (e.g., a polynucleotide or polypeptide) which is introduced into a host by experimental manipulations and may include gene sequences found in that host so long as the introduced gene contains some modification {e.g., a point mutation, the presence of a selectable marker gene, the presence of a recombination site, etc.) relative to the naturally-occurring gene.

[0055] As used herein, the terms "function" or "functional activity" refer to a chemical, biological or enzymatic function.

[0056] The term "gene" as used herein refers to any and all discrete coding regions of the cell's nucleome, as well as associated non-coding and regulatory regions. The gene is also intended to mean the open reading frame encoding specific polypeptides, introns, and adjacent 5' and 3' non-coding nucleotide sequences involved in the regulation of expression. In this regard, the gene may further comprise control signals such as promoters, enhancers, termination and/or polyadenylation signals that are naturally associated with a given gene or heterologous control signals. The DNA sequences may be cDNA or genomic DNA or a fragment thereof. The gene may be introduced into an appropriate vector for extra chromosomal maintenance or for integration into a plant cell.

[0057] The terms "growing" or "regeneration" as used herein mean growing a whole, differentiated plant from a plant cell, a group of plant cells, a plant part (including seeds), or a plant piece (e.g., from a protoplast, callus, or tissue part).

[0058] By "knock-out" is meant the inactivation or loss-of-function of a gene, which decreases, abrogates or otherwise inhibits the level or functional activity of an expression product of that gene. A "knock-out" plant or plant cell refers to a genetically modified plant or plant cell in which a gene is inactivated or loses function. [0059] By "marker gene" is meant a gene that imparts a distinct phenotype to cells expressing the marker gene and thus allows such transformed cells to be distinguished from cells that do not have the marker. A selectable marker gene confers a trait for which one can 'select' based on resistance to a selective agent (e.g., an herbicide, antibiotic, radiation, heat, or other treatment damaging to untransformed cells). A screenable marker gene (or reporter gene) confers a trait that one can identify through facile observation or testing, i.e., by 'screening' (e.g., β-glucuronidase, luciferase, green fluorescent protein or other activity not present in untransformed cells). It shall be understood that the term "marker gene" excludes the anti-apoptosis polynucleotide and the polynucleotide of interest that is introduced into the plant cells. [0060] The term "marker free" as used herein refers to Agrobacterium- mediated transformation of plant cells, which is carried out without selecting for the presence of an identifying characteristic that is conferred by a marker gene in the plant cells.

[0061] The term "negative selection" refers to the act of selecting against cells through the implementation of methodologies which allow for the killing of those cells. For example, "negative selection" encompasses the situation in which a host cell grown in the presence of a negative selective agent such as acyclovir, ganciclovir, or 5- fluoro-2'-deoxyuridine (F2dU) dies if the cell containing a suicide gene, such as the herpes simplex virus (HSV) thymidine kinase (TK) gene, is expressed within the cell. [0062] The term "non-coding sequence" refers to any nucleic acid sequence that does not contribute to the code for the polypeptide product of a gene. [0063] The term "5' non-coding region" is used herein in its broadest context to include all nucleotide sequences which are derived from the upstream region of an expressible gene, other than those sequences which encode amino acid residues which comprise the polypeptide product of the gene, wherein 5' non-coding region confers or activates or otherwise facilitates, at least in part, expression of the gene.

[0064] By "nucleome" is meant the total nucleic acid complement and includes the genome, extrachromosomal nucleic acid molecules and all RNA molecules such as mRNA, heterogenous nuclear RNA (hnRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), small cytoplasmic RNA (scRNA), ribosomal RNA (rRN A), translational control RNA (tcRNA), transfer RNA (tRNA), eRNA, messenger- RNA-interfering complementary RNA (micRNA) or interference RNA (iRNA), chloroplast or plastid RNA (cpRNA) and mitochondrial RNA (mtRNA).

[0065] By "obtained from" is meant that a sample such as, for example, a nucleic acid extract is isolated from, or derived from, a particular source of a plant. For example, the nucleic acid extract may be obtained from tissue isolated directly from a plant.

[0066] The term "oligonucleotide" as used herein refers to a polymer composed of a multiplicity of nucleotide units (deoxyribonucleotides or ribonucleotides, or related structural variants or synthetic analogues thereof) linked via phosphodiester bonds (or related structural variants or synthetic analogues thereof). An oligonucleotide is typically rather short in length, generally from about 10 to 30 nucleotides, but the term can refer to molecules of any length, although the term "polynucleotide" or "nucleic acid" is typically used for large oligonucleotides.

[0067] By "operably connected" or "operably linked" and the like is meant a linkage of polynucleotide elements in a functional relationship. A nucleic acid is

"operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For instance, a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the coding sequence. Operably linked means that the nucleic acid sequences being linked are typically contiguous and, where necessary to join two protein coding regions, contiguous and in reading frame. A coding sequence is "operably linked to" another coding sequence when RNA polymerase will transcribe the two coding sequences into a single mRNA, which is then translated into a single polypeptide having amino acids derived from both coding sequences. The coding sequences need not be contiguous to one another so long as the expressed sequences are ultimately processed to produce the desired protein. "Operably connecting" a promoter to a transcribable polynucleotide is meant placing the transcribable polynucleotide (e.g. , protein encoding polynucleotide or other transcript) under the regulatory control of a promoter, which then controls the transcription and optionally translation of that polynucleotide. In the construction of heterologous promoter/structural gene combinations, it is generally preferred to position a promoter or variant thereof at a distance from the transcription start site of the transcribable polynucleotide, which is approximately the same as the distance between that promoter and the gene it controls in its natural setting; i.e. : the gene from which the promoter is derived. As is known in the art, some variation in this distance can be accommodated without loss of function. Similarly, the preferred positioning of a regulatory sequence element (e.g., an operator, enhancer etc) with respect to a transcribable polynucleotide to be placed under its control is defined by the positioning of the element in its natural setting; i.e. the genes from which it is derived.

[0068] As used herein, "plant" and "differentiated plant" refer to a whole plant or plant part containing differentiated plant cell types, tissues and/or organ systems. Plantlets and seeds are also included within the meaning of the foregoing terms. Plants included in the invention are any plants amenable to transformation techniques, including angiosperms, gymnosperms, monocotyledons and dicotyledons.

[0069] The term "plant cell" as used herein refers to any plant cell or cell line including protoplasts, gamete-producing cells, and cells which regenerate into whole plants. Plant cells also include cells in plants as well as protoplasts in culture. [0070] By "plant tissue" is meant differentiated and undifferentiated tissue derived from roots, shoots, pollen, seeds, tumor tissue, such as crown galls, and various forms of aggregations of plant cells in culture, such as embryos and calluses.

[0071] The term "polypeptide", "peptide" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues and to variants and synthetic analogues of the same. Thus, these terms apply to amino acid polymers in which one or more amino acid residues is a synthetic non-naturally-occurring amino acid, such as a chemical analogue of a corresponding naturally-occurring amino acid, as well as to naturally-occurring amino acid polymers.

[0072] The term "polynucleotide" or "nucleic acid" as used herein designates mRNA, RNA, cRNA, cDNA or DNA, synthetic forms and mixed polymers, both sense and antisense strands, and may be chemically or biochemically modified or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those skilled in the art. Such modifications include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog (such as the morpholine ring), internucleotide modifications such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), pendent moieties (e.g., polypeptides), intercalators (e.g., acridine, psoralen, etc.), chelators, alkylators and modified linkages (e.g., α-anomeric nucleic acids, etc.). Also included are synthetic molecules that mimic polynucleotides in their ability to bind to a designated sequence via hydrogen binding and other chemical interactions. Such molecules are known in the art and include, for example, those in which peptide linkages substitute for phosphate linkages in the backbone of the molecule. RNA forms of the genetic molecules of the present invention are generally mRNA or iRNA including siRNAs. The genetic form may be in isolated form or integrated with other genetic molecules such as vector molecules and particularly expression vector molecules. The terms "nucleotide sequence," "polynucleotide" and "nucleic acid" used herein interchangeably and encompass polynucleotides in which one or more nucleotides have been added or deleted, or replaced with different nucleotides.

[0073] The term "positive selection" refers to a selection method that enables only those cells that carry a DNA insert integrated at a specific chromosomal location to grow under particular conditions.

[0074] The terms "promoter" and "expression modulating sequence" are used interchangeably herein and are meant as a region of DNA, which controls at least in part the initiation and level of transcription of a polynucleotide. Reference herein to a "promoter" or an "expression modulating sequence" is to be taken in its broadest context and includes the transcriptional regulatory sequences of a classical genomic gene, including a TATA box and CCAAT box sequences, as well as additional regulatory elements (i.e., activating sequences, enhancers and silencers) that alter gene expression in response to developmental and/or environmental stimuli, or in a tissue- specific or cell-type-specific manner. A promoter is usually, but not necessarily, positioned upstream or 5', of a transcribable sequence (e.g., a coding sequence or a sequence encoding a functional RNA), the expression of which it regulates.

Furthermore, the regulatory elements comprising a promoter are usually positioned within 2 kb of the start site of transcription of the gene. Promoters according to the invention may contain additional specific regulatory elements, located more distal to the start site to further enhance expression in a cell, and/or to alter the timing or inducibility of expression of a structural gene to which it is operably connected. The term "promoter" also includes within its scope inducible, repressible and constitutive promoters as well as minimal promoters. The term "inducer stimulus" refers to hormonal, environmental, chemical and physical means by which a promoter is expressible, "switched on". The term "repressor stimulus" refers to hormonal, environmental, chemical and physical means by which a promoter is not-expressible, "switched off. Minimal promoters typically refer to minimal expression control elements that are capable of initiating transcription of a selected DNA sequence to which they are operably connected. In some examples, a minimal promoter is not capable of initiating transcription in the absence of additional regulatory elements (e.g., enhancers or other cw-acting regulatory elements) above basal levels. A minimal promoter frequently consists of a TATA box or TATA-like box. Numerous minimal promoter sequences are known in the literature. For example, minimal promoters may be selected from a wide variety of known sequences, including promoter regions from CaMV 35S promoter and SV40 among many others. [0075] The terms "regulatable promoter" and "regulatable expression modulating sequence" refers to polynucleotide sequences that direct gene expression not constitutively, but in a temporally- and/or spatially-regulated manner, and include both tissue-specific and inducible promoters. It includes natural and synthetic sequences as well as sequences which may be a combination of synthetic and natural sequences. Different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental conditions. New promoters of various types useful in plant cells are constantly being discovered. Since in most cases the exact boundaries of regulatory sequences have not been completely defined, nucleic acid fragments of different lengths may have identical promoter activity.

[0076] "Regulatory sequences" or "regulatory elements" refer to nucleotide sequences located upstream (5' non-coding sequences), within, or downstream (3' non- coding sequences) of a transcribable sequence, including a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated transcribable sequence. Regulatory sequences include enhancers, promoters, translation leader sequences, introns, and polyadenylation signal sequences. They include natural and synthetic sequences as well as sequences which may be a combination of synthetic and natural sequences.

[0077] The term "stringency" as used herein, refers to the temperature and ionic strength conditions, and presence or absence of certain organic solvents, during hybridization. The higher the stringency, the higher will be the degree of complementarity between immobilized nucleotide sequences and the labeled polynucleotide sequence.

[0078] The term "stringent conditions" refers to temperature and ionic conditions under which only nucleotide sequences having a high frequency of complementary bases will hybridize. The stringency required is nucleotide sequence dependent and depends upon the various components present during hybridization. Generally, stringent conditions are selected to be about 10 to 20° C lower than the thermal melting point (T_m) for the specific sequence at a defined ionic strength and pH. The T_m is the temperature (under defined ionic strength and pH) at which 50% of a target sequence hybridizes to a complementary probe.

[0079] The term "transcribable nucleic acid sequence" or "transcribed nucleic acid sequence" includes nucleic acid that is transcribed by cellular machinery to produce a transcript and excludes the non-transcribed regulatory sequence that drives transcription. Depending on the aspect of the invention, the transcribable sequence may be derived in whole or in part from any source known to the art, including a plant, a fungus, an animal, a bacterial nucleome or episome, eukaryotic, nuclear or plasmid DNA, cDNA, viral DNA or chemically synthesized DNA. The transcribable sequence may contain an uninterrupted coding sequence or it may include one or more introns, bound by the appropriate splice junctions. The transcribable sequence may also encode a fusion protein. In other embodiments, the transcribable sequence comprises non- coding regions only.

[0080] The term "transformation" means alteration or manipulation of the genotype of a plant cell by the introduction of an expression system or exogenous sequence according to the invention.

[0081] The terms "transformed" and "transgenic" as used herein refer to a cell, tissue, organ or organism into which a foreign or exogenous nucleic acid, such as a chimeric construct or recombinant vector, has been introduced, including progeny thereof in which foreign or exogenous nucleic acid is present. [0082] The term "transgene" is used herein to describe genetic material that has been or is about to be artificially introduced into the nucleome, especially the genome, of a plant cell and that is transmitted to the progeny of the plant. The transgene is used to transform a plant cell, meaning that a permanent or transient genetic change, especially a permanent genetic change, is induced in a plant cell following incorporation of one or more nucleic acid components of the expression system as defined herein.

[0083] By "vector" is meant a nucleic acid molecule, suitably a DNA molecule derived, for example, from a plasmid, bacteriophage, or plant virus, into which a nucleic acid sequence may be inserted or cloned. A vector typically contains one or more unique restriction sites and may be capable of autonomous replication in a plant cell including a target cell or tissue or a progenitor cell or tissue thereof, or be integrable with the nucleome of the defined host such that the cloned sequence is reproducible. Accordingly, the vector may be an autonomously replicating vector, i.e., a vector that exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a linear or closed circular plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector may contain any means for assuring self-replication. Alternatively, the vector may be one which, when introduced into the plant cell, is integrated into the nucleome and replicated together with the chromosome(s) into which it has been integrated. A vector system may comprise a single vector or plasmid, or two or more vectors or plasmids, which contain the total DNA (e.g. , a polynucleotide of interest, an apoptosis-inhibiting polynucleotide and optionally a modulator polynucleotide, as defined herein) to be introduced into the nucleome of the plant cell, or a transposon. The choice of vector will typically depend on the compatibility of the vector with the plant cell into which the vector is to be introduced. In some embodiments, the vector from which the polynucleotide of interest is expressed lacks a marker gene for selecting transformants that contain the polynucleotide of interest. In other embodiments, the vector includes a marker gene but the step of identifying or screening for the marker gene is excluded from the method of the invention.

[0084] The terms "wild type," "native" or "non-transgenic" refers to an untransformed plant, plant cell, plant part or plant tissue, i.e., one where the nucleome, especially the genome, has not been altered by the presence of one or more nucleic acid components of an expression system as defined herein.

2. Apoptosis-inhibiting agents

[0085] The present invention is based in part on the determination that the efficiency of Agrobacterium-medialed transformation of plant cells can be increased substantially (by more than about 100-fold in banana embryogenic cells) by exposing the plant cells during the transformation to conditions that inhibit apoptosis in those cells. The inventors have surprisingly discovered that this increased efficiency permits identification of transformed plant cells that contain an exogenous polynucleotide or encoded polypeptide (also referred to herein as polynucleotide of interest or polypeptide of interest) without screening for the presence of a co-transformed marker gene (also referred to herein as "marker free" transformation. Accordingly, the present invention provides methods for introducing a polynucleotide of interest into a plant cell, wherein the methods comprise exposing plant cells to an Agrobαcterium that contains the polynucleotide of interest under conditions that inhibit apoptosis in the cells, and identifying a transformed plant cell that contains the polynucleotide of interest without selecting for the presence of a marker gene in those cells. Any method of inhibiting apoptosis is contemplated by the present invention, including the use of apoptosis- inhibiting agents such as small molecule compounds and apoptosis-inhibiting polynucleotides and polypeptides. The apoptosis-inhibiting agent is either present in the plant cells at the time of transformation or introduced into the plant cells prior to transformation or at the same time as transforming the cells with the polynucleotide of interest. 2.1 Small molecule inhibitors of apoptosis

[0086] In some embodiments, therefore, the apoptosis-inhibiting agent is a chemical inhibitor, for example, a small typically organic compound, which has a molecular weight of more than about 50 and less than about 2,500 Dalton. The small molecule compound is suitably selected from ethylene inhibitors (e.g., 2,5- norbornadiene, norbornene, silver thiosulfate, and silver nitrate), ethylene synthesis inhibitors (e.g., aminoethoxyvinylglycine (AVG), cobalt salts, acetyl salicylic acid, or salicylic acid), gibberellin antagonists (e.g., abscisic acid (ABA)) and phosphatase inhibitors (e.g., okadaic acid). A small molecule compound is suitably present in an effective concentration, e.g. , for silver nitrate in a concentration of from 0.1 to 20 mg/L, especially 1 to 10 mg/L. In these embodiments, the plant cells to be transformed are contacted with the small molecule compound for a time and under conditions sufficient to inhibit apoptosis of the plant cells that would otherwise occur in response to an apoptotic signal (e.g. , Agrobacterium infection). 2.2 Apoptosis-inhibiting polynucleotides

[0087] In other embodiments, the apoptosis-inhibiting agent is an apoptosis- inhibiting polynucleotide, which inhibits apoptosis directly or which encodes an apoptosis-inhibiting RNA or an apoptosis-inhibiting polypeptide.

2.2.1 Polynucleotides encoding apoptosis-inhibiting polypeptides [0088] Representative apoptosis-inhibiting polypeptides include but are not restricted to: Bcl-xL; CED-9; Bcl-2; BI-I (a Bax inhibitor with known anti-apoptosis activity); Hsp70; AtILP-I (an IAP-like protein; IAPs from baculovirus are known anti- apoptosis genes (Higashi et al, 2005); AtBAGl (in mammals, BAGl enhances the anti- apoptotic effects of Bcl-2 and is a Hsp70 co-chaperone), AtBAG2, AtBAG3, AtBAG4, AtBAG5, AtBAGό, AtBAG7; CED-9; IAP-I and; mcl-1. Since apoptosis-inhibiting genes from one organism have been shown to function in other disparate organisms (e.g., apoptosis-inhibiting genes from animal and bacteria have been shown to function in plants and vice versa), the present invention contemplates the use of any apoptosis- inhibiting gene and encoded product from any source provided that it is operable in plant cells. Listed below in Table 1 are illustrative examples of apoptosis-inhibiting genes and their corresponding sequences. TABLE 1 NON-LIMITING EXAMPLES OF ANTI-APOPTOSIS GENES

[0089] If desired, the nucleotide sequence of the apoptosis-inhibiting polynucleotide may by modified using codons which are preferred by the host plant cells and avoiding nucleotide sequences, e.g., polyadenylation signals or splice sites within the coding region, which may affect optimal expression in the host plant, e.g., analogously to the methods described in U.S. Pat. No. 5,380,831 or U.S. Pat. No. 5,610,042.

2.2.2 Polynucleotides encoding apoptosis-inhibiting RNAs

[0090] In other embodiments, the apoptosis-inhibiting polynucleotide comprises a nucleic acid sequence encoding an inhibitory RNA molecule {e.g., a ribozyme, an antisense nucleic acid or RNAi molecule) that is specific to a transcript product of an apoptosis gene whose expression product {e.g., protease, kinase, phosphatase or regulatory protein) stimulates or otherwise advances apoptosis. Suitably, the apoptosis-inhibiting polynucleotide comprises a nucleic acid sequence encoding a RNA molecule that directly or indirectly attenuates or otherwise disrupts the expression of an apoptosis gene. In illustrative examples of this type, the apoptosis-inhibiting polynucleotide comprises a nucleic acid sequence, which when expressed in the host cell produces a RNA molecule that comprises a targeting region having sequence identity with a nucleotide sequence of the apoptosis gene and that attenuates or otherwise disrupts the expression of that gene. The targeting region may have sequence identity with the sense strand or the anti-sense strand of the apoptosis gene. Various methods of using inhibitory RNA molecules are discussed in more detail below in Section 3 and although these methods are discussed in the context of controlling the expression of an apoptosis-inhibiting polynucleotide or the level or functional activity of an apoptosis-inhibiting polypeptide, they can be used analogously for controlling the expression of an apoptosis gene or the level or functional activity of its gene product. 2.2.3 Form and location of apoptosis-inhibiting polynucleotide

[0091] The apoptosis-inhibiting polynucleotide is usually in the form of a construct, which is typically chimeric in nature. These constructs will usually comprise regulatory elements that control expression of the apoptosis-inhibiting polynucleotide or that process its expression product, as described infra. [0092] The apoptosis-inhibiting polynucleotide may be stably incorporated into the nucleome {e.g., genome) of the plant cells to be transformed or may be only transiently present and operable, e.g., at or around the time the cell is exposed to the Agrobacterium. Transient expression can be obtained, e.g., using an agroinfection system, in which, for example, the T-DNA carries two geminiviruses in tandem such that a viral replicon that carries the apoptosis-inhibiting polynucleotide may replicate in the cell. In this system, the virus typically will not integrate into the plant genome but will replicate to a high copy number and provide a high level of transient expression. Cells thus primed to be resistant to apoptosis can then be transformed using Agrobacterium having Ti plasmids comprising the polynucleotide of interest, which will be incorporated into the nucleome, while the virus is diluted through regeneration and will not be transmitted to the seed. Thus, the progeny and descendants of the infected plant cells are stably transformed with the gene of interest but not with the apoptosis- inhibiting polynucleotide. Transient expression may alternatively be obtained by introducing short apoptosis-inhibiting oligonucleotide sequences into the plant, e.g., antisense sequences.

2.3 Apoptosis-inhibiting polypeptides [0093] In other embodiments, the apoptosis-inhibiting agent is an apoptosis- inhibiting polypeptide, which may be produced from an apoptosis-inhibiting polynucleotide that is expressed in the plant cells into which it is introduced, or which may be delivered independently of an introduced polynucleotide. In the latter case, the apoptosis-inhibiting polypeptide may be delivered from Agrobacteήum into plant cells in the form of a fusion protein comprising a targeting moiety that targets the fusion protein to a specific subcellular location. Certain species of micro-organism are known to transfer T-DNA into recipient cells by traversing the cell wall and membrane and the nuclear membrane. For example, an apoptosis-inhibiting polypeptide may be fused to a virulence (Vir) fusion protein in Agrobacterium, wherein the polypeptide is delivered to plant cells using Agrobacterium-mediated transformation. The apoptosis-inhibiting polypeptide will generally be localized to the nucleus of the plant cell. However, other sub-cellular localization could be targeted within the cell. Agrobacterium fusion proteins are constructed to retain the functional properties of the Vir protein so that the selected protein as well as the transgene can be delivered. An illustrative method of introducing apoptosis-inhibiting polypeptides into plant cells through the use of fusion protein transfer techniques is described for example in U.S. Patent No. 6,800,791 (Mathew et ah, Method of delivery of proteins to plant cells, 2000).

3. Controlling the level or functional activity of apoptosis-inhibiting agents

[0094] The expression of an apoptosis-inhibiting polynucleotide or the level or functional activity of an apoptosis-inhibiting polypeptide is desirably controllable to reduce or abrogate anti-apoptotic activity post-transformation. In this regard, high levels of expression of Bcl-xL or CED-9 polynucleotides in transgenic tomato plants has been shown to affect both plant growth and seed development Xu et al. , (2004, Proc Natl AcadSci USA, 101(44):15805-15810) and there is now growing evidence that apoptosis-like events are involved in a range of plant development processes. It is possible therefore that continued expression of the apoptosis-inhibiting polynucleotide and ensuing production of the apoptosis-inhibiting polypeptides could have an effect on normal plant development and may negate the advantage of increased transformation efficiency. Accordingly, in certain advantageous embodiments, once an apoptosis- inhibiting polynucleotide has been transformed into a plant cell, its expression is suitably disrupted or the level or functional activity of its expression product is abrogated or reduced. In illustrative examples of this type, the expression of the apoptosis-inhibiting polynucleotide is disrupted by using RNA-mediated inhibitory techniques (e.g., sense or antisense suppression techniques as disclosed for example by Waterhouse et α/.,1998, Proc Natl Acad Sci USA, 95(23): 13959- 13964). An illustrative approach may incorporate constitutive expression of the anti-apoptosis polynucleotide and conditional expression of the RNA inhibitory molecule under the control of an inducible promoter. In this approach, expression of the apoptosis-inhibiting polynucleotide would be silenced upon chemical induction of the RNA inhibitory molecule. Alternatively, an inhibitor of the encoded apoptosis-inhibiting polypeptide can be employed to reduce the level or functional activity of the polypeptide. [0095] Accordingly, in some embodiments, a modulator polynucleotide is employed in the methods and constructs of the invention to abrogate or otherwise disrupt the expression of an apoptosis-inhibiting polynucleotide that has been introduced into a plant cell by Agrobacterium-mediated transformation.

[0096] In representative examples, the modulator polynucleotide comprises a nucleic acid sequence encoding an antisense RNA molecule that directly blocks the translation of mRNA transcribed from the apoptosis-inhibiting polynucleotide by binding to the mRNA and preventing protein translation. When employed, antisense RNAs should be at least about 10-20 nucleotides or greater in length, and be at least about 75% complementary to their target genes or gene transcripts such that expression of the targeted homologous sequence is precluded.

[0097] In other illustrative examples, the modulator polynucleotide comprises a nucleic acid sequence encoding a ribozyme that functions to inhibit the translation of the mRNA of the anti-apoptosis polynucleotide. Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. The mechanism of ribozyme action involves sequence specific hybridization of the ribozyme molecule to complementary target RNA, followed by an endonucleolytic cleavage. Within the scope of the invention are engineered hammerhead motif ribozyme molecules that specifically and efficiently catalyze endonucleolytic cleavage of target gene RNA sequences. Specific ribozyme cleavage sites within any potential RNA target are initially identified by scanning the target molecule for ribozyme cleavage sites which include the following sequences, GUA, GUU and GUC. Once identified, short RNA sequences of between 15 and 20 ribonucleotides corresponding to the region of the anti-apoptosis polynucleotide containing the cleavage site may be evaluated for predicted structural features such as secondary structure that may render the oligonucleotide sequence unsuitable. When employed, ribozymes may be selected from the group consisting of hammerhead ribozymes, axehead ribozymes, newt satellite ribozymes, Tetrahymena ribozymes and RNAse P, and are designed according to methods known in the art based on the sequence of the target polynucleotide (for instance, see U.S. Pat. No. 5,741,679). The suitability of candidate targets may also be evaluated by testing their accessibility to hybridization with complementary oligonucleotides, using ribonuclease protection assays. [0098] Alternatively, the modulator polynucleotide comprises a nucleic acid sequence encoding an antigen-binding molecule that is interactive with a protein product of the apoptosis-inhibiting polynucleotide. The antigen-binding molecule may be selected from immunoglobulin molecules (e.g., whole polyclonal antibodies and monoclonal antibodies)and fragments thereof (e.g., Fv, Fab, Fab' and F(ab')₂ immunoglobulin fragments) as well as synthetic antigen-binding molecules(e.g., stabilized Fv fragments, single variable region domains (also known as a dAbs), minibodies and the like as known in the art).

[0099] In other embodiments, the modulator polynucleotide comprises a nucleic acid sequence encoding a RNA molecule that directly or indirectly attenuates or otherwise disrupts the expression of the apoptosis-inhibiting polynucleotide by post- transcriptional gene silencing (PTGS). In these embodiments, the PTGS conferred by the RNA molecules is sometimes referred to as RNA interference (RNAi). RNAi refers to interference with or destruction of the product of a target gene by introducing a single stranded or double stranded RNA (dsRNA) that is homologous to a transcript of the apoptosis-inhibiting polynucleotide. Absolute homology is not required for RNAi, with a lower threshold being described at about 85% homology for a dsRNA of about 200 base pairs (Plasterk and Ketting, 2000, Current Opinion in Genetics and Dev, 10:562-

67). Therefore, depending on the length of the dsRNA, the RNAi-encoding nucleic acids can vary in the level of homology they contain toward the apoptosis-inhibiting polynucleotide, e.g., with dsRNAs of 100 to 200 base pairs having at least about 85% homology with the apoptosis-inhibiting polynucleotide, and longer dsRNAs, i.e., 300 to 100 base pairs, having at least about 75% homology to the apoptosis-inhibiting polynucleotide. RNA-encoding constructs that express a single RNA transcript designed to anneal to a separately expressed RNA, or single constructs expressing separate transcripts from convergent promoters, are suitably at least about 100 nucleotides in length. RNA-encoding constructs that express a single RNA designed to form a dsRNA via internal folding are desirably at least about 200 nucleotides in length. [0100] Thus, in the above embodiments, expression of the nucleic acid sequence in plant cells produces a RNA molecule that comprises a targeting region having sequence identity with a nucleotide sequence of the apoptosis-inhibiting polynucleotide and that attenuates or otherwise disrupts the expression of that polynucleotide. In certain embodiments, the targeting sequence displays at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% identity to a nucleotide sequence of the apoptosis-inhibiting polynucleotide. In other embodiments, the targeting sequence hybridizes to a nucleotide sequence of the apoptosis-inhibiting polynucleotide under at least low stringency conditions, more suitably under at least medium stringency conditions and even more suitably under high stringency conditions. Reference herein to low stringency conditions include and encompass from at least about 1% v/v to at least about 15% v/v formamide and from at least about 1 M to at least about 2 M salt for hybridization at 42° C, and at least about 1 M to at least about 2 M salt for washing at 42° C. Low stringency conditions also may include 1% bovine serum albumin (BSA), 1 mM EDTA, 0.5 M NaHPO₄ (pH 7.2), 7% SDS for hybridization at 65° C, and (i) 2 x SSC, 0.1% SDS; or (ii) 0.5% BSA, 1 mM EDTA, 40 mM NaHPO₄ (pH 7.2), 5% SDS for washing at room temperature. Medium stringency conditions include and encompass from at least about 16% v/v to at least about 30% v/v formamide and from at least about 0.5 M to at least about 0.9 M salt for hybridization at 42° C, and at least about 0.5 M to at least about 0.9 M salt for washing at 42° C. Medium stringency conditions also may include 1% BSA, 1 mM EDTA, 0.5 M NaHPO₄ (pH 7.2), 7% SDS for hybridization at 65° C, and (i) 2 x SSC, 0.1% SDS; or (ii) 0.5% BSA, 1 mM EDTA, 40 mM NaHPO₄ (pH 7.2), 5% SDS for washing at 42° C. High stringency conditions include and encompass from at least about 31% v/v to at least about 50% v/v formamide and from at least about 0.01 M to at least about 0.15 M salt for hybridization at 42° C, and at least about 0.01 M to at least about 0.15 M salt for washing at 42° C. High stringency conditions also may include 1% BSA, 1 niM EDTA, 0.5 M NaHPO₄ (pH 7.2), 7% SDS for hybridization at 65° C, and (i) 0.2 x SSC, 0.1% SDS; or (ii) 0.5% BSA, ImM EDTA, 40 mM NaHPO₄ (pH 7.2), 1% SDS for washing at a temperature in excess of 65° C. Desirably, the targeting sequence hybridizes to a nucleotide sequence of the anti-apoptosis polynucleotide under physiological conditions. Other stringent conditions are well known in the art. A skilled artisan will recognize that various factors can be manipulated to optimize the specificity of the hybridization. Optimization of the stringency of the final washes can serve to ensure a high degree of hybridization. For detailed examples, see Ausubel et ah, supra at pages 2.10.1 to 2.10.16 and Sambrook et al. ("Molecular Cloning. A Laboratory Manual", Cold Spring Harbor Press, 1989) at sections 1.101 to 1.104. [0101] Suitably, the targeting region has sequence identity with the sense strand or antisense strand of the apoptosis-inhibiting polynucleotide. In certain embodiments, the RNA molecule is unpolyadenylated, which can lead to efficient reduction in expression of the anti-apoptosis polynucleotide, as described for example by Waterhouse et al., in U.S. Patent No. 6,423,885. [0102] Typically, the length of the targeting region may vary from about 10 nucleotides up to a length equaling the length (in nucleotides) of the apoptosis- inhibiting polynucleotide. Generally, the length of the targeting region is at least 10, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 nts, usually at least about 50 nts, more usually at least about 100 nts, especially at least about 150 nts, more especially at least about 200 nts, even more especially at least about 500 nts. It is expected that there is no upper limit to the total length of the targeting region, other than the total length of the apoptosis-inhibiting polynucleotide. However for practical reason (such as e.g. stability of the constructs described herein) it is expected that the length of the targeting region should not exceed 5000 nts, particularly should not exceed 2500 nts and could be limited to about 1000 nts.

[0103] The RNA molecule may further comprise one or more other targeting regions (e.g., from about 1 to about 10, or from about 1 to about 4, or from about 1 to about 2 other targeting regions) each of which has sequence identity with a nucleotide sequence of the apoptosis-inhibiting polynucleotide. Generally, the targeting regions are identical or share at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% sequence identity with each other. [0104] In some embodiments, PTGS of the apoptosis-inhibiting polynucleotide is achieved using the strategy of Glassman et al., described in U.S. Patent Application Publication No 2003/0036197. In this strategy, suitable nucleic acid sequences and their reverse complement can be used to alter the expression of any homologous, endogenous target RNA (e.g., a target RNA defining an expression product of the apoptosis-inhibiting polynucleotide) which is in proximity to the suitable nucleic acid sequence and its reverse complement. The suitable nucleic acid sequence and its reverse complement can be either unrelated to any endogenous RNA in the plant cell or can be encoded by any nucleic acid sequence in the nucleome of the plant cells provided that nucleic acid sequence does not encode any target RNA or any sequence that is substantially similar to the target RNA. Thus, in some embodiments of the present invention, the RNA molecule further comprises two complementary RNA regions which are unrelated to any endogenous RNA in the plant cells and which are in proximity to the targeting region. In other embodiments, the RNA molecule further comprises two complementary RNA regions which are encoded by any nucleic acid sequence in the nucleome of the plant cells provided that the sequence does not have sequence identity with the nucleotide sequence of the apoptosis-inhibiting polynucleotide, wherein the regions are in proximity to the targeting region. In the above embodiments, one of the complementary RNA regions can be located upstream of the targeting region and the other downstream of the targeting region. Alternatively, both the complementary regions can be located either upstream or downstream of the targeting region or can be located within the targeting region itself.

[0105] In some embodiments, the proposed apoptosis-inhibiting polynucleotides of the invention can be "knocked out" using targeted homologous recombination. See, for example, Kempin et al., 1997, Nature, 389:802; Smithies et al., 1985, Nature, 317:230 234; Thomas and Capecchi, 1987, Cell, 51:503 512; and Thompson et al., 1989, Cell, 5:313 321. In a related embodiment, the modulator polynucleotide comprises a nucleic acid sequence encoding a site specific recombinant protein. The site-specific recombinase protein may include components of any recombinant system that mediates nucleic acid rearrangements in a specific nucleic acid locus, including site specific recombinases of the integrase or resolvase/invertase classes Abremski et ah, (1992, Protein Engineering, 5:87-91) and site-specific recombination mediated by intron-encoded endonucleases Perrin et al., (1993, EMBO J. 12:2939-2947). Suitable site-specific recombinase proteins may be selected from the group comprising FLP recombinase, Cre recombinase, R recombinase from the Zygosaccharomyces rouxii plasmid pSRl, a recombinase from the Kluyveromyces drosophilarium plasmid pKDl, a recombinase from the Kluyveromyces waltii plasmid pKWl, any component of the Gin recombination system, the specific DNA binding component of the recombinase complex or the enzyme component of the recombinase complex. Typically, in these embodiments, the site specific recombinase protein is produced from a separate construct from which a modulator polynucleotide that encodes the recombinase protein is regulatably expressed. In some embodiments, the expression of the recombinase-encoding polynucleotide is regulated using a regulatable or inducible promoter as described for example below or a polynucleotide that attenuates or otherwise disrupts the expression of the recombinase-encoding polynucleotide by PTGS. In other embodiments, the site-specific recombinase protein is a fusion protein, comprising the recombinase protein or a component of the recombinase complex, fused to part or all of a nuclear receptor, such that the amino acids that encode the ligand- binding regions of the nuclear receptor are included. In this way, in the plant cells in which the recombinase fusion protein is expressed, the activity of the recombinase is controlled by the presence of the ligand for the nuclear receptor. In certain embodiments, the site-specific recombinase fusion protein comprises Cre recombinase flanked by two loxP sites (i.e., a Cre/loxP expression system). Such an expression system comprises the DNA recombinase enzyme derived from E. coli Pl phage, which is flanked by two loxP sites in direct orientation. The loxP DNA sequence is derived from E. coli Pl phage, which has the following 34 bp DNA nucleotide sequence: 5'- ATAACTTCGTATAGCATA CATTATACGAAGTTAT-3'. Suitably, the Cre recombinase fusion protein ligand-binding domain allows the activity of expressed Cre recombinase to be inhibited in the absence of ligand binding to the ligand binding domain, and wherein the inhibition of the Cre recombinase activity in relation to the loxP sites is relieved by binding of the ligand to the ligand-binding domain. [0106] An alternative to post-transcriptional gene silencing may involve transcriptional gene silencing using a disaggregated ssDNA (geminivirus or nanovirus) silencing system. Plant single stranded DNA (ssDNA) viruses replicate by rolling circle replication where the virus encodes a Replication initiation protein (Rep protein) which directs the replication of ssDNA. The plant host provides the DNA polymerase machinery. The Rep protein recognizes its cognate intergenic region to which it binds, initiating replication within the highly conserved loop sequence of the stem/loop structure. This initiation can occur in either the cis or trans orientation and, furthermore, all viral sequences other than the intergenic region(s) and the Rep protein can be dispensed with for replication and can be replaced by heterologous sequences of virtually any origin. Several vector systems have been disclosed based on geminiviruses including those based on: African cassava mosaic virus, Fofana et al., (2004, Plant MoI. Biol, 56(4):613-624); Cabbage leaf curl virus, Turnage et al., (2002, Plant J., 30(l):107-l 14); Tomato golden mosaic virus, and Kjemtrup et al., (1998, Plant J., 14(l):91-100). In each of these examples, foreign DNA, either transgenes or plant genes, are inserted into the viral DNA and plants or plant cells infected with the vector. In each instance, the plant or transgene is effectively silenced and there is clear evidence that DNA methylation is at least partly responsible for the observed gene silencing. In this regard, Seemanpillai et al, (2003, MoI. Plant Microbe Interact., 16(5):429-438) have demonstrated that geminiviruses can be very effective agents for transcriptional gene silencing, using tobacco transformed with a GUS transgene under the control of the Tomato leaf curl virus (TLCV) coat protein promoter. Upon infection of these plants with TLCV, the transgene is silenced by hypermethylation of DNA.

[0107] Accordingly, in some embodiments, a system is used in which an expression cassette that comprises an apoptosis-inhibiting polynucleotide operably connected to a regulatory element, is flanked by intergenic regions of a geminivirus (e.g., the intergenic regions of tobacco yellow dwarf virus (TYDV)) to form a chimeric construct that is stably integrated into the nucleome of plants cells. Expression of the Rep protein in these cells causes formation of episomes and rolling circle replication of the apoptosis-inhibiting polynucleotide, which causes transient expression of that polynucleotide. After a brief period, this expression is silenced. An exemplary embodiment of this system is disclosed in International Publication No. WO 01/72996. The inventors have demonstrated that such episomes will be replicated in banana embryogenic cells for up to 20 days (Horser et ai, 2001, J Gen. Virol., 82(2):459-464; and Horser et al., 2001, Arch. Virol, 146(l):71-86) and that TYDV derived vectors are replicated for example, in tobacco cells, banana cells and sugarcane cells. Accordingly, once introduced into plant cells, episomes expressing the apoptosis-inhibiting polynucleotide of the invention can be replicated for up to 20 days, which is considered to provide sufficient time to inhibit apoptosis of the plant cells, which is caused, for example, by infection with A. tumefaciens during Agrobacterium-mediated transformation. Inhibition or silencing of apoptosis can be initiated through the high level of replication of the transgenes, both Rep and the anti-apoptosis transgenes, which become methylated leading to transcriptional silencing of both sequences.

4. Polynucleotides of interest

[0108] The polynucleotide of interest may be an endogenous polynucleotide that is found naturally in the genome of the host plant cells. Alternatively, the polynucleotide of interest is a recombinant or artificial nucleic acid that has been or is about to be introduced into the nucleome of the host plant cells. Typically, the polynucleotide of interest is selected from 1) genes that are both transcribed into mRNA and translated into polypeptides as well as (2) genes that are only transcribed into RNA {e.g., functional RNA molecules such as rRNA, tRNA, RNAi, ribozymes and antisense RNA). [0109] In some embodiments, the polynucleotide of interest encodes a polypeptide for commercial manufacture, where the polypeptide is extracted or purified from the host plant, host plant cell or host plant part. Such polypeptides include, but are not limited to, polypeptides involved in the biosynthesis of antibiotics or secondary metabolites, immunogenic molecules for use in vaccines, cytokines and hormones. [0110] In other embodiments, the polynucleotide of interest encodes a product conferring a beneficial property to the host or other advantageous characteristic including, but not limited to, herbicide resistance or tolerance {e.g., glyphosate resistance or glufosinate resistance), stress tolerance {e.g., salt tolerance), sterility, improved food content or increased yields {e.g., a product affecting starch biosynthesis or modification such as starch branching enzymes, starch synthases, ADP-glucose pyrophosphorylase, products involved in fatty acid biosynthesis such as desaturases or hydroxylases and products altering sucrose metabolism such as invertases, sucrose isomerases or sucrose synthases) as well as disease resistance or tolerance {e.g. , resistance to bacterial, viral, nematode, helminth, insect, protozoan or viral pathogens, a product conferring insect resistance such as crystal toxin protein of Bacillus thuringiensis; a product conferring viral resistance such as a viral coat or capsid protein; a product conferring fungal resistance such as chitinase, β-l,3-glucanase or phytoalexins).

5. Constructs

[0111] The apoptosis-inhibiting polynucleotides, the polynucleotides of interest and the modulatory polynucleotides as broadly described above are typically operably connected to a regulatory element (e.g. , a promoter and a 3' non-translated region) that is functional in plant cells to create a nucleic acid construct, designed for genetic transformation of plants.

5.1 Promoters

[0112] Promoters contemplated by the present invention may be native to the plant or may be derived from an alternative source, where the promoter is functional in the plant. The selection of a particular promoter depends on the cell type used to express the desired polynucleotide. Numerous promoters that are active in plant cells have been described in the literature, illustrative examples of which include the nopaline synthase (NOS) promoter, the octopine synthase (OCS) promoter (which is carried on tumor- inducing plasmids of Agrobαcterium tumefaciens), the caulimovirus promoters such as the cauliflower mosaic virus (CaMV) 19S promoter and the CaMV 35S promoter, the figwort mosaic virus 35S-promoter, the light-inducible promoter from the small subunit of ribulose-l,5-bis-phosphate carboxylase (ss RUBISCO), the Adh promoter, the sucrose synthase promoter, the R gene complex promoter, the GST-II-27 gene promoter and the chlorophyll a/b binding protein gene promoter, etc.

[0113] For the purpose of expression in source tissues of the plant, such as the leaf, seed, root or stem, it is sometimes desirable that the promoters driving expression of a particular gene have relatively high expression in these specific tissues. For this purpose, one may choose from a number of promoters for genes with tissue- or cell-specific or enhanced expression. Examples of such promoters include the chloroplast glutamine synthetase GS2 promoter from pea, the chloroplast fructose- 1,6- biphosphatase (FBPase) promoter from wheat, the nuclear photosynthetic ST-LS 1 promoter from potato, the serine/threonine kinase (PAL) promoter and the glucoamylase (CHS) promoter from Arabidopsis thaliana. Also reported to be active in photosynthetically active tissues are the ribulose-l,5-bisphosphate carboxylase (RbcS) promoter from eastern larch (Larix laricina), the promoter for the cab gene, cabό, from pine, the promoter for the Cab-1 gene from wheat, the promoter for the CAB-I gene from spinach, the promoter for the cab IR gene from rice, the pyruvate, orthophosphate dikinase (PPDK) promoter from corn, the promoter for the tobacco Lhcbl *2 gene, the Arabidopsis thaliana SUC2 sucrose-H+ symporter and the promoter for the thylakoid membrane proteins from spinach (psaD, psaF, psaE, PC, FNR, atpC, atpD, cab, rbcS). Other promoters for the chlorophyll a/b-binding proteins may also be utilised in the invention, such as the promoters for LhcB gene and PsbP gene from white mustard.

[0114] For the purpose of expression in sink tissues of the plant, such as the tuber of the potato plant, the fruit of tomato, or the seed of corn, wheat, rice and barley, it is desirable that the promoters driving expression of the gene of interest have relatively high expression in these specific tissues. A number of promoters for genes with tuber-specific or tuber-enhanced expression are known, including the class I patatin promoter, the promoter for the potato tuber ADPGPP genes, both the large and small subunits, the sucrose synthase promoter, the promoter for the major tuber proteins including the 22 kd protein complexes and protease inhibitors, the promoter for the granule-bound starch synthase gene (GBSS) and other class I and II patatins promoters.

[0115] Other promoters can also be used to express a selected polynucleotide sequence in specific tissues, such as seeds or fruits. Examples of such promoters include the 5' regulatory regions from such genes as napin, phaseolin, soybean trypsin inhibitor, ACP, stearoyl-ACP desaturase, soybean α' subunit of β-conglycinin (soy 7s), and oleosin. Further examples include the promoter for β-conglycinin. Also included are the zeins, which are a group of storage proteins found in corn endosperm. Genomic clones for zein genes have been isolated and the promoters from these clones, including the 15 kD, 16 kD, 19 kD, 22 kD, 27 kD and genes, could also be used. Other promoters known to function, for example, in corn include the promoters for the following genes: waxy, Brittle, Shrunken 2, Branching enzymes I and II, starch synthases, debranching enzymes, oleosins, glutelins and sucrose synthases. Examples of promoters suitable for expression in wheat include those promoters for the ADP glucose pyrosynthase (ADPGPP) subunits, the granule bound and other starch synthase, the branching and debranching enzymes, the embryogenesis-abundant proteins, the gliadins and the glutenins. Examples of such promoters in rice include those promoters for the ADPGPP subunits, the granule bound and other starch synthase, the branching enzymes, the debranching enzymes, sucrose synthases and the glutelins. Examples of such promoters for barley include those for the ADPGPP subunits, the granule bound and other starch synthase, the branching enzymes, the debranching enzymes, sucrose synthases, the hordeins, the embryo globulins and the aleurone specific proteins.

[0116] Root specific promoters may also be used. An example of such a promoter is the promoter for the acid chitinase gene. Expression in root tissue could also be accomplished using the root specific subdomains of the CaMV35S promoter that have been identified.

[0117] Examples of constitutive plant promoters useful for expressing genes in plant cells include, but are not limited to, the cauliflower mosaic virus (CaMV) 35S promoter, maize ubiquitin (JJbi-1) promoter, rice actin {Act) promoter, nopaline synthase promoter, the 1'- or 2'-promoter derived from tDNA of A. tumefaciens and the octopine synthase promoter. A variety of plant gene promoters that are regulated in response to environmental, hormonal, chemical, and/or developmental signals to name but a few can also be used for expression of foreign genes in plant cells, including promoters regulated by heat (e.g. , heat shock promoters, Hsp70), light (e.g. , pea rbcS- 3A or maize rbcS promoters or chlorophyll a/b-binding protein promoter); phytohormones, such as abscisic acid or hormones such as estrogen (ERE); wounding (e.g., wunl); anaerobiosis (e.g., Adh); and chemicals such as methyl jasminate, salicylic acid, or safeners (elnl). It may also be advantageous to employ well-known organ- specific promoters such as endosperm-, embryo-, root-, phloem-, or trichome-specific promoters, for example.

[0118] In some embodiments, the apoptosis-inhibiting polynucleotide and/or the polynucleotide of interest are conditionally expressible, for example through the use of an inducible promoter. In essence, transcription or expression under the control of an inducible promoter is "stimulated" or increased in response to an applied stimulus. The nature of the stimulus varies between promoters. Some inducible promoters cause little or undetectable levels of expression of the polynucleotide in the absence of the appropriate stimulus. Other inducible promoters cause detectable constitutive expression in the absence of the stimulus. Whatever the level of expression is in the absence of the stimulus, expression from any inducible promoter is increased in the presence of the correct stimulus. [0119] There are a number of chemically inducible promoter systems that have been developed for plants. Illustrative examples of such promoters include but are not limited to the ethanol inducible promoter system, Felenbok, (1991, J Biotechnol, 17(1):11-17), the glucocorticoid inducible promoter system, Aoyama and Chua, (1997, Planta, 213(3):370-378) which has already been used to control the expression of a pro- apoptosis gene in Arabidopsis protoplasts and the methoxyfenozide inducible promoter system, Padidam et ah, (2003, Transgenic Res, 12(1): 101 -109). Chemically inducible promoters function in such a way that expression is switched on in the presence of the inducer, the inducer does not have a negative effect on the tissue to be transformed and there is no expression in the absence of the inducer. An alternative to a chemically inducible promoter system is a system wherein the promoter is repressed by a stimulus, and once the stimulus is removed, expression of the operably connected sequence is switched on. Examples of such a system include the Saccharomyces cerevisiae JENl promoter, which is repressed in the presence of certain sugars such as glucose, fructose and mannose (Chambers et ah, 2004, Applied. Enviro. Microbiol., 70(l):8-17). [0120] Inducible promoters may also be selected from environmentally inducible promoters including, but not limited to, the light-inducible promoter from the small subunit of ribulose-l,5-bis-phosphate carboxylase (ss RUBISCO); the drought- inducible promoter of maize (Buske? al, 1997, Plant J., 11:1285-1295), the cold, drought, and high salt inducible promoter from potato (Kirch, 1997, Plant MoI. Biol. ,33: 897-909), and many cold inducible promoters known in the art; for example rd29a and corl5a promoters from Arabidopsis (GenBank ID: D13044 and U01377), bltlOl and blt4.8 from barley (GenBank ID: AJ310994 and U63993), wcsl20 from wheat (GenBank ID:AF031235), mlipl5 from corn (GenBank ID: D26563) and bnl 15 from Brassica (Genbank ID: UOl 377). [0121] Examples of promoters under developmental control include promoters that initiate transcription preferentially in certain tissues, such as leaves, roots, fruit, seeds, or flowers. An exemplary promoter is the anther specific promoter 5126 (U. S. Patent Nos. 5,689,049 and 5,689,051). Examples of seed-preferred promoters include, but are not limited to, 27 kD gamma zein promoter and waxy promoter as described in: Boronat, A, et al, (1986, Plant 5"c/.,47:95-102; Reina, M, et al, 1990, Nucleic Acids Res., 18 (21):6426 and; Kloesgen, R. B, et al, 1986, MoI. Gen. Genet., 203:237-244). The disclosures of each of these are incorporated herein by reference in their entirety.

[0122] The barley or maize Nucl promoter, the maize Cim 1 promoter or the maize LTP2 promoter can be used to preferentially express in the nucleus. See for example WO 00/11177 and U. S. Application number 6,225,529 (2001). [0123] Either heterologous or non-heterologous (/. e. , endogenous) promoters can be employed to direct expression of the nucleic acids of the present invention.

5.2 3' Non-translated region

[0124] The constructs of the present invention can comprise a 3' non- translated sequence. A 3' non-translated sequence refers to that portion of a gene comprising a DNA segment that contains a polyadenylation signal and any other regulatory signals capable of effecting mRNA processing or gene expression. The polyadenylation signal is characterized by effecting the addition of polyadenylic acid tracts to the 3' end of the mRNA precursor. Polyadenylation signals are commonly recognized by identity with the canonical form 5' AATAAA-3' although variations are not uncommon.

[0125] The 3' non-translated regulatory DNA sequence suitably includes from about 50 to 1,000 nucleotide base pairs and may contain plant transcriptional and translational termination sequences in addition to a polyadenylation signal and any other regulatory signals capable of effecting mRNA processing or gene expression. Examples of suitable 3' non-translated sequences are the 3' transcribed non-translated regions containing a polyadenylation signal from the nopaline synthase (nos) gene of Agrobacterium tumefaciens (Bevan et al, 1983, Nucl. Acid Res., 11:369) and the terminator for the T7 transcript from the octopine synthase gene of Agrobacterium tumefaciens. Alternatively, suitable 3' non-translated sequences may be derived from plant genes such as the 3' end of the protease inhibitor I or II genes from potato or tomato, the soybean storage protein genes and the pea E9 small subunit of the ribulose- 1,5-bisphosphate carboxylase (ss RUBISCO) gene, although other 3' elements known to those of skill in the art can also be employed. Alternatively, 3' non-translated regulatory sequences can be obtained de novo as, for example, described by An (1987, Methods in Enzymology, 153:292).

5.3 Optional sequences [0126] The nucleic acid constructs of the present invention can further include enhancers, either translation or transcription enhancers, as may be required. These enhancer regions are well known to persons skilled in the art, and can include the ATG initiation codon and adjacent sequences. The initiation codon must be in phase with the reading frame of the coding sequence relating to the foreign or endogenous DNA sequence to ensure translation of the entire sequence. The translation control signals and initiation codons can be of a variety of origins, both natural and synthetic. Translational initiation regions may be provided from the source of the transcriptional initiation region, or from the foreign or endogenous DNA sequence. The sequence can also be derived from the source of the promoter selected to drive transcription, and can be specifically modified so as to increase translation of the mRNA.

[0127] Examples of transcriptional enhancers include, but are not restricted to, elements from the CaMV 35S promoter and octopine synthase genes as for example described by Last et al. (U.S. Patent No. 5,290,924). It is proposed that the use of an enhancer element such as the ocs element, and particularly multiple copies of the element, will act to increase the level of transcription from adjacent promoters when applied in the context of plant transformation. Alternatively, the omega sequence derived from the coat protein gene of the tobacco mosaic virus (Gallie et al, 1987, Nucleic Acids Res. 15(8):3257-73) may be used to enhance translation of the mRNA transcribed from a polynucleotide according to the invention. [0128] As the DNA sequence inserted between the transcription initiation site and the start of the coding sequence, /. e. , the untranslated leader sequence, can influence gene expression, one can also employ a particular leader sequence. Preferred leader sequences include those that comprise sequences selected to direct optimum expression of the R polypeptide gene. For example, such leader sequences include a preferred consensus sequence which can increase or maintain mRNA stability and prevent inappropriate initiation of translation as for example described by Joshi (1987, Nucl. Acid Res., 15:6643). However, other leader sequences, e.g., the leader sequence of RTBV, have a high degree of secondary structure that is expected to decrease mRNA stability and/or decrease translation of the mRNA. Thus, leader sequences (i) that do not have a high degree of secondary structure, (ii) that have a high degree of secondary structure where the secondary structure does not inhibit mRNA stability and/or decrease translation, or (iii) that are derived from genes that are highly expressed in plants, will be most preferred.

[0129] Regulatory elements such as the sucrose synthase intron as, for example, described by Vasil et al. (1989, Plant Physiol. , 91:5175), the Adh intron I as, for example, described by Callis et al. (1987, Genes Develop., II), or the TMV omega element as, for example, described by Gallie et al. (1989, The Plant Cell, 1:301) can also be included where desired. Other such regulatory elements useful in the practice of the invention are known to those of skill in the art.

[0130] Additionally, targeting sequences may be employed to target a polypeptide product of the apoptosis-inhibiting polynucleotide or of the polynucleotide of interest or of the modulator polynucleotide to an intracellular compartment within plant cells or to the extracellular environment. For example, a DNA sequence encoding a transit or signal peptide sequence may be operably linked to a sequence encoding a polypeptide product as described above such that, when translated, the transit or signal peptide can transport the polypeptide product to a particular intracellular or extracellular destination, and can then be post-translationally removed. Transit or signal peptides act by facilitating the transport of proteins through intracellular membranes, e.g., endoplasmic reticulum, vacuole, vesicle, plastid, mitochondrial and plasmalemma membranes. For example, the targeting sequence can direct a desired protein to a particular organelle such as a vacuole or a plastid {e.g., a chloroplast), rather than to the cytosol. Thus, the nucleic acid construct can further comprise a plastid transit peptide encoding DNA sequence operably linked between a promoter region or promoter variant according to the invention and the foreign or endogenous DNA sequence. For example, reference may be made to Heijne et al. (1989, Eur. J. Biochem., 180:535) and Keegstra et al. (1989, Ann. Rev. Plant Physiol. Plant MoI. Biol, 40:471). [0131] The nucleic acid construct is typically introduced into a vector, such as a plasmid. Plasmid vectors include additional DNA sequences that provide for easy selection, amplification, and transformation of the expression cassette in prokaryotic and eukaryotic cells, e.g., pUC-derived vectors, pSK-derived vectors, pGEM-derived vectors, pSP-derived vectors, or pBS-derived vectors. Additional DNA sequences include origins of replication to provide for autonomous replication of the vector, selectable marker genes, preferably encoding antibiotic or herbicide resistance, unique multiple cloning sites providing for multiple sites to insert DNA sequences or genes encoded in the nucleic acid construct, and sequences that enhance transformation of prokaryotic and eukaryotic cells.

[0132] The vectors may contains one or more element(s) that permit either stable integration of the vector into the host cell genome or autonomous replication of the vector in the cell independent of the genome of the cell. The vector may be integrated into the host cell genome when introduced into a host cell. For integration, the vector may rely on a foreign or endogenous DNA sequence present therein or any other element of the vector for stable integration of the vector into the genome by homologous recombination. Alternatively, the vector may contain additional nucleic acid sequences for directing integration by homologous recombination into the genome of the host cell. The additional nucleic acid sequences enable the vector to be integrated into the host cell genome at a precise location in the chromosome. To increase the likelihood of integration at a precise location, the integrational elements should preferably contain a sufficient number of nucleic acids, such as 100 to 1,500 base pairs, preferably 400 to 1,500 base pairs, and most preferably 800 to 1,500 base pairs, which are highly homologous with the corresponding target sequence to enhance the probability of homologous recombination. The integrational elements may be any sequence that is homologous with the target sequence in the genome of the host cell. Furthermore, the integrational elements may be non-encoding or encoding nucleic acid sequences.

[0133] For cloning and subcloning purposes, the vector may further comprise an origin of replication enabling the vector to replicate autonomously in a host cell such as a bacterial cell. Examples of bacterial origins of replication are the origins of replication of plasmids pBR322, pUC19, pACYC177, and pACYC184 permitting replication in E. coli, and pUBl 10, pE194, pTA1060, and pAMβl permitting replication in Bacillus. The origin of replication may be one having a mutation to make its function temperature-sensitive in a Bacillus cell (see, e.g., Ehrlich, 1978, Proc. Natl.

Acad. ScL C/&4, 75:1433). [0134] A number of vectors suitable for stable transformation of plant cells or for the establishment of transgenic plants have been described in, for example see; Gelvin et al, (1990, Plant Molecular Biology Manual Plant Biotechnology: Commercial Prospects and Problems, eds). Typically, plant expression vectors include, for example, one or more cloned plant sequences under the transcriptional control of 5' and 3' regulatory sequences and a dominant selectable marker. However, the selectable marker will not be required, as the invention comprises a system which does not require selection of transformed plants with the polynucleotide or polypeptide of interest through the use of marker genes. Such plant expression vectors can also contain a promoter regulatory region {e.g., a regulatory region controlling inducible or constitutive, environmentally, or developmentally-regulated, or cell- or tissue-specific expression), a transcription initiation start site, a ribosome binding site, an RNA processing signal, a transcription termination site, and/or a polyadenylation signal. However, if the vector does comprise a selectable marker gene, it can still be used in the methods described above without using the marker gene to identify the transformed plant cells.

[0135] Plant expression vectors optionally include RNA processing signals, e.g., introns, which may be positioned upstream or downstream of a polypeptide- encoding sequence in the transgene. In addition, the expression vectors may also include additional regulatory sequences from the 3' non-translated region of plant genes, e.g., a 3' non-translated region to increase mRNA stability of the mRNA, such as the PI- II terminator region of potato or the octopine or nopaline synthase 3' non-translated regions.

[0136] Vectors suitable for the transfer of multiple genes are also well known in the art and include for example; Ye, et al , (2000, Science, 28:303-305).

[0137] The construction of such vectors which can be employed in conjunction with the present invention is well known in the art and examples include but are not restricted to: Sambrook et al, (1989, Molecular Cloning: A Laboratory Manual; Cold Spring Harbor, New York); Gelvin et al, (1990, Supra); Prakash et al, (1993, Oxford & IBH Publishing Co. New Delhi, India) and; Heslot et al , (1992, Molecular Biology and Genetic Engineering of Yeasts, CRC Press, Inc., USA) each incorporated herein in its entirety by reference. [0138] In some embodiments, typical vectors useful for expression of genes in higher plants include vectors derived from the tumor-inducing (Ti) plasmid of Agrobacte^ήum tumefaciens described by Rogers et ah, (1987, Methods in Enzymology, 153:253-277). A typical binary vector system may comprise an octopine-type vir helper strain such as LBA4404 that harbors the disarmed Ach5 Ti plasmid and a binary vector such as pBinl9 which is commonly used for plant transformation. The available range of vir helper strains has been expanded with the nopaline-type MP90 and the L, L- succinamopine-type EHAlOl. The bacterial kanamycin resistance gene in EHAlOl was deleted to develop the vir helper strain EHA105, EHAlOl and EHA105. Popular A. tumefaciens vectors in the art include but are not restricted to plasmids pKYLXό and pKYLX7 of Schardl et ah, (1987, Gene, 61:1-11) and; Berger et ah, (1989, Proc. Natl. Acad. Sci. USA, 86:8402-8406).

[0139] In addition, the vector can be linearized prior to its introduction into plant cells for the purposes of genetically modifying cellular endogenous genomic sequences as linear vectors exhibit significantly higher targeting frequencies than those that are circular (Thomas et ah, 1986, Cell, 44:49). It is, however, possible to successfully utilize vectors for these purposes without linearization.

[0140] An exemplary high expression vector system that may be used to practice the methods of the present invention is the InPACT system (International Publication No. WO 01/72996, Dale et ah, 2001). In this system, a chosen gene sequence (e.g., the polynucleotide of interest or the anti-apoptosis polynucleotide or the modulator polynucleotide) is operably flanked by nucleotide sequences representing "intergenic regions" of a geminivirus, which are recognized by a viral-derived replicating protein (REP). When the gene, flanked by such sequences is integrated into the genome of a plant, the Rep protein facilitates excision and circularization of the gene and the intergenic regions. The system has two fundamental features: the gene to be expressed is split such that exon 1 is 3' of exon 2 and separated by the terminator sequence and the promoter sequence respectively, and the intergenic regions incorporating the stem/loop sequences and the interons are embedded in introns. As an integrated sequence, this "split gene construct" does not express the encoded gene. However, in the presence of REP, the sequence is released by replicative release to become an episomal single stranded DNA molecule. This ssDNA molecule is converted into a transcriptionally active double stranded DNA molecule by the host and the gene is transcribed. The intergenic region which is embedded in the intron located between exons 1 and 2 is processed out and the gene product is expressed. Thus, this strategy provides an expression platform where there is no expression in the absence of REP, but high expression levels in the presence of REP, as not only will the first copied ssDNA molecule by produced by replicative release, but this molecule itself can be further replicated by REP, providing an in vivo amplification system.

6. Introduction of polynucleotides into plant cells

[0141] In accordance with the present invention, the polynucleotide of interest is introduced into plant cells using Agrobacterium-mediated transformation. The apoptosis-inhibiting polynucleotide and the modulator polynucleotide/polypeptide may also be introduced into the plant cells using this method; however, this is not essential and other methods may be used.

6.1 Agrobacterium-mediated transformation

[0142] Agrobαcterium species such as A. tumefαciens and A. rhizogenes are capable of infecting a wide range of plant species, causing Crown Gall diseases. The Agrobαcterium has natural transformation abilities which can be exploited in plant biotechnology techniques. For practical reasons the introduction of new genes in the T- region by means of recombinant DNA techniques are often carried out in Escherichia coli. However, the Ti plasmids normally cannot be maintained in E. coli, since it does not replicate in this host. Therefore, in the existing procedures well known in the art, a so-called shuttle vector is used which replicated in E. coli and A. tumefaciens and into which the T-region is introduced. Subsequently new genes are introduced into this T region for transformation into a plant cell. The complete Ti plasmid is necessary in order to transform cells via the method of Agrobacterium-mediated transformation, since the Ti plasmid contains the essential Vir-region on which genes are positioned for selection of T-DNA and transfer into a plant cell.

[0143] In Agrobacterium-mediated transformation plant tissues are typically cut in small pieces, e.g., 10 x 10mm, and soaked for 10 minutes in a fluid containing suspended Agrobαcterium. Some cells along the cut tissue will be transformed by the bacterium that inserts its DNA into the nucleome of the cell. Placed on selectable rooting and shooting media, the plants will regrow from the transformed cells or tissues. Some plants species can be transformed just by dipping the unopened flowers into suspension of agrobacteria and then planting the seeds in a selective medium.

6.1.1 Vacuum Infiltration

[0144] Vacuum infiltration, Logemann, E et al. , (2006, Plant Methods, 24(2): 16) allows the penetration of pathogenic bacteria into the inter cell spaces of plant tissues. Physically, the vacuum generates a negative atmospheric pressure that causes the air spaces between the cells in the plant tissue to decrease. The longer the duration and the lower the pressure of the vacuum, the less air space within the plant tissue. The increase in the pressure allows the infiltration medium, including the infective transformation vector to relocate into the plant tissue. For plant transformation, vacuum is applied to a plant part in the presence of Agrobacteήum for a certain time period. The length of time that a plant part or tissue is exposed to vacuum is critical as prolonged exposure causes hyperhydricity.

[0145] Vacuum infiltration-facilitated transformation can be performed in planta, in which the plant part to be transformed, e.g. flower, is not excised from the plant, thus eliminating in vitro regeneration of plants. It also offers other several advantages such as the generation of many independently transformed plants from a single plant, a reduction in somaclonal variation by avoiding tissue culture steps, the possibility of testing many constructs in a short time frame as the process is in itself fast, and is potentially useful for transformation of plants recalcitrant to plant tissue culture and regeneration.

6.1.2 Floral Dip

[0146] The floral-dip method is well known in the art, Clough and Bent, (1998, Plant J, 16(6):735-743) and is a very efficient method for generating a number of transgenic plants, not limited to but including for example Arabidopsis thaliana plants. These methods allow plant transformation without the need for tissue culture. A large volume of bacterial culture grown in liquid media is necessary for this transformation method.

[0147] Floral dipping comprises the method of dipping floral tissues into a solution containing Agrobacterium tumefaciens, 5% sucrose and 500 μL / L of surfactant Silwet L-77. Sucrose and surfactant are critical to the success of the floral dip method. Plants inoculated with numerous immature floral buds and few siliques present produce transformed progeny at the highest rate. Plant tissue culture media, the hormone benzylaminopurine and pH adjustments are not necessary for transformation, and Agrobacterium can be applied to plants at a range of cell densities. The application step of Agrobacterium dipping may be repeated and may improve transformation rates and the overall yield of transformants by approximately twofold. Covering plants for 1 day to retain humidity after inoculation also raises transformation rates twofold.

6.1.3 Other methods

[0148] Another useful Agrobacterium transformation protocol involves a combination of wounding by particle bombardment, followed by use of Agrobacterium for DNA or protein delivery Bridney et al. (1992, Plant MoI. Biol, 18:301-313). Further methods include but are not restricted to the split meristem method, the regeneration of plants from leaf explants Horsch et al, (1985, Science, 227:1229-1231).

[0149] Alternatively, an Agrobacterium transformation protocol, as described by Khanna et al (2004, MoI. Breed., 14: 239-252) and International Publication No. WO 02/12521 can be used, which involves centrifugation and heat treatment.

6.2 Methods of introducing the Anti-apoptosis or modulator polynucleotides into plant cells

[0150] In some embodiments, the apoptosis-inhibiting polynucleotide or modulator polynucleotide of the invention are introduced into plant tissues or plant cells by any number of routes, including microinjection, electroporation and particle bombardment acceleration methods, illustrative examples of which include microinjection (Crossway et al, 1986, Biotechniques 4:320-334), electroporation (Riggs et al, 1986, Proc. Natl. Acad ScL USA, 83:5602-5606), and ballistic particle acceleration (see, for example, Sanford et al, U.S. Pat. No. 4,945,050; Tomes et al, U.S. Pat. No. 5,879,918; Tomes et al, U.S. Pat. No. 5,886,244; Bidney et al, U.S. Pat. No. 5,932,782; Tomes et al (1995) "Direct DNA Transfer into Intact Plant Cells via Microprojectile Bombardment," in Plant Cell, Tissue, and Organ Culture: Fundamental Methods, ed. Gamborg and Phillips (Springer- Verlag, Berlin); and McCabe et al , (1988, Biotechnology 6:923-926). Also see Weissinger et al (1988 Ann. Rev. Genet. 22:421-477), Sanford et al, (1987, Particulate Science and Technology 5:27-37; onion), Christou et al, (1988, Plant Physiol. 87:671-674; soybean); Datta et al, (1990, Biotechnology 8:736-740; rice), Klein et al (1988, Proc. Natl. Acad. Sci. USA 85:4305- 4309, maize), Hooykaas-Van Slogteren et al (1984, Nature (London) 311:763-764; cereals), Bowen et al, (U.S. Pat. No. 5,736,369; cereals), Bytebier et al, (1987, Proc. Natl Acad. Sci. USA 84:5345-5349; Liliaceae), De Wet et al (1985, in The Experimental Manipulation of Ovule Tissues, ed. Chapman et al. (Longman, N. Y.), pp. 197-209; pollen), Kaeppler et al, (1990, Plant Cell Reports 9:415-418; 1992, Theor. Appl Genet.84:560-566; whisker-mediated transformation), D'Halluin et al (1992, Plant Cell 4:1495-1505; electroporation); Li et al, (1993, Plant Cell Reports 12:250- 255; rice), Christou and Ford (1995, Annals of Botany 75:407-413; rice) and Osjoda et al (1996, Nature Biotechnology 14:745-750). Transformation techniques that fall within these and other classes are well known to workers in the art, and new techniques are continually becoming known. The particular choice of a transformation technology will be determined by its efficiency to transform certain plant species as well as the experience and preference of the person practicing the invention with a particular methodology of choice. It will be apparent to the skilled person that the particular choice of a transformation system to introduce a construct into plant cells is not essential to or a limitation of the invention, provided it achieves an acceptable level of nucleic acid transfer.

[0151] In these embodiments, recipient plant cells are employed that are susceptible to transformation and subsequent regeneration into stably transformed, fertile plants. For monocot transformation for example, immature embryos, meristematic tissue, gametic tissue, embryogenic suspension cultures or embryogenic callus tissue can be employed as a source of recipient cells which is useful in the practice of the invention. For dicot transformation, organ and tissue cultures can be employed as a source of recipient cells. Thus, tissues, e.g., leaves, seed and roots, of dicots can provide a source of recipient cells useful in the practice of the invention. Cultured susceptible recipient cells are suitably grown on solid supports. Nutrients are provided to the cultures in the form of media and the environmental conditions for the cultures are controlled. Media and environmental conditions which support the growth of regenerable plant cultures are well known to the art. [0152] In principle both dicotyledonous and monocotyledonous plants that are amenable to transformation, can be modified by introducing of the anti-apoptosis and/or modulator constructs of the invention into a recipient plant cell and growing a new plant that harbors the anti-apoptosis and/or modulator constructs. Illustrative transformation methods include electroporation and microprojectile bombardment, to name but a few. Transformation techniques that fall within these and other classes are well known to workers in the art, and the particular choice of a transformation technology will be determined by its efficiency to transform the selected plant species. The anti-apoptosis and/or modulator constructs may be introduced into the plant cells prior to, simultaneous with or after agroinfection-mediated introduction of the polynucleotide of interest. In specific embodiments, the anti-apoptosis and/or modulator constructs are introduced into plant cells prior to the introduction of the polynucleotide of interest. [0153] The methods used to regenerate transformed cells into differentiated plants are not critical to this invention, and any method suitable for a target plant can be employed. Normally, a plant cell is regenerated to obtain a whole plant following a transformation process. Regeneration from protoplasts varies from species to species of plants, but generally a suspension of protoplasts is first made. In certain species, embryo formation can then be induced from the protoplast suspension, to the stage of ripening and germination as natural embryos. The culture media will generally contain various amino acids and hormones, necessary for growth and regeneration. Examples of hormones utilized include auxins and cytokinins. It is sometimes advantageous to add glutamic acid and proline to the medium, especially for such species as corn and alfalfa. Efficient regeneration will depend on the medium, on the genotype, and on the history of the culture. If these variables are controlled, regeneration is reproducible. Regeneration also occurs from plant callus, explants, organs or parts. Transformation can be performed in the context of organ or plant part regeneration as, for example, described in Methods in Enzymology, Vol. 118 and Klee et al, (1987, Annual Review of Plant Physiology, 38:467). Utilizing the leaf disk-transformation-regeneration method of Horsch et al, (1985, Science, 227:1229), disks are cultured on selective media, followed by shoot formation in about 2-4 weeks. Shoots that develop are excised from calli and transplanted to appropriate root-inducing selective medium. Rooted plantlets are transplanted to soil as soon as possible after roots appear. The plantlets can be repotted as required, until maturity is reached.

[0154] In vegetatively propagated crops, the mature transgenic plants are propagated by the taking of cuttings or by tissue culture techniques to produce multiple identical plants. Selection of desirable transgenics is made and new varieties are obtained and propagated vegetatively for commercial use.

[0155] Genetically modified plants derived from plant cells genetically modified through utilization of the expression system of the invention include, but are not limited to, a transgenic TO or RO plant, i.e., the first plant regenerated from transformed plant cells, a genetically modified Tl or Rl plant, i.e., the first generation progeny plant, and progeny plants of further generations derived there from which the first, second and optionally third constructs of the invention in their nucleomes.

[0156] Parts obtained from the regenerated plant, such as flowers, seeds, leaves, branches, fruit, and the like are included in the invention, provided that these parts comprise cells that have been transformed as described. Progeny and variants, and mutants of the regenerated plants are also included within the scope of the invention, provided that these parts comprise the first, second and optionally third constructs of the invention in their cellular nucleome sequences. [0157] It will be appreciated that the literature describes numerous techniques for regenerating specific plant species and more are continually becoming known. Those of ordinary skill in the art can refer to the literature for details and select suitable techniques without undue experimentation. Further more detailed descriptions of the Agrobacterium-mediated transformation techniques for use with this invention are detailed below.

7. Plant tissues capable of transformation

[0158] The present invention may be used for the transformation of any plant species, monocotyledonous and dicotyledonous, including but not limited to corn (Zeamays), Brassica sp. (e.g., B. napus, B. rapa and B. juncea), particularly those Brassica species useful as sources of seed oil, alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secalecerea/e), sorghum (Sorghum bicolor, Sorghum vulgare), sunflower (Helianthus annuus), safflower(Carthamustinctorius), millet (Pennisetumg/aucum, Panicummiliaceum, Eleusinecoracana, Setariaitalica), wheat (Triticumaestivum), soybean (Glycine max), tobacco (Nicotianatabacum), potato (Solanumtuberosum), peanuts (rachis hypogaea), cotton (Gossypiumhirsutum), sweet potato (Ipomoea battus), cassava (Manihotesculenta), coffee (Cofea spp.), coconut (Cocosnucifera), pineapple (Ananascomosus), citrus trees (Citrus spp.), cocoa(Theobroma cacao), tea (Camellia sinensis), banana (Musa spp.), avocado (Perseaamericana), fig (Ficuscasica), guava (Psidiumguajava), mango (Mangiferaindica),olive (Oleaeuropaea), papaya (Carica papaya), cashew(Anacardiumoccidentale), macadamia (Macadamia integrifolia), almond (Prunusamygdalus), sugar beets (Beta vulgaris), oats, barley (Hordeumvulgare), vegetables, ornamentals, and conifers.

[0159] Vegetables include tomatoes (Lycopersiconesculentum), lettuce (e. g., Lactuca sativa), green beans (Phaseolusvulgaris), lima beans (Phaseoluslimensis), peas (Lathyrus spp.), and members of the genusCucumis such as cucumber (C. sativus), cantaloupe (C. cantalupensis), and musk melon (C.me/o). [0160] Ornamentals include azalea (Rhododendron spp.), hydrangea

(Macrophylla hydrangea), hibiscus (Hibiscusrosasanensis), roses (Rosa spp.), tulips (Tulipa spp.), daffodils (Narcissus spp.), petunias (Petunia hybrida), carnation (Dianthus caryophyllus), poinsettia (Euphorbia pulcherrima), and chrysanthemum. Conifers that may be employed in practicing the present invention include, for example, pines such asloblolly pine (Pinustaeda), slash pine (Pinuselliotil), ponderosa pine (Pinus ponderosa), lodgepole pine (Pinuscontorta), and Monterey pine (Pinusradiata);Douglas- fir (Pseudotsugamenziesil); Western hemlock (Tsugacanadensis); Sitka spruce (Piceaglauca); redwood (Sequoia sempervirens); true firs such as silver fir (Abiesamabilis) and balsam fir (Abiesbalsamea); and cedars such as Western red cedar (Thujaplicata) and Alaska yellow-cedar (Chamaecyparisnootkatensis).

[0161] Plants of the present invention include crop plants (for example, corn, alfalfa, sunflower, safflower, canola, soybean, casava, cotton, peanut, sorghum, rice, wheat, millet, tobacco, rye, oats, barley, turf grass, etc.). In one embodiment plants of the present invention include corn, soybean, canola, rice, sunflower, wheat and sorghum plants, and in another corn and soybean plants.

[0162] Plant cells that have been transformed may be grown into plants in accordance with conventional ways, McCornicket al, (1986, Plant Cell Reports, 5:81- 84). Transformed plants may be grown or pollinated with the same transformed strain or different strains and the resulting hybrid having expression of the isolated polynucleotide of interest. Two or more generations may be grown to ensure that the polynucleotide of interest has been inherited if so desired. 8. Transgene analysis

[0163] It is not necessary to identify or select for the presence of a marker gene in a plant cell wherein a polynucleotide of interest has been introduced, since the method of transformation provided by the invention is extremely efficient. However, to confirm the presence of any of the polynucleotides or polypeptides described above in the transformed plant cells or tissues, a variety of assays may be performed. Such assays include but are not restricted to, for example, "molecular biological" assays well known to those of skill in the art, such as Southern and Northern blotting techniques and Polymerase Chain Reaction (PCR) and related DNA amplification techniques. A protein expressed by the heterologous DNA may be analyzed by high performance liquid chromatography or ELISA (e.g., nptll) as is well known in the art.

[0164] In order that the invention may be readily understood and put into practical effect, particular preferred embodiments will now be described by way of the following non-limiting examples.

EXAMPLES

EXAMPLE 1 ELECTROPORATION OF AGROBACTERIUM

Preparation of Competent Cells [00100] Before Agrobacterium can be transformed with a vector which contains a construct of choice, the cells must be made to be competent. Such methods of preparing competent cells are well known in the art and for example include such methods as follows:

[00101] Approximately 500 mL of liquid broth (LB not YEP) can be inoculated with 5 mL of a fresh saturated culture of the appropriate strain of

Agrobacterium. The culture is then incubated at 28° C with vigorous agitation. If the culture is started in the late afternoon, it can be harvested the following morning. When the cells have reached log phase (ODsso 0.5-0.8), the culture can be chilled by gently swirling in an ice-water bath. After this stage, the cells must be kept at 4° C for all further steps. The next stage of the procedure involved pelleting the cells by centrifuging at 400Og for 10 minutes in a pre-chilled 4° C rotor. The supernatant is discarded and 5-10 mL of ice-cold H₂O is added as a wash step (a wide-bore pipette to pipette the cells gently up and down can be used). Each time this step is repeated, the final volume must be adjusted to 500 mL with ice-cold H₂O. The last two steps are repeated twice, for example; i. After the first repeat, the cells are resuspended in a final volume of 250 mL of ice-cold H₂O; ii. After the second repeat, the cells are resuspended in a final volume of 50 mL of ice-cold H₂O. Finally, the cells are pelleted as described above, and resuspended in 5 mL oflO% (v/v) ice-cold, sterile glycerol. Competent Agrobacterium cells can then be dispensed in50 μL aliquots of cells into microcentrifuge tubes and snap-frozen in liquid nitrogen, for storage at-70° C.

Electroporation and Recovery of cells

[00102] Competent Agrobacterium cells as described above can be transformed with a polynucleotide of interest using a number of techniques known in the art, non-limiting examples of which include the freeze thaw method and electroporation of the cells. The method of electroporation of cells is provided in further detail below: [00103] Competent cells stored at -70° C can be defrosted on ice at a volume of approximately (50 μL per transformation). After the cells are defrosted, plasmid DNA (1 μl of E. coli miniprep or 1-5 μgof CsCl-purified plasmid DNA) may be added to the cells. Both the cells and the DNA can be mixed together on ice. This transformation mixture can then be transferred to a pre-chilled electroporation cuvette. Electroporation of the cells can be carried out as recommended for E. coli by the manufacturer of the chosen electroporator. For example, when using an electroporator with a 2 mm cuvette, the following conditions can be used: Capacitance: 25 μF; Voltage: 2.4 kV; Resistance: 200Ω and Pulse length: 5 msec. Immediately after electroporation, 1 mL of LB is added to the cuvette, and the bacterial suspension can be transferred to a 15-mL culture tube, before incubating for 4 hours at 28° C with gentle agitation. The suspended cell can be collect by centrifuging briefly, and spread on LB agar plates containing the appropriate antibiotic or selection. The plates are then incubated for approximately 3-4 days at 28° C, until colonies begin to form, but before satellite colonies are produced. Any colonies that have grown during this time can be streaked on to a new LB agar plate and re-incubated at 28° C until the colonies have grown. The plate can then be kept sealed at 4° C as a stock plate. The colonies that grew should contain the polynucleotide of interest. To verify whether this is the case, small cultures of each independent colony can be grown and mini-preps and PCR undertaken to check for the insertion of the desired sequence. Finally, glycerol stocks of the appropriate clones can be stored at-20° C. Variations of the freeze thaw method are provided in the art. The invention is not restricted to the methods described above.

EXAMPLE 2

FREEZE-THAW METHOD OF TRANSFORMING AGROBACTERIUM [00104] Once a desired polynucleotide is introduced into a bacterial strain, i.e. ,

E. coli the polynucleotide can be transferred into Agrobacterium by the freeze-thaw method. Although the transformation frequency by these methods is low (approximately 10³ transformants per μg DNA) compared to other methods, the technique is reliable and very rapid. Steps in the procedure are well known in the art and may include: [00105] Primarily, an Agrobacterium strain containing an appropriate helper

Ti plasmid in 5 mL of medium is grown overnight at 28° C. The next step involves the addition of 2 mL of the overnight culture to 50 mL of medium in a 250-mL flask. The culture is then shaken vigorously (250 rpm) at 28°C until the culture grows to an OD₆₀₀ of 0.5 to 1.0. Once the culture has reached this stage, the cells are chilled on ice. Keeping the cultures chilled, the cell suspension is centrifuged at 3000 g for 5 min at 4°C. The supernatant of this solution is discarded and the cells resuspended in 1 mL of 20 mM CaCl₂ solution (ice-cold). Aliquots of the cells are placed into pre-chilled

Eppendorf test tubes. The second stage of this method comprises adding about 1 μg of plasmid DNA to the cells before snap freezing them in liquid nitrogen. The cells are further thawed by incubating the test tubes in a 37° C water bath for 5 min. To each test tube, 1 mL of fresh LB medium is added to the tube and incubated at 28° C for 2-4 h with gentle shaking. This period allows the bacteria to express the antibiotic resistance genes if there is a selection step in place. The cells are further centrifuged in their tubes for 30 s in an Eppendorf centrifuge and the supernatant solution is removed. The pelleted cells are resuspended in 0.1 mL LB medium. Finally, the cells can be spread on a LB agar plate containing appropriate antibiotic selection, before incubation at 28° C. Transformed colonies containing the polynucleotide of choice should appear in approximately 2-3 days. Variations of the freeze thaw method are provided in the art and the invention is not restricted to the method described above.

EXAMPLE 3

EMBRYOGENIC CELL SUSPENSIONS [0165] Examples of embryogenic cell suspensions of banana cultivars Grand

Nain and Lady Finger, transformed using Agrobacterium tumefaciens strain AGLl without or with binary vectors pPTN254,pPTN255, pPTN261,pPTN396 or pPTN290 carrying Bcl-xL, Bcl-xL(gl38A) null mutation, Ced-9, Bcl-2 3'UTR and GusPlus genes respectively, apart from 35S driven nptll selection marker are demonstrated in Table 2 below. The cultivars used are Grand Nain (AAA) and Lady Finger (AAB) and the data is displayed as Mean + Standard Error from four replicates of 50 mg settled cell volume of embryogenic suspension cells. TABLE 2

EFFECT OF EXPRESSION OF ANTI-APOPTOTIS GENES ON AGROBACTERIUM-MEΌIAΎEΌ TRANSFORMATION EFFICIENCY IN BANANA PLANTS

[0166] Sucrose starvation (Riou-Khamlichi et al. , 2000) was used for synchronization of suspension cells. Cells were washed three times with suspension maintenance media lacking sucrose and then resuspended in 100 mL of the same. Flasks were put back on the shaker at 27° C, 90rpm for 24 hours before sucrose was added to the medium to a final concentration of 3%. The cultures were incubated under conditions as above and 4 day old embryogenic cell suspensions (ECS) were used for transformation. To reduce variations between different flasks, ECS were pooled before each experiment and re-aliquoted out into 2 mL tubes and used as starting material for experiments.

[0167] Embryogenic cell suspensions (ECS) are the most regenerable banana tissue and are frequently used for banana transformation. In a previous report Khanna et al. , (2004, supra) the inventors described an Agrobacterium-medieAed transformation protocol using two cultivars, Grand Nain (AAA) and Lady Finger (AAB) and A. tumefaciens strains AGLl and LBA4404. They inventors also observed Agrobacterium- induced cell death in banana ECS and discovered that heat-shock could control it but only to a very limited extent. Effect of A. tumefaciens on embryogenic cell suspensions (ECS) was then analyzed in greater detail, with the aim of further improving their transformation efficiency. EXAMPLE 4

CONSTRUCTS AND PLANT TRANSFORMATION

[0168] Binary vectors pPTN254, pPTN255, pPTN261, pPTN396 and pPTN290, used for transformation had the maize polyubiquitin-1 (Ubi-1) promoter controlling the constitutive expression of Bcl-xL (chicken), Bcl-xL G138A (one loss-of- function substitution at codon 138 of Bcl-xL protein), Ced-9 (from C. elegans), Bcl-2 3' UTR (human) and UidA reporter gene encoding β-glucuronidase (GUS), respectively. The vectors were electroporated into Agrobacterium tumefaciens strain AGLl, Lazo et al, (1991, Bio/Technol, 9:963-967) and selected on yeast-mannitol (YM) medium, Vincent, (1970, A Manual for the practical study of root nodule bacteria. IBP Handbook 15, Blackwell Scientific Publications: London) supplemented with carbenicillin (250 mg/liter), spectinomycin (100 mgL^'1), and rifampicin (50 mgL^'1). Agrobacterium culture and banana ECS transformation were carried out as previously described Khanna et al, (2004, supra). ECS were not subjected to heat shock prior to transformation, except in one specified experiment.

EXAMPLE 5

CELL VIABILITY TEST [0169] The loss of plasma membrane integrity was evaluated using visual and spectrophotometric assay of trypan blue staining, Hou and Lin, (1996, Plant Physiol, 111: Suppl 2:166). Approximately, 50mg of control and Agrobacterium infected samples were washed three times with suspension maintenance media and incubated for 1 hour in the incubation medium containing 0.4% trypan blue (in water, glycerol and lactic acid 1 :1:1). After multiple changes of 50% glycerol-water to remove unbound dye, samples were observed under the microscope (see Figure 1). For use in visual assays, 200 cell aggregates were scored per treatment for positive staining with three replicates per treatment. For quantitative assessment, bound trypan blue was extracted from 50 mg scv of stained ECS in a 500 μL solution of 50% methanol/ 1% SDS for 1 h at 50° C and quantified using a spectrophotometer by measuring the absorbance at 595 run.

EXAMPLE 6

TUNEL ASSAY

[0170] TUNEL (TdT-mediated dUTP nick-end labeling) method labels free 3'-OH groups of DNA and is used to detect fragmented DNA and visualize apoptotic bodies in situ Gorczyca et al, (1993, Cancer Res, 53:1945-1951). Plant samples were fixed at 4° C after vigorous washing in PBS and counterstained for 15 min at room temperature with 0.5 μg mL^"'propidium iodide (PI). Confocal images were obtained using Leitz (63 x 1.4NA oil, PL APO or Leitz 4Ox INA oil) and PL FLUOTAR objective lenses under a Leica (TCS 4D) confocal laser scanning microscope(Leica, Heidelberg, Germany), equipped with Argon/Krypton and UV lasers (ex. spliter DD488/586) and Leica TCS-4D software C for 30 min, with 4% (v/v) formaldehyde in 0.1 M phosphate-buffered saline (PBS, pH 7.2) and permeabilized using 1% Triton X 100 in 0.1% sodium citrate for 10 minutes. Samples were labelled by terminal deoxynucleotidyl transferase-mediated dUTP nick-end labelling (TUNEL) using in situ Cell Death Detection kit (Roche Diagnostics, Basel, Switzerland), according to the manufacturer's instructions. [0171] The inventors applied TUNEL staining and propidium iodide counterstaining to banana ECS and root cells infected with Agrobacterium. Control cells incubated on co-culture media without Agrobacterium infection contained intact nucleus, as visualized by non-specific DNA staining with propidium iodide (Figures 2a and 8a) and specific labeling of fragmented DNA was rare (Figure 2b and 8b). In contrast, cells treated with Agrobacterium contained nuclei of distorted shape (Figure 2c and 8c), frequently accompanied by multiple TUNEL positive green fluorescent apoptotic bodies indicating free 3'-OH groups of DNA within the nuclei (Figure 2d and 8d). Compared to the control ECS, which showed maximally 2% of cells with TUNEL- positive nuclei, cell populations treated with Agrobacterium exhibited more than 50% of the TUNEL-positive nuclei.

[0172] The TUNEL assays showed a high percentage of positive staining after 48 hours of Agrobacterium co-culture but trypan blue staining and visible browning of cells was not visible until after 4 days indicating that nuclear DNA fragmentation preceded the loss of membrane integrity, suggesting that the observed DNA fragmentation was caused by apoptotic rather than necrotic cell death.

[0173] Transformed cells were subjected to TUNEL assay on third day of co- culture. A high percentage of TUNEL-positive cells were detected in ECS transformed withpPTN255 (Figure 2h) or pPTN290 (Figure 2j) indicating that Bcl-xL G138A or vector only control induced cell death comparable to that caused by AGLl alone (Figure 2d), confirming that transformation process itself had not contributed significantly to the cell death at that stage. The number of cells displaying TUNEL- positive staining dropped significantly in cells transformed with pPTN254 (Figure 2f), pPTN261 and pPTN396. The fragmentation of nuclei and the formation of micronuclei were observed at a high frequency in cells transformed withpPTN255 (Figures 2g and 2h) or pPTN290 (Figures 2i and 2 j), as compared to the cells transformed with pPTN254 (Figures 2e and 2f), pPTN261 or pPTN396.

[0174] Another typical feature of apoptosis is the cleavage of DNA at specific chromosomal sites by DNA endonucleases, Eastman et al, (1994, Endonucleases associated with apoptosis; In: Apoptosis (Mihich, e and Schimke, R. T. eds) 249-259). The in situ TUNEL assay does not discriminate between random fragmentation and oligonucleosome-sized cleavage of DNA. To discriminate between the former, which is associated with necrosis, and the latter, which is characteristic of PCD, total DNA was extracted from the same set of cells, that was investigated using the TUNEL assay, and analysed by agarose gel electrophoresis. The inventors observed PCD-specific laddering of DNA in Agrobacterium exposed cells (Figure 3), correlating with the indication of DNA fragmentation in cells using the TUNEL assay. Nuclear DNA from non-infected tissues retained a single high molecular weight band and there was no DNA laddering (Figure 3, lane 1), despite the appearance of a few TUNEL- positive nuclei in cell clumps, which apparently were too few in number to be detected by agarose gel electrophoresis. EXAMPLE 7

DNA LADDERING

[0175] One hallmark of programmed cell death (PCD) is the fragmentation of nuclear DNA and disintegration of the nucleus to form apoptotic bodies containing the fragmented DNA, Martin et al, (1994, Trends Biochem., 19:26-30). DNA was isolated from cells infected with Agrobacterium using DNeasy Plant kit (Qiagen Inc., Valencia, CA, USA). Samples were thoroughly washed to remove Agrobacterium prior to DNA isolation. For each sample, 5 μg DNA was loaded per lane, electrophoresed on a 2% agarose gel at 60V cm^'1 for 4 hours and stained with ethidium bromide.

[0176] Progressively increasing DNA laddering was observed after 24 hours of co-culture when cells were exposed to Agrobacterium at an OD₆₀O of 0.1, 0.5 and 1.0 respectively (Figure 3, lanes 5-7). At higher inoculum density (OD₆₀₀= 1.0), laddering was clearly evident at 24 hours but with lower inocula, it became prominent after 48 hours (Figure 3, lanes 8 and 9). By 72 hours, DNA laddering could be seen in all sets of cells exposed to Agrobacterium (Figure 3, lanes 1 1-13). These results indicate that the nuclear DNA is cleaved into nucleosomal fragments during the 2-3 day co-culture period. Nuclear DNA from ECS after 7 days showed a smear instead of the DNA ladder, indicating degradation of DNA in a large percentage of cells. Since the Agrobacterium used in these experiments did not contain any binary vector, these results indicate that Agrobacterium induced PCD in banana cells and that it was exposure to Agrobacterium rather than genetic transformation that caused cell death.

[0177] Nuclear DNA from unexposed control cells from Grand Nain and Lady Finger cultivars and cells transformed with pPTN254, pPTN261 or pPTN396 retained a single high molecular weight band (Figure 4, lanes 5, 6, 7, 8 and 9) and no DNA laddering was detectable even at 72 hours. In Grand Nain and Lady Finger cells exposed to AGLl alone (Figure 4, lane 1 and 2), cells transformed with pPTN290 (Figure 4, lane 3) and pPTN255 (Figure 4, lane 4), laddering was clearly evident at 72 hours. The pattern of DNA laddering and TUNEL staining correlated with the pattern of visual browning and trypan blue staining in the transformed cells, indicating that browning and loss of cell viability following Agrobacterium infection is a consequence of programmed cell death and can be inhibited through expression of anti-apoptosis genes. EXAMPLE 8

STABLE TRANSFORMATION WITH ANTI-APOPTOSIS GENES

[0178] For generation of stably transformed banana plantlets, ECS were selected on kanamycin and regenerated as previously described (Khanna et al. , 2004).

[0179] There was a dramatic effect on the recovery of transformed embryos in cells transformed with pPTN254, pPTN261 or pPTN396 as compared to ECS transformed withpPTN255 (Figure 5) or pPTN290. Embryos formed were counted to quantify the effect of expression of anti-apoptotic genes (Table 2). Untransformed control cells from Grand Nain and Lady finger cell lines used for this experiment generated an average of 4900 and 5600 embryos per 50mg of settled cell volume (scv) of ECS. Exposure of these cells to AGL 1 reduced this number to 104 and 110 respectively for Grand Nain and Lady Finger when no heat shock pre-treatment was used for the cells. Heat shock pre-treatment increased the recovery of embryos to 162 and 188 respectively. Similar results were obtained with pPTN290 transformed ECS.

[0180] Grand Nain ECS transformed with pPTN254 also gave rise to an average of 4630 embryos from four different experiments whereas cells transformed with pPTN255 formed less 100 embryos, as did the control pPTN290 transformed cells. Similarly, approximately 3150 and 820 embryos were formed from ECS transformedCed-9 and Bcl-2 3'UTR respectively. Comparable results were obtained with Lady finger ECS (Table 2). These results suggest that all three anti-apoptosis genes had a dramatic effect on cell death in transformed cells, leading to recovery of almost all transformed cells. Since the Agrobacterium-mediated transformation protocol used was very efficient, T-DNA transfer efficiency was very high. When combined with an equally high recovery of transformed cells by abrogating apoptotic cell death, and almost every cell transformed with the anti-apoptosis gene Bcl-xL developing into an embryo, the transformation efficiency could be enhanced by up to a 50-fold. The other two genes, Ced-9 and Bcl-2 3' UTR also had a significant but albeit lesser positive effect.

[0181] Four replicates of 100 embryos from each vector transformation were transferred to regeneration media and transformed embryos were regenerated into plantlets. Bcl-2 3'UTR transgenics started regenerating profusely at least three weeks ahead of all others (Figure 5e), including the controls. There is no clear explanation for this phenomenon. The conversion of embryos to plantlets was comparable for untransformed controls and embryos transformed with pPTN254, pPTN261 and pPTN396 (Table 2). The plantlet conversion rate was much lower for Agrobacterium exposed cells or cells transformed with reporter gene and loss of function mutation, indicating that the anti-apoptosis genes had positive effects on regeneration from the transformed embryos. The reason for this effect is not understood but, combined with a high number of transformed embryos recovered from cells transformed with these genes, the transformation efficiency could be improved by a 100-fold by using Bcl-xL gene as compared to Bcl-xL (138A) or a reporter gene. Since the only difference between Bcl-xL and Bcl-xL (Gl 38A) is that of one amino acid leading to loss of function, it can be concluded that this enhancement in transformation efficiency was due to the effect of expression of the Bcl-xL gene.

[0182] More than 50 transformants for each transgene were transferred to rooting media and twenty plants were characterised for each transgene to identify independent lines harboring single copies of transgene and for the confirmation of transcription from the transgene. One or two copy-number, kanamycin-resistant transgenic plants harbouring the various anti-apoptotic genes were selected for further analysis (Figure 6). Non-transformed banana and banana-containing null mutation or vector alone served as controls. PCR analysis using non-T-DNA region primers was used for confirming absence of any Agrobacterium contamination in selected plants. RT-PCR (Figure 7) of selected plants confirmed transcription of transgenes in selected plantlets. No developmental abnormalities were observed in the transgenics. EXAMPLE 9

MOLECULAR ANALYSIS OF TRANSGENIC BANANA PLANTS

[0183] Genomic DNA was isolated from plant tissues using CTAB (cetyltrimethylammonium bromide) buffer supplemented with 1.4% (w/v) 2- mercaptoethanol and standard chloroform extractions. Gene specific primers was used to confirm presence of transgenes and non-T-DNA region specific primers was used to confirm absence of vector DNA backbone or Agrobacterium contamination in the intracellular spaces of plant tissues. PCR reaction contained 8 picomoles of each primer, 200μM dNTPs, 50ng genomic DNA and 0.25units of Platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA, USA) with 1 x buffer (2.5 mM MgCl₂). The primer sequences used were Bcl-xFl (5'atgagtcagagcaaccgggagctg3') and Bcl-xRl (5'tcatttccgac tgaagagtgagccc3') for Bcl-xL and Bcl-xL (Gl 38A); Ced-9F2 (S'gatggcgactggcgagatgaagS¹) and Ced-9R2 (5'gaaaccgccgaacgagattagacc3') for Ced-9; Bcl-F2 (5'acatgcctgcccc aaacaaata3') and Bcl-R2 (5'ggtgatccggccaacaacat3') for Bcl-2 3'UTR and Spec-Fl(5'agtgatattgatttgctggttac3') and SpecRl (5'atgacgggctgatactgg3') for spectinomycin gene in the non-T-DNA region of the vectors. The reaction mixture was subjected to an initial denaturation step of 95° C, followed by 35 cycles of 95° C (30s), 62° C (30s) and 72° C (lmin) and a final extension step of 72° C (lOmin). PCR products were checked on ethidium bromide stained 1.2% agarose gel. [0184] Total RNA was extracted using QIAGEN RNeasy Plant Mini Kit

(Qiagenlnc, Valencia, CA, USA) and analysed using Titan One Tube RT-PCR Kit (Roche Diagnostics, Basel, Switzerland) following manufacturer instructions and gene- specific primers as above.

[0185] For transgene copy number detection, 10 μg of genomic DNA extracts were digested with restriction enzyme Sad or EcoRW that cut only once within the T- DNA and outside the selected probe region. Digested DNA was subjected to Southern analysis following standard procedures. Digoxigenin-labelled probes for each individual anti-apoptosis gene were generated using a PCR DIG probe synthesis kit (Roche Diagnostics, Basel, Switzerland) using gene-specific primers with plasmid DNA as the template. Hybridization and detection of the probe was carried out using DIG

Luminescent Detection kit for Nucleic Acids (Roche Diagnostics, Basel, Switzerland) according to the manufacturer's instructions. EXAMPLE 10

AGRO-INFECTION OF TRANSGENIC BANANA PLANTS

[0186] Selected transformed plants were rooted in rooting media, Khanna et al, (2004, supra) without agar. The root tip cells were synchronised by incubating the roots for 15 hours in Hydroxyurea (2.5 mM), followed by 6 hours of recovery as per Dolezel et al, (1999, Methods Cell Sci, 21:95-107). Following synchronization, young actively growing roots were immersed in 1.5 mL of Agrobacterium cell suspension for 30 minutes at 22° C and co-cultivated as above.

[0187] DNA was isolated from infected roots at various intervals and tested for DNA laddering. For in situ detection of apoptosis using TUNEL, root tips were fixed and assayed as described above.

[0188] Transgenics and un-transformed control plantlets were rooted in MS4, Khanna et al. , (2004, supra) liquid media and young actively growing roots from plants transformed with anti-apoptotic genes to Agrobacterium were used to determine the cytoprotective effect of these transgenes on the stably transformed root cells.

[0189] Roots were tested for Agrobacterium-induced cell death by exposing them to AGLl at using a high density inoculum (OD₆₀₀ of 1.0). Absence of TUNEL positive nuclei in Bcl-xL transformed root cells (Figure 8f), as compared to untransformed controls (Figure 8d), Bcl-xL (Gl 38A) transformed plants (Figure 8h) and pPTN290 transformed plants (Figure 8j) further confirmed that expression of anti- apoptotic transgenes had a cytoprotective effect on the banana cell that protected the cells from Agrobacterium-induced programmed cell death.

[0190] Programmed cell death was inhibited in Bcl-xL, Bcl-2 3'UTR and Ced-9 transgenics as indicated by lack of detectable DNA laddering (Figure 9, lanes 2- 4) in root cells exposed to Agrobacterium at a high inoculum density (OD_60O of 1.0), whereas root cells from untransformed Grand Nain and Lady Finger plants showed distinct laddering as did the roots cells from plants transformed with pPTN255 and pPTN290 (Figure 9, lanes 6-9). pPTN255 transformed plants not exposed to Agrobacterium did not show any laddering (Figure 9, lane 5), excluding the possibility of other processes contributing to DNA fragmentation. EXAMPLE 11

AGRO-INFECTION OF TRANSGENIC SUGARCANE Materials and Methods

Plant Expression Vectors [0191] The exogenous nucleic acid used in all microprojectile based transformation experiments was either a reporter gene encoding Gfp driven by UBIl promoter or one of the negative regulators of apoptosis Bcl-xL and Bcl-xL G138A (a loss of function mutant) of animal origin (Dickman et αl., 2001, Proc. Nαtl. Acαd. Sci USA, 98: 6957-6962) AtBαg4 (Doukhanina et αl., 2006, J Biol. Chem., 27:18793-801) of plant origin and Hsp70h (S) (severe) or Hsp70h (M) (mild) of plant virus origin driven by (CaMV) 35 S promoter. For selection of transformed sugarcane cells, all constructs carried the nptll gene (which confers resistance to geneticin) marker gene driven by the 35S promoter and terminated by the (CaMV) 35S poly A region. For bacterial selection all constructs carried a spectinomycin resistance gene. [0192] Using standard cloning procedures, superbinary plant expression vector pUGfpnptll(S) carrying maize ubiquitin driven green fluorescent protein (Gfp) reporter gene was cloned for Agrobαcterium-mediated transformation of sugarcane. A Hmdlll-SOcI fragment (2817 bp) carrying maize ubiquitin promoter, Gfp coding region and nos terminator digested out from vector pA53 (kindly provided by Glen Ηassall) was electrophoresed and purified from agarose gel and cloned into HzrcdIII and Sαcl digested T-DNA region of superbinary vector pΗK(S), that carried an extra virulence gene (virG) in the backbone for enhancing monocot transformation. HmdIII and Spel digested 3145 bp fragment containing ubi promoter, nptll coding region and nos terminator was also cloned into Hwdlll and Spel digested T-DNA region of the superbinary vector as a plant selection marker. The final superbinary vector pUGFPnptll was electroporated into A. tumefαciens strain LBA4404 and used for sugarcane transformation.

Sugarcane Tissue Culture

[0193] Young developing leaves of sugarcane varieties Q 1 17 and Q208 were used for all tissue culture experiments. Top portions (about 30 cm) of shoots were cut and all leaves except the innermost 3-4 whorls were carefully removed under aseptic conditions. Transverse thin section explants measuring about 1.0-2.0 mm in thickness were prepared by serial transverse sectioning of the lowermost 3-4 cm portion (just above the apical meristem) of the leaf spindle using a sharp surgical blade under sterile conditions. Murashige & Skoog (MS) (1962, Physiologia Plantarum, 15: 473-497) nutrient formulation was used as the basal medium. For callus induction, MSD-3 media (Table 3) supplemented with anti-oxidants citric acid and ascorbic acid (150 mg L^"1 each) was used. Explants were cultured in tissue culture dishes (90 x 25 mm) with 25 mL agar-solidified medium. For generating cell suspensions, explants were inoculated in 250 mL flasks containing 50 mL liquid MSD-3 medium. Liquid cultures were agitated continuously on a shaker at 120 rpm. All cultures were incubated at 25- 28° C in dark, except for the suspension cultures that were maintained under 16 hrs photoperiod provided by cool, white fluorescent tubes. Sub-culturing was done at least once in ten days, or more frequently if media or explants turned brown due to phenolic exudation.

TABLE 3 MEDIA COMPOSITION (PER LITRE)

Experiment 1

[0194] A. tumefaciens strains LBA4404 and AGLl were grown in 5 mL of liquid LB (Luria-Bertani broth) medium at 200 rpm agitation with appropriate antibiotics at 28° C for 24 hrs. A 0.5 mL culture was added to 50 mL of liquid YMB medium (Table 3) and grown until the culture reached an OD600 of 1.0. The culture was centrifuged at 5000 x g for 10 min at room temperature. The pellet was resuspended in AIM medium (Table 3), and the bacterial suspension was adjusted to optical density of 0.7 measured at 600 nm wavelength (OD600 0.7) for inoculation of sugarcane cultures. Cells were inoculated with Agrobacterium for 10 min. Treated cells were co-cultivated on co-culture media SCM-I medium (Table 3) for 2 days in the dark at 25° C. Cells were washed after co-cultivation with sterile distilled water and visually assessed for browning at periodic intervals.

Experiment 2 [0195] The experiment described above was repeated using synchronized liquid cell suspension cultures of both cultivars and A tumefaciens strains LBA4404 and AGLl but using two cell densities of Agrobacterium (OD600 = 0.1 and 1.0). Treated cells were co-cultivated on co-culture media SCM-I medium (Table 3) for 2 days in the dark at 25° C. Cells were washed after co-cultivation with sterile distilled water and assessed for DNA fragmentation.

DNA Laddering

[0196] Genomic DNA from cell suspension cultures exposed to A. tumefaciens LBA4404 and AGLl as well as genomic DNA from unexposed cells (from Experiment 2) was isolated using CTAB extraction method (Rogers et al, 1985, Plant Cell Reports 5: 69-76) 48 hrs after exposure. Approximately 3 μg of total genomic DNA was loaded per lane and electrophoresed on a 1% agarose gel at 25V cm-1 overnight and viewed using a UV trans-illuminator.

TUNEL Assay

[0197] Liquid cell suspension cultures from Experiment 2 described above but exposed to A. tumefaciens LBA4404 and AGLl at two different inoculum densities (OD660 = 0.1 and 1.0), as well as the unexposed control cells were fixed in 4% (v/v) formaldehyde in 0.1 M phosphate-buffered saline (PBS, pH 7.2) 48 hrs after the exposure to Agrobacterium. They were permeabilized using 0.1% sodium citrate containing 1% Triton XlOO. DNA was labelled by terminal deoxynucleotidyl transferase-mediated dUTP nick-end labelling (TUNEL) using an in situ Cell Death Detection kit (ROCHE DIAGNOSTICS, Basel, Switzerland), according to the manufacturer's instructions. Samples were counterstained with 0.5 μg ml/¹ propidium iodide and confocal images were obtained using Leica 63 x 1.4NA oil PL APO objective lenses under a Leica TCS 4D confocal laser scanning microscope (LEICA, Heidelberg, Germany), equipped with Argon/Krypton and UV lasers (ex. splitter DD488/586) and Leica TCS-4D software.

Results

Sugarcane Tissue Culture

[0198] Leaf explants from sugarcane cultivars Ql 17 and Q208 cultured on MSD-3 media enlarged considerably but many of the explants turned brown and died within two weeks of culture due to excessive production of phenolic compounds. The browning was inhibited and survival was greatly improved by supplementing the media with the antioxidants ascorbic acid (150 mg L^"1) and citric acid (150 mg L^'1). Also, more frequent subculture in such cases (weekly subculturing instead often days) helped reduce phenolic production. [0199] The potential of leaf tissue to form callus in both cultivars was greatly influenced by the size of the explant. Generally, thicker slices (>5 mm thick) produced more phenolics, even when ascorbic acid was used, which slowed callus initiation, and reduced quality. Callus proliferation was much slower in thicker slices as compared to the thinner ones (< 3 mm thick), possibly due to endogenous hormone levels in differentiated tissue below (callus forms at the top of outer edges of leaf circles). Q208 somatic embryos were generally smaller in size than those from Ql 17, though the number of embryos formed per leaf disc was comparable. Best embryogenesis response was achieved when explants were kept below 3 mm. Q208 had more endogenous contaminants associated with it, possibly because leaf whorls were not as tightly packed as those of Ql 17. Ql 17 regenerated on hormone free media (Figure 10), with greening starting to appear after 10 days on regeneration medium (RM). Q208 required supplementation of RM with 2 mg L^"1 BAP, and it started showing green patches only after 3 weeks on regeneration media.

Asrobacterium induced cell death in Ql 17 and Q208 explants

[0200] Explants from both cultivars tested showed browning two days after exposure to Agrobacterium (OD660 = 0.7). Browning continued even though the tissue was washed in liquid growth media containing 200 mg L^"1 bactericidal antibiotic Timentin, and plated on solid media containing 200 mg L^"1 Timentin. By day seven, nearly 80% of embryogenic callus cells were deep brown. Control tissue did not show any browning (see Figure 11). Two weeks after exposure to Agrobacterium LBA4404, 4 day old leaf discs from both of the cultivars turned completely brown and did not form any embryos following exposure. The unexposed control explants had approximately 15 embryos per explant in both cultivars. Two weeks after exposure to Agrobacterium, 14 day old explants, showed an average of 8 embryos per explant of Ql 17, and 15 embryos in case of Q208. The unexposed controls in both cultivars had approximately 100 embryos per explant, indicating a decrease of 92% and 85% in embryogenesis following exposure to Agrobacterium (OD660 = 0.7).

DNA Fragmentation Detection

[0201] The effect of Agrobacterium exposure on integrity of nuclear DNA was visualized by elecrophoresing the sugarcane genomic DNA on agarose gel before and after exposure to Agrobacterium. Exposure to both strains of A. tumefaciens

LBA4404 and AGLl caused the degradation of genomic DNA within 48 hours, whereas no DNA degradation was visible in cultures grown in the absence of A. tumefaciens (Figure 12).

In Situ DNA Fragmentation Detection [0202] Intra-nucleosomal DNA cleavage was examined by an assay that allows for in situ detection of DNA breaks at the single cell level. TUNEL labeled suspension cells from both Ql 17 and Q208 (control and exposed to A. tumefaciens LBA4404 and AGLl at OD_66O = 0.1 and 1.0) were visualized using confocal microscopy and photographed 48 hours after exposure (Figures 13 and 14). No TUNEL label was observed in nuclei of cells from either of the cultivars that were not exposed to Agrobacterium. Ql 17 exposed to LBA4404 (OD₆₆₀ = 0.1) showed no TUNEL positive nuclei, and very few TUNEL positive nuclei were seen after exposure to AGLl at OD_66O = 0.1. However, following exposure to higher optical densities of Agrobacterium inoculum (OD₆₆₀ = 1.0), the number of TUNEL labeled nuclei increased significantly; indicating that intra nucleosomal fragmentation of DNA is directly related to bacterial inoculum density. Number of TUNEL positive nuclei in Q208, increased from approx. 10% after exposure to AGLl OD₆₆₀ = 0.1 to nearly 90% after exposure to AGLl OD₆₆₀ = 1.0. Extent of TUNEL staining in either of the cultivars was noticeably less in treatment groups exposed to LBA4404 compared to those that were exposed to AGLl. Ql 17 generally showed less TUNEL positive nuclei compared to Q208, indicating genotypic variation in response to Agrobacterium induced cell death. EXAMPLE 12

SUGARCANE TRANSFORMATION WITH NEGATIVE REGULATORS OF CELL DEATH

Materials and Methods

[0203] Plasmid DNA was prepared using a Qiagen Plasmid MaxiPrep Kit according to the manufacturer's instructions. Approximately 4 hrs prior to microprojectile bombardment, sugarcane explants (4, 14, 24 and 34 days after culture initiation) were placed in a circle (about 3 cm in diameter) on solid MSD-3 media containing osmoticum (0.2 M mannitol). Explants were bombarded using a particle inflow gun (Finer et αl, 1992, Plant Cell Reports, 11: 323-328). Gold particles (Bio- Rad), 1.0 μm in diameter, were used as microprojectiles, and were prepared for bombardment by mixing 3 μg of gold particles with 2 μg of plasmid, 25 μL of 2.5 M CaCl₂ and 5 μL of 0.1 M spermidine-free base. All solutions were kept on ice. The gold was kept in suspension for 5 min with occasional vortexing, and then allowed to precipitate for 10 min on ice; 22 μL of supernatant was subsequently removed. The remaining suspension was vortexed, and 5 μL aliquots were used for each bombardment. Target tissue was placed 7.5 cm from the point of particle discharge and covered by a 210 mm stainless steel mesh baffle. Helium pressure used for particle launch was 1500 KPa and chamber vacuum was at -84 KPa.

[0204] Explants were bombarded once and maintained at 25° C for 12 hrs, then transferred onto solid MSD-3 medium without osmoticum. A completely random design (CRD), consisting of three replications with three randomly chosen leaf whorls or 2 g of embryogenic calli (for 24 and 34 day old explants had formed callus) per replication, was used in a typical experiment (see Table 4 for experimental design). TABLE 4 TREATMENTS USED FOR SUGARCANE TRANSFORMATION

Results [0205] 14-day old explants transformed biolistically with cell death inhibitor genes (as summarised in Table 4), when super-transformed with Agrobacterium strain LB A4404 carrying pUGfpnptll, showed inhibition of cell death as compared to the non- transgenic controls. Two weeks after exposure to Agrobacterium, non-transgenic Agrobacterium exposed control explants produced on an average 8 embryos from Ql 17 and 10 embryos per explant from Q208. AtBag4 and Bcl-xL transformed set had as many embryos formed on each explant as the non-transgenic control, indicating a complete inhibition of cell death. Explants transformed with Hsp70h (S) had an average of 50 embryos on each explant (Figure 15). Both cultivars showed similar response. 34 days old explants transformed with cell death inhibitor genes also showed similar response in both cultivars. 80% of Agrobacterium exposed control explants from both Ql 17 and Q208 controls was brown and unresponsive after 2 weeks. Q208 explants transformed with Bcl-xL gene showed no cell death and only 5% of Ql 17 explants transformed with Bcl-xL were brown. Explants transformed with other genes showed 5- 40% brown tissue visible (see Table 5 and Figures 16 and 17).

TABLE 5

PERCENTAGE CELL DEATH IN 34-DAY OLD SUGARCANE EXPLANTS (CV. Ql 17 AND Q208) TRANSFORMED WITH ANTI-APOPTOSIS GENES PRIOR TO AGROBACTERIUM-

MEDIATED TRANSFORMATION.

EXAMPLE 12 AGROBACTERWM-MEDIAΎEΌ TRANSFORMATION OF BOMBARDED TISSUES

Materials and Methods

102061 Agrobacterium strain LBA4404 carrying superbinary vector pUGfpnptll(S) was grown at 28° C in YMB media, supplemented with Rifampicin 20 mg L^'1, Streptinomycin 200 mg L^'1 and Spectinomycin 100 mg L^'1. After three days, the cells were subcultured and grown overnight at 28° C in YMB media. Cells were centrifuged down at 5000 x g for 10 min and resuspended in AIM (Table 3) medium containing 100 μM acetosyringone to an OD_66O of 0.7. The bacterial suspension was left at 25° C in the dark, shaking for 4 hrs before using it for co-cultivation. Explants were placed in 5 mL of induced Agrobacterium suspension (with 0.02% Pluronic F-68) and placed in the vacuum (25 mm Hg) for 5 min, to allow the bacteria to infiltrate the explant. Untransformed control was vacuum infiltrated with AIM media without Agrobacterium (but containing acetosyringone and Pluronic F-68). Excess bacteria were then removed and explant dried on a sterile filter paper for 10 s. Control experiments consisted of untransformed explants, microprojectile transformed only and Agrobacterium transformed only explants. Following 2-day co-culture on AIM media, transformed explants were washed three times in liquid MSD-3 media, supplemented with 200 mg L^"1 Timentin, transferred to selection media (same as callus initiation media (MSD-3) but with 200 mg L^"1 Timentin and 50 mg L^"'of Geneticin, and kept in the dark at 25° C for 4 weeks. Cultures were checked periodically for proliferation on selection media and expression of Gfp reporter gene. A Leica MZI2 stereomicroscope with GFP-Plus fluorescence module was used for all Gfp visualizations. A green barrier filter BGG22, Chroma technology was used to visualize Gfp florescence in tissues containing chlorophyll. The images were recorded in TIFF format using a digital camera and compiled using Microsoft PowerPoint program. Proliferating cultures were selected and transferred to regeneration media as described above. Results

[0207] Gfp expression from the reporter gene in the Agrobacterium superbinary vector was observed in Ql 17 and Q208 tissue 2 weeks after transformation with Agrobacterium strain LBA4404 carrying pUGfpnptll. On average, 7% of the 14 days old explants and 8.5% for 34 days old explants of both cultivars showed Gfp expression. With an average explant size of 5 mm³, area of the explant that showed Gfp expression was calculated as percentage of the total explant area and is summarised in Table 6 and presented in Figure 18.

TABLE 6

VISUAL MARKER (GFP) EXPRESSION IN 14- AND 34-DAY OLD Q117 EMBRYOGENIC EXPLANTS AFTER EXPOSURE TO AGROBACTER/UMLBA4404 PUGFPNPTII(S)

[0208] Explants transformed with only anti-apoptosis genes are currently on regeneration, but only the calli carrying the anti-apoptosis genes have shown indications of regeneration. [0209] The data presented herein demonstrate that two Agrobacterium strains commonly used for transformation of monocots, AGLl and LBA4404, induce apoptotic-like cell death in sugarcane cultivars, Ql 17 and Q208 in a dosage dependant manner. The inventors also discovered that poor survival and low rate of proliferation following exposure to Agrobacterium of target plant cells is a major factor that affects the efficiency of Agrobacterium-mQdiatQd transformation of Ql 17 and Q208 cells. [0210] Microprojectile bombardment of the target explant tissue with human anti-apoptotic gene Bcl-xL, 4 days prior to transforming it with Agrobacterium LBA4404/pUGfpnptII significantly improved survival and proliferation of transformed cells (Table 5). More importantly, plant derived (Arabidopsis thaliana AtBag4) and plant virus derived {Citrus Tristeza Virus Hsp70h) cell death inhibitor genes were found to be functional homologues of human anti-apoptosis gene Bcl-xL, and provided comparable levels of protection to Agrobacterium infected sugarcane cells. Accordingly, the inventors have herein presented evidence that stable expression of animal, plant and plant virus derived negative regulators of PCD genes improved survival of sugarcane cells after exposure to two most commonly used Agrobacterium strains, AGLl and LBA4404 by estimated 70-80%, which in turn can increase the transformation efficiency significantly. Based on the data from expression of the reporter gene in the transformed embryos there was an increase in percentage of stably transformed embryos from 15-40% to 95-100%, which is a major leap forward towards establishing an efficient transformation protocol of sugarcane.

[0211] The disclosure of every patent, patent application, and publication cited herein is hereby incorporated herein by reference in its entirety.

[0212] The citation of any reference herein should not be construed as an admission that such reference is available as "Prior Art" to the instant application. [0213] Throughout the specification the aim has been to describe the preferred embodiments of the invention without limiting the invention to any one embodiment or specific collection of features. Those of skill in the art will therefore appreciate that, in light of the instant disclosure, various modifications and changes can be made in the particular embodiments exemplified without departing from the scope of the present invention. All such modifications and changes are intended to be included within the scope of the appended claims.

Claims

WHAT IS CLAIMED IS:

1. A method for introducing a polynucleotide of interest into a plant cell, comprising exposing plant cells to an Agrobacterium that contains the polynucleotide of interest under conditions that inhibit apoptosis in the cells, and identifying a transformed plant cell that contains the polynucleotide of interest without selecting for the presence of a marker gene in those cells.

2. The method of claim 1 , comprising exposing the plant cells to an apoptosis- inhibiting polynucleotide.

3. The method of claim 2, wherein the apoptosis-inhibiting polynucleotide is selected from Bcl-xL, AtBag4 and Hsp 70.

4. The method of claim 1 , comprising exposing the plant cells to an apoptosis- inhibiting polypeptide.

5. The method of claim 4, wherein the apoptosis-inhibiting polypeptide is selected from Bcl-xL, AtBAG4 and Hsp70.

6. The method of claim 1 , comprising exposing the plant cells to a chemical inhibitor of apoptosis.

7. The method of claim 6, wherein the chemical inhibitor is selected from the group consisting of ethylene inhibitors, ethylene synthesis inhibitors, gibberellin antagonists and phosphatase inhibitors.

8. The method of claim 1 , wherein the plants cells are exposed to an apoptosis- inhibiting polynucleotide or an apoptosis-inhibiting polypeptide before, after or simultaneously with exposing the cells to the Agrobacterium.

9. The method of claim 1 , wherein the plants cells are exposed to an apoptosis- inhibiting polynucleotide before exposing the cells to the Agrobacterium.

10. The method of claim 9, comprising stably integrating the apoptosis- inhibiting polynucleotide in the nucleome of the plant cells.

11. The method of claim 1 , wherein the plants cells are exposed to a construct that comprises an apoptosis-inhibiting polynucleotide that is operably connected to a regulatory element that is operable in the plant cells.

12. The method of claim 2 or claim 4, further comprising modulating the level or functional activity of the apoptosis-inhibiting polynucleotide apoptosis-inhibiting or polypeptide in the plant cells.

13. The method of claim 1, wherein the plant cells are selected from monocotyledonous plant cells.

14. The method of claim 13, wherein the monocotyledonous plant cells are graminaceous monocotyledonous plant cells.

15. The method of claim 13, wherein the monocotyledonous plant cells are non- graminaceous monocotyledonous plant cells.

16. The method of claim 1 , wherein the transformed plant cell is identified by detecting the presence of the polynucleotide of interest or an expression product thereof in the transformed plant cell.

17. The method of claim 1, further comprising regenerating a plant from the transformed plant cell.

18. Use of a vector or vector system for introducing a polynucleotide of interest in a plant cell by Agrobacterium-mediated transformation under conditions that inhibit apoptosis in the cell, the vector or vector system comprising the polynucleotide of interest but lacking a marker gene that confers an identifying characteristic on the plant cell.

19. The use of claim 18, wherein the vector or vector system further comprises an apoptosis-inhibiting polynucleotide.

20. The use of claim 19, wherein the apoptosis-inhibiting polynucleotide and the polynucleotide of interest are on separate vectors.

21. The use of claim 19, wherein the apoptosis-inhibiting polynucleotide is conditionally expressible.

22. Use of a culture of plant cells for marker- free Agrobacterium-mediated transformation, wherein the plant cells comprise in their nucleome an apoptosis- inhibiting polynucleotide that is operably connected to a regulatory element.

23. The use of claim 22, wherein the regulatory element comprises a regulatable promoter that conditionally expresses the apoptosis-inhibiting polynucleotide.

24. Use of a culture of plant cells comprising in their nucleome an apoptosis- inhibiting polynucleotide that is operably connected to a regulatory element for introducing a polynucleotide of interest in those cells by marker-free Agrobacterium- mediated transformation.