WO2009133461A1 - Composition - Google Patents

Abstract

An antifouling composition comprising, as an active ingredient, alcohol dehydrogenase (ADH) selected from a quinone redox cofactor-dependent ADH, a nicotinamide adenine dinucleotide (NAD+) redox cofactor-dependent ADH, a nicotinamide adenine dinucleotide phosphate (NADP+) redox cofactor-dependent ADH, or any combination thereof is described. Use of alcohol dehydrogenase selected from a quinone redox cofactor-dependent ADH, a nicotinamide adenine dinucleotide (NAD+) redox cofactor-dependent ADH, a nicotinamide adenine dinucleotide phosphate (NADP+) redox cofactor-dependent ADH, or any combination thereof for inhibiting biofilm formation is also described.

Description

COMPOSITION

Related applications

The present application relates to the subject-matter disclosed in UK patent application number 0807882.6 filed 30 April 2008 (attorney docket reference P033144GB (AFC)), UK patent application number 0811662.6 filed 25 June 2008 (attorney docket reference P033144GBR) and US patent application number USSN 61/099667 filed 24 September 2008 (attorney docket reference P033144USO), the contents of each of which are incorporated herein by reference.

The present application also relates to the subject-matter disclosed in UK patent application number 0807881.8 filed 30 April 2008 (attorney docket reference P033172GB (SC)) and US patent application number USSN 61/099698 filed 24 September 2008 (attorney docket reference P033172USO), the contents of each of which are incorporated herein by reference.

The present application also relates to the subject-matter disclosed in UK patent application number 0817077.1 filed 17 September 2008 (attorney docket reference P033900GB (SPC)) and US patent application number USSN 61/099715 filed 24 September 2008 (attorney docket reference P033900USO), the contents of each of which are incorporated herein by reference.

Field of the Invention

This invention relates to a composition.

In particular, the present invention relates to an antifouling composition.

More in particular, this invention relates to an antifouling composition comprising an enzyme having an antifouling effect and the use of the enzyme for inhibiting the formation of a biofilm, especially a bacterial biofilm. Description of the Prior Art

Biofouling is a problem at any surface that is constantly or intermittent in contact with water. Attachment and growth of living organisms on surfaces causes hygienic and functional problems to many types of equipment and devices ranging from medical implants and electronic circuitry to larger constructions, such as processing equipment, paper mills and ships.

In many cases, biofouling consists of microscopic organic impurities or a visible slimy layer of extracellular polymeric substances (EPS) containing bacteria and other microorganisms. This category of biofouling is called microfouling, or more commonly biofilm, and occurs everywhere in both natural and industrial environments where surfaces are exposed to water. When fully developed, biofouling in marine environments also includes macroscopic organisms, such as algae and barnacles. This type of biofouling is a particular problem for submerged structures, such as pipelines, cables, fishing nets, the pillars of bridges and oil platforms and other port or hydrotechnical constructions. Fuel consumption of ships may be increased by up to 40% due to biofouling. Fig. 1 is a schematic overview of the structural component chemistry of extracellular polymeric substances (EPS) involved in bacterial biofilms.

In particular, as discussed in US 5071479, the growth of marine organisms on the submerged parts of a ship's hull is a particular problem. Such growth increases the frictional resistance of the hull to passage through water, leading to increased fuel consumption and/or a reduction in the speed of the ship. Marine growths accumulate so rapidly that the remedy of cleaning and repainting as required in dry- dock is generally considered too expensive. An alternative, which has been practiced with increasing efficiency over the years, is to limit the extent of fouling by applying to the hull a top coat paint incorporating antifouling agents. The antifouling agents may be biocides which are freed from the surface of the paint over a period of time at a concentration which is high enough to inhibit fouling by marine organisms at the hull surface Previously, tributyl tin (TBT) has been a widely used biocide, particularly in marine anti-fouls. However, due to growing concerns about the environmental effects caused by using such organic tin biocides at their commercial levels as an antifoulant active ingredient in coating compositions for aquatic (marine) applications the use has effectively been stopped. It has been shown that, due to the widespread use of tributyltin-type compounds in particular, at concentrations as high as 20 wt.% in paints for ship bottoms, the pollution of surrounding water due to leaching has reached such a level as to cause the degradation of mussel and shell organisms. These effects have been detected along the French-British coastline and a similar effect has been confirmed in U.S. and Far East waters. The International Maritime Organisation (IMO) International Convention on the Control of Harmful Anti-Fouling Systems (AFS Convention) adopted at an IMO diplomatic conference in October 2001 bans application of TBT coatings on ships with effect from 1 January 2003 followed, as of 1 January 2008, by the elimination of active TBT coatings from ships.

Currently, the most widely used antifouling paints are based on copper with booster biocides (Yebra et al, 2004. Progress in Organic Coatings 50:75-104). Booster biocides e.g. copper pyrithione or isothiazolone are however necessary to complement the biocidal action of copper, which is ineffective against some widespread algal species tolerant to copper (e.g. Enteromorpha spp). The booster biocides are equally under suspicion for being harmful to the environment. The safety of booster biocides has been reviewed by several authors (Boxall, 2004. Chemistry Today 22(6):46-8; Karlsson and Eklund, 2004. Marine Pollution Bulletin 2004;49:456-64; Kobayashi and Okamura, 2002. Marine Pollution Bulletin 2002;44:748-51; Konstantinou and Albanis, 2004. Environment International 2004;30:235-48; Ranke and Jastorff, 2002 Fresenius Environmental Bulletin 2002;11(10a):769-72).

There is therefore a desire to provide environmentally friendly antifouling ingredients.

US 5770188 relates to antifouling paint compositions containing a lipid-coated enzyme which is stable in organic solvents as a result of coating with a lipid having 6 to 30 carbon atoms, and a paint resin. However, while coating the enzyme with a lipid may be beneficial for marine anti-fouling applications (by preventing the enzyme from dissolving in water), such lipid-coated enzymes are unsuitable when the enzyme is provided in solution and not in a coating. Furthermore, it is unsuitable for applications such as the prevention of biofilm in food processing equipment as the lipids may be unwanted in the food product.

Summary of the Invention

In a first aspect, the present invention a method of inhibiting biofilm formation, especially bacterial biofilm formation, on an article, comprising contacting the article with an alcohol dehydrogenase (ADH) selected from a quinone redox cofactor- dependent ADH, a nicotinamide adenine dinucleotide (NAD⁺) redox cofactor- dependent ADH, a nicotinamide adenine dinucleotide phosphate (NADP⁺) redox cofactor-dependent ADH, and any combination thereof.

In a second aspect, the present invention comprises an antifouling composition comprising, as an active ingredient, an alcohol dehydrogenase (ADH) selected from a quinone redox cofactor-dependent ADH, a nicotinamide adenine dinucleotide (NAD⁺), redox cofactor-dependent ADH, a nicotinamide adenine dinucleotide phosphate (NADP⁺) redox cofactor-dependent ADH, and any combination thereof; and a carrier.

In a third aspect, the present invention comprises a coating comprising an antifouling composition, as defined herein.

In a fourth aspect, the present invention comprises an article provided with an antifouling composition, as defined herein.

In a fifth aspect, the present invention comprises a method of inhibiting biofilm formation, especially bacterial biofilm formation, on an article, comprising contacting the article with an antifouling composition as defined herein.

In a sixth aspect, the present invention comprises use of an antifouling composition, as defined herein, for inhibiting biofilm formation, especially bacterial biofilm formation.

In a seventh aspect, the present invention comprises use of an alcohol dehydrogenase (ADH) selected from a quinone redox cofactor-dependent ADH, a nicotinamide adenine dinucleotide (NAD⁺) redox cofactor-dependent ADH and a nicotinamide adenine dinucleotide phosphate (NADP⁺) redox cofactor-dependent ADH, and any combinations thereof for inhibiting biofilm formation, especially bacterial biofilm formation.

Additional Aspects of the Present Invention

The present invention also encompasses methods comprising the use of - as well as the uses of - ADH active polypeptides that are co- or post-translationally processed during expression, for example by signal peptide cleavage. Post-translational cleavage may also occur at the C-terminal. Preferred co- or post-translational processing occurs at the N-terminal end to yield N-terminal truncated sequences.

Therefore in some embodiments of the present invention the effective fragment thereof (also referred to as functional fragment thereof) is the mature polypeptide produced by the native host or a suitable appropriate expression host.

The present invention also encompasses the co- or post-translationally processed ADH active polypeptides.

The present invention also encompasses nucleotide sequences that encode such co- or post-translationally processed active polypeptides.

In addition, the present invention encompasses an amino acid sequence that is expressed from or is expressable from all or part of said nucleotide sequences.

An example of a co- or post-translationally processed active polypeptide is presented as SEQ ID No. 1a.

Without wishing to be bound by theory, SEQ ID No. 2 may be optionally cleaved to SEQ ID No. 2a.

Without wishing to be bound by theory, SEQ ID No. 5 may be optionally cleaved to SEQ ID No. 5a. Thus, the present invention also encompasses:

An amino acid sequence comprising SEQ ID No. 1A or an amino acid sequence having at least 75% amino acid sequence identity therewith but not SEQ ID No. 1.

An amino acid sequence comprising SEQ ID No. 1A or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%, amino acid sequence identity therewith.

An amino acid sequence comprising SEQ ID No. 2A or an amino acid sequence having at least 75% amino acid sequence identity therewith but not SEQ ID No. 2.

An amino acid sequence comprising SEQ ID No. 2A or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%, amino acid sequence identity therewith.

An amino acid sequence comprising SEQ ID No. 5A or an amino acid sequence having at least 75% amino acid sequence identity therewith but not SEQ ID No. 5.

An amino acid sequence comprising SEQ ID No. 5A or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%, amino acid sequence identity therewith.

A nucleotide sequence encoding any of said amino acid sequences.

A vector comprising said nucleotide sequence.

A host transformed with said nucleotide sequence or said vector. The host may be a bacterial host, a fungal host, a yeast host or a plant host.

A method comprising expressing said nucleotide sequence or said vector.

Some Preferred Aspects of the Present Invention

Preferred aspects of the present invention are apparent in the description and in the examples and in the claims.

Some preferred aspects include:

A method or a composition or a coating or an article or a use or an amino acid sequence or a nucleotide sequence according to the present invention wherein the alcohol dehydrogenase is selected from alcohol dehydrogenases in enzyme class EC 1.1.5.

A method or a composition or a coating or an article or a use or an amino acid sequence or a nucleotide sequence according to the present invention wherein the alcohol dehydrogenase is selected from alcohol dehydrogenases in enzyme class EC 1.1.5.2.

A method or a composition or a coating or an article or a use or an amino acid sequence or a nucleotide sequence according to the present invention wherein the alcohol dehydrogenase is selected from alcohol dehydrogenases in enzyme class EC 1.1.1.

A method or a composition or a coating or an article or a use or an amino acid sequence or a nucleotide sequence according to the present invention wherein the alcohol dehydrogenase is selected from alcohol dehydrogenases in enzyme classes EC 1.1.1.1 and EC 1.1.1.2.

A method or a composition or a coating or an article or a use or an amino acid sequence or a nucleotide sequence according to the present invention wherein the NAD⁺ or NADP⁺ cofactor is present in a concentration of 0.01-5000 ppm by weight. A method or a composition or a coating or an article or a use or an amino acid sequence or a nucleotide sequence according to the present invention wherein the NAD⁺ or NADP⁺ is present in a concentration of 0.10-1000 ppm by weight.

Brief Description of the Drawings

Fig. 1 is a schematic overview of the structural component chemistry of extracellular polymeric substances (EPS) involved in bacterial biofilms.

Fig. 2 is a plasmid map of pENTRY-ADH containing the PQQ dependent ADH gene, Gateway compatible attLsites and the Zeocin selection marker.

Fig. 3 is a plasmid map of the P. pastoris destination vector pPIC2-DEST, which was derived from pPIC3.5K (Invitrogen).

Fig. 4 is a plasmid map of the P.pastoris PQQ-ADH expression plasmid pPIC2-ADH.

Fig. 5 is a map of the plasmid pET3d-asd expressing the E. coli aldose sugar dehydrogenase ylil.

Fig. 6 shows SDS-PAGE analysis of E. coll samples expressing sugar aldose dehydrogenase: Nl, total cell extract of E. coll culture containing the expression plasmid pET3d-asd before induction; I, total cell extract after induction with IPTG, 1-4, Asd His-tagged fractions eluted from a Ni²⁺ agarose column.

Fig. 7 is a graph illustrating the percentage reduction of biofilm formation by Cobetia marina plotted against concentration of Pseudogluconobacter saccharoketogenes ADH (PsADH).

Fig. 8 is a graph illustrating the percentage reduction of biofilm formation by Cobetia marina plotted against the concentrations of PsADH, hexose oxidase (HOX) and HOX or PsADH in combination with catalase.

Fig. 9 is a graph indicating the percentage reduction in biofilm formation by Cobetia marina plotted against the concentration of PsADH for two different starting concentrations of green tea extract. Fig. 10 is a graph indicating the percentage reduction in Cobetia marina biofilm formation plotted against the concentration of a number of different ADH enzymes (LkADH: Lactobacillus kefir ADH; TbADH: Thermoanaerobium brockii ADH; ScADH: Saccharomyces cerevisiae ADH).

Fig. 11 is a graph indicating the percentage reduction in Listeria innocua biofilm formation plotted against the concentration of a number of different ADH enzymes (LkADH: Lactobacillus kefir ADH; TbADH: Thermoanaerobium brockii ADH; ScADH: Saccharomyces cerevisiae ADH, EcASD: Escherichia coli aldose sugar dehydrogenase, PsADH: Pseudogluconobacter saccharoketogenes ADH).

Fig. 12 is a graph indicating the percentage reduction in Cobetia marina biofilm formation in the presence of 18 ppm PsADH plotted against the concentration of pyrroloquinoline quinone (PQQ) cofactor at varying PQQ concentrations as indicated.

Fig. 13 is a graph indicating the percentage reduction in Cobetia marina biofilm formation in the presence of 18 ppm PsADH plotted against the molar ratio of pyrroloquinoline quinone (PQQ) cofactor to PsADH.

Fig. 14 is a zoom of Fig. 13 to show the details of percentage reduction in Cobetia marina biofilm formation in the presence of 18 ppm PsADH plotted against the ratio of pyrroloquinoline quinone (PQQ) cofactor for low ratios.

Fig. 15 is a graph indicating the percentage reduction in biofilm development of Cobetia marina plotted against the concentration of a number of different additional enzymes (proteases and a mannanase).

Detailed Description of Preferred Embodiments

In the present specification "foulants" referred to by the terms "anti-foul(s)", "anti- fouling", and "anti-foulants" include organisms and non-living matter which may attach and/or reside and/or grow on the surface to be treated with the present composition. The organisms include micro-organisms such as bacteria, fungi and protozoa (in particular, bacteria), and organisms such as algae, plants and animals (in particular vertebrates, invertebrates, barnacles, molluscs, bryozoans and polychaetes). The organism may be marine organisms.

In the art, the term "biofilm" is generally used to describe fouling involving only microorganisms, whereas the term "biofouling" is more general and refers to fouling with both microscopic and macroscopic organisms. The term "biofilm" is also sometimes referred to as microfouling, whereas fouling involving macroscopic organisms is sometimes referred to as macrofouling. The present invention is directed to the prevention of biofouling in general terms and is preferably directed to the prevention of biofilm formation, particularly bacterial biofilm formation.

Alcohol Dehydrogenase

The antifouling composition of the present invention comprises, as an active ingredient, an alcohol dehydrogenase (ADH) enzyme. Alcohol dehydrogenase is also used (either alone or in combination with a carrier) in the methods of inhibiting biofilm according to the present invention. Unless otherwise specified, the preferred features described below apply to all aspects of the present invention: the term 'used in the present invention' applies to both the composition and method / use aspects of the invention.

Alcohol dehydrogenase (ADH) is an oxidoreductase enzyme first discovered in the mid-1960s in Drosophila melanogaster. Alcohol dehydrogenases occur in many organisms and facilitate the interconversion between alcohols and aldehydes or ketones. In humans and many other animals, they serve to break down alcohols which could otherwise be toxic; in yeast and many bacteria, some alcohol dehydrogenases catalyze the opposite reaction as part of fermentation. The enzymes that mainly catalyse the reduction of aldehydes to alcohols are sometimes referred to as aldehyde reductases.

In this specification the term 'alcohol dehydrogenase', when used in isolation, covers all enzymes capable of acting on a >CH-OH group to oxidise it to a >C=O group (or the reverse reaction). Such enzymes are also known as 'aldehyde reductase' when the reverse reaction (ie reduction of a >C=O group to a >CH-OH group) occurs. It has been well documented in the literature that some enzymes, especially proteases, show antifouling activity. This has recently been reviewed: see Kristensen JB, Meyer RL, Laursen BS, Shipovskov S, Besenbacher F, Poulsen CH; "Antifouling enzymes and the biochemistry of marine settlement". Biotechnology advances (submitted for publication).

The activity of some ADH enzymes is dependent on the presence of a redox cofactor. Such ADH enzymes are referred to in this specification as 'redox cofactor-dependent alcohol dehydrogenases' and are used in this invention.

In particular, the ADH used in the present invention is selected from a quinone redox cofactor-dependent ADH and a nicotinamide adenine dinucleotide (NAD⁺) or nicotinamide adenine dinucleotide phosphate (NADP⁺) redox cofactor-dependent ADH. The function of the redox cofactors is described in more detail below.

The present invention is based on the surprising finding that quinone- or NAD7NADP⁺ redox cofactor-dependent alcohol dehydrogenases are capable of inhibiting or reducing the formation of biofilm (fouling), particularly bacterial biofilm.

Some alcohol dehydrogenases, especially ADHs falling within enzyme class (E.G.) 1.1.1, particularly E. C. 1.1.1.1 or E. C. 1.1.1.2, as well as those falling within enzyme class (E.G.) 1.2.1, generally function in conjunction with the redox cofactor nicotinamide adenine dinucleotide (NAD⁺) or nicotinamide adenine dinucleotide phosphate (NADP⁺), the reaction proceeding with the reduction of NAD⁺ or NADP⁺ to NADH or NADPH respectively.

Other alcohol dehydrogenases, especially those falling within enzyme class EC 1.1.5, particularly EC 1.1.5.2, generally function in conjunction with a quinone redox cofactor, particularly a quinone cofactor selected from pyrroloquinoline quinone (PQQ), tryptophyl tryptophanquinone (TTQ), topaquinone (TPQ), and lysine tyrosylquinone (LTQ), the quinone group being reduced to a di- or tetrahydroquinone group during the reaction.

The ADH enzyme used in the present invention is an NAD⁺ / NADP⁺ cofactor- or quinone cofactor-dependent alcohol dehydrogenase, ie an ADH which functions in conjunction with a redox cofactor selected from nicotinamide adenine dinucleotide (NAD⁺), nicotinamide adenine dinucleotide phosphate (NADP⁺) or a quinone cofactor, particularly a quinone cofactor selected from pyrroloquinoline quinone (PQQ), tryptophyl tryptophanquinone (TTQ), topaquinone (TPQ), and lysine tyrosylquinone (LTQ).

In one embodiment, the ADH is selected from enzyme class (E.G.) 1.1, especially from subclass 1.1.1 or 1.1.5. Of the ADH enzymes in subclass 1.1.1, preferred are those in classification 1.1.1.1 or 1.1.1.2. Of the ADH enzymes in subclass 1.1.5, preferred are those in classification 1.1.5.2.

In another embodiment, the ADH is selected from the aldehyde reductases of enzyme class (E.G.) 1.2.1. These enzymes catalyse the opposite reaction of the ADHs and it is known that many enzymes can work as catalyst for both the forward and the reverse reaction depending on conditions.

In one embodiment, the ADH is obtainable or is obtained from a living organism. Suitable ADH's are of bacterial or fungal origin. Preferred are ADH enzymes of bacterial origin, especially Pseudoglυconobacter saccharoketogenes ADH, Lactobacillus kefir ADH, Thermoanaerobium brockii ADH and Escherichia coli ASD, or an alcohol dehydrogenase enzyme having at least 70%, for example at least 75%, such as at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95%, still more preferably at least 96%, such as at least 97%, yet more preferably at least 98%, and most preferably at least 99%, sequence identity to any thereof. Particularly preferred is Pseudogluconobacter saccharoketogenes ADH or an alcohol dehydrogenase enzyme having at least 70%, for example at least 75%, such as at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95%, still more preferably at least 96%, such as at least 97%, yet more preferably at least 98%, and most preferably at least 99%, sequence identity thereto. Among ADH enzymes of fungal origin, Saccharomyces cerevisiae ADH, or an alcohol dehydrogenase enzyme having at least 70%, for example at least 75%, such as at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95%, still more preferably at least 96%, such as at least 97%, yet more preferably at least 98%, and most preferably at least 99%, sequence identity thereto, is preferred. In a preferred aspect, the alcohol dehydrogenase is not lipid-coated. As noted above, a non-lipid-coated ADH can be used in food processing machinery and avoid the risk of lipid contamination of the food product.

Amino acid sequences

Amino acid sequences of ADH enzymes having the specific properties as defined herein, particularly those of SEQ ID Nos. 1 , 1A, 2, 2a, 3, 4, 5 or 5a, defined below, may be used in the present invention.

As used herein, the term "amino acid sequence" is synonymous with the term "polypeptide" and/or the term "protein". In some instances, the term "amino acid sequence" is synonymous with the term "peptide". In some instances, the term "amino acid sequence" is synonymous with the term "enzyme".

The amino acid sequence may be prepared/isolated from a suitable source, or it may be made synthetically or it may be prepared by use of recombinant DNA techniques.

The protein used in the present invention may be used in conjunction with other proteins, particularly other enzymes, for example amylases, proteases or lipases. Thus the present invention also covers a composition comprising a combination of enzymes wherein the combination comprises the enzyme used in the present invention and another enzyme, which may be, for example, another enzyme as described herein.

Sequence identity / sequence homology / variants / homologues / derivatives

The present invention also encompasses the use of polypeptides having a degree of sequence identity (sometimes referred to as sequence homology) with amino acid sequence(s) defined herein or with a polypeptide having the specific properties defined herein. The present invention encompasses, in particular, polypeptides having a degree of sequence identity with any of SEQ ID Nos. 1, 1A, 2, 2a, 3, 4, 5 or 5a, defined herein, or homologues thereof. Here, the term "homologue" means an entity having sequence identity with the subject amino acid sequences or the subject nucleotide sequences. Here, the term "homology" can be equated with "sequence identity". In a preferred embodiment, the enzyme has the amino acid sequence shown in SEQ ID No. 1 or an amino acid sequence having at least 50%, preferably at least 55%, such as at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%, amino acid sequence identity therewith.

In a preferred embodiment, the enzyme has the amino acid sequence shown in SEQ ID No. 1A or an amino acid sequence having at least 50%, preferably at least 55%, such as at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%, amino acid sequence identity therewith.

In a preferred embodiment, the enzyme has the amino acid sequence shown in SEQ ID No. 2 or an amino acid sequence having at least 50%, preferably at least 55%, such as at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%, amino acid sequence identity therewith.

The enzyme may have the amino acid sequence shown in SEQ ID No. 2A or an amino acid sequence having at least 50%, preferably at least 55%, such as at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%, amino acid sequence identity therewith.

In a preferred embodiment, the enzyme has the amino acid sequence shown in SEQ ID No. 3 or an amino acid sequence having at least 50%, preferably at least 55%, such as at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%, amino acid sequence identity therewith.

In a preferred embodiment, the enzyme has the amino acid sequence shown in SEQ ID No. 4 or an amino acid sequence having at least 50%, preferably at least 55%, such as at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%, amino acid sequence identity therewith. In a preferred embodiment, the enzyme has the amino acid sequence shown in SEQ ID No. 5 or an amino acid sequence having at least 50%, preferably at least 55%, such as at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%, amino acid sequence identity therewith.

The enzyme may have the amino acid sequence shown in SEQ ID No. 5A or an amino acid sequence having at least 50%, preferably at least 55%, such as at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%, amino acid sequence identity therewith.

The homologous amino acid sequence and/or nucleotide sequence should provide and/or encode a polypeptide which retains the functional activity and/or enhances the activity of the enzyme.

In the present context, a homologous sequence is taken to include an amino acid sequence which may be at least 50%, preferably at least 55%, such as at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%, identical to the subject sequence. Typically, the homologues will comprise the same active sites etc. as the subject amino acid sequence. Although homology can also be considered in terms of similarity (i.e. amino acid residues having similar chemical properties/functions), in the context of the present invention it is preferred to express homology in terms of sequence identity.

Sequence identity comparisons can be conducted by eye, or more usually, with the aid of readily available sequence comparison programs. These commercially available computer programs use complex comparison algorithms to align two or more sequences that best reflect the evolutionary events that might have led to the difference(s) between the two or more sequences. Therefore, these algorithms operate with a scoring system rewarding alignment of identical or similar amino acids and penalising the insertion of gaps, gap extensions and alignment of non-similar amino acids. The scoring system of the comparison algorithms include: i) assignment of a penalty score each time a gap is inserted (gap penalty score), ii) assignment of a penalty score each time an existing gap is extended with an extra position (extension penalty score), iii) assignment of high scores upon alignment of identical amino acids, and iv) assignment of variable scores upon alignment of non-identical amino acids.

Most alignment programs allow the gap penalties to be modified. However, it is preferred to use the default values when using such software for sequence comparisons.

The scores given for alignment of non-identical amino acids are assigned according to a scoring matrix also called a substitution matrix. The scores provided in such substitution matrices are reflecting the fact that the likelihood of one amino acid being substituted with another during evolution varies and depends on the physical/chemical nature of the amino acid to be substituted. For example, the likelihood of a polar amino acid being substituted with another polar amino acid is higher compared to being substituted with a hydrophobic amino acid. Therefore, the scoring matrix will assign the highest score for identical amino acids, lower score for non-identical but similar amino acids and even lower score for non-identical non- similar amino acids. The most frequently used scoring matrices are the PAM matrices (Dayhoff et al. (1978), Jones et al. (1992)), the BLOSUM matrices (Henikoff and Henikoff (1992)) and the Gonnet matrix (Gonnet et al. (1992)).

Suitable computer programs for carrying out such an alignment include, but are not limited to, Vector NTI (Invitrogen Corp.) and the ClustalV, ClustalW and ClustalW2 programs (Higgins DG & Sharp PM (1988), Higgins et al. (1992), Thompson et al. (1994), Larkin et al. (2007). A selection of different alignment tools are available from the ExPASy Proteomics server at www.expasv.org. Another example of software that can perform sequence alignment is BLAST (Basic Local Alignment Search Tool), which is available from the webpage of National Center for Biotechnology Information which can currently be found at http://www.ncbi.nlm.nih.gov/ and which was firstly described in Altschul et al. (1990) J. MoI. Biol. 215; 403-410. Once the software has produced an alignment, it is possible to calculate % similarity and % sequence identity. The software typically does this as part of the sequence comparison and generates a numerical result.

In one embodiment, it is preferred to use the ClustalW software for performing sequence alignments. Preferably, alignment with ClustalW is performed with the following parameters for pairwise alignment:

ClustalW2 is for example made available on the internet by the European Bioinformatics Institute at the EMBL-EBI webpage www.ebi.ac.uk under tools - sequence analysis - ClustalW2. Currently, the exact address of the ClustalW2 tool is www.ebi.ac.uk/Tools/clustalw2.

Thus, the present invention also encompasses the use of variants, homologues and derivatives of any amino acid sequence of a protein as defined herein, particularly those of SEQ ID Nos. 1, 1A, 2, 2a, 3, 4, 5 or 5a, defined herein.

The sequences, particularly those of SEQ ID Nos. 1, 1A, 2, 2a, 3, 4, 5 or 5a, may also have deletions, insertions or substitutions of amino acid residues which produce a silent change and result in a functionally equivalent substance. Deliberate amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues as long as the secondary binding activity of the substance is retained. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; and amino acids with uncharged polar head groups having similar hydrophilicity values include leucine, isoleucine, valine, glycine, alanine, asparagine, glutamine, serine, threonine, phenylalanine, and tyrosine.

The present invention also encompasses conservative substitution (substitution and replacement are both used herein to mean the interchange of an existing amino acid residue, with an alternative residue) that may occur i.e. like-for-like substitution such as basic for basic, acidic for acidic, polar for polar etc. Non-conservative substitution may also occur i.e. from one class of residue to another or alternatively involving the inclusion of unnatural amino acids such as ornithine (hereinafter referred to as Z), diaminobutyric acid ornithine (hereinafter referred to as B), norleucine ornithine (hereinafter referred to as O), pyriylalanine, thienylalanine, naphthylalanine and phenylglycine.

Conservative substitutions that may be made are, for example within the groups of basic amino acids (Arginine, Lysine and Histidine), acidic amino acids (glutamic acid and aspartic acid), aliphatic amino acids (Alanine, Valine, Leucine, Isoleucine), polar amino acids (Glutamine, Asparagine, Serine, Threonine), aromatic amino acids (Phenylalanine, Tryptophan and Tyrosine), hydroxyl amino acids (Serine, Threonine), large amino acids (Phenylalanine and Tryptophan) and small amino acids (Glycine, Alanine).

Replacements may also be made by unnatural amino acids include; alpha* and alpha-disubstituted* amino acids, N-alkyl amino acids*, lactic acid*, halide derivatives of natural amino acids such as trifluorotyrosine*, p-CI-phenylalanine*, p- Br-phenylalanine*, p-l-phenylalanine*, L-allyl-glycine*, β-alanine*, L-α-amino butyric acid*, L-γ-amino butyric acid*, L-α-amino isobutyric acid*, L-ε-amino caproic acid* 7- amino heptanoic acid*, L-methionine sulfone*^*, L-norleucine*, L-norvaline*, p-nitro-L- phenylalanine*, L-hydroxyproline* L-thioproline*, methyl derivatives of phenylalanine (Phe) such as 4-methyl-Phe*, pentamethyl-Phe*, L-Phe (4-amino)^#, L-Tyr (methyl)*, L-Phe (4-isopropyl)*, L-Tic (1,2,3,4-tetrahydroisoquinoline-3-carboxyl acid)*, L- diaminopropionic acid ^# and L-Phe (4-benzyl)*. The notation * has been utilised for the purpose of the discussion above (relating to homologous or non-conservative substitution), to indicate the hydrophobic nature of the derivative whereas # has been utilised to indicate the hydrophilic nature of the derivative, #* indicates amphipathic characteristics.

Variant amino acid sequences may include suitable spacer groups that may be inserted between any two amino acid residues of the sequence including alkyl groups such as methyl, ethyl or propyl groups in addition to amino acid spacers such as glycine or β-alanine residues. A further form of variation, involves the presence of one or more amino acid residues in peptoid form, will be well understood by those skilled in the art. For the avoidance of doubt, "the peptoid form" is used to refer to variant amino acid residues wherein the α-carbon substituent group is on the residue's nitrogen atom rather than the α-carbon. Processes for preparing peptides in the peptoid form are known in the art, for example Simon RJ et al. (1992), Horwell DC. (1995).

By way of example, the ADH may be selected from Pseudogluconobacter saccharoketogenes ADH (SEQ ID No 1), Pseudogluconobacter saccharoketogenes ADH (SEQ ID No 1A), Lactobacillus kefir ADH (SEQ ID No 2), Lactobacillus kefir ADH (SEQ ID No 2a), Saccharomyces cerevisiae ADH (SEQ ID No 3) or Thermoanaerobium brockii ADH (SEQ ID No 4), Escherichia coll ASD (SEQ ID No 5) or Escherichia coli ASD (SEQ ID No 5a).

In preferred embodiments, the ADH is selected from Pseudogluconobacter saccharoketogenes ADH (SEQ ID No 1), Pseudogluconobacter saccharoketogenes ADH (SEQ ID No 1A), Lactobacillus kefir ADH (SEQ ID No 2), Saccharomyces cerevisiae ADH (SEQ ID No 3) or Thermoanaerobium brockii ADH (SEQ ID No 4), or Escherichia coli ASD (SEQ ID No 5).

In one preferred embodiment, the ADH is selected from Pseudogluconobacter saccharoketogenes ADH (SEQ ID No 1) and Pseudogluconobacter saccharoketogenes ADH (SEQ ID No 1A).

In one aspect, preferably the sequence used in the present invention is in a purified form. The term "purified" means that a given component is present at a high level. The component is desirably the predominant active component present in a composition.

Isolated and/or purified

In one aspect, preferably the product according to the present invention is in an isolated form. The term "isolated" means that the product is at least substantially free from at least one other component with which the product is associated in the reaction mixture. In one aspect, preferably the product according to the present invention is in a purified form. The term "purified" means that a given component is present at a high level. The component is desirably the predominant component present in a composition. Preferably, it is present at a level of at least about 90%, or at least about 95% or at least about 98%, said level being determined on a dry weight/dry weight basis with respect to the total composition under consideration.

Concentration

The ADH enzyme used in the present invention may be present in any concentration to enable it to perform the required function of inhibiting biofilm formation. Suitably, the ADH is present in a concentration of about 0.05-500 ppm, preferably about 0.1- 200 ppm, more preferably about 0.1-100 ppm, even more preferably about 0.5-50 ppm, yet more preferably about 1-50 ppm, and most preferably about 1-10 ppm (by weight). If the alcohol dehydrogenase enzyme is provided as a composition, the composition will preferably be used in a concentration that provides alcohol dehydrogenase enzyme in the preferred concentration of the alcohol dehydrogenase enzyme given above.

Redox cofactors

As noted above, the ADH used in the present invention is a redox cofactor- dependent ADH, specifically a quinone- or NAD⁺/NADP⁺ redox cofactor-dependent ADH. ADH is preferably used in the present invention with a redox cof actor. In this specification the term 'redox cofactor' is defined as any non-protein chemical compound that assists the enzymatic redox reaction. The cofactor may be tightly bound or loosely bound to the enzyme, or unbound.

Cofactors can be divided into two broad groups: coenzymes and prosthetic groups. Coenzymes are small organic non-protein molecules that carry chemical groups between enzymes. These molecules are not bound tightly by enzymes and are released as a normal part of the catalytic cycle. In contrast, prosthetic groups form a permanent part of the protein structure.

In one embodiment, the cofactor is nicotinamide adenine dinucleotide (NAD⁺) or nicotinamide adenine dinucleotide phosphate (NADP⁺). When these compounds are used as the cofactor, the reaction typically proceeds with the reduction of NAD⁺ or NADP⁺ to NADH or NADPH respectively. In this specification the terms NAD⁺ and NADP⁺ encompasses the redox cofactors nicotinamide adenine dinucleotide (NAD⁺) or nicotinamide adenine dinucleotide phosphate whether in their oxidised (positively charged) form or their reduced form (usually described as NADH and NADPH).

NAD⁺ or NADP⁺ cofactors are particularly preferred when the ADH is an ADH enzyme in subclass 1.1.1 , particularly ADH enzymes in E.C. 1.1.1.1 or 1.1.1.2, or is an aldehyde reductase enzyme in subclass 1.2.1. NAD⁺ or NADP⁺ cofactors are especially preferred when the ADH is Lactobacillus kefir ADH (SEQ ID No 2), Saccharomyces cerevisiae ADH (SEQ ID No 3) or Thermoanaerobium brockii ADH (SEQ ID No 4).

The enzyme cofactors may be present in any concentration to enable the enzyme to perform the required function of inhibiting biofilm formation. Suitably, the NAD⁺ or NADP⁺ cofactor is present in a concentration of 0.01-5000 ppm by weight. More preferably, the NAD⁺ or NADP⁺ is present in a concentration of 0.10-1000 ppm by weight.

In another embodiment, the cofactor is a quinone cofactor. In this specification the term 'quinone cofactor' covers any compound including a 6-membered (saturated or partially unsaturated) ring having two carbonyl (>C=O) groups as ring substituents, and which is capable of acting as a cofactor for ADH. 1 ,4-quinones and 1 ,2-quinones, for example those of the general formulae below (wherein the wavy bonds represent attachments to the remainder of the molecule, including molecules wherein two bonds together with the carbon atoms to which they are attached form a ring) are preferred. Quinone cofactors are particularly preferred when the ADH is an ADH enzyme in subclass 1.1.5, particularly ADH enzymes in E.C. 1.1.5.2, and especially when the ADH enzyme is Pseudogluconobacter saccharoketogenes ADH (SEQ ID No 1), Pseudogluconobacter saccharoketogenes ADH (SEQ ID No 1A), or Escherichia coli ASD (SEQ ID No 5).

Preferably, the quinone cofactor is selected from from pyrroloquinoline quinone (PQQ), tryptophyl tryptophanquinone (TTQ), topaquinone (TPQ), and lysine tyrosylquinone (LTQ), the structures of which are set out below, or acceptable salts, esters or other derivatives thereof.

Acceptable salts of the quinone cofactors used in the present invention include the acid addition and base salts thereof. Suitable acid addition salts are formed from acids which form non-toxic salts. Examples include the acetate, adipate, aspartate, benzoate, besylate, bicarbonate/carbonate, bisulphate/sulphate, borate, camsylate, citrate, cyclamate, edisylate, esylate, formate, fumarate, gluceptate, gluconate, glucuronate, hexafluorophosphate, hibenzate, hydrochloride/chloride, hydrobromide/bromide, hydroiodide/iodide, isethionate, lactate, malate, maleate, malonate, mesylate, methylsulphate, naphthylate, 2-napsylate, nicotinate, nitrate, orotate, oxalate, palmitate, pamoate, phosphate/hydrogen phosphate/dihydrogen phosphate, pyroglutamate, saccharate, stearate, succinate, tannate, tartrate, tosylate, trifluoroacetate and xinofoate salts. Suitable base salts are formed from bases which form non-toxic salts. Examples include the aluminium, arginine, benzathine, calcium, choline, diethylamine, diolamine, glycine, lysine, magnesium, meglumine, olamine, potassium, sodium, tromethamine and zinc salts.

Acceptable esters of the quinone cofactors used in the present invention, in particular PQQ, include (C_1-6)alkyl esters, haloOD^alkyl esters, hydroxy(C_1-6)alkyl esters and (C_1-6)alkoxy(C_1-6)alkyl esters, and benzyl esters. Other acceptable derivatives include N-oxide derivatives.

PQQ TPQ

TTQ LTQ

More preferably, the quinone cofactor is pyrroloquinoline quinone (PQQ) or an acceptable salt, ester or other derivative thereof.

When the quinone cofactor is pyrroloquinoline quinone (PQQ), the PQQ may be made synthetically, for example as described in Buchi, G., J. H. Botkin, G. C. M. Lee, and K. Yakushijin, J. Am. Chem. Soc. (1985) 107, 5555-5556. Alternatively, the PQQ may be obtained from natural sources, particularly foods, as described for example in Kumazawa et al., Biochem. J. (1995) 307, 331-333. Examples of foodstuffs containing PQQ include broad bean, green soybeans, potato, sweet potato, parsley, cabbage, carrot, celery, green pepper, spinach, tomato, apple, banana, kiwi fruit, orange, papaya, green tea, oolong (tea), cola, whiskey, wine, sake, bread, fermented soybeans (natto), miso (bean paste) and tofu (bean curd). Preferred sources of PQQ are plant extracts. A particularly preferred source of PQQ is green tea or green tea extract, as this is cheap and widely available.

When the quinone cofactor is PQQ, the PQQ is preferably present in a concentration of 0.01-1000 ppm, such as e.g., 0.1-500 ppm, 0.15-250 ppm or 0.2-100 ppm. More preferably, the PQQ is present in a concentration of 0.25-10 ppm.

When a quinone is used as cofactor with the ADH enzyme, a metal ion is preferably also used in conjunction with the ADH and quinone. Without wishing to be bound by theory, it is believed that the metal ion coordinates to the quinone and the substrate, thereby assisting transfer of hydrogen from the substrate to the quinone. Examples of suitable metal ions include alkali metal ions such as lithium, sodium and potassium ions, alkaline earth metal ions such as magnesium and calcium ions, and transition metal ions such as iron, manganese, cobalt, copper, molybdenum and zinc ions, or any combination thereof. Divalent or trivalent metal ions are preferred and calcium ions or iron (Fe²⁺ / Fe³⁺) ions or any combination thereof are particularly preferred.

According to Toyama et a/, Arch. Biochem. Biophys. (2004) 428, 10-21, quino(hemo)protein alcohol dehydrogenases (ADH) that have pyrroloquinoline quinone (PQQ) as cofactor are classified into 3 groups, types I, II, and III. Type I ADH is a simple quinoprotein having PQQ as the only cofactor, while type Il and type III ADHs are quinohemoprotein having heme c as well as PQQ in the catalytic polypeptide. Type Il ADH is a soluble periplasmic enzyme and is widely distributed in Proteobacteria such as Pseudomonas, Ralstonia, Comamonas, etc. In contrast, type III ADH is a membrane-bound enzyme working on the periplasmic surface solely in acetic acid bacteria. It consists of three subunits that comprise a quinohemoprotein catalytic subunit, a triheme cytochrome c subunit, and a third subunit of unknown function. The present invention embraces compositions and methods using all three types of ADH as defined in the above article; Type I ADH is preferred. Carriers

Alcohol dehydrogenase may be used in the present invention alone, i.e. in the absence of a carrier. However, the ADH is preferably used in conjunction with an acceptable carrier, ie a non-toxic carrier which does not significantly affect the biofilm inhibition (antifouling) properties of the ADH. Suitably, the carrier renders the ADH enzyme stable in the antifouling composition and in antifouling applications.

Examples of suitable carriers include buffers, granulation binders, liquid vehicle (diluent), disintegrant, flow agents, and lubricants.

Suitable buffers include, for example, acetate, carbonate/bicarbonate, citrate or phosphate buffers, and mixtures thereof. Suitable liquid vehicles (diluents) include, for example, water, ethanol, propylene glycol and glycerol, and mixtures thereof. Suitable granulation binders include, for example, polyvinylpyrrolidone, hydroxypropylmethylcellulose, hydroxypropylcellulose, sucrose, maltose, gelatine and acacia. Suitable disintegrants include, for example, starch (preferably corn, potato or tapioca starch), sodium starch glycollate, croscarmellose sodium, and mixtures thereof. Suitable lubricants include, for example, magnesium stearate, stearic acid, glyceryl behenate and talc, and mixtures thereof.

The enzyme may be provided in a liquid, a powder / granular or tablet form. The powder may be prepared by spray drying an enzyme solution that may be buffered (e.g. with citrate or phosphate). The solution may also contain salt (e.g. NaCI, KCI) or sugar (e.g. maltodextrin or sucrose). Further it could be a slurry containing insoluble particles (e.g. starch or microcrystalline cellulose). The above powder may be agglomerated in a fluid bed. The agglomerate may either be used directly or being further processed to tablets, which may besides the agglomerate, contain may contain a carrier such as those defined and exemplified above.

Optionally, the antifouling composition of the present invention further comprises a binder to immobilise at least one of the constituents, optionally to immobilise the enzymes. Optionally, the antifouling composition of the present invention may be formulated such that at least one of the constituents, in particular the enzyme, is encapsulated and/or immobilised and/or entrapped and/or cross-linked. Examples of such methods are described in Cao (2006), "Carrier-bound Immobilized Enzymes", Wϊley- VCH Verlag GmbH & Co., or silica-based encapsulation compositions and methods as described in more detail below.

The antifouling compositions of the present invention may be formulated as coatings, lacquers, stains, enamels and the like, hereinafter referred to generically as "coating(s)".

Thus, in one aspect the present invention provides a coating comprising an antifouling composition as defined above.

Preferably, the coating is formulated for treatment of any surface that is in contact with water ranging from humid from time to time to constant immersion in water and thus has the potential to be fouled. More preferably, the surface is selected from outdoor wood work, external surface of a central heating system, bathroom walls, the hull of a marine vessel or any off-shore installations, and surfaces in food production / packaging and/or any other industrial processes.

When the antifouling composition of the present invention is formulated as a coating, the carrier for the coating may comprise a liquid vehicle (solvent) for dissolving or suspending the composition. The liquid vehicle may be selected from any liquid which does not interfere with the activities of any essential components of the composition. In particular, the liquid vehicle should not interfere significantly with the activity of the anti-foulant ADH enzyme(s). In this regard, suitable liquid vehicles are disclosed in US 5071479 and include water and organic solvents including aliphatic hydrocarbons, aromatic hydrocarbons, such as xylene, toluene, mixtures of aliphatic and aromatic hydrocarbons having boiling points between 100 and 32O⁰C, preferably between 150 and 230⁰C; high aromatic petroleum distillates, e.g., solvent naphtha, distilled tar oil and mixtures thereof; alcohols such as butanol, octanol and glycols; vegetable and mineral oils; ketones such as acetone; petroleum fractions such as mineral spirits and kerosene, chlorinated hydrocarbons, glycol esters, glycol ester ethers, derivatives and mixtures thereof. The liquid vehicle may contain at least one polar solvent, such as water, in admixture with an oily or oil-like low-volatility organic solvent, such as the mixture of aromatic and aliphatic solvents found in white spirits, also commonly called mineral spirits.

The vehicle may typically contain at least one of a diluent, an emulsifier, a wetting agent, a dispersing agent or other surface active agent. Examples of suitable emulsifiers are disclosed in US 5071479 and include nonylphenol-ethylene oxide ethers, polyoxyethylene sorbitol esters or polyoxyethylene sorbitan esters of fatty acids, derivatives and mixtures thereof.

Any suitable surface coating material may be incorporated in the composition and/or coating of the present invention. Examples of trade-recognized coating materials are polyvinyl chloride resins in a solvent based system, chlorinated rubbers in a solvent based system, acrylic resins and methacrylate resins in solvent based or aqueous systems, vinyl chloride-vinyl acetate copolymer systems as aqueous dispersions or solvent based systems, butadiene copolymers such as butadiene-styrene rubbers, butadiene-acrylonitrile rubbers, and butadiene-styrene-acrylonitrile rubbers, drying oils such as linseed oil, alkyd resins, asphalt, epoxy resins, urethane resins, polyester resins, phenolic resins, derivatives and mixtures thereof.

The antifouling composition and/or coating of the present invention may contain pigments selected from inorganic pigments, such as titanium dioxide, ferric oxide, silica, talc, or china clay, organic pigments such as carbon black or dyes insoluble in aqueous media, preferably sea water, derivatives and mixtures thereof.

The antifouling composition and/or coating of the present invention may contain materials such as rosin to provide controlled release of the anti-foulant compound, rosin being to a very slight extent soluble in sea water.

The antifouling composition and/or coating of the present invention may contain plasticisers, rheology characteristic modifiers, other conventional ingredients and mixtures thereof. The antifouling composition of the present invention, particularly when formulated as a coating, may further comprise an adjuvant conventionally employed in compositions used for protecting materials exposed to an aquatic environment. Examples of suitable adjuvants include additional fungicides, auxiliary solvents, processing additives such as defoamers, fixatives, plasticisers, UV-stabilizers or stability enhancers, water soluble or water insoluble dyes, color pigments, siccatives, corrosion inhibitors, thickeners or anti-settlement agents such as carboxymethyl cellulose, polyacrylic acid or polymethacrylic acid, anti-skinning agents, derivatives and mixtures thereof, as well as those substances listed above in relation to carriers.

Encapsulation

Silica particles are hard and insoluble in both aqueous and organic solvents and are thus believed to provide an optimal encapsulation for alcohol dehydrogenase enzymes in an anti fouling system. A procedure for co-precipitation of silicate and enzymes has previously been developed (and described in US2005/0158837). A mixture of enzyme and a polycationic polymer is mixed with a phosphate buffered silicate solution (PBSi) resulting in the formation of a colloidal co-precipitate consisting of the enzyme and the polycation within a hydrated, amorphous silica matrix.

Furthermore, the present invention provides a one-step formulation process which allows simplified formulation of the antifouling ADH composition for paint.

In one preferred aspect the encapsulated alcohol dehydrogenase enzyme is a co- precipitate of an enzyme, a silicate and a N-containing organic template molecule. Preferably the N-containing organic template molecule is a polyamine, a modified polyamine, polyethyleneimine, a polypeptide or a modified polypeptide.

In one preferred aspect the silicate is obtained by neutralising an alkali metal silicate.

In one preferred aspect the encapsulated alcohol dehydrogenase enzyme is obtained by or is obtainable by hydrolysing an organosilicate and adding a buffer. In one preferred aspect the encapsulated alcohol dehydrogenase enzyme is a co- precipitate of an alcohol dehydrogenase enzyme, a silicate and polyethyleneimine. Preferably the enzyme: polyethyleneimine ratio is from about 1 to about 20, such as 2 to about 15, or such as from about 5 to about 15, or such as from about 5 to about 10, or from 0.3 to about 10, or from about 0.5 to about 5, or from about 0.7 to about 2, or from about 0.75 to about 1.25.

A silicate or organosilicate solution for encapsulating the alcohol dehydrogenase enzyme may be prepared from silica precursors. For the purposes of the invention, a silicate precursor is an organic or inorganic substance that can give rise to silicon dioxide (SiO₂, silica) under selected conditions.

A silicate solution is a solution containing soluble silicon dioxide in the form of silicate or oligosilicate salts. The silicate solution used in the method is prepared by mixing a dilute alkali metal silicate solution or alkyl siliconate salt solution with an aqueous solution or an acidic resin to reduce the pH to 12 or lower to form a buffered silicate solution, such as a phosphate-buffered solution. The aqueous solution that reduces the pH of the alkali metal silicates or alkyl siliconate salts to 12 or lower, can be an acid, an acidic solution, or a low pH buffer. Acids useful for neutralization include phosphoric acid, citric acid, acetic acid, hydrochloric acid and the like. Weak acids such as phosphoric acid, citric acid, and acetic acid are preferred and phosphoric acid is more preferred. Acid resins useful for neutralization include Amberlite'"IR- 120+, which is a strongly acidic cation exchanger (available from Aldrich, Wl, USA).

Silicate precursors useful for the present invention include alkali metal silicates and alkyl siliconate salts. Alkali metal silicates include sodium silicates (e.g. sodium metasilicate, sodium orthosilicate and sodium silicate solutions), potassium silicates, and cesium silicates. Preferred alkali metal silicates are sodium silicates and potassium silicates.

Preferred alkali metal silicates include sodium silicates. Sodium silicates are commercially available. For example, sodium metasilicate and sodium orthosilicate can be obtained from Gelest Inc. (Morrisville, PA, USA). Sodium silicate solution (a solution of SiO₂ and NaOH) can be obtained from Sigma Aldrich. Alkyl siliconate salts include sodium alkyl siliconate, potassium alkyl siliconate, and cesium alkyl siliconate. Preferred alkyl siliconate salts are sodium alkyl siliconate and potassium alkyl siliconate. A preferred alkyl siliconate salt is sodium methyl siliconate. In this embodiment, the Si-OH groups capable of condensation with gel formation are generated by the protonation of Si-O-metal groups, such as an alkyl siliconate, e.g. sodium methylsiliconate, MeSi(ONa)₃.

The silicate solution may be prepared by first hydrolyzing tetraalkylorthosilicate with an acid, a base, or a catalyst, to form silicate sols. Silicate sols are defined as a stable colloidal solution of silicate oligomers where the particle size is in the nanometer range. Silicate sols can undergo gelation or precipitation when exposed to a change in pH or a catalyst (Her, R.K. The Chemistry of Silica¹ (Wiley, 1979); Brinker, CJ. and Scherer, G.W. 'Sol Gel Science: The Physics and Chemistry of Sol- Gel Processing¹ (Academic Press, 1990)). Silicate sols are then added to a buffer, an acid or a base to form a silicate solution having a pH of about 2 to about 12, more preferably about 4 to about 10 and most preferably about 5 to about 9. Examples of tetraalkylorthosilicates include tetramethylorthosilicate (TMOS) and tetraethyl- orthosilicate (TEOS).

An organosilicate solution is a solution containing soluble silicon dioxide in the form of silicate or oligosilicate salts and an organosilane, a silane containing at least one silicon-carbon (Si-C) bond. The organosilicate solution used in the method is prepared by first hydrolyzing a tetraalkylorthosilicate and one or more organosilanes selected from the group consisting of alkyltrialkoxysilane, aryltrialkoxysilane, dialkyldialkoxysilane, and diaryldialkoxysilane, to form sols at either an acidic pH (pH 1-6) or a basic pH (pH 8-13). A preferred acidic pH is, for example, pH 1-5, or pH 1.5-4. A preferred basic pH is, for example, pH 9-12. The sols are then added to a buffer, an acid, or a base to form an organosilicate solution having a pH of about 2 to about 12, preferably a pH of about 4 to about 10 and more preferably a pH of about 5 to about 9. For example, phenyltriethoxysilane (PTES) is hydrolyzed with an aqueous acid to form a phenylsilsesquioxane sol (PPSQ), which is combined with a silicate sol derived from a tetraethylorthosilicate and added to a buffer to form an organosilicate solution. The ratio of the organosilane to silicate precursor ranges from about 1: 100 to about 10: 1 , preferably, about 1: 50 to about 2: 1 and preferably about 1: 10 to about 1: 1 on a molar basis. Combinations

The ADH enzyme may be used according to the present invention in combination with one or more further active agents. Such combinations may offer advantages, including synergy, when used together in an antifouling composition.

In particular, the ADH enzyme may be used in combination with green tea. Green tea has been shown to posses antimicrobial activity by itself (Friedman 2007, MoI Nutr Food Res. Jan;51(1):116-34). Green tea provides antimicrobial compounds including polyphenol^ compounds and, as noted above, is a source of the pyrroloquinoline quinone (PQQ) cofactor used in conjunction with some of the ADH enzymes used in the present invention. A combination of ADH and green tea is expected to be especially advantageous.

In particular, the ADH enzyme may be used according to the present invention in combination with one or more further enzymes as active agents. Such combinations may offer advantages, including synergy, when used together in an antifouling composition.

In one embodiment, the further enzyme is another ADH enzyme, so that two (or more) different ADH enzymes are used in combination. This may be particularly advantageous as some ADH enzymes may be more active than others on different components of the biofilm.

In another embodiment, the further enzyme is a protease. It is known in the art that proteases (especially serine protease (EC 3.4.21)) have antifouling activity - see for example US 5411666, US 5919689, EP 590746A and EP 1272570A. Preferred are the serine proteases classified in EC 3.4.21 , especially serine protease (E. C. 3.4.21.62).

Preferred are proteases of bacterial origin, particularly Bacillus suhtilis proteases or Bacillus licheniformis proteases.

Where present, the protease is suitably present in a concentration of 0.1-500 ppm, preferably 1-100 ppm, more preferably 1-60 ppm and most preferably 1-20 ppm. In another embodiment, the further enzyme is a mannanase. Use of mannanases to inhibit biofilm formation is also known in the art: see for example Dow et al, Proc Natl Acad Sci USA, (2003) 100(19) .10995- 11000. Preferred are the mannanases classified in EC 3.2.1.78.

Where present, the mannanase is suitably present in a concentration of 0.1-500 ppm, preferably 1-100 ppm, more preferably 1-60 ppm and most preferably 1-20 ppm.

Applications

According to the present invention, ADH is used (with or without a carrier) to inhibit fouling. In particular, ADH is used to inhibit biofilm formation (microfouling).

Thus, the present invention comprises in an alternative aspect a method of inhibiting biofilm formation on an article, comprising contacting the article with an alcohol dehydrogenase selected from a quinone redox cofactor-dependent ADH and a nicotinamide adenine dinucleotide (NAD⁺) or nicotinamide adenine dinucleotide phosphate (NADP⁺) redox cofactor-dependent ADH. In preferred embodiments, the biofilm is a bacterial biofilm.

In the above method, the ADH may be used alone (in the absence of a carrier) or together with a carrier in the form of a composition, as described and exemplified above.

In the methods of the invention, the ADH is as defined above, either in the broadest aspect or any of the preferred aspects described herein.

In preferred methods, the alcohol dehydrogenase or antifouling composition comprising alcohol dehydrogenase is added to the aqueous medium in contact with the article. In alternative preferred methods, the antifouling composition is provided as a coating on the article.

In preferred methods, the alcohol dehydrogenase is not lipid coated. In preferred methods, the alcohol dehydrogenase is present in an amount of about 0.05-500 ppm by weight, more preferably about 0.1-100ppm by weight, still more preferably about 1-10 ppm by weight and most preferably about 2-5 ppm by weight.

The alcohol dehydrogenase used in the methods of the invention is a cofactor- dependent alcohol dehydrogenase. Suitably, the method of the invention additionally comprises contacting the article with a redox cofactor, such as those described and exemplified above.

In preferred methods, the redox cofactonADH molar ratio is between 0.02:1 and 600:1 , more preferably between 0.5:1 and 40:1, still more preferably between 1 :1 and 30:1 , and most preferably between 5:1 and 20:1.

In preferred methods, the alcohol dehydrogenase enzyme is selected from Pseudogluconobacter saccharoketogenes ADH (SEQ ID No 1), Pseudogluconobacter saccharoketogenes ASD (SEQ ID No 1A), and Escherichia co// ADH (SEQ ID No. 5) or an alcohol dehydrogenase enzyme having at least 70% sequence identity thereto, in particular at least 75%, such as at least 80%, e.g. at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

In alternative preferred methods, the alcohol dehydrogenase enzyme is selected from Lactobacillus kefir ADH (SEQ ID No 2), Saccharomyces cerevisiae ADH (SEQ ID No 3) or Thermoanaerobium brockii ADH (SEQ ID No 4) or an alcohol dehydrogenase enzyme having at least 70% sequence identity to any thereof, in particular at least 75%, such as at least 80%, e.g. at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to any thereof.

In one preferred method according to the invention, the redox cofactor is a quinone cofactor, particularly a quinone cofactor selected from pyrroloquinoline quinone (PQQ), tryptophyl tryptophanquinone (TTQ), topaquinone (TPQ), and lysine tyrosylquinone (LTQ). Preferably the redox cofactor is pyrroloquinoline quinone (PQQ). Suitably, the PQQ is derived from green tea extract.

In one preferred method according to the invention, the PQQ is present in a concentration of 0.01-1000 ppm, more preferably 0.10-500 ppm, still more preferably 0.25-10 ppm (by weight). In one preferred method according to the invention, the PQQ:ADH molar ratio is between 0.02:1 and 600:1, more preferably between 0.5:1 and 40:1, still more preferably between 1:1 and 30:1, and most preferably between 5:1 and 20:1.

In one preferred method according to the invention, the article is further contacted with a metal ion, as described and exemplified above. Suitably, the metal ion is a Fe²⁺ or Fe³⁺ ion.

In one preferred method according to the invention, the redox cofactor is selected from nicotinamide adenine dinucleotide (NAD⁺) or nicotinamide adenine dinucleotide phosphate (NADP⁺). Suitably, the NAD⁺ or NADP⁺ cofactor is present in a concentration of about 0.01-5000 ppm by weight. More preferably, the NAD⁺ or NADP⁺ cofactor is present in a concentration of about 0.10-1000 ppm by weight.

In one preferred method according to the invention, the article is further contacted with an additional active ingredient, examples of which are described above in relation to combinations. Suitably, the additional active ingredient is an additional enzyme.

In one preferred method according to the invention, the additional enzyme is a second, different ADH enzyme.

In an alternative preferred method according to the invention, the additional enzyme is a protease, preferably a serine protease (E.G. 3.4.21.62). Where present, the protease is suitably present in a concentration of about 0.1-500 ppm, preferably about 1-20 ppm (by weight).

In an alternative preferred method according to the invention.the additional enzyme is a mannanase, preferably a mannanase classified in EC 3.2.1.78. Where present, the mannanase is suitably present in a concentration of about 0.1-500 ppm, more preferably about 1-20 ppm (by weight). Articles

The invention further comprises an article provided with an antifouling composition as defined above. Preferably, wherein the antifouling composition is provided as a coating on the article.

Preferably, the article is selected from a hull of a marine vessel, a medical device, a contact lens, food processing apparatus, paper manufacturing apparatus, oil recovery and processing apparatus, an offshore installation (for example an oil rig or production platform), drinking water dispensing apparatus, a pipeline, a cable, a fishing net, a pillar of a bridge, the external surface of a central heating system, a port building or installation.

EXAMPLES

The PQQ-ADH enzyme used in the examples is SEQ ID NO. 1a, which is the enzyme prepared in "preparation 1".

Materials

Marine minimal medium (MMM): Five mL of trace element solution (1000 mg/L FeCI₂-2H₂O, 70 mg/L ZnCI₂,80 mg/L MnCI₂,6 mg/L H₃BO₃, 130 mg/L CoCI₂-6H₂O,2 mg/L CuCI₂-2H₂O, 34 mg/L NiCI₂-2H₂O, 36 mg/L Na₂MoO₄-2H₂O in 50 mM HCI) and glucose to a final concentration of 10 mM was added to 1 L of Base medium (2.44 g/L Na₂HPO₄, 1.52 g/L KH₂PO₄, 0.50 g/L (NH₄)₂SO₄, 0.20 g/L MgSO₄-7H₂O, 0.05 g/L CaCI₂-2H₂O, 29.22 g/L NaCI).

Artificial sea water (ASW): 24.0 g/L NaCI, 5.1 g/L MgCI₂, 4.0 g/L Na₂SO₄, 1.1 g/L CaCI₂, 0.67 g/L KCI, 0.098 g/L KBr, 0.027 g/L H₃BO₃, 0.024 g/L SrCI₂, 0.003 g/L NaF, 0.196 g/L NaHCO₃.

Phosphate buffered saline (PBS) pH 7.4: 137 mM NaCI, 27 mM KCI, 100 mM Na₂HPO₄, 2 mM K₂HPO₄. pH adjusted to 7.4. Bacterial strains:

The marine bacterium Cobetia marina (DSMZ 4741) was cultured in marine minimal medium pH 8.2) at 25 ⁰C to an OD₆oo of 0.8-1.0 (overnight). The cells were harvested and resuspended in ASW to an OD₆₀₀ of 0.3.

Listeria innocua was cultured in LB medium at 25 °C to an OD₆₀O of 0.8-1.0 (overnight). The cells were resuspended in PBS pH 7.4 to an OD₆₀₀Of 0.3.

Enzyme preparations:

Pseudogluconobacter saccharoketogenes alcohol dehydrogenase (PsADH) (Ace BAB62258) was prepared as described in Preparation 1 below.

Escherichia coli ASD (EcASD) (Ace NP_415358) was prepared as described in Preparation 2 below.

Lactobacillus kefir ADH [LkADH) was obtained from Sigma (05643) (Ace AAP94029).

Saccharomyces cerevisiae ADH (ScADH) was obtained from Sigma (A 3263) (Ace CAA91578).

Thermoanaerobium brockii ADH (7IbADH) was obtained from Sigma (A8435) (Ace CAA46053).

Proteases:

Properase 1600L (Genetically modified bacterial serine endoprotease), Purafect 4000L (serine protease derived from a genetically modified strain of Bacillus subtilis), Protex 6L (serine protease (EC 3.4.21.62) derived from Bacillus licheniformis), were obtained from Genencor. Other enzymes:

Mannastar (mannanase EC 3.2.1.78) and Hexose oxidase (EC 1.1.3.5) were obtained from Genencor.

Co-factors:

Pyrroloquinoline quinone (PQQ) was obtained from Sigma (D7783)

Green tea extract: Guardian, Green Tea Extract, were obtained from Danisco.

Nicotinamide Adenine Dinucleotide Phosphate (NADP+) was obtained from Sigma (N0505): 15 mM NADP⁺ solution was freshly prepared each time. NADP⁺ was added to a final concentration of 750 μM in the assays when the tested enzyme was NADP⁺ dependent.

Preparation 1 : Pseudoαluconobacter saccharoketogenes ADH

The gene encoding the Pseudogluconobacter saccharoketogenes PQQ-dependent alcohol dehydrogenase gene (PQQ-ADH) was synthesized as a codon optimized fragment, including its own signal sequence, and cloned into the pDONR/Zeo via the Gateway® BP recombination reaction (Invitrogen, Carlsbad, CA, USA) resulting in the entry vector pENTRY-ADH (Fig. 2). SEQ ID No. 6 shows the DNA sequence of the codon optimized PQQ-ADH gene (from Geneart AG (Regensburg, Germany)). Shown in italics are the sequences flanking the PQQ-ADH ORF. These flanking sequences contain the attB sites that facilitate the Gateway® BP dependent cloning of the gene into pDONR/Zeo.

To enable the expression of the PQQ-ADH in Pichia pastoris, the gene was cloned from pENTRY-ADH into pPIC2-DEST (Fig. 3) via the Gateway® LR recombination reaction. The resulting plasmid, pPIC2-ADH (Fig. 4) was linearized by Sail digestion, enabling integration of the construct into the HIS4 locus of P. pastoris GS115 upon transformation. This vector contains the P. pastoris strong AOX1 promoter, allowing for strong methanol-inducible gene expression. For production of PQQ-ADH, P. pastoris: :pPIC2-ADH was grown in a 2 liter B. Braun Biostat B fermentor according to standard P. pastoris fermentation protocols (Invitrogen, Carlsbad, CA USA). During fermentation the major fraction of the expressed PQQ-ADH was found in the culture supernatant, with levels reaching 100- 400 mg/l 72 hours after the start of methanol induction. The N-terminus of the mature protein was found to start at position 37 of the coding part, thus starting with AEPSKAGQSA.

The N-terminus of the PsADH expressed by Pichia pastoris was determined by Edman degradation and analysis on a Procise® cLC capillary 491 protein sequencing system (Applied Biosystems).

Figure 3 is a plasmid map of the P. pastoris destination vector pPIC2-DEST, which was derived from pPIC3.5K (Invitrogen). The vector contains the methanol inducible AOX1 promoter (PAOX1) and the AOX transcription terminator (AOX-TT). The Gateway® cassette was inserted between promoter and terminator of pPIC3.5K, and consists of the recombination sites attR1 and 2, the chloramphenicol resistance marker (cmR) and ccdB gene for negative selection in the Gateway® cloning procedure. Furthermore, the vector contains the HIS4 gene for selection in P. pastoris, the kanamycin (Kan) and ampicilin (Amp) resistance genes for selection in E. co// (Kan).

Preparation 2: Expression of a soluble aldose sugar dehydrogenase from Escherichia coli

Soluble aldose sugar dehydrogenase from E. coli was expressed as described in the paper of Southall et al, J. Biol. Chem. (2006) 281 (41) 30650-30659 with minor modifications.

The ylil gene coding for a E. coli soluble aldose sugar dehydrogenase, Asd, without its original leader sequence was amplified by PCR from E. coli K12 cells (TOP10 strain, Invitrogen) using PureTaq Ready-To-Go PCR beads (GE Healthcare).

A standard PCR reaction protocol was applied using the following set of primers: asdTNco, 5' CATGCCATGGCTCCTGCAACGGTAAATGTCGAA 3¹; asdBBam, 5¹ CGCGGATCCCTAGTGGTGGTGGTGGTGGTGAATGCGTGGGCTAACTTTAAGTA ATTC 3'. A δxHis tag was introduced at the COOH terminus of the polypeptide for its further purification. The PCR product obtained was digested with Ncol and BamHI restriction enzymes and cloned into the corresponding restriction sites of the pET-3d expression vector (Novogen). After sequence analysis, the resulting plasmid (Fig. 5) was transformed into E. coli BL21 (DE Lys) cells for production of recombinant protein. Single clones were grown overnight in LB broth (10 g/L Bacto Tryptone (Difco), 5 g/L Bacto Yeast Extract (Difco), 5 g/L NaCI) with 50 μg/ml of amplicilin and 34 μg/ml of chloramphenicol. This culture was used to infect 300 ml of LB medium with amplicilin. Culture was grown at 37° C until O.D.₅g_{0 nm} 1 0 followed by induction with 0.5 mM of isopropyl-b-D-thiogalactopyranoside (IPTG) for 6h at 30⁰C. Cells were harvested by centrifugation and the pellet was resuspended in 15 ml of a sonication buffer: 50 mM Na-phosphate, pH 7.5, 300 mM NaCI, 15 mM MgCI₂, 20 mM imidazole. After sonication, the cell debris was removed by centrifugation and a soluble fraction was loaded on a 3ml Ni²⁺ agarose column (Qiagen). The His-tagged Asd protein was eluted with 400 mM imidazole in the same buffer according to recommendations of the supplier. Fractions containing the protein were pooled, dialysed against the buffer containing 20 mM Tris-HCI, 100 mM NaCI, 1 mM CaCI2, pH 7.5 , and checked for enzymatic activity. Protein purity was confirmed by a SDS- PAGE analysis (Fig. 6).

Biofilm formation assays - General

Assays for enzymatic prevention of biofilm formation were performed in 96 well polystyrene microtitre plates. Prior to use, enzymes and/or cofactors were transferred to the relevant assay buffer (ASW for Cobetia marina and PBS for Listeria innocua) using a PD10 column. Unless otherwise stated PQQ was used in a final concentration of 75 ppm when PQQ dependent enzymes were included in the assay and NADP⁺ was included in a final concentration of 560 ppm when NADP⁺ dependent enzymes were used in the assays.

A 50% dilution series of the enzymes were made from column 1 to 12 using a total volume of 100 μL. The bacterial culture (100 μL) was then added. Control rows without enzyme and without bacteria and enzyme were always included. Each condition was assayed in duplicate on each plate and two replica plates were made. Biofilm were allowed to develop overnight (18-20 h) by incubation at 25°C with shaking at 750 rpm. To monitor potential growth, OD₆₀₀ was recorded before and after the overnight incubation. The liquid was then removed from the plates by inversion and the wells washed 3 times 5 min with 250 μl_ assay buffer and shaking at 750 rpm: the remaining cells were fixed with 200 μL 96 % ethanol for 15 min and the plates left to dry. The bacteria were stained with 100 μL 0.5 % crystal violet in water for 10 min. Excess stain were washed off with demineralised water using a microplate washer and the plates were left to dry. The crystal violet was then resolubilised into 100 μL 96 % ethanol for 15 min using shaking at 750 rpm and quantified by reading OD₅₄₀.

The change in biofilm formation was calculated as Percentage reduction (PR) compared to the amount of biofilm formed without enzymes added according to the formula below (see Leroy et a/. Biofouling (2008) 24(1 ):11-22):

where A₀ is OD₅₄₀ for a control without enzyme added, A_B is OD₅₄₀ for a control without bacteria and A_s is OD₅₄₀ for the sample.

Example 1 - Prevention of biofilm formation by P. saccharoketoaenes ADH (PsADH)

The potential capability of the PsADH to prevent biofilm formation on the polystyrene surface of a microtiter plate by the marine bacterium Cobetia marina was investigated. The assay was performed in artificial sea water (ASW) and in the presence of 100 ppm PQQ.

Figure 7 illustrates the prevention of biofilm formation by PsADH. The percentage reduction of biofilm formation by Cobetia marina is plotted against concentration of PsADH. Maximum inhibition is achieved at 2-5 ppm PsADH. A control experiment with boiled enzyme is shown with the dashed line.

As can be seen in Figure 7, PsADH efficiently prevents formation of up to 90% of the biofilm formed in the absence of enzyme. The biofilm prevention activity is lost when the enzyme is heat inactivated (dashed line). The cofactor PQQ alone results in a negative PR (-24 + 6) indicating that it actually slightly promotes biofilm formation (data not shown). In order to get a better understanding of the mechanism of biofilm prevention by PsADH a series of control experiments were performed. In order to exclude the hypothesis that the antifouling effect could be caused by production of hydrogen peroxide by the reaction of PsADH acting on traces of glucose or other hexoses in the medium, a control experiment was performed using hexose oxidase (HOX): if H₂O₂ were responsible, a similar effect would be observed when using HOX.

Figure 8 illustrates the prevention of biofilm formation by PsADH, HOX and catalase. The graphs indicate the percentage reduction in biofilm formation plotted against concentration of PsADH or HOX. Catalase was included in a fixed amount of 95 ppm in combination with gradients of HOX and PsADH where indicated. Catalase was included in the assays with PsADH and HOX in order to test if the observed effect was due to production of hydrogen peroxide.

As can be seen in Figure 8, HOX in low concentrations shows a small reduction in biofilm formation: however, at higher concentrations it promotes biofilm formation. The reduction never reaches the same efficiency as for PsADH.

As can be seen in Figure 8, there is no significant difference in the two curves "PsADH" and "PsADH, catalase" and therefore it seems that the effect is not caused by H₂O₂ production.

In summary, it can be concluded that PsADH in concentrations down to 2 ppm is able to efficiently prevent biofilm formation. The effect is not due to hydrogen peroxide production since catalase cannot antagonise the effect. The PQQ cofactor is preferred for optimal effect.

Example 2 - Green tea extract as source of PQQ

Green tea has been reported to contain PQQ (Kumazawa et a/ 1995, Biochem. J. (1995) 307, 331-333). Therefore, PQQ was replaced by green tea extract in the biofilm assays. However, it was difficult to quantify the amount of biofilm due to a high background staining by the green tea extract (results not shown). In order to overcome this problem 90 ppm PsADH and either 1 % or 2% green tea extract were mixed in order to allow for complex formation between PsADH and PQQ. Low molecular weight impurities were then removed by passing the solution through a PD10 desalting column equilibrated with ASW. The resulting solutions were used for biofilm assays as described above.

The results are shown in Figure 9, which indicates the percentage reduction in biofilm formation plotted against the concentration of PsADH for the two different concentrations of green tea extract. It is observed that the PsADH with green tea extract is able to prevent biofilm formation. However, higher enzyme concentrations (approx. 50 ppm) are needed for maximum effect compared to when purified PQQ is used (2-5 ppm). It is important to note that the experiments with green tea extract and purified PQQ canot be directly compared due to differences in background staining.

As a control, the effect of green tea extract PD10 treated as described above was tested in concentrations up to 20 000 ppm. No reduction in biofilm formation could be observed, on the contrary biofilm formation was promoted (PR of app -20) for >5000 PPM green tea extract (data not shown).

Taking the biofilm promotion effect of the green tea extract by itself into account, it may be concluded that green tea extract can be used as a PQQ source for PsADH in biofilm prevention applications.

Example 3 - Biofilm prevention by other related enzymes

Alcohol dehydrogenases from other sources were tested in order to identify if the biofilm prevention activity is a unique property of PsADH or other members of the ADH's show the same activity, and also to ensure that the biofilm prevention activity was not just towards the tested bacterial strain a number of the enzymes were tested in biofilm formation assays using a strain of Listeria innocua.

The tested enzymes included Lactobacillus kefir ADH (JLAADH), Saccharomyces cerevisiae ADH (ScADH), Thermoanaerobium brockii ADH (H)ADH) (NADP⁺ dependent) and E. coli ADH (EcADH). The results are shown in Figures 10 and 11.

Figure 10 illustrates the prevention of Cobetia marina biofilm formation, the graph indicating the percentage reduction in biofilm formation plotted against the concentration of the enzyme. The abbreviations used are as follows: Lactobacillus kefir ADH (LAADH) (NADP⁺ dependent), Saccharomyces cerevisiae ADH (ScADH), Thermoanaerobium brockii ADH (TbADH) (NADP⁺ dependent).

Biofilm prevention activity on the Listeria innocua is shown in Figure 11. The graphs indicate the percentage reduction in biofilm formation plotted against the concentration of the enzyme. Abbreviations are as follows: Lactobacillus kefir ADH (LkADH) (NADP⁺ dependent), Saccharomyces cerevisiae ADH (ScADH), Thermoanaerobium brockii ADH (TbADH) (NADP⁺ dependent), E. coli ASD - (EcASD) (PQQ dependent). As can be seen in Figure 11 , biofilm prevention activity is not an isolated phenomenon of PsADH but can also be found in ADH from other sources.

In summary, it can be concluded that the tested alcohol dehydrogenases show biofilm prevention activity against two different bacterial strains under highly different conditions (PBS and ASW).

Example 4 - Optimisation of PQQ concentration

The amount of required PQQ cofactor for efficient biofilm removal was assayed by using a constant concentration of 18 ppm PsADH and a gradient of PQQ in assays of Cobetia marina biofilm development.

The results are shown in Figure 12 which indicates the percentage reduction of biofilm development of Cobetia marina in the presence of 18 ppm PsADH plotted against the amount of PQQ.

As can be seen in Figure 12, for the specified concentration of PsADH, PQQ in concentrations as low as 1 ppm is sufficient to keep maximal activity. Below 0.25 ppm the PR drops to the level found when no PQQ is added (as previously seen in Figure 8). However, as shown in Figure 13, if too much PQQ is added, a negative effect can be observed. For the specified concentration of PsADH, the optimal concentration of PQQ appears to be between 1 and 10 ppm.

It is believed that it is the molar ratio of PQQ to PsADH that is important. The ratio can be calculated by taking the molecular weight of PsADH (36.5 kDA) and PQQ (330.206 g/mol) into account. The result of this calculation for the experiment shown in Figure 12 is shown in Figures 13 and 14 (wherein Fig. 14 is a zoom of Fig. 13 to show the detail for low PQQ: ADH ratios).

As can be seen in the figures PQQ has a positive effect when used in the ratio between 0.02:1 and 600:1. The maximal effect is observed for PQQ.ADH ratios between 2:1 and 20:1.

Example 5 - Combinations with proteases and mannanases

Biofilm prevention activity of different proteases and a mannanase on Cobetia marina was assayed as above. The results are shown in Fig. 15, which illustrates the percentage reduction in biofilm development of Cobetia marina plotted against the amount of enzyme.

It can be concluded that the tested enzymes can prevent biofilm formation by 80- 100 %. The proteases Protex and Purafect shows maximum activity from app 5 ppm, whereas Protex (protease) and Mannastar (mannanase) requires app 20 ppm for maximal activity.

Some aspects of the invention

Some aspects of the invention are provided in the following numbered paragraphs.

(1) An antifouling composition comprising, as an active ingredient, alcohol dehydrogenase (ADH) selected from a quinone redox cofactor-dependent ADH, a nicotinamide adenine dinucleotide (NAD⁺) or nicotinamide adenine dinucleotide phosphate (NADP⁺) redox cofactor-dependent ADH, together with a carrier.

(2) An antifouling composition according to paragraph 1 , wherein the alcohol dehydrogenase is not lipid coated.

(3) An antifouling composition according to paragraph 1 or paragraph 2, wherein a redox cofactor is used with the alcohol dehydrogenase. (4) An antifouling composition according to paragraph 3, wherein the redox cofactoπADH molar ratio is between 0.02:1 and 600:1 by weight.

(5) An antifouling composition according to paragraph 4, wherein the redox cofactor.ADH molar ratio is between 0.5:1 and 40:1 by weight.

(6) An antifouling composition according to paragraph 5, wherein the redox cofactor:ADH molar ratio is between 1:1 and 30:1 by weight.

(7) An antifouling composition according to paragraph 6, wherein the redox cofactonADH molar ratio is between 5:1 and 20:1 by weight.

(8) An antifouling composition according to any one of paragraphs 1 to 7, wherein the alcohol dehydrogenase is selected from alcohol dehydrogenases in enzyme class EC 1.1.5.

(9) An antifouling composition according to paragraph 8, wherein the alcohol dehydrogenase is selected from alcohol dehydrogenases in enzyme class EC 1.1.5.2.

(10) An antifouling composition according to paragraph 9, wherein the alcohol dehydrogenase enzyme is selected from Pseudogluconobacter saccharoketogenes ADH (SEQ ID No 1), Pseudogluconobacter saccharoketogenes ADH (SEQ ID No 1A) and Escherichia coli ASD (SEQ ID No. 5) or an alcohol dehydrogenase enzyme having at least 70% sequence identity thereto.

(11) An antifouling composition according to paragraph 10, wherein the alcohol dehydrogenase enzyme is selected from Pseudogluconobacter saccharoketogenes ADH (SEQ ID No 1), Pseudogluconobacter saccharoketogenes ADH (SEQ ID No 1A) and Escherichia coli ASD (SEQ ID No. 5) or an alcohol dehydrogenase enzyme having at least 75%, such as at least 80%, e.g. at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

(12) An antifouling composition according to any one of paragraphs 1 to 7, wherein the alcohol dehydrogenase is selected from alcohol dehydrogenases in enzyme class EC 1.1.1. (13) An antifouling composition according to paragraph 12, wherein the alcohol dehydrogenase is selected from alcohol dehydrogenases in enzyme classes EC 1.1.1.1 and EC 1.1.1.2.

(14) An antifouling composition according to paragraph 12 or paragraph 13, wherein the alcohol dehydrogenase enzyme is selected from Lactobacillus kefir ADH (SEQ ID No 2), Saccharomyces cerevisiae ADH (SEQ ID No 3) or Thermoanaerobium brockii ADH (SEQ ID No 4) or an alcohol dehydrogenase enzyme having at least 70% sequence identity to any thereof.

(15) An antifouling composition according to paragraph 14, wherein the alcohol dehydrogenase enzyme is selected from Lactobacillus kefir ADH (SEQ ID No 2), Saccharomyces cerevisiae ADH (SEQ ID No 3) or Thermoanaerobium brockii ADH (SEQ ID No 4) or an alcohol dehydrogenase enzyme having at least 75%, such as at least 80%, e.g. at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to any thereof.

(16) An antifouling composition according to any one of paragraphs 3 to 11, wherein the redox cofactor is a quinone cofactor.

(17) An antifouling composition according to paragraph 16, wherein the quinone cofactor is selected from pyrroloquinoline quinone (PQQ), tryptophyl tryptophanquinone (TTQ), topaquinone (TPQ), and lysine tyrosylquinone (LTQ).

(18) An antifouling composition according to paragraph 17, wherein the redox cofactor is pyrroloquinoline quinone (PQQ).

(19) An antifouling composition according to paragraph 18, wherein the PQQ is derived from green tea extract.

(20) An antifouling composition according to paragraph 18 or paragraph 19, wherein the PQQ is present in a concentration of 0.01-5000 ppm by weight.

(21) An antifouling composition according to paragraph 20, wherein the PQQ is present in a concentration of 0.10-1000 ppm by weight. (22) An antifouling composition according to paragraph 21, wherein the PQQ is present in a concentration of 0.25-10 ppm by weight.

(23) An antifouling composition according to paragraph 20 or paragraph 21 , wherein the PQQ.ADH molar ratio is between 0.02:1 and 600:1.

(24) An antifouling composition according to paragraph 23, wherein the PQQ:ADH molar ratio is between 0.5:1 and 40:1.

(25) An antifouling composition according to paragraph 24, wherein the PQQ:ADH molar ratio is between 1 :1 and 30:1.

(26) An antifouling composition according to paragraph 25, wherein the PQQ:ADH molar ratio is between 5:1 and 20:1.

(27) An antifouling composition according to any one of paragraphs 16 to 26, additionally containing a metal ion.

(28) An antifouling composition according to paragraph 27, wherein the metal ion is a Fe²⁺ or Fe³⁺ ion.

(29) An antifouling composition according to any one of paragraphs 3 to 7 or 12 to 15, wherein the redox cofactor is selected from nicotinamide adenine dinucleotide (NAD⁺) or nicotinamide adenine dinucleotide phosphate (NADP⁺).

(30) An antifouling composition according to paragraph 29, wherein the NAD⁺ or NADP⁺ cofactor is present in a concentration of 0.01-5000 ppm by weight.

(31) An antifouling composition according to paragraph 30, wherein the NAD⁺ or NADP⁺ is present in a concentration of 0.10-1000 ppm by weight.

(32) An antifouling composition according to any one of the preceding paragraphs, further comprising an additional active ingredient. (33) An antifouling composition according to paragraph 32, wherein the additional active ingredient is an additional enzyme.

(34) An antifouling composition according to paragraph 33, wherein the additional enzyme is a second, different ADH enzyme.

(35) An antifouling composition according to paragraph 33, wherein the additional enzyme is a protease.

(36) An antifouling composition according to paragraph 35, wherein the protease is a serine protease (E.C. 3.4.21.62).

(37) An antifouling composition according to paragraph 33, wherein the additional enzyme is a mannanase.

(38) An antifouling composition according to paragraph 37, wherein the mannanase is a mannanase classified in EC 3.2.1.78.

(39) An antifouling composition according to any one of the preceding paragraphs, wherein the ADH is immobilised to the surface of an article or to a carrier.

All publications mentioned in the above specification, and references cited in said publications, are herein incorporated by reference. Various modifications and variations of the described methods and system of the present invention will be apparent to those skilled in the art without departing from the scope and spirit of the present invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in molecular biology or related fields are intended to be within the scope of the following claims.

Claims

53Claims

1. A method of inhibiting biofilm formation on an article, comprising contacting the article with alcohol dehydrogenase (ADH) selected from the group consisting of a quinone redox cofactor-dependent ADH, a nicotinamide adenine dinucleotide (NAD⁺) redox cofactor-dependent ADH, a nicotinamide adenine dinucleotide phosphate (NADP⁺) redox cofactor-dependent ADH and any combination thereof.

2. A method according to claim 1 , wherein the alcohol dehydrogenase or antifouling composition comprising alcohol dehydrogenase is added to the aqueous medium in contact with the article.

3. A method according to claim 1 , wherein the antifouling composition is provided as a coating on the article.

4. A method according to any one of claims 1 to 3, wherein the alcohol dehydrogenase is not lipid coated.

5. A method according to any preceding claim wherein the alcohol dehydrogenase is present in an amount of about 0.05 to about 500 ppm by weight.

6. A method according to claim 5, wherein the alcohol dehydrogenase is present in an amount of about 0.1 to about IOOppm by weight.

7. A method according to claim 6, wherein the alcohol dehydrogenase is present in an amount of about 1 to about 10 ppm by weight.

8. A method according to claim 7, wherein the alcohol dehydrogenase is present in an amount of about 2 to about 5 ppm by weight.

9. A method according to any one of claims 1 to 8, additionally comprising contacting the article with a redox cofactor.

10. A method according to claim 9, wherein the redox cofactoπADH molar ratio is between 0.02:1 and 600:1. 54

11. A method according to claim 10, wherein the redox cofactorADH molar ratio is between 0.5:1 and 40:1.

12. A method according to claim 11, wherein the redox cofactorADH molar ratio is between 1:1 and 30:1.

13. A method according to claim 12, wherein the redox cofactoπADH molar ratio is between 5:1 and 20:1.

14. A method according to any one of claims 1 to 13, wherein the alcohol dehydrogenase is selected from alcohol dehydrogenases in enzyme class EC 1.1.5.

15. A method according to claim 14, wherein the alcohol dehydrogenase is selected from alcohol dehydrogenases in enzyme class EC 1.1.5.2.

16. A method according to claim 15, wherein the alcohol dehydrogenase enzyme is selected from Pseudogluconobacter saccharoketogenes ADH (SEQ ID No 1), Pseudogluconobacter saccharoketogenes ADH (SEQ ID No 1A), Escherichia coli ADH (SEQ ID No. 5) and Escherichia coli ADH (SEQ ID No. 5a) or an alcohol dehydrogenase enzyme having at least 70% sequence identity to any thereof.

17. A method according to claim 16, wherein the alcohol dehydrogenase enzyme is selected from Pseudogluconobacter saccharoketogenes ADH (SEQ ID No 1), Pseudogluconobacter saccharoketogenes ADH (SEQ ID No 1A), Escherichia coli ADH (SEQ ID No. 5) and Escherichia coli ADH (SEQ ID No. 5a) or an alcohol dehydrogenase enzyme having at least 75% (such as at least 80%, or at least 85%, or at least 90%, or at least 95%, or at least 96%, or at least 97%, or at least 98% or or at least 99%) sequence identity to any thereof.

18. A method according to any one of claims 1 to 13, wherein the alcohol dehydrogenase is selected from alcohol dehydrogenases in enzyme class EC 1.1.1. 55

19. A method according to claim 18, wherein the alcohol dehydrogenase is selected from alcohol dehydrogenases in enzyme classes EC 1.1.1.1 and EC 1.1.1.2.

20. A method according to claim 19, wherein the alcohol dehydrogenase enzyme is selected from Lactobacillus kefir ADH (SEQ ID No 2), Lactobacillus kefir ADH (SEQ ID No 2a), Saccharomyces cerevisiae ADH (SEQ ID No 3) or Thermoanaerobium brockii ADH (SEQ ID No 4) or an alcohol dehydrogenase enzyme having at least 70% sequence identity to any thereof.

21. A method according to claim 20, wherein the alcohol dehydrogenase enzyme is selected from Lactobacillus kefir ADH (SEQ ID No 2), Lactobacillus kefir ADH (SEQ ID No 2a), Saccharomyces cerevisiae ADH (SEQ ID No 3) or Thermoanaerobium brockii ADH (SEQ ID No 4) or an alcohol dehydrogenase enzyme having at least 75% (such as at least 80%, or at least 85%, or at least 90%, or at least 95%, or at least 96%, or at least 97%, or at least 98% or or at least 99%) sequence identity to any thereof.

22. A method according to any one of claims 9 to 17, wherein the redox cofactor is a quinone cofactor.

23. A method according to claim 22, wherein the quinone cofactor is selected from pyrroloquinoline quinone (PQQ), tryptophyl tryptophanquinone (TTQ), topaquinone (TPQ), and lysine tyrosylquinone (LTQ).

24. A method according to claim 23, wherein the redox cofactor is pyrroloquinoline quinone (PQQ).

25. A method according to claim 24, wherein the PQQ is derived from green tea extract.

26. A method according to claim 24 or claim 25, wherein the PQQ is present in a concentration of about 0.01 to about 5000 ppm by weight.

27. A method according to claim 26, wherein the PQQ is present in a concentration of about 0.10 to about 1000 ppm by weight. 56

28. A method according to claim 27, wherein the PQQ is present in a concentration of about 0.25 to about 10 ppm by weight.

29. A method according to claim 24 or claim 25, wherein the PQQ.ADH molar ratio is between 0.02:1 and 600:1.

30. A method according to claim 29, wherein the PQQ.ADH molar ratio is between 0.5:1 and 40:1.

31. A method according to claim 30, wherein the PQQ:ADH molar ratio is between 1 :1 and 30:1.

32. A method according to claim 31 , wherein the PQQ:ADH molar ratio is between 5:1 and 20:1.

33. A method according to any one of claims 22 to 32, additionally comprising contacting the article with a metal ion.

34. A method according to claim 33, wherein the metal ion is a Fe²⁺ or Fe³⁺ ion, or combinations thereof.

35. A method according to any one of claims 9 to 13, 20 or 21, wherein the redox cofactor is selected from nicotinamide adenine dinucleotide (NAD⁺) or nicotinamide adenine dinucleotide phosphate (NADP⁺).

36. A method according to claim 35, wherein the NAD⁺ or NADP⁺ cofactor is present in a concentration of about 0.01 to about 5000 ppm by weight.

37. A method according to claim 36, wherein the NAD⁺ or NADP⁺ is present in a concentration of about 0.10 to about 1000 ppm by weight.

38. A method according to any one of claims 1 to 37, further comprising contacting the article with an additional active ingredient.

39. A method according to claim 38, wherein the additional active ingredient is an additional enzyme. 57

40. A method according to claim 39, wherein the additional enzyme is a second, different ADH enzyme.

41. A method according to claim 40, wherein the additional enzyme is a protease.

42. A method according to claim 41 , wherein the protease is a serine protease (E.G. 3.4.21.62).

43. A method according to claim 41 or 42, wherein the protease is present in a concentration of about 0.1 to about 500 ppm by weight.

44. A method according to claim 43, wherein the protease is present in a concentration of about 1 to about 20 ppm by weight.

45. A method according to claim 39, wherein the additional enzyme is a mannanase.

46. A method according to claim 45, wherein the mannanase is a mannanase classified in EC 3.2.1.78.

47. A method according to claim 45 or 46, wherein the mannanase is present in a concentration of about 0.1 to about 500 ppm by weight.

48. A method according to claim 47, wherein the mannanase is present in a concentration of about 1 to about 20 ppm by weight.

49. A method according to any one of claims 1 to 48, wherein the biofilm comprises bacteria.

50. A method according to any one of the preceding claims, wherein the ADH is immobilised to the surface of an article or to a carrier.

51. An antifouling composition comprising, as an active ingredient, alcohol dehydrogenase (ADH) as defined in any one of claims 1 to 50, together with a carrier. 58

52. A coating comprising an antifouling composition as defined in claim 51.

53. A coating according to claim 52 formulated for treatment of the surface of an article selected from a hull of a marine vessel, a medical device, a contact lens, food processing apparatus, paper manufacturing apparatus, oil recovery and processing apparatus, an offshore installation (for example an oil rig or production platform), drinking water dispensing apparatus, a pipeline, a cable, a fishing net, a pillar of a bridge, the external surface of a central heating system, a port building or installation.

54. An article provided with an antifouling composition as defined in claim 51.

55. An article according to claim 54, wherein the antifouling composition is provided as a coating on the article.

56. An article according to claim 54 or 55 selected from a hull of a marine vessel, a medical device, a contact lens, food processing apparatus, paper manufacturing apparatus, oil recovery and processing apparatus, an offshore installation (for example an oil rig or production platform), drinking water dispensing apparatus, a pipeline, a cable, a fishing net, a pillar of a bridge, the external surface of a central heating system, a port building or installation.

57. A method of inhibiting biofilm formation on an article, comprising contacting the article with an antifouling composition as defined in claim 51.

58. Use of a composition as defined in claim 51 for inhibiting biofilm formation.

59. Use of an alcohol dehydrogenase selected from a quinone redox cofactor- dependent ADH, a nicotinamide adenine dinucleotide (NAD⁺) redox cofactor- dependent ADH, a nicotinamide adenine dinucleotide phosphate (NADP⁺) redox cofactor-dependent ADH, and any combinations thereof for inhibiting biofilm formation.

60. Use according to claim 52 or claim 53, wherein the biofilm comprises bacteria. 59

61. An amino acid sequence comprising SEQ ID No. 1A or an amino acid sequence having at least 75% amino acid sequence identity therewith but not SEQ ID No. 1.

62. An amino acid sequence according to claim 61 comprising SEQ ID No. 1A or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%, amino acid sequence identity therewith.

63. A nucleotide sequence encoding the amino acid sequence of claim 61 or claim 62.

64. A vector comprising the nucleotide sequence of claim 63.

65. A host transformed with the nucleotide sequence of claim 63 or the vector of claim 64.

66. A host according to claim 65 wherein the host is selected from a bacterial host, a fungal host or a yeast host.

67. A method comprising expressing the nucleotide sequence of claim 63 or the vector of claim 64.

68. An amino acid sequence comprising SEQ ID No. 2A or an amino acid sequence having at least 75% amino acid sequence identity therewith but not SEQ ID No. 2.

69. An amino acid sequence according to claim 68 comprising SEQ ID No. 2A or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%, amino acid sequence identity therewith.

70. A nucleotide sequence encoding the amino acid sequence of claim 68 or claim 69.

71. A vector comprising the nucleotide sequence of claim 70. 60

72. A host transformed with the nucleotide sequence of claim 70 or the vector of claim 71.

73. A host according to claim 72 wherein the host is selected from a bacterial host, a fungal host or a yeast host.

74. A method comprising expressing the nucleotide sequence of claim 70 or the vector of claim 71.

75. An amino acid sequence comprising SEQ ID No. 5A or an amino acid sequence having at least 75% amino acid sequence identity therewith but not SEQ ID No. 5.

76. An amino acid sequence according to claim 75 comprising SEQ ID No. 2A or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%, amino acid sequence identity therewith.

77. A nucleotide sequence encoding the amino acid sequence of claim 75 or claim 76.

78. A vector comprising the nucleotide sequence of claim 77.

79. A host transformed with the nucleotide sequence of claim 77 or the vector of claim 78.

80. A host according to claim 79 wherein the host is selected from a bacterial host, a fungal host or a yeast host.

81. A method comprising expressing the nucleotide sequence of claim 77 or the vector of claim 78.

82. A method or a composition or a coating or an article or a use substantially as described herein and with reference to the accompanying figures.

83. An amino acid sequence or a nucleotide sequence or a vector or a host or a method substantially as described herein and with reference to the accompanying figures.