Images

Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
  • C12N15/111—General methods applicable to biologically active non-coding nucleic acids
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
  • A61K31/7088—Compounds having three or more nucleosides or nucleotides
  • A61K31/713—Double-stranded nucleic acids or oligonucleotides
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
  • A61P31/04—Antibacterial agents
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P35/00—Antineoplastic agents
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
  • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/10—Type of nucleic acid
  • C12N2310/11—Antisense
  • C12N2310/113—Antisense targeting other non-coding nucleic acids, e.g. antagomirs
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/50—Physical structure
  • C12N2310/53—Physical structure partially self-complementary or closed
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/50—Physical structure
  • C12N2310/53—Physical structure partially self-complementary or closed
  • C12N2310/531—Stem-loop; Hairpin
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2799/00—Uses of viruses
  • C12N2799/02—Uses of viruses as vector
  • C12N2799/021—Uses of viruses as vector for the expression of a heterologous nucleic acid
  • C12N2799/027—Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from a retrovirus

Definitions

• the present invention relates to a method for efficiently inhibiting the function of miRNA and a nucleic acid used therefor.
• MicroRNA is a small (about 20-24 nucleotides) regulatory non-coding RNA that is expressed endogenously, post-transcription as a component of an RNA-induced silencing complex (RISC) It regulates the expression of many target genes at the level. If a miRNA and its target sequence in the mRNA are completely complementary, the miRNA induces cleavage of the mRNA, causing a rapid decrease in mRNA levels. However, most mammalian miRNAs have only a limited level of complementarity with target sequences located in the 3 'untranslated region (3'-UTR), in translational repression or cytoplasmic processing (bodies) (P-bodies) Causes either rapid deenylation of the target mRNA.
• RISC RNA-induced silencing complex
• More than 1/3 of human coding genes are predicted to be miRNA targets (Bartel, DP (2004) Cell, 116, 281-297; Lewis, BP et al. (2005) Cell, 120, 15- 20; Ambros, V. et 2003al. (2003) Rna, 9, 277-279), evidence still showing that miRNAs play an important role in cell defense against differentiation, development, tumorigenesis, and infection. (Li, QJ et al. (2007) Cell, 129, 147-161; Lu, J. et al. (2005) Nature, 435, 834-838; Lecellier, CH et al. (2005) Science, 308, 557-560).
• reagents are chemically synthesized to be complementary to the mature miRNA, are resistant to cellular nucleases, and probably function as uncleaved substrates for RISC. Since they are designed to be introduced into cells by transfection, the inhibitory activity is necessarily transient.
• microRNA sponge a DNA vector expressing the miRNA competitive inhibitor “microRNA sponge” has been reported (Ebert, M.S. et al. (2007) Nat Methods, 4, 721-726). Transient expression of microRNA sponge vectors efficiently inhibits miRNA function, but even if introduced by DNA-based vectors, the inhibitory effect is not maintained for more than a month. Therefore, it has been desired to establish a method for inhibiting miRNA over a longer period.
• the present invention relates to an miRNA inhibitor for efficiently inhibiting miRNA, a vector for expressing the inhibitor in a cell, a method for constructing the vector, a method for inhibiting miRNA using the inhibitor or the vector, etc. About.
• RNA having a miRNA binding sequence (MBS) bound to both strands at one end of double-stranded RNA exhibits strong miRNA inhibitory activity (FIGS. 1 and 2).
• MBS miRNA binding sequence
• RNA-inhibiting RNAs as linear single-stranded RNAs by closing one end of these RNA structures including the double-stranded part (for example, a loop structure). This allowed the RNA to be expressed from a single transcription unit.
• a cassette containing the target MBS is inserted into the expression unit containing this constant region.
• the present invention relates to an miRNA inhibitor for efficiently inhibiting miRNA, a vector for expressing the inhibitor in a cell, a method for constructing the vector, and a method for inhibiting miRNA using the inhibitor or the vector More specifically, [1] An miRNA-inhibiting complex comprising RNA or an analog thereof, wherein at least one strand comprising a double-stranded structure and comprising an miRNA binding sequence is present at least at one end of the double-stranded structure.
• Bound, miRNA-inhibiting complex [2] Including a second multi-strand structure, one strand containing a miRNA binding sequence is bound to each of the two strands at one end, and sandwiched between the double-strand structure and the multi-strand structure The complex according to [1], wherein the other end of each of the chains is bonded to two chains of the second multi-stranded structure, [3] The complex according to [2], wherein the multiple strand is a double strand or a four strand.
• Structure II is a hairpin, a complex comprising one miRNA binding sequence each in a and b of the structure; [10] RNA constituting the complex of any one of [1] to [9] or an analog thereof, [11] a nucleic acid encoding the RNA according to [10], [12] The nucleic acid according to [11], which is bound downstream of the promoter, [13] The nucleic acid according to [12], wherein the promoter is a polymerase III promoter, [14] The nucleic acid according to [12] or [13], which is mounted in a retroviral vector, [15] The method for producing the nucleic acid according to [12], wherein at least one miRNA binding is performed between a pair of nucleic acids encoding a pair of complementary sequences forming at least one double-stranded structure downstream of the promoter.
• the present invention also provides [1] An miRNA-inhibiting complex comprising RNA or an analog thereof, wherein at least one strand comprising a double-stranded structure and comprising an miRNA binding sequence is present at least at one end of the double-stranded structure.
• Bound, miRNA-inhibiting complex [2] a second double-stranded structure, wherein one strand containing the miRNA binding sequence is bound to each of the two strands at one end, and the two double-stranded structures are sandwiched between the two double-stranded structures;
• the complex according to [3] composed of linear single-stranded RNA or an analog thereof, [5]
• [6] The complex according to [5], comprising two miRNA binding sequences, [7] RNA constituting the complex of any one of [1] to [6] or an analog thereof, [8] a nucleic acid encoding the
• nucleic acid encoding the miRNA-binding sequence includes at least two miRNA-binding sequences and a sequence that forms a stem loop therebetween.
• the present invention provides an miRNA inhibitor that can efficiently and specifically inhibit the function of miRNA.
• the miRNA inhibitor of the present invention can stably inhibit miRNA for a long period of time, for example, by incorporating its expression unit into a retroviral vector. This allows for in vivo assays such as knockdown mice. Furthermore, since the U6 promoter system regulated by Cre-loxP has already been established, it is possible to perform miRNA knockdown in a time-specific and tissue-specific manner using this. As illustrated in FIG. 6, the miRNA-inhibiting RNA expression cassette of the present invention can be easily constructed, and thus an RNA library for comprehensive analysis of miRNA can be constructed. Thus, the present invention provides a very useful tool for miRNA research.
• RNA-inhibiting RNA can be used to identify target mRNA candidates by exhaustively examining the expressed mRNA in cultured cells based on the presence or absence of expression of a specific miRNA-inhibiting RNA.
• In vivo genes are also expected to be a significant proportion of miRNA targets, and miRNAs play an important role in a variety of settings, including differentiation, development, tumorigenesis, and cellular defense against infections.
• the method of the present invention is useful for elucidating gene regulatory mechanisms and controlling the functions of miRNAs involved in gene therapy for tumors and infectious diseases.
• I represents the first double-stranded structure
• II represents the second double-stranded structure.
• a and b each contain at least one MBS.
• the end of the second double-stranded structure (the right end in the figure) may or may not form a loop.
• the decoy RNA becomes a single strand.
• a and b may contain a plurality of MBS, and a and b may not be completely in a single-stranded state but may partially form a double-stranded structure.
• a plurality of the units may be connected in tandem (for example, # 15 and # 16 of panel A).
• D A structure in which the end of the second double-stranded structure forms a loop in the unit shown in panel (C).
• the number of bases contained in the loop is not particularly limited, and may be 0 to several, for example, 1, 2, 3, 4, 5, 6, 7 bases.
• the vertical line of the double-stranded part of panels (A), (C), (D) represents that it has a double-stranded structure, and the number of bases is limited to the number of vertical lines Not what you want. It is a figure which shows that the MBS sequence of prototype decoy RNA influences an inhibitory effect significantly. Relative GFP expression was determined as indicated in the description of FIG. 1B. It is a figure which shows the comparison of the effect of the length of the linker sequence of a decoy RNA. (A) Structure of decoy RNA # 22 to # 26.
• the curved arrow in black represents MBS (5 ' ⁇ 3'). ⁇ indicates a linker sequence.
• Bold black curved arrows represent MBS.
• A A diagram showing a typical structure of the miRNA-inhibiting RNA of the present invention. MBS represents the miRNA binding site.
• Lentiviral vectors expressing these miRNA-inhibiting RNAs were introduced into HeLaS3 cells carrying both miR-140-5p reporter and miR140-5p / 140-3p vectors, and GFP expression levels were increased 8-12 days after introduction. Were determined. The expression level was normalized to the expression level of HeLaS3 cells carrying only the miR-140-5p reporter and expressed as mean ⁇ SEM.
• Relative GFP expression levels were normalized to those of HeLaS3 cells carrying only the miR-140-3p reporter.
• E Analysis of intracellular localization of miRNA-inhibiting RNA.
• Y4 small plasmoplasm RNA Y4 scRNA, 93nt
• ACA1 small nucleolar RNA ACA1 snoRNA, 130nt
• Y4 scRNA and ACA1 snoRNA PA-1 were shown as cell fraction markers.
• Un, 5p, 3p, N, and C represent uninfected cells, TuD-miR140-5p-infected cells, TuD-miR140-3p-infected cells, nuclear fraction, and cytoplasm fraction, respectively. It is a figure which shows the inhibitory effect with respect to endogenous miR21 activity of a miRNA inhibition complex.
• RNA expression plasmid vector or LNA / DNA antisense oligonucleotide RNA antisense oligonucleotide
• Renilla luciferase miR-21 reporter white bar
• non-targeting control Renilla luciferase reporter black bar
• Firefly for transfection control PA-1 cells (A) or HCT-116 (B) were transiently transfected with luciferase reporter. After dual luciferase assay, expression levels were normalized to those of PA-1 cells or HCT-116 cells transfected with TuD-NC vector and expressed as mean ⁇ SEM.
• PA-1 cells were transfected with a miRNA-inhibiting RNA expression plasmid vector, and total protein was prepared 72 hours after transfection.
• PDCD4 (top) and ⁇ -actin loading (control) (bottom) were determined by Western blot.
• U6 snRNA was used as an endogenous control.
• E The expression levels of pre-miR21 and mature-miR21 in cells treated in the same manner as in (B) were measured by northern blot.
• Y4 scRNA was shown as a loading control. It is a figure which shows the comparison of the effect of a miRNA inhibition RNA expression plasmid vector, a CMV (sponge) expression plasmid vector, an H1-Antagomir expression plasmid vector, a miRNA (eraser) expression plasmid vector, and a LNA / DNA antisense oligonucleotide. Dual luciferase assay was performed 72 hours after transfection using HCT-116 cells.
• Expression levels were normalized to those of HCT-116 cells transfected with the non-targeting control Renilla luciferase reporter and expressed as mean ⁇ SEM. It is a figure which shows the analysis of the miRNA inhibition RNA expression level by a Northern blot.
• the expression levels of TuD-miR-21-4ntin and TuD-miR-21-pf were analyzed by Northern blotting in PA-1 cells (A) and HCT-116 cells (B) transfected with miRNA-inhibiting RNA expression vectors, respectively.
• the mobility of Y4 scRNA and ACA1 snoRNA is indicated by triangles. Y4 scRNA was shown as a loading control.
• FIG. 1 It is a figure which shows the biological activity induced
• A Analysis of cell proliferation activity of PA-1 cells by introduction of TuD-miR21. The miRNA-inhibiting RNA expression vector was introduced into PA-1 cells, and the number of cells was analyzed for 4 days after the introduction of the vector. Analysis of apoptosis induction in PA-1 cells by introduction of (B) TuD-miR21. The miRNA-inhibiting RNA expression vector was introduced into PA-1 cells, and the activities of caspase 3 and caspase 7 were analyzed 3 days after the introduction of the vector.
• This activity was normalized with respect to the number of PA-1 cells into which each miRNA-inhibiting RNA expression vector was introduced, and expressed as mean ⁇ SEM. It is a figure which shows the inhibitory effect to the family of target miRNA of miRNA inhibitory RNA.
• A The sequences of miR-16, 195, 497 and their homology were shown. The sequence indicated by the bracket is the seed site, and the black bar indicates the homologous site.
• B The binding of MBS and miR-16 of TuD-miR-16-4ntin, TuD-miR-195-4ntin and TuD-miR497-4ntin was shown. Black dots indicate GU bonds.
• C miRNA-inhibiting RNA expression plasmid vector together with Renilla luciferase miR-16 reporter (white bar) or non-targeting control Renilla luciferase reporter (black bar) and Firefly luciferase reporter for transfection control 116 cells were transfected and dual luciferase assay was performed.
• MBS represents a miRNA binding site that is completely or partially complementary to miR140-3p.
• FIG. 14 shows the structure and sequence of decoy RNA for miR140-3p (continuation of Fig. 13). It is a figure which shows the structure of the retroviral vector used for construction of the highly sensitive assay system of miR-140-3p (TM) or miR-140-5p (*).
• TM highly sensitive assay system of miR-140-3p
• miR-140-5p miR-140-5p
• U3, R and U5 each represent the corresponding sequence from MoMLV long terminal repeat.
• Retroviral vector packaging signal
• R the R sequence of the lentivirus.
• FIG. 2 is a diagram showing the effect of establishing a highly sensitive assay system for miR140-3p activity and introducing miRNA-inhibiting RNA (Panels A to E). FACS analysis of GFP expression level (autofluorescence) in HeLaS3 cells (A), FACS analysis of GFP expression level in HeLaS3 cells carrying only miR140-3p reporter (B), and miR140-3p reporter and miR140-5p / 140-3p FACS analysis of GFP expression levels in HeLaS3 cells carrying both expression vectors (C).
• FIG. 1 A schematic diagram of Renilla luciferase reporter pGL4.74 without 4 insertion.
• C Structure of a Renilla luciferase reporter pGL4.74-miR21T ⁇ ⁇ ⁇ with a 22 bp insertion completely complementary to mature miR-21 immediately downstream of the Renilla luciferase gene.
• D Structure of Renilla luciferase reporter pGL4.74-miR16T with a 22 bp insertion that is completely complementary to mature miR-16 immediately downstream of the Renilla luciferase gene. It is a figure which shows the structure and arrangement
• RNA-inhibiting RNA expression plasmid vector or LNA / DNA antisense oligonucleotide Renilla luciferase miR-21 reporter (white bar) or non-targeting control Renilla luciferase reporter (black bar) ⁇
• Firefly for transfection control SW480 cells A
• HT29 cells B
• TIG-3 / E / TERT cells C
• 3Y1 cells D
• the result of comparing the miRNA inhibitory effect of the miRNA-inhibiting RNA of the present invention with normal LNA, PNA, and 2′-O-methylated oligo is shown.
• the miRNA inhibitory effect of the miRNA inhibitory RNA of this invention is compared with miRIDIAN Inhibior et al. Transcription of miRNA-inhibiting RNA of the present invention using guanine quadruplex (G-quadruplex) and its effect.
• G-quadruplex guanine quadruplex
• FIG. 1 Schematic diagram of the structures of TuD-miR21-4ntin, TuD-miR21-4ntin-GqL111, and TuD-miR21-4ntin-GqL333.
• C mi miRNA inhibitory activity by each RNA. The effect which the structure of miRNA inhibitory RNA exerts is shown.
• FIG. 1 Schematic diagram of the structures of TuD-miR21-4ntin, TuD-miR21-4ntin-1MBS-1, and TuD-miR21-4ntin-1MBS-2. Dashed arrows indicate MBS reverse sequence in 1MBS-1 and TuD-NC (control sequence) in 1MBS-2.
• B miRNA inhibitory activity by each RNA.
• (A) shows the structure of an expression cassette that transcribes the miRNA-inhibiting RNA of the present invention from the human 7SK promoter. Since the transcription of the human 7SK promoter is enhanced by the sequence immediately below the transcription start point of 7SK RNA (especially the 1st to 8th nucleotides), the 1st to 13th nucleotide of 7SK RNA is replaced with the stem portion of the inhibitory RNA of the present invention. Incorporated.
• A-D An expression plasmid for miRNA-inhibiting RNA of the present invention targeting miR200 was constructed, and the effect of miRNA-inhibiting RNA expressed from two types of promoters using a luciferase reporter assay system was shown.
• E Epithelial-mesenchymal transition by DTuD-miR200c-4ntin.
• a cell population that stably expresses miRNA-inhibiting RNA was prepared by introducing a miRNA-inhibiting RNA expression lentiviral vector into HCT-116 cells, and total protein was prepared 15 days after the introduction.
• the present invention relates to a miRNA-inhibiting complex that can efficiently and specifically inhibit miRNA.
• the miRNA-inhibiting complex of the present invention comprises a double-stranded or multi-stranded structure, and at least one strand containing a miRNA-binding sequence (MBS) binds to two strands at least one end of the double-stranded or multi-stranded structure. is doing.
• MFS miRNA-binding sequence
• this double-stranded or multi-stranded structure is referred to as the “first” double-stranded structure so that it can be distinguished from the additional double-stranded or multi-stranded structure that can be included in the complex of the present invention. (See below).
• the complex of the present invention may or may not be single-stranded (ie, a single molecule linked by a covalent bond), and is composed of, for example, a single strand, a double strand, or a plurality of more strands.
• the present invention includes a complex composed of double-stranded RNA in which RNA strands containing MBS are bound to two strands at one end of a double-stranded structure one by one.
• one RNA strand containing at least one MBS may be bound to two strands at one end of a double-stranded structure.
• two strands at one end of the double-stranded structure are connected by an RNA strand containing MBS (for example, FIG.
• the RNA connecting two strands of a double-stranded structure contains at least one MBS, but may contain, for example, two, three, or more (for example, FIG. 2A).
• Double-stranded structures include stem loops or hairpins. That is, the double-stranded structure may be a double-stranded structure contained in a stem loop or hairpin.
• the miRNA-inhibiting complex may be a structure having at least one RNA or an analog thereof having a double-stranded structure.
• the complex preferably comprises one or two molecules comprising RNA or an analog thereof.
• the miRNA binding sequence refers to a sequence that binds to miRNA.
• MBS contains at least a portion complementary to miRNA so that it can bind to miRNA.
• MBS may or may not be a completely complementary sequence to miRNA.
• MBS may be a sequence of natural RNA targeted by miRNA.
• MBS is, for example, at least 10 bases for miRNA, such as 11 bases or more, 12 bases or more, 13 bases or more, 14 bases or more, 15 bases or more, 16 bases or more, 17 bases or more, 18 bases or more, 19 bases or more, Complementary bases of 20 bases or more, 21 bases or more, 22 bases or more, 23 bases or more, or 24 bases or more are included consecutively or discontinuously.
• the complementary bases are continuous or have a gap of 3 or less, 2 or less, preferably 1 site.
• the gap may be MBS-side and / or miRNA-side unpairing (bulge), or one gap may have bulge bases on only one strand, and both strands are unpaired. It may have a paired base. Preferably, it is designed to include an unpaired base at least on the MBS side.
• the number of bulge and mismatch bases is, for example, 6 bases or less, preferably 5 bases or less, 4 bases or less, 3 bases or less, 2 bases or less, or 1 base per strand, per bulge or mismatch, respectively.
• MBS capable of forming a bulge showed a higher miRNA inhibitory effect than MBS consisting of a completely complementary sequence (Example 4). Therefore, in order to obtain a higher miRNA inhibitory effect, it is preferable to design MBS so as to form a bulge.
• the 10th and / or 11th base from the 3 'end of MBS is not complementary to miRNA, or contains an extra base between 10th and 11th (or in miRNA
• the 10th and / or 11th base from the 5 'end of the target sequence is not a complementary base to MBS, or is unpaired between the 10th and 11th nucleotides MBS containing a combined base is less susceptible to degradation and can be expected to have high activity.
• the MBS may be designed so that bases including the 10th and 11th positions from the 5 ′ end of miRNA are unpaired, for example, 9th to 11th, 10th to 12th, or 9th to 12th
• the MBS may be designed so that is unpaired. There is no unpaired base on the miRNA side, but on the MBS side, between the 10th and 11th positions from the 3 ′ end (or 5 ′ of the target sequence in miRNA (sequence that hybridizes with MBS)). An unpaired base may be present between the 10th and 11th sites from the end).
• the unpaired base may be present on the miRNA side and / or MBS side, but is preferably present at least on the MBS side.
• the number of unpaired nucleotides in each strand can be adjusted as appropriate, and is, for example, 1 to 6 nucleotides, preferably 1 to 5 nucleotides, more preferably 3 to 5, for example 3, 4 or 5 It is a nucleotide.
• miRNA target recognition it is important for miRNA target recognition to match the 2-7th or 3-8th base (referred to as the seed region) from the 5 'end of miRNA (Jackson AL et al., RNA 12 (7): 1179-1187, 2006; Lewis BP et al., Cell 120: 15-20, 2005; Brennecke et al. PLoS BIOLOGY 3, 0404-0418, 2005; Lewis et al. Cell 115, 787-798, 2003; Kiriakidou et al. Genes & Development 18, 1165-1178, 2004).
• the miRNA-inhibiting RNA of the present invention has been shown to be able to effectively inhibit miRNA even if it has MBS that only matches the seed region and has only a low complementarity to other regions. (Example 6, FIG. 12).
• MBS MBS in the present invention
• those in which the seed region of miRNA (bases 2 to 7 and / or 3 to 8 from the 5 ′ end of miRNA) are completely complementary are preferable.
• G: U pairs (U: G pairs) may also be considered complementary, but preferably only G: C (C: G) and A: U (U: A) are considered complementary.
• the MBS includes a miRNA seed region (2-7th and / or 3-8th base from the 5 ′ end of the miRNA) that is completely complementary and at least 8 bases relative to the miRNA. More preferably, those containing 9 bases, more preferably 10 bases of complementary bases in succession are preferred. Furthermore, the MBS in the present invention preferably contains a total of 11 bases or more, more preferably 12 bases or more, and more preferably 13 bases or more complementary bases for miRNA.
• MBS is preferably a sequence that hybridizes with a miRNA sequence under physiological conditions.
• Physiological conditions are, for example, 150 mM NaCl, 15 mM sodium citrate, pH 7.0, 37 ° C. More preferably, the MBS is a sequence that hybridizes with the miRNA sequence under stringent conditions.
• the stringent conditions are, for example, 1 ⁇ SSC (1 ⁇ SSC is 150 mM NaCl, 15 mM sodium ⁇ citrate, pH 7.0) or 0.5 ⁇ SSC at 42 ° C, more preferably 1 ⁇ SSC or 0.5 ⁇ SSC. , 45 ° C., more preferably 1 ⁇ SSC or 0.5 ⁇ SSC, 50 ° C.
• Hybridization for example, either RNA containing miRNA sequence or RNA containing MBS is labeled, the other is immobilized on a membrane, and both are hybridized.
• Hybridization conditions are, for example, 5xSSC, 7% (W / V) SDS, 100 ⁇ g / ml denatured salmon sperm DNA, 5x Denhardt's solution (1x Denhardt solution is 0.2% polyvinylpyrrolidone, 0.2% bovine serum albumin, and 0.2% For example, at 37 ° C., 45 ° C., or 50 ° C.
• the nucleic acid After incubating for a sufficient period of time (eg, 3, 4, 5 or 6 hours or more), washing is performed under the above conditions, and by detecting whether the labeled nucleic acid is hybridized, the nucleic acid is hybridized under the condition. Or not.
• a sufficient period of time eg, 3, 4, 5 or 6 hours or more
• MBS preferably exhibits high homology with the complementary sequence of the miRNA sequence.
• High homology means, for example, 70% or more, 75% or more, 76% or more, 77% or more, 78% or more, 79% or more, 80% or more, 81% or more, 82% or more, 83% or more, 84% or more, 85% or higher, 86% or higher, 87% or higher, 88% or higher, 89% or higher, 90% or higher, 93% or higher, 95% or higher, 96% or higher, 97% or higher, 98% or higher, or 99% or higher It is a base sequence having sex. The identity of the base sequence can be determined using, for example, the BLAST program (Altschul, S. F. et al., J.
• MBS preferably consists of a sequence in which one or several bases are inserted, substituted, and / or deleted from the complementary sequence of the miRNA sequence.
• MBS is within 8 bases, within 7 bases, within 6 bases, within 5 bases, within 4 bases, within 3 bases, within 2 bases, or insertion, substitution of 1 base with respect to the complementary sequence of miRNA sequence, And / or consisting of sequences with deletions.
• the MBS has an insertion of within 8 bases, within 7 bases, within 6 bases, within 5 bases, within 4 bases, within 3 bases, within 2 bases, or 1 base relative to the complementary sequence of the miRNA sequence. Consists of an array.
• MBS has a higher miRNA inhibitory activity in a sequence having a mismatch than in a sequence completely complementary to the miRNA sequence. This is considered to be due to the fact that MBS is completely complementary and is cleaved by RISC containing miRNA, thereby reducing the expression level of miRNA-inhibiting RNA.
• MBS when MBS hybridizes with miRNA, the 10th and / or 11th bases from the 3 ′ end of MBS are unpaired (or the 5 ′ end of the target sequence on the miRNA side that hybridizes with MBS) MBS designed to contain unpaired bases between the 10th and 11th nucleotides. Can be expected to have high activity.
• Such unpairing may be, for example, the bulge on the MBS side, and the base that forms the bulge is 1 to 6 bases, preferably 1 to 5 bases, more preferably 3 to 5 bases (eg 3, 4 or 5). Base).
• MBS may consist of RNA, or may contain a nucleic acid salt or consist of a nucleic acid salt (Example 7).
• an increase in miRNA inhibitory effect can be expected by forming a nucleic acid salt at a site where MBS is cleaved (such as the 10th and / or 11th base from the 3 ′ end of MBS) so that cleavage does not occur.
• a nucleic acid having a backbone or sugar such as phosphothioate or 2′-O-methyl (Krutzfeldt, J. et al., Nucleic Acids Res. 35: 2885-2892; Davis, S. et al ., 2006, Nucleic Acids Res. 34: 2294-2304).
• the miRNA targeted by the miRNA inhibition complex of the present invention is not particularly limited. As long as it has an miRNA structure, it can be applied to any species such as plants, nematodes, vertebrates and the like.
• the number of miRNA sequences is very well known in many organisms, including humans, mice, chickens, zebrafish, and Arabidopsis (see the miRBase :: Sequences web page: microrna.sanger.ac.uk / sequences /).
• mammals such as mice, rats, goats, primates including monkeys, and human miRNAs can be targeted.
• miR21 (Lagos-Quintana M et al., Science.
• miR16 (Lagos-Quintana M et al., Science. 294: 853-858, 2001; Mourelatos Z et al., Genes Dev. 16: 720-728, 2002; Lim LP et al., Science. 299 : 1540, 2003; Calin GA et al., Proc Natl Acad Sci U S A. 99: 15524-15529, 2002; Michael MZ et al., Mol Cancer Res. 1: 882-891, 2003), miR497 (Bentwich I et al., Nat Genet. 37: 766-770, 2005; Landgraf P et al., Cell. 129: 1401-1414, 2007), etc. No.
• the miRNA-inhibiting complex of the present invention further includes a second multiple strand structure in addition to the first multiple strand structure, and an RNA strand containing MBS is present on two strands at one end of the first multiple strand structure.
• Each of the RNA strands has a structure that binds one by one, and the other end of the RNA strand is sandwiched between the first multiple strand structure and the second multiple strand structure. Relates to miRNA-inhibiting complexes bound to two strands at one end of each.
• the multi-stranded structure may be double stranded, or may be four stranded like G-quadruplex (G-quadruplex).
• the first multi-stranded structure is double-stranded and the second multi-stranded structure is double-stranded or four-stranded.
• the present invention further includes a second double-stranded structure in addition to the first double-stranded structure, and the two strands at the ends to which MBS is bound in the first double-stranded structure have MBS.
• Each of the contained RNA strands is bonded to each other, and the other end of each RNA strand is inserted between the first double-stranded structure and the second double-stranded structure,
• the present invention relates to a miRNA-inhibiting complex that binds to each of the two strands of the second double-stranded structure.
• the RNA complex has, for example, at least two double-stranded structures, and each of the four RNA strands constituting the two double-stranded structures contains MBS without interposing any remaining three strands. It has a structure that binds to RNA.
• the miRNA-inhibiting complex can be explained more simply by binding to each strand of the two double-stranded structures so that the two RNA strands containing MBS are sandwiched between the two double-stranded structures.
• MiRNA inhibition complex (FIG. 2 (C)). That is, an RNA complex having the structure of FIG.
• RNA strands a and b are sandwiched between double-stranded structures I and II, and RNAs containing one or more MBS in each of a and b are included in the present invention. Since the two RNA strands containing MBS are bound to each pair of double-stranded structures, the RNA strands are in opposite directions (Fig. 2, # 12 to # 16). . Thus, by adding MBS to each double-stranded chain, it is possible to exhibit higher miRNA inhibitory activity.
• Two RNA strands including MBS present so as to be sandwiched between two double-stranded structures each contain one or more MBS. These MBSs may be the same sequence or different. Moreover, the same miRNA may be targeted and the sequence couple
• the miRNA-inhibiting complex of the present invention may contain a total of two MBS, and the two MBS may be the same sequence or a sequence that binds to the same miRNA.
• Each pair of duplexes included in the miRNA inhibition complex of the present invention may be a separate RNA molecule as described above, or one or both ends of the duplex are connected, It may be linear or cyclic.
• linear is a term for a ring and only means that it has a terminal, and naturally does not mean that a secondary structure is not formed.
• the miRNA inhibition complex composed of linear single-stranded RNA can be prepared, for example, by a single RNA synthesis, or can be expressed from one expression unit using an expression vector or the like.
• two chains at one end of the second double-stranded structure can be connected by a loop to form a single strand as a whole.
• One or more MBS may be included in the sequence connecting the double strands (FIG. 2, # 2, # 11, # 13, # 14, # 16).
• the duplexes can be joined by short loops.
• the double strand can be combined with a sequence of 1 to 10 bases, preferably 1 to 8 bases, 2 to 6 bases, 3 to 5 bases, for example 4 bases.
• the arrangement is not particularly limited.
• An example is 5′-GUCA-3 ′ (FIG. 6A).
• the present invention relates to RNA having the structure of FIG. 2 (A) # 13 or FIG. 2 (D), in which RNA strands a and b are sandwiched between double-stranded structures I and II, II forms a hairpin (or stem loop), and a and b each contain RNA containing one or more MBS.
• the double-stranded structure contained in the miRNA-inhibiting complex of the present invention is not particularly limited in sequence, but preferably has a length of 4 base pairs or more.
• at least one of the double-stranded structures included in the RNA complex of the present invention (that is, the first double-stranded structure) has an important function for nuclear export of the RNA complex.
• the chain length of this double strand may be, for example, 15 to 50 base pairs, and preferably 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 bases, or any one or more thereof, 50, 49, 48 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23 , 22, 21, 20, 19, or 18 bases, or any of them.
• the length of the base pair of the double-stranded structure is, for example, 15-30, preferably 16-28, preferably 17-25, preferably 17-24, such as 17, 18, 19, 20, 21 , 22, 23, or 24.
• dsRNA exceeding 20 bp can be a potential target for cleavage by Dicer in the cytoplasm, so it is included in the complex of the present invention to avoid it.
• the double-stranded structure can be 20 bp or less, such as 19 bp or less, or 18 bp or less.
• the miRNA-inhibiting complex of the present invention contains a second or more double-stranded structure
• these double-stranded structures may be shorter than the length of the first double-stranded structure, for example, in order to make the entire miRNA inhibition complex compact.
• the chain length of each double strand may be adjusted as appropriate, and is 4 bp to 20 bp, for example, and may be 5 bp to 15 bp, 5 bp to 12 bp, 5 bp to 10 bp, 6 bp to 9 bp, or 7 bp to 8 bp, for example.
• the base pair sequence forming the double-stranded structure can be appropriately designed so that the duplex can be specifically and stably formed in the miRNA inhibition complex.
• sequences in which several base sequences are repeated in tandem such as double base repeat sequences and 3-4 base repeat sequences.
• the GC content of the double-stranded portion may be adjusted as appropriate, for example, 12% to 85%, preferably 15% to 80%, 20% to 75%, 25% to 73%, 32% to 72%, 35% ⁇ 70%, 37% -68%, or 40% -65%.
• the stem I and stem II sequences shown in FIG. 6A can be exemplified, but are not limited thereto.
• the four strands include G-quadruplex, and specifically, a sequence of GGG-loop-GGG-loop-GGG-loop-GGG can be used.
• the sequence of the loop can be appropriately selected. For example, all three loops can be made into one base (for example, M (A or C)), or both can be made into three bases (SEQ ID NOs: 167, 168, etc.) ).
• the MBS and the double-stranded structure may be linked directly or via other sequences.
• MBS can be attached to the end of a double stranded structure via a suitable linker or spacer sequence.
• a linker also referred to as a spacer
• a linker or spacer sequence between the MBS sequence and the double-stranded structure may increase accessibility to miRNAs where MBS is present in RISC. The length of the linker or spacer may be appropriately adjusted.
• 1 to 10 bases preferably 1 to 9 bases, 1 to 8 bases, 1 to 7 bases, 1 to 6 bases, 1 to 5 bases, 1 to 4 Base, or 1-3 bases.
• the sequence of the linker or spacer is not particularly limited, and can be, for example, a sequence consisting of A and / or C, or a sequence containing A and / or C more than other bases.
• it is preferable to consider that the linker or spacer sequence does not form a stable base pair with the opposing linker or spacer sequence or MBS.
• AAC, CAA, ACC, CCA, or a sequence including any of them can be exemplified.
• a pair of linker or spacer sequences added to both sides of MBS may be an inverted sequence (mirror image sequence).
• AAC can be added to the 5 'side of the MBS and CAA can be added to the 3' side.
• the nucleic acid constituting the miRNA inhibition complex of the present invention may be modified.
• the nucleotides making up the nucleic acid may be natural nucleotides, modified nucleotides, artificial nucleotides, or combinations thereof.
• the nucleic acid contained in the miRNA-inhibiting complex of the present invention may be composed of RNA, may be an RNA / DNA chimera, or may contain other nucleic acid analogs, including any combination thereof. It's okay.
• Nucleic acids include not only those linked by phosphodiester bonds but also those having amide bonds or other backbones (such as peptide nucleic acids (PNA)).
• Nucleic acid analogs include, for example, natural and artificial nucleic acids, and may be nucleic acid derivatives, nucleic acid analogs, nucleic acid derivatives, and the like. Such nucleic acid analogs are well known in the art and include, but are not limited to, phosphorothioates, phosphoramidates, methylphosphonates, chiral methylphosphonates, 2'-O-methylribonucleotides, peptide nucleic acids (PNA), and the like. Not.
• the backbone of PNA may include a backbone consisting of aminoethylglycine, polyamide, polyethyl, polythioamide, polysulfinamide, polysulfonamide, or a combination thereof (Krutzfeldt, J. et al., Nucleic Acids Res. 35: 2885-2892; Davis, S. et al., 2006, Nucleic Acids Res. 34: 2294-2304; Butla, A. et al., 2003), Nucleic Acids Res. 31: 4973-4980; Hutvagner, G. et al., 2004, PLoS Biol. 2: E98; Chan, JA et al., 2005, Cancer Res. 65: 6029-6033; Esau, C. et al., 2004, J. Biol. Chem. 279: 52361- 52365; Esau, C. et al., 2006, Cell Metab. 3: 87-98).
• Nucleic acid modification can be performed to inhibit degradation by endonucleases.
• Particularly preferred modifications include 2 'or 3' sugar modifications such as 2'-O-methyl (2'-O-Me) ylated nucleotides or 2'-deoxynucleotides, or 2'-fluoro, difluorotoluyl, 5-Me -2'-pyrimidine, 5-allylamino-pyrimidine, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl (2'-O-AP), 2'-ON-methylacetamide (2'-O-NMA), 2'-O-dimethylaminoethyloxyethyl (2'-DMAEOE), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylamino Propyl (2'-O-AP), 2'-hydroxy nucleotide, phosphorothio
• DFT difluorotoluyl modification, for example, substitution of 2,4-difluorotoluyluracil or guanidine to inosine may be performed.
• the nucleic acid may contain a conjugate at the end.
• the conjugate include lipophilic substances, terpenes, protein binding substances, vitamins, carbohydrates, retinoids, peptides, and the like.
• examples include cholesterol, dU-cholesterol, alkyl chains, aryl groups, heterocyclic complexes, and modified sugars (D-ribose, deoxyribose, glucose, etc.).
• the conjugate and the nucleic acid can be bound via, for example, an arbitrary linker, and specific examples include a pyrrolidine linker, serinol linker, aminooxy, or hydroxyprolinol linker.
• a cell permeation signal can be appropriately added to the nucleic acid.
• many cell-permeable peptides for introducing nucleic acids into cells are known (WO2008 / 082885).
• arginine-rich peptides such as polyarginine, such as HIV-1 Tat (48-60), HIV-1 (Rev (34-50), FHV Coat (35-49), BMV Gag ( 7-25), HTLV-II Rex (4-16), a partial peptide thereof, or an inverso or retro-inverso thereof.
• amino acid d form may be used as appropriate.
• a cell-penetrating peptide or the like may be bound to a nucleic acid by a known linker.
• the miRNA-inhibiting complex of the present invention can be designed to be composed of linear single-stranded nucleic acids (FIG. 2).
• the present invention is particularly concentrated on one side (right side in FIG. 2) of the double-stranded structure (stem I in FIG. 2) where all MBS is present, and each strand of the double-stranded structure is closed on that side.
• a complex in which both ends of a single-stranded RNA are on opposite sides of the double-stranded structure (FIG. 2).
• the sequence containing MBS may contain additional multi-stranded (eg, double or quadruplex) structures (eg, stems II and III in FIG. 2).
• the length of the single-stranded RNA may be determined as appropriate, for example, within 500 bases, preferably within 450 bases, within 420 bases, within 400 bases, within 380 bases, within 360 bases, within 340 bases, within 320 bases, within 300 bases, 300 bases Within base, within 280 base, within 260 base, within 240 base, within 220 base, within 200 base, within 180 base, within 160 base, within 140 base, within 120 base, within 100 base, or within 80 base.
• the length of a single-stranded RNA forming a complex having two double-stranded structures and two MBS is, for example, 60 to 300 bases, preferably 70 to 250 bases, 80 to 200 bases, 90 to 180 bases, Or 100 to 150 bases.
• the first double-stranded structure (double-stranded structure close to both ends of the single-stranded RNA) is, for example, 15-30 bp, preferably 16-28 bp, preferably 17-25 bp, preferably 17-24 bp, such as 17 bp, 18 bp.
• the second double stranded structure (an additional double stranded structure included in sequences containing MBS) to make the whole compact
• the length may be shorter than the length of the first double-stranded structure, for example, 4 bp to 20 bp, such as 5 bp to 15 bp, 5 bp to 12 bp, 5 bp to 10 bp, 6 bp to 9 bp, or 7 bp to 8 bp.
• the present invention also relates to RNA constituting the miRNA-inhibiting complex of the present invention (herein, RNA includes natural RNA and nucleic acid analogs), and nucleic acid (DNA or RNA) encoding the RNA.
• RNA includes natural RNA and nucleic acid analogs
• DNA or RNA nucleic acid
• the miRNA-inhibiting RNA complex is composed of one molecule of RNA, by annealing the RNA within the molecule, or when composed of two or more RNA molecules, annealing those RNAs.
• the complex of the present invention can be constructed.
• These RNAs can be appropriately synthesized.
• desired RNA can be produced by chemical synthesis of RNA.
• RNA can be expressed by an expression vector that expresses the RNA.
• the expression vector is not particularly limited, and for example, a desired expression vector that is expressed in bacteria such as E. coli, eukaryotic cells such as yeast, insect cells, plant cells, or animal cells can be used.
• a vector that is expressed in cells of higher eukaryotes such as plants, insects, animals and the like to express RNA in those cells and inhibit the function of miRNA.
• the promoter for transcription of RNA is not particularly limited, and Pol I promoter, Pol II promoter, Pol III promoter, bacteriophage promoter, and the like can be used.
• RNA polymerases and promoters of T4 phage and T7 phage can be exemplified.
• the polymerase II (Pol II) promoter include CMV promoter and ⁇ -globin promoter.
• a polymerase III (Pol III) promoter that can be expressed in a higher amount than Pol II.
• Pol III promoters include U6 promoter, H1 promoter, tRNA promoter, 7SK promoter, 7SL promoter, Y3 promoter, 5S rRNA promoter, Ad2 VAI and VAII promoter (Das, G. et al., 1988).
• human U6, human H1, human 7SK, or mouse U6 promoter can be preferably used.
• the Pol III promoter can function as a transcription terminator by adding, for example, a poly (T) -tract of about 4 to 7 bases downstream of the DNA encoding the RNA to be transcribed.
• the transcription unit constructed in this way can be used for expression as it is, or can be incorporated into another vector system.
• a vector An expression plasmid, a desired viral vector, etc. can be utilized.
• viral vectors include, but are not limited to, retrovirus vectors, adenovirus vectors, adeno-associated virus vectors (Miller, AD et al. (1991) J. Virol. 65, 2220-2224; Miyake, S Et al. (1994) Proc. Natl. Acad. Sci. USA, 91, 8802-8806; Samulski, R. J. et al. (1989) J. Virol. 63, 3822-3828).
• a transcription unit containing a Pol III promoter may be used by being incorporated into a retrovirus (including lentivirus) LTR.
• retrovirus including lentivirus
• Incorporation into a retroviral vector makes it possible to introduce genes into target cells with high efficiency, and since the transgene is integrated into the chromosome, miRNA can be stably inhibited for a long period of time.
• the retrovirus used is not particularly limited, and examples thereof include ecotropic virus vectors (Kitamura, T. et al. (1995) Proc. Natl. Acad. Sci. USA. 92, 9146-9150), amphotropic virus vectors, Virus vectors pseudotyped by VSV-G etc. (Arai, T. et al. (1998) J. Virol.
• lentiviral vectors such as HIV vectors, SIV vectors, FIV vectors (Shimada, T. et al. (1991) J. Clin. Inv. 88, 1043-1047).
• a MoMLV-based retroviral vector or an HIV-based lentiviral vector can be used.
• LTR When incorporated into LTR, for example, it can be incorporated into the ⁇ U3 region of LTR having a deletion ( ⁇ U3) in the U3 region (FIG. 15).
• the vector expresses miRNA-inhibiting RNA and inhibits miRNA function for at least 1 week, preferably at least 2 weeks, at least 3 weeks, at least 4 weeks, or at least 1 month after introduction into the cell. can do.
• miRNA-inhibiting RNA complex when the miRNA-inhibiting RNA complex is designed to be composed of single-stranded linear RNA molecules, it is necessary to introduce a single expression vector that transcribes this RNA into the cell. Conveniently, miRNA-inhibiting RNA complexes can be formed and the miRNA of interest can be inhibited. In this case, as already described, all of one or more MBS contained in the miRNA-inhibiting RNA complex are only on one side of a certain double-stranded structure (first double-stranded structure; corresponding to stem I in FIG. 2).
• the double strands on one side are designed to be linked by RNA containing MBS (ie, closed), and the opposite side of the double-stranded structure is at both ends of the linear RNA strand Can be.
• the part forming the double-stranded structure and the part corresponding to both ends of the linear single-stranded RNA are constant regions not depending on MBS, and only the part of the single-stranded RNA is MBS.
• the variable region can be changed depending on That is, RNA having such a structure has both the efficiency of miRNA inhibition and the ease of production.
• the RNA containing MBS may contain two or more MBS, and may contain a sequence that forms a stem (or stem loop) between the MBS.
• the stem may be, for example, a 2 or 4 strand stem.
• a vector for example, a miRNA-inhibiting RNA expression cassette
• a vector that expresses the miRNA-inhibiting RNA complex according to the target miRNA can be easily constructed (Fig. 6).
• a promoter may be appropriately disposed upstream of the pair of complementary sequences (FIG. 6B). The promoter is not particularly limited, but the Pol III promoter is preferable.
• a terminator can be arranged downstream of the pair of complementary sequences.
• a DNA that expresses a pair of complementary sequences is extremely useful for expressing a single-stranded RNA constituting a miRNA-inhibiting RNA complex.
• An insertion site can be appropriately designed between the pair of complementary sequences so that DNA encoding MBS can be inserted.
• the insertion site may be a desired restriction enzyme recognition sequence (may be multi-cloning), a site-specific recombination sequence such as an att sequence, or may be cleaved in advance so that it can be inserted immediately.
• the present invention also relates to a method for producing a nucleic acid (eg, DNA) encoding an RNA constituting the RNA complex of the present invention, which encodes a pair of complementary sequences forming at least one double-stranded structure.
• the present invention relates to a method comprising a step of inserting a double-stranded DNA encoding at least one miRNA binding sequence between double-stranded DNAs.
• the present invention also relates to a method for producing a nucleic acid (for example, DNA) that expresses RNA constituting the RNA complex of the present invention, wherein a pair of complementary sequences forms at least one double-stranded structure downstream of a promoter. And inserting a double-stranded DNA encoding at least one miRNA binding sequence between the double-stranded DNAs encoding.
• the present invention also provides a nucleic acid for producing a nucleic acid encoding the RNA constituting the RNA complex of the present invention, wherein the nucleic acid encodes a pair of complementary sequences forming at least one double-stranded structure, and / or Or relates to its complementary strand.
• the present invention also provides a composition for producing a nucleic acid encoding the RNA constituting the RNA complex of the present invention, the nucleic acid encoding a pair of complementary sequences forming at least one double-stranded structure, and And / or a composition comprising its complementary strand.
• the composition may further comprise a pharmaceutically acceptable carrier as appropriate.
• the present invention also provides a nucleic acid for producing a vector that expresses RNA constituting the RNA complex of the present invention, and encodes a pair of complementary sequences forming at least one double-stranded structure downstream of a promoter. And / or its complementary strand.
• the present invention also provides a composition for producing a vector that expresses RNA constituting the RNA complex of the present invention, comprising a pair of complementary sequences forming at least one double-stranded structure downstream of a promoter. It relates to a composition comprising the encoding nucleic acid and / or its complementary strand.
• the present invention also relates to a nucleic acid (for example, DNA) for producing a nucleic acid encoding the RNA constituting the RNA complex of the present invention, and relates to a nucleic acid encoding at least one miRNA binding sequence and / or its complementary strand.
• a nucleic acid for example, DNA
• the present invention also provides a composition for producing a nucleic acid (eg, DNA) encoding an RNA constituting the RNA complex of the present invention, the nucleic acid encoding at least one miRNA binding sequence and / or its complementary strand. It relates to the composition containing this.
• the present invention also provides a nucleic acid encoding a pair of complementary sequences forming at least one double-stranded structure and / or a complementary strand thereof for producing a nucleic acid encoding the RNA constituting the RNA complex of the present invention.
• the present invention also provides a nucleic acid encoding a pair of complementary sequences forming at least one double-stranded structure downstream of a promoter and / or for producing a vector that expresses RNA constituting the RNA complex of the present invention and / or Or the use of its complementary strand.
• the present invention also relates to the use of a nucleic acid encoding at least one miRNA binding sequence and / or its complementary strand for producing a nucleic acid encoding the RNA constituting the RNA complex of the present invention.
• any combination of the above nucleic acids can be used as an element of a kit for producing a nucleic acid encoding RNA constituting the RNA complex of the present invention.
• the present invention relates to a nucleic acid encoding a pair of complementary sequences forming at least one double-stranded structure and a kit comprising the complementary strand.
• the nucleic acid and complementary strand may form a double stranded DNA.
• a promoter and / or terminator may be operably linked to the double-stranded DNA containing a pair of complementary sequences.
• the nucleic acid may be an expression plasmid, for example.
• the kit may further include a nucleic acid encoding at least one miRNA binding sequence and / or a complementary strand thereof.
• the present invention provides a kit for producing a vector that expresses the RNA complex of the present invention, comprising: (a) a pair of complementary sequences forming at least one double-stranded structure downstream of a promoter;
• the present invention relates to a kit comprising a nucleic acid comprising a site for inserting a nucleic acid between a pair of complementary sequences, and (b) a nucleic acid encoding at least one miRNA binding sequence.
• a nucleic acid encoding the RNA complex of the present invention by inserting a nucleic acid encoding at least one miRNA binding sequence between the nucleic acids encoding a pair of complementary sequences forming the at least one double-stranded structure. Can be easily obtained.
• the structure of each nucleic acid is as described in detail for the RNA complex of the present invention.
• a pair of complementary sequences forming a double-stranded structure may be appropriately determined, and the chain length may be, for example, 15 to 50 base pairs, and preferably 15, 16, 17, 18, 19, 20 , 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 bases, or any one or more thereof, 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, or 18 bases, or any of them.
• the length of the base pair of the double-stranded structure is, for example, 15-30, preferably 16-28, preferably 17-25, preferably 17-24, such as 17, 18, 19, 20, 21 , 22, 23, or 24.
• the nucleic acid is a double-stranded nucleic acid and a desired promoter is operably linked.
• the promoter is preferably the Pol III promoter.
• the present invention is a vector for producing a nucleic acid that expresses the RNA complex of the present invention, comprising a pair of complementary sequences forming at least one double-stranded structure downstream of a promoter and the pair of complements.
• the present invention relates to a vector comprising a nucleic acid comprising a site for inserting a nucleic acid between sequences.
• a restriction enzyme recognition sequence a BsmBI sequence can be exemplified, but this is merely an example and can be appropriately selected.
• a nucleic acid encoding at least one MBS may contain more than one MBS and may be a stretch of a set of one or more complementary sequences that may form a multi-stranded (eg, two or four stranded) structure. It may be included in the sequence.
• the nucleic acid can be exemplified by a pair of complementary sequences forming at least one double-stranded structure, and a nucleic acid containing at least one MBS at both ends of the pair of complementary sequences.
• such a nucleic acid is a nucleic acid containing a pair of complementary sequences capable of forming a stem between two MBS. This stem corresponds to the second double-stranded structure.
• a sequence that forms a G-quadruplex may be included as the second multiple chain structure.
• the nucleic acid may include two or more structural units including a pair of complementary sequences that can form a double-stranded structure between two MBS.
• the structural unit can be included in multiple nesting structures, and between a pair of complementary sequences that can form a double-stranded structure between a pair of MBS, and another pair of MBS and a double-stranded structure between them.
• a sequence including a pair of complementary sequences that can form (# 15, # 16, etc. in FIG. 2) can be included. Multiple MBS sequences may be the same or different.
• MBS-second multiple strands are inserted between a pair of complementary sequences (stem I in FIG. 6) forming the first double-stranded structure.
• a nucleic acid having a structure in which a sequence having a structure-MBS structure is inserted is obtained.
• MBS a pair of complementary sequences forming a second double-stranded structure (stem II in FIG. 6) —a nucleic acid having a structure in which a sequence having the MBS structure is inserted.
• a nucleic acid encoding an RNA complex arranged so that two strands containing MBS are sandwiched between two multi-stranded (eg, double-stranded) structures can be obtained (FIG. 6).
• a nucleic acid consisting of two multi-stranded (eg double-stranded) structures and a pair of opposing single strands (each containing MBS) is compact and exhibits sufficient miRNA inhibitory activity.
• a pair of complementary sequences capable of forming a double-stranded structure and MBS can be appropriately linked via a linker or spacer. The length of the linker or spacer is as described in the specification. In addition, complementary sequences may be linked via a linker or spacer.
• the linker or spacer becomes a loop, and the double strand is combined to form a stem loop.
• the length of the loop may be appropriately adjusted, and details are as described in the specification.
• a sequence forming a G-quadruplex can be used as appropriate.
• a nucleic acid encoding MBS and its complementary strand are synthesized, and both are annealed (for example, the synthetic oligo DNA of FIG. 6B).
• the end of the annealed double-stranded nucleic acid can have the same structure as the end cleaved with a restriction enzyme as appropriate when it is inserted into a restriction enzyme cleavage recognition site.
• the miRNA-inhibiting complex of the present invention or RNA constituting the complex (herein, RNA includes natural RNA and analogs), or a vector that expresses the RNA is a composition for inhibiting miRNA It can be. Since the composition of the present invention can specifically and efficiently inhibit a target miRNA, it is useful for controlling the function of a gene through miRNA inhibition.
• the composition of the present invention can be combined with a desired pharmacologically acceptable carrier or vehicle as required. Examples thereof include a desired solution usually used for suspending nucleic acids, and examples thereof include distilled water, phosphate buffered saline (PBS), sodium chloride solution, Ringer's solution, and culture solution.
• PBS phosphate buffered saline
• composition of the present invention may be combined with organic substances such as biopolymers, inorganic substances such as hydroxyapatite, specifically collagen matrices, polylactic acid polymers or copolymers, polyethylene glycol polymers or copolymers and chemical derivatives thereof as carriers. it can.
• the composition of the present invention can be used as a desired reagent or as a pharmaceutical composition.
• the present invention also provides use of the composition of the present invention, the miRNA-inhibiting complex of the present invention, or the RNA constituting the complex or a vector expressing the RNA for inhibiting miRNA.
• the present invention also provides miRNA inhibitors comprising any of them.
• Introducing into cells can be performed in vitro, ex vivo, or in vivo.
• the cells When administered via cells, the cells are introduced into appropriate cultured cells or cells collected from the inoculated animal.
• Examples of the introduction of nucleic acid include calcium phosphate coprecipitation method, lipofection, DEAE dextran method, a method of directly injecting a DNA solution into a tissue by an injection needle or the like, and introduction by a gene gun.
• Viral vectors are preferred because genes can be introduced into target cells with high efficiency.
• the dose varies depending on the disease, patient weight, age, sex, symptoms, administration purpose, administration composition form, administration method, transgene, etc., but it is adjusted appropriately according to the animal to be administered, administration site, administration frequency, etc.
• the administration route can be appropriately selected.
• the administration subject is preferably a mammal (including human and non-human mammals). Specifically, non-human primates such as humans and monkeys, rodents such as mice and rats, rabbits, goats, sheep, pigs, cows, dogs, cats, and other mammals are included.
• Example 1 1.1 Plasmid construction The oligonucleotide shown in (1) below is annealed and cloned into pMXs-GIN (Haraguchi, T. et al. (2007) FEBS Lett, 581, 4949-4954) cleaved with NotI and SalI. pMXs-GIN-miR140-5pT and pMXs-GIN-miR140-3pT, which are GFP reporters of miR-140-5p and miR-140-3p, were prepared. A 0.7 kb BamHI-EcoRI fragment of pMXs-GFP (Kitamura, T.
• a 1.3 kb HindIII-XbaI fragment of pIRES1Hyg (Clontech) was inserted into the HindIII-XbaI site of pcDNA3.1 to prepare pCMV-Hyg.
• a 2.1 kb NruI-ApaI fragment of pCMV-Hyg was inserted into the NruI-EcoRV site of pSSCG to prepare pSSCH.
• a miR-140-5p / 140-3p expression retroviral vector plasmid a 0.5-kb mouse miR-140-5p / 140-3p fragment was obtained by PCR from the mouse genome using the primer pairs shown in (1) below.
• PCR product was cloned into pCR2.1 (Invitrogen).
• the 0.5-kb BamHI-XhoI fragment of this plasmid was cloned into pSSCH digested with BamHI and SalI to prepare pSSCH-miR140-5p / 140-3p.
• primer pair pMXs-GIN-miR140-3pT used to construct the GFP reporter vector the sense strand 5'- GGCCGCTCCGTGGTTCTACCCTGTGGTAGGG-3 '(SEQ ID NO: 1) and the antisense strand 5'- TCGACCCTACCACAGGGTAGAACCACGGAGC-3 '(SEQ ID NO: 2), for pMXs-GIN-miR140-5pT, sense strand 5'-GGCCGCTCTACCATAGGGTAAAACCACTGGGG -3' (SEQ ID NO: 3) and antisense strand 5'-TCGACCCCAGTGGTTTTACCCTATGGTAGAGC -3 ' SEQ ID NO: 4), for PCR-miR140-5p / 140-3p, sense strand 5'-TGCTTGCTGGTGGTGTAGTC-3 '(SEQ ID NO: 5) and antisense strand 5'-ACCAACACCCACCCAATAGA-3' (
• the oligo pair shown in (2) below was annealed and cloned into pmU6 digested with BbsI and EcoRI to prepare pmU6-TuD-shuttle.
• a series of oligonucleotide pairs shown in (3) below was synthesized. Each oligo pair was annealed and cloned into pmU6-TuD-shuttle digested with BsmBI. Each mU6-TuD RNA cassette was then subcloned into a lentiviral vector plasmid (pLSP) as previously described (Haraguchi, T. et al.
• Each oligo pair (decoy RNA # 1-12, 17-21) was annealed and cloned into pmU6 digested with BbsI and EcoRI. Each oligo pair (decoy RNA # 13-16) was annealed and cloned into pmU6-protoshuttle digested with BsmBI. Each oligo pair (decoy RNA # 22-26) was annealed and cloned into pmU6-TuD-shuttle digested with BsmBI.
• mU6-decoy RNA # 27 cassette the oligo pair shown in (4) below was used as a PCR primer and template, and the PCT product was cloned into pCR2.1.
• Oligonucleotides used (2) Primer pair for constructing the RNA shuttle vector of the present invention
• the sense strand 5'-TTTTGACGGCGCTAGGATCATCGGAGACGGTACCGTCTCGATGATCCTAGCGCCGTCTTTTTTG-3 '(SEQ ID NO: 7) and the antisense strand 5 '-AATTCAAAAAAGACGGCGCTAGGATCATCGAGACGGTACCGTCTCCGATGATCCTAGCGCCGT-3' SEQ ID NO: 8
• sense strand 5'- TTTGACGGCGCTAGGATCATCGGAGACGGTACCGTCTCCGATGATCCTAGCGCCGTCTTTTTTG -3 CG (CT NO: GC) : 10 was used.
• the sense strand sense strand 5'-CATCAACCTACCATAGGGTCATCAAAACCACTGCAAGTATTCTGGTCACAGAATACAACCTACCATAGGGTCATCAAAACCACTGCAAG-3 '(SEQ ID NO: 11) and antisense
• RNA # 2 sense strand 5'-TTTTGACGGCGCTAGGATGCTTGGATCCGTGGTTCTACCCTGTGGTAAGGAAGCATCCTAGCGCCGTCTTTTTTG-3 '(SEQ ID NO: 25) and antisense strand 5'-AATTCAAAAAAGACGGCGCTAGGATGCTTCCTTACCACAGGGTAGGTCCTAGTACACAGCGTAGGTCC
• decoy RNA # 3 the sense strand 5′-TTTTGACAGCGCTCTACGATGAAGGCTCCGTGGTTCTACCCTGTGGTAAGGTTCATCGTAGAGCGCTGTCTTTTTTG-3 ′ and the antisense strand 5′-AATTCAAAAAAGACAGCGCTCTACGACGCTTAGTAG-3
• decoy RNA # 4 the sense strand 5′-TTTTGACAGCGCTCTACGATGCAAGGCTCCGTGGTTCTACCCTGTGGTAAGGTTGCATCGTAGAGCGCTGTCTTTTTTG-3 ′ and the antisense strand 5
• RNA # 20 the sense strand 5'-TTTTGACGGCGCTAGGATGCTTGGATCCGTGGTTCTAATCTCCCTGTGGTAAGGAAGCATCCTAGCGCCGTCTTTTTTG-3 '(SEQ ID NO: 55) and antisense strand 5'-AATTCAAAAAAGACGGCGCTAGGATGCTTCCTTACCACACGGATC
• decoy RNA # 21 the sense strand 5'-TTTTGACGGCGCTAGGATGCTTCCATCCCAGTACACATTTAAATCTGTGGTACCAAGCATCCTAGCGCCGTCTTTTTTG-3 '(SEQ ID NO: 57) and the antisense strand 5'-AATTCAAAAAAGACGGCGCTAGGATGCTTGAGACCACAGATTTAGTAGCCGTACCACAGATTTAGTAGCC
• decoy RNA # 22 the sense strand 5'-CATCCTCCGTGGTTCTAATCTCCCTGTGGTACGTATTCTGGTCACAGAATACCTCCGTGGTTCTAATCTCC
• PCR product was cloned into pCR2.1 using the oligo pairs shown in (5) below as PCR primers and templates.
• the 0.2-kb XhoI-AgeI fragment of this plasmid was cloned into pLenti6 / V5-GW / lacZ (Invitrogen) digested with XhoI and AgeI to prepare pLenti6 / CMV-sponge-miR21 / lacZ.
• the pCS2-Venus 0.3-kb XbaI-ApaI fragment was cloned into the XbaI-ApaI site of pSL1180 to prepare pSL1180-polyA.
• the 3.9-kb HindIII-AgeI fragment of pLenti6 / CMV-sponge-miR21 / lacZ was cloned into the HindIII-AgeI site of pSL1180-polyA to prepare pSL1180-CMVsponge21.
• Antagomir21mir expression vector plasmid (Scherr, M. et al.
• a luciferase reporter plasmid In order to construct a luciferase reporter plasmid, the 0.8-kb KpnI-HindIII fragment of pGL4.74 (Promega) was cloned into pGL4.12 (Promega) digested with KpnI and HindIII to prepare pTK4.12.
• the oligonucleotide pair shown in (6) below was annealed and ligated to the 4.9-kb EcoRI-XbaI fragment of pTK4.12, creating pTK4.12C.P-.
• the oligonucleotide pair shown in (6) below was annealed and cloned into pGL4.74 digested with XbaI and FseI to produce pGL4.74-miR21T.
• Oligonucleotides used Sense strand 5'-CTCGAGTAACTCAACATCAGGACATAAGCTAAGTCTCAACATCAGGACATAAGCTATCAGTCAACATCAGGACATAAGCTACTGATCAACATCAGGACATAAGCTA-3 '(SEQ.GATCAACATCAGGACATAAGCTA-3') '-ACCGGTTAGCTTATGTCCTGATGTTGACCGATAGCTTATGTCCTGATGTTGACAGTTAGCTTATGTCCTGATGTTGAGTTCTAGCTTATGTCCTGATGTTGATCAG-3' (SEQ ID NO: 72) was used.
• forward 5′-AGATCTAATTCATATTTGCATGTCGCT-3 ′ (SEQ ID NO: 73) and reverse 5′-GAATTCAAAAAATAGCTTATGTCCTGATGTTGAGGATCCGAGTGGTCTCATACAGAACTTATA-3 ′ (SEQ ID NO: 74) were used.
• HeLaS3 cells Puck et al., J. Exp. Med. 103: 273-284 (1956)
• PA-1 cells Gaovanella, BC et al., In Vitro Cell Dev. Biol., 10: 382, 1974, 10: 382; Giovanella, BC. Et al., J Natl Cancer Inst, 1974, 52: 921-30
• HCT-116 cells Cancer Res 1981; 41: 1751; J Nat Cancer Inst 1982; 69: 767
• SW480 cells Leibovitz et al., Cancer Res.
• HT29 cells Fogh & Trempe in Human Tumor Cells in Vitro (ed. Fogh J.), Plenum Press, New York, 1975, pp. 115-159), TIG-3 / E / TERT cells (Akagi T et al., Proc Natl Acad Sci USA, 100, 13567-13572. (2003)), and 3Y1 cells (Ushijima T et al., Jpn. J. Cancer Res. 85: 455-458, 1994; Kimura G et al., Int. J. Cancer, 15: 694-706, 1975) is 10% foetal bovine serum (FBS ) In DMEM containing 37).
• FBS foetal bovine serum
• HeLaS3 cells were seeded at 1x10 5 cells per well in a 6-well plate.After 24 hours, pMXs-GIN, pMXs-GIN-miR140-5pT and pMXs-GIN-miR140-3pT virus stocks ( ⁇ 1x10 4 TU) were added at 8 ⁇ g / It was introduced in the presence of ml of polybrene and selected with G418 (1 mg / ml) from 24 hours after transduction. After selection for 2 weeks, G418 was removed from the medium.
• HeLaS3 cells harboring miR-140-5p reporter or miR-140-3p reporter are seeded into 6-well plates at 1x10 5 cells per well, and 24 hours later, pSSCH-miR140-5p / 140-3p virus stock ( ⁇ 1x10 4 TU) was introduced in the presence of 8 ⁇ g / ml polybrene, and was selected with Hygromycin (0.5 mg / ml) 24 hours after transduction. After 2 weeks of selection, Hygromycin was removed from the medium.
• HeLaS3 cells carrying both miR-140-5p reporter and miR140-5p / 140-3p vector, and both miR-140-3p reporter and miR140-5p / 140-3p vector HeLaS3 cells are plated in 6-well plates at 1x10 5 cells per well in DMEM containing 10% foetal bovine serum (FBS), 24 hours later, each miRNA-inhibiting RNA-expressing virus stock (2x10 5 TU) or each decoy RNA-expressing virus Stock (2 ⁇ 10 5 TU) was introduced in the presence of 8 ⁇ g / ml polybrene.
• FBS foetal bovine serum
• Total RNA was prepared using miRNA Isolation Kit (Ambion). Expression of mature miRNA was determined by miR-qRT-PCR using miRNA specific looped RT primers and TaqMan probe according to manufacturer's recommendations (Applied Biosystems, Foster City, USA). U6 snRNA was used as an internal control. PCR was performed in triplicate using the 7300 Real Time PCR System (Applied Biosystems).
• Luciferase assay PA-1 cells, HCT-116 cells, SW480 cells, HT29 cells, TIG-3 / E / TERT cells, and 3Y1 cells were each 1.5x10 in DMEM containing 10% foetal bovine serum (FBS).
• LNA / DNA antisense oligonucleotides are synthesized by ThermoELECTRON and contain locked nucleic acids at eight consecutive centrally located bases (Naguibneva, I. et al. (2006) Biomed Pharmacother, 60, 633-638).
• the LNA / DNA antisense oligonucleotide has the sequence shown in (7) below. All assays were performed with GLOMAX TM (Promega) by dual luciferase assay (Promega) 48 hours after transfection.
• Oligonucleotide (7) Sequence of LNA / DNA antisense oligo
• LNA-miR21 5'-TCAACAT CAGTCTGA TAAGCTA-3 '(SEQ ID NO: 79) was used.
• LNA-NC 5′-CATTAAT GTCGGACA ACTCAAT-3 ′ (SEQ ID NO: 80) was used. LNA is underlined.
• PA-1 cells were seeded in 48-well plates at 1x10 4 cells per well in DMEM containing 10% foetal bovine serum (FBS), and 24 hours later, TuD-miR21-4ntin and TuD-NC expressing lentiviral stock (1 ⁇ 10 5 TU) was introduced in the presence of 8 ⁇ g / ml polybrene and the medium was changed 24 hours after transduction.
• the cell proliferation was measured by measuring the metabolic activity of the cells with GLOMAX TM by CellTiter-Glo TM (Promega) immediately before the transduction and 24, 48, 72, 96 hours after the transduction.
• PA-1 cells were seeded in 48-well plates at 3x10 3 cells per well in DMEM containing 10% foetal bovine serum (FBS), and 18 hours later, TuD-miR21-4ntin and TuD-NC-expressing lentiviral stocks (3x10 4 TU) was introduced in the presence of 8 ⁇ g / ml polybrene and the medium was changed 24 hours after transduction. It was further carried out at GLOMAX TM by Caspase-Glo TM 3/7 (Promega) measuring the activity of caspase 3 and 7 72 hours after transduction.
• GLOMAX TM by Caspase-Glo TM 3/7 (Promega) measuring the activity of caspase 3 and 7 72 hours after transduction.
• the cell pellet was suspended in NP40 lysis buffer (10 mM Tris-HCl (pH 7.4), 10 mM NaCl, 3 mM MgCl 2 , 0.5% Nonidet P-40), allowed to stand on ice for 10 minutes, and then incubated at 1500 rpm at 4 ° C for 5 minutes. Centrifuge for minutes. The supernatant was recovered as a cytoplasmic fraction, and cytoplasmic RNA was recovered by ISOGEN (Wako Pure Chemical Industries, Osaka, Japan). Further, the precipitate, which is a nuclear fraction, was washed twice with 4 ml of NP40 lysis buffer.
• NP40 lysis buffer 10 mM Tris-HCl (pH 7.4), 10 mM NaCl, 3 mM MgCl 2 , 0.5% Nonidet P-40
• RNA smaller than 200 bp was purified from the cytoplasmic RNA and nuclear fraction precipitate using mirVana TM miRNA Isolation Kit (Ambion, Austin, TX). In order to compare and compare the number of original cells, 5% of the recovered RNA was used for Northern blot analysis.
• TAKARA T4 polynucleotide kinase
• Oligonucleotide 8 DNA Probe Sequence Used for Northern Blot 5′-GTTGATGATCCTAGCCGTC-3 ′ (SEQ ID NO: 135) was used as a miRNA-inhibiting RNA detection probe. 5′-TCAACATCAGTCTGATAAGCTA-3 ′ (SEQ ID NO: 136) was used as the miR-21 detection probe. 5′-GCAGTGGGGGGTTGTATACCAAC-3 ′ (SEQ ID NO: 137) was used as a Y4 scRNA detection probe. As the ACA1 snoRNA detection probe, 5′-GTGATGGAAGCATAACCTGTCTC-3 ′ (SEQ ID NO: 138) was used.
• Example 2 Highly sensitive assay system for detecting miR-140-3p activity HeLaS3 (Landgraf, P. et al. 2007) Cell, 129, 1401-1414) was used to construct an extremely sensitive assay system for miR-140-3p activity.
• a retrovirus-based GFP reporter was constructed (miR-140-3p reporter) with a 21 bp insert completely complementary to mature miR-140-3p immediately downstream of the GFP gene (FIG. 15A). These were introduced into HeLaS3 cells to establish mixed cell populations that stably express GFP.
• a retroviral vector was constructed (miR140-5p / 140-3p vector) that drives RNA containing the entire pre-miRNA containing both miR140-5p and miR140-3p from the Pol II promoter (FIG. 15C). This was introduced into HeLaS3 cells with a miR-140-3p reporter to establish mixed cell populations. Compared to non-transfected HeLaS3 cells with the miR-140-3p reporter, GFP expression levels were less than 20% (FIGS. 16A, B, and C).
• Example 3 Design and effectiveness of prototype decoy RNA As a prototype of a decoy RNA, a simple two sequence expected to expose a completely complementary RNA sequence to the RNA sequence of mature miR-140-3p. A decoy RNA with the following structure was designed. These prototype decoy RNAs (FIG. 1A) form a stem loop structure, which is composed of a mature miR-140-3p and a fully complementary MBS and a three-base linker at each end. To stably express these decoy RNAs in cells, use a lentiviral vector equipped with a short RNA expression cassette driven by the polymerase III promoter (mU6) present in both LTRs after integration. Selected (Figure 15D).
• mU6 polymerase III promoter
• RNA decoys are expected to have a 3'-overhanging end of 2 ( ⁇ 4) nucleotides in the stem ( Figure 1A) .
• the synthesized decoy RNA should be transported from the cell nucleus to the cytoplasm, where it will act on the RISC containing the corresponding miRNA, miR-140-3p.
• the nuclear transport of small-RNA with a stem-loop structure has been studied in detail so far, and it has been shown that the length of the stem is important for the efficiency of nuclear export by Exp-5 (Zeng , Y. andullCullen, BR (2004) Nucleic Acids Res, 32, 4776-4785). It has been shown that the binding activity of hairpinExpRNA to Exp-5 decreases dramatically when the stem sequence length is shorter than 16 bp, so the stem length of the prototype RNA decoy varies from 17bp to 24bp.
• RNA decoy with an 18 bp stem is slightly more inhibitory than others, and dsRNA greater than 20 bp can be a potential target for Dicer cleavage in the cytoplasm. It was decided to use a stem length of 18 bp.
• Example 4 Optimization of inhibitory power by modifying the secondary structure of the prototype decoy RNA and MBS
• the decoy RNA was designed to have a more complex secondary structure than the prototype (Fig. 2A)
• the expression cassette was inserted into a lentiviral vector and introduced into the same assay cells used in FIG. 1B.
• These RNAs tested here (decoy # 10- # 16, FIG. 2A) were more efficient than the prototype decoy RNA (decoy RNA # 2) (FIG. 2AB).
• MBS that contains four extra nucleotides between the 8th and 9th nucleotides from the 3 'end of the fully complementary MBS provides attenuation of translation rather than RNA cleavage.
• decoy # 27 was generated by inserting a 3-nucleotide linker between the stem sequence and MBS, and further substituting MBS-pf with MBS-4ntin. Decoy # 27 was greatly improved (55.2% to 80.1%, Figures 2 and 5).
• decoy # 13 was modified on the same principle to produce decoy # 24, but this did not improve the inhibition ability. This is probably because the decoy activity of decoy # 24 was already almost saturated, completely offsetting the exogenously introduced miR-140-3p activity.
• decoy RNAs having the structure of decoy # 13 and # 24 are extremely promising because these RNAs inhibit miRNA functions very efficiently.
• This decoy RNA has two MBS, which are flanked by two stem structures. For example, two MBSs are each sandwiched between the two stem structures, and each MBS has the nucleic acid strands in opposite directions.
• the two stem structures may be double-stranded or four-stranded.
• an expression cassette for this RNA can be easily constructed.
• TuD a decoy RNA having two MBSs and sandwiched between two stem structures has a particularly strong miRNA inhibitory effect.
• Example 5 Versatility, specificity and duration of the inhibitory effect of the RNA complex of the present invention
• insertion of a miR-140-3p reporter A reporter cell line for miR-140-5p was constructed in which the sequence was simply replaced with a sequence completely complementary to miR-140-5p (FIG. 15 (B)).
• TuD-miR-140-3p TuD-miR-140-3p (TuD-miR-140-3p-4ntin) (decoy # 24) or TuD-miR-140-5p-4ntin (Figure 18) contains 4 extra nucleotides in the MBS The inhibitory effect of was determined using both of these reporter cell lines.
• TuD-miR-140-3p-4ntin vector was introduced into HeLaS3 cells with both miR-140-3p reporter and miR140-5p / 140-3p vector, and the GFP expression level over time was changed over one month. Was monitored (FIG. 7C). From these results, TuD-miR-140-3p-4ntin efficiently inhibits the target miR-140-3p in HeLaS3 cells for over a month, and TuD-miR-140-5p-4ntin does not It was shown that the state of not being maintained is maintained.
• TuD-miR-140-5p-4ntin reduced the apparent expression level of miR-140-5p by about 65% as long as it was detected by this method, but not TuD-miR-140-3p-4ntin (FIG. 7D). This result showed that the amount of free miR-140-5p was reduced to about 1/3, but dsRNA formed between RNA decoy and mature miRNA was not Even so, it may be too stable to detect mature miRNA by real-time PCR.
• RNA expressed in HeLaS3 cells expressing TuD-miR-140-3p-4ntin or TuD-miR-140-5p-4ntin was examined. 14 days after introduction of TuD-miR-140-3p-4ntin vector or TuD-miR-140-5p-4ntin vector, cell nuclear fraction RNA and cytoplasmic fraction RNA were prepared, and intramolecular and intermolecular bonds were prepared. To minimize, PAGE was performed at high temperature and analyzed by Northern blot. A 120 nt band and a broad band around 90 nt were observed by the probe for the expressed miRNA-inhibiting RNA (FIG. 7E).
• TuD-miR-140-3p-4ntin and TuD-miR-140-5p-4ntin were mainly present in the cytoplasm, and TuD-miR-140-5p-4ntin was slightly present in the nucleus. This confirmed that the transcribed RNA was efficiently transported out of the nucleus.
• MBS sequence has some influence on RNA export efficiency to some extent, but the effect is minor.
• Example 6 Inhibitory effect of the RNA complex of the present invention on endogenous miRNA
• a comparison with a conventional synthetic miRNA inhibitor was performed next.
• Several experiments were performed using different target miRNAs (endogenous miR-21) and different assay systems. Using the same principles as TuD-miR-140-3p-4ntin and TuD-miR-140-3p-pf, we constructed two TuD-miR21s, TuD-miR-21-4ntin and TuD-miR21-pf, respectively ( Figure 18).
• a DNA-based vector expressing TuD-miR-21-4ntin or TuD-miR-21-pf ( Figure 18)
• a PA with a Renilla luciferase reporter with or without a 21 bp DNA sequence fully complementary to mature miR-21 in -UTR and a control Firefly luciferase reporter ( Figure 17 (AC)) as a transfection control.
• -1 cells were transiently transfected.
• TuD-miR21-4ntin The cell population expressing TuD-miR21-4ntin is expressed by miR21 reporter expression, ie, Renilla luciferase activity normalized with Firefly luciferase activity, and expression of cells transfected with DNA-based vector (TuD-NC) expressing negative control. It was raised about 25 times (Fig. 8A). TuD-miR-21-pf showed a lower inhibitory effect but still resulted in a significant recovery corresponding to about 14-fold activity. Importantly, the level of reporter activity recovered was close to that of the control reporter without the miR-21 target sequence. The activity of this control reporter was almost constant independently of the introduced decoy RNA, as expected.
• the inhibitory effect of the expression vector producing the transiently transfected RNA complex of the present invention was compared with that of the LNA / DNA antisense oligonucleotide as described in section 1.5 of Example 1 ( FIG. 8A).
• Transfection of PA-1 cells with locked nucleic acid (LNA / DNA) antisense oligonucleotide (LNA-miR21) compared to that of PA-1 cells transfected with LNA / DNA-NC ⁇ ⁇ used as a negative control.
• Increased the expression of the target reporter by a factor of two.
• the cell line for the assay is changed from PA-1 used above to HCT-116, and the plasmid vector expressing the RNA complex of the present invention, CMV sponge expression plasmid vector, H1-Antagomir expression plasmid vector, miRNA eraser expression Comparison of miRNA inhibitory effects of plasmid vectors and LNA / DNA antisense oligonucleotides was performed as described in Section 1.5 of Example 1 ( Figure 9). As a result, it was shown that the RNA complex of the present invention is extremely effective as compared with other methods.
• TuD-miR-21-4ntin and TuD-miR- in PA-1 cells and HCT-116 cells transfected with miRNA-inhibiting RNA (TuD-miR-21-4ntin and TuD-miR-21-pf) expression vectors, respectively
• the expression level of 21-pf was analyzed by Northern blot.
• both TuD-miR-21-4ntin and TuD-miR-21-pf were strongly expressed (FIG. 10A).
• TuD-miR-21-4ntin was strongly expressed, whereas TuD-miR-21-pf showed only weaker expression than that (FIG. 10B). This phenomenon is consistent with the above hypothesis that TuD-miR-21-4ntin is stable to degradation by miRNA under conditions where miR-21 concentration is high, whereas TuD-miR-21-pf is susceptible to degradation. Match.
• the miR-21 level was examined using quantitative real-time RT-PCR.
• TuD-miR-21-4ntin and TuD-miR-21-pf significantly reduced the apparent expression level of miR-21 (FIG. 8D).
• FIG. 8E As a result of examining the miR-21 level by Northern blot, no decrease was observed in both pre-miR-21 and mature-miR-21 (FIG. 8E).
• the actual amount of miR-21 did not decrease, but it was thought that detection by RT-PCR was inhibited due to the strong binding of miR-21 and TuD-miR-21. It is done. This phenomenon has been pointed out by other research groups.
• FIGS. 8A, 9B, ⁇ and 9 were performed at 500 ng / well in a 24-well plate, but when the amount dependency was examined, the effect was saturated at 300 ng / well, and 1/3 of that at 10 ng / well. A moderate miRNA inhibitory effect was observed (FIG. 19).
• RNA of the present invention also showed a high miRNA inhibitory effect in colon cancer cells (SW480, HT29), immortalized human lung embryonic fibroblasts (TIG-3 / E / TERT) and rat fibroblasts (3Y1) ( (Figure 20).
• RNA complex of the present invention can specifically inhibit the function of endogenous miRNA.
• RNA-inhibiting RNA induces biological activity by suppressing the miRNA function.
• Lentiviral vectors expressing TuD-miR21-4ntin and TuD-NC were introduced into PA-1 cells at an MOI of 10 and the cell proliferation activity was measured (FIG. 11A).
• the cells into which TuD-NC was introduced proliferated 5 times or more in 4 days, whereas the cells into which TuD-miR21-4ntin was introduced proliferated only to about 1.6 times.
• apoptosis was evaluated by measuring the activities of caspases 3 and 7 using a similar culture kit (FIG. 11B).
• the cells into which TuD-miR21-4ntin was introduced were up to about 3 times the cells into which TuD-NC was introduced. This is because apoptosis was induced due to the low degree of cell proliferation in the cells into which TuD-miR21-4ntin was introduced. From the above, it was confirmed that the RNA of the present invention sufficiently suppressed the miRNA function, thereby inhibiting the growth-stimulating activity and apoptosis-suppressing activity of miR-21 (Corsten, MF, (2007) Cancer Res. 67, 8994-9000 )It has been shown.
• MiRNA has a miRNA family that has the same seed sequence and is thought to have a common target gene. Therefore, in order to investigate whether the miRNA-inhibiting RNA of the present invention has an inhibitory effect on the target miRNA family, experiments were conducted targeting miRNA-15a, 15b, 16, 195, 424, and 497 families.
• a luciferase reporter vector for miR-16 was constructed in which the insertion sequence of the miR-21 luciferase reporter was replaced with a sequence completely complementary to miR-16 (FIG. 17D).
• HCT-116 cells in which miRNA-15a, 15b, and 16 were expressed and miRNA-195, 424, and 497 were not expressed were observed by miRNA micro array (FIG. 21). As shown in FIG.
• the homology of miRNA-16 and 195 is high, and the homology of miRNA-16 and 497 is low except for the seed site. Therefore, TuD-miR-16-4ntin, TuD-miR-195-4ntin and TuD-miR497-4ntin were constructed (FIGS. 18 and 12B). Since miRNA-195 and 497 are not expressed under these conditions, the inhibitory effect of TuD-miR-195-4ntin and TuD-miR497-4ntin on miRNA-15a, 15b, and 16 can be observed.
• TuD-miR16-4ntin, TuD-miR-195-4ntin and TuD-miR497-4ntin cell populations expressed miR16 reporter expression, namely Renilla luciferase activity normalized with Firefly luciferase activity, The expression was increased by 3.1-fold, 5.2-fold and 2.6-fold, respectively, compared to the expression of the cell population transfected with TuD-NC (FIG. 12C).
• the level of reporter activity recovered by TuD-miR-16-4ntin and TuD-miR-195-4ntin was the same level as that of the control reporter without the miR-16 target sequence.
• the activity of the control reporter was almost constant regardless of the introduced miRNA-inhibiting RNA. From this experiment, it was confirmed that the inhibitory effect of the RNA of the present invention extends not only to the target miRNA but also to its family. Moreover, although the inhibitory effect on the family having high homology is higher than that on the family having low homology, it was shown that the inhibitory effect is obtained even if the homology is low.
• RNA complex of the present invention was produced using an oligonucleotide, and the inhibitory effect on endogenous miRNA was examined.
• Cell Culture HCT-116 cells (Cancer Res 1981; 41: 1751; J Nat Cancer Inst 1982; 69: 767) were cultured at 37 ° C. in DMEM containing 10% foetal bovine serum (FBS). Luciferase assay The day before transfection, HCT-116 cells were seeded in 24-well plates at 1.0x10 5 cells per well in DMEM containing 10% foetal bovine serum (FBS), Lipofectamine 2000 (Invitrogen) and 10 ng of pTK4.12C.P.
• LNA / DNA antisense oligonucleotides are synthesized by ThermoELECTRON and contain locked nucleic acids at eight consecutive centrally located bases (Naguibneva, I. et al. (2006) Biomed Pharmacother, 60, 633-638).
• TuD-2'-O-Methyl-RNA oligonucleotide, 2'-O-Methyl-RNA antisense oligonucleotide, LNA / DNA antisense oligonucleotide, PNA antisense oligonucleotide have the sequence shown in (1) below .
• miRIDIAN Inhibitor is a synthetic oligo purchased from Thermo scientific Dharmacon. All assays were performed with GLOMAX TM (Promega) by dual luciferase assay (Promega) 48 hours after transfection.
• Oligonucleotides used (1) 2'-O-Methyl antisense oligo and LNA / DNA antisense oligo sequences For 2'-O-Methyl-TuD-miR21, 5'-GACGGCGCUAGGAUCAUCAACUCAACAUCAGUCAAUGUGAUAAGCUACAAGUAUUCUGGU -3 '(SEQ ID NO: : 148) and 5′-ACCAGAAUACAACUCAACAUCAGUCAAUGUGAUAAGCUACAAGAUGAUCCUAGCGCCGUC-3 ′ (SEQ ID NO: 149) were used after annealing. All bases are 2'-O-Methylated.
• PNA-miR21 5'- RRRQRRKKR-OO- ATTAATGTCGGACAA-3 '(SEQ ID NOs: 152, 153) was used.
• PNA-NC 5'- RRRQRRKKR-OO- TCAACATCAGTCTGA-3 '(SEQ ID NOs: 152, 154) was used. All bases are PNA. Cell penetrating peptide and AEEA linker (AEEA: 8-amino-3,6-dioxaoctanoic acid) are underlined.
• the cell population transfected with 2'-O-Methyl-TuD-miR21 shows the expression of miR21 reporter, that is, Renilla luciferase activity normalized by Firefly luciferase activity, and expression of cells transfected with 2'-O-Methyl-NC. More than about 21 times, about 43 times, about 51 times, about 58 times, and about 69 times at each concentration of 1 nM, 3 nM, 10 nM, 50 nM, and 200 nM (FIGS. 22 and 23).
• 2′-O-Methyl-miR21, LNA-miR21, and PNA-miR21 showed only about 6-fold, about 2-fold, and about 11-fold increases at 200 nM, respectively.
• the miR-21 inhibitory effect of 2'-O-Methyl-TuD-RNA oligonucleotide and miRIDIAN Inhibitor was compared at concentrations of 0.1 nM, 0.3 nM, 1 nM, and 3 nM.
• -Methyl-TuD-miR21 shows about 3.0 times, about 9.1 times, about 28.9 times, about 45.9 times rise, miRIDIAN Inhibitor-miR21 is about 2.5 times, about 5.2 times, about 11.6 times, about 20.1 times An increase was shown (Figure 24). On the other hand, the activity of the Renilla luciferase reporter without the target sequence was almost constant independently of the introduced antisense oligo at low concentrations. These results indicate that 2'-O-Methyl-TuD-miR21 has a much higher ability to inhibit miRNA under these transfection conditions than conventional synthetic reagents.
• Example 8 Construction of miRNA-inhibiting plasmid using other promoters PCR was performed from human genomic DNA using the primers shown in (2) below, and cloned into pCR2.1 to prepare ph7SK-protoshuttle (Fig. 27 (A) )). ph7SK-protoshuttle was digested with KpnI-HindIII, and the oligonucleotide shown in (2) below was annealed and cloned to prepare ph7SK-TuD-shuttle.
• Each oligo pair shown in (3) below was annealed and cloned into ph7SK-TuD-shuttle digested with BsmBI to prepare ph7SK-TuD-miR21-4ntin. Thereafter, the BamHI-EcoRI fragment of ph7SK-TuD-miR21-4ntin was inserted into the BamHI-EcoRI site of pSL1180 (Pharmacia) to prepare a miRNA-inhibiting RNA expression plasmid vector pSL1180-TuD-miR21-4ntin.
• Oligonucleotides used (2) Primer pair for constructing the shuttle vector of RNA of the present invention
• sense strand 5'- CTCGGATGTGAGGGCGTCATCGGAGACGACACCATCCACAGCCAGCGTCTCGATGACGCCCTCACATCCTTTTTTGAATTCA -3' SEQ ID NO: 157) and antisense strand 5'- AGCTTGAATTGCAATGGTGCTG 158) was used.
• TuD RNA-miR21-4ntin has a sense strand 5'-CATCAACTCAACATCAGTCAATGTGATAAGCTACAAGTATTCTGGTCACAGAATACAACTCAACATCAGTCAATGTGATAAGCTACAAGTGTGTTTT -3 ′ (SEQ ID NO: 18) was used.
• HCT-116 cells contain miRNA-inhibiting RNA expression plasmid vector. Overtransfected.
• the cell population transfected with mU6 promoter-TuD-miR21 is approximately 59 times more miR21 reporter expression, ie, Renilla luciferase activity normalized by Firefly luciferase activity than that of cells transfected with mU6 promoter-TuD-NC. It was raised (FIG. 27 (B)).
• h7SK promoter-TuD-miR21 increased about 77 times the expression of cells transfected with h7SK promoter-TuD-NC.
• the BamHI-EcoRI fragments of these plasmids were inserted into the BamHI-EcoRI site of pSL1180 (Pharmacia), and miRNA-inhibiting RNA expression plasmid vectors pSL1180-TuD-miR21-4ntin-GqL111, pSL1180-TuD-miR21-4ntin-GqL333, pSL1180- TuD-miR21-4ntin-1MBS-1 and pSL1180-TuD-miR21-4ntin-1MBS-2 were prepared.
• Oligonucleotides used (4) For the primer pair TuD RNA-miR21-4ntin-GqL111 for constructing the expression vector of the RNA of the present invention, the sense strand 5′-CATCAACTCAACATCAGTCAATGTGATAAGCTACAAGGGAGGGCGGGAGGGAACTCAACATCAGTCAATGTGATAAGCTACAAG-3 ′ (SEQ ID NO: 159) and The sense strand 5′-TCATCTTGTAGCTTATCACATTGACTGATGTTGAGTTCCCTCCCGCCCTCCCTTGTAGCTTATCACATTGACTGATGTTGAGTT-3 ′ (SEQ ID NO: 160) was used.
• G-quadruplex Comparison of effects of each structure on inhibitory effect (G-quadruplex)
• a miRNA-inhibiting RNA was prepared by replacing the shorter one of the two stem structures with a G-quadruplex known as a strong structure (FIG. 25).
• G-quadruplex has the sequence GGG-loop-GGG-loop-GGG-loop-GGG.
• the loop array length 1-1-1 takes a structure called Parallel, and the loop 3-3-3 transitions between the Parallel structure and the Antiparallel structure. These were designated as GqL111 and GqL333, respectively.
• the effect of miRNA-inhibiting RNA of each structure was compared by a luciferase reporter assay system using HCT-116 cells.
• mU6-TuD-miR21-4ntin increased the expression of miR21 reporter by about 40 times compared to mU6 promoter-TuD-NC.
• mU6-TuD-miR21-4ntin-GqL111 and mU6-TuD-miR21-4ntin-GqL333 increased about 33 times and about 20 times (FIG. 25 (C)).
• mU6-TuD-miR21-4ntin-1MBS-1, mU6-TuD-miR21-4ntin-1MBS-2 increased about 22 times and about 6.5 times (FIG. 26 (B)).
• the number of MBS greatly affects the inhibitory effect.
• MiRNA inhibitory RNAs with one or three MBS also showed a high inhibitory effect, but miRNA inhibitory RNAs with two MBS were most effective.
• TuD-miR21 which has two MBS, exhibits significantly higher inhibitory effects than TuD-miR21-4ntin-1MBS-1 and TuD-miR21-4ntin-1MBS-2, which have one MBS. did. It was shown that when the region facing MBS is not MBS, its nucleotide sequence can greatly influence the inhibitory effect.
• Example 10 Biological activity by miR-200 family inhibition 1.1 Plasmid construction Each oligo pair shown in (5) below is annealed and cloned into pmU6-TuD-shuttle and ph7SK-TuD-shuttle digested with BsmBI. -4ntin-3pL, ph7SK-TuD-miR200c-4ntin-3L, and ph7SK-TuD-miR200c-4ntin-3pL were prepared.
• the BamHI-EcoRI fragment of these plasmids was inserted into the BamHI-EcoRI site of pSL1180 (Pharmacia), and miRNA-inhibiting RNA expression plasmid vectors pSL1180-mU6-TuD-miR200c-4ntin-3L, pSL1180-mU6-TuD-miR200c-4ntin- 3pL, pSL1180-h7SK-TuD-miR200c-4ntin-3L, and pSL1180-h7SK-TuD-miR200c-4ntin-3pL were prepared.
• HCT-116 cells (Cancer Res 1981; 41: 1751; J Nat Cancer Inst 1982; 69: 767) were cultured at 37 ° C in DMEM containing 10% foetal bovine serum (FBS) did.
• HCT-116 cells are seeded at 1x10 5 cells per well in a 6-well plate.
• pLCG-h7SK-TuD-NC virus stock (1 ⁇ 10 6 TU) was introduced in the presence of 8 ⁇ g / ml polybrene, and GFP-expressing cells were sorted using a FACS Area 8 days after transduction.
• Luciferase assay HCT-116 cells were plated on 24-well plates at 1.0x10 5 cells per well in DMEM containing 10% foetal bovine serum (FBS) the day before transfection, Lipofectamine 2000 (Invitrogen) and 10 ng of pTK4.12C.
• P- (Firefly luciferase plasmid; internal control), 100 ng pGL4.74-miR200cT (RLuc target reporter plasmid), or pGL4.74 without target sequence (Figure 28A), 1 ng, 10 ng pSL1180-mU6-TuD- miR200c-4ntin-3L and pSL1180-mU6-TuD-NC • pSL1180-h7SK-TuD-miR200c-4ntin-3pL • pSL1180-h7SK-TuD-NC were transfected in triplicate.
• pLCG-mU6-TuD-miR200c-4ntin-3L, pLCG-h7SK-TuD-miR200c-4ntin-3pL cells introduced 21 days after introduction of lentivirus, respectively, in DMEM containing 10% foetal bovine serum (FBS), 1.0x10 5 cells per well in 24-well plates, Lipofectamine 2000 (Invitrogen) and 10 ng pTK4.12C.P- (Firefly luciferase plasmid; internal control), 100 ng pGL4.74-miR200cT (RLuc target reporter plasmid), or PGL4.74 without the target sequence (FIG. 28A) was transfected in triplicate. All assays were performed with GLOMAX TM (Promega) by dual luciferase assay (Promega) 48 hours after transfection.
• GLOMAX TM Promega
• the membranes were incubated with a horseradish peroxidase-conjugated secondary antibody for 1 hour at room temperature. The signal was detected using ECL reagent (Amersham).
• Oligonucleotide used (5) Primer pair for constructing expression vector of RNA of the present invention pmU6-TuD-miR200c-4ntin-3L and ph7SK-TuD-miR200c-4ntin-3L, sense strand 5'-CATCAACTCCATCATTACCCCACTGGCAGTATTACAAGTATTCTGGTCACAGAATACAACTGGCATCA -3 ′ (SEQ ID NO: 179) and antisense strand 5′-TCATCTTGTAATACTGCCAGTGGGGTAATGATGGAGTTGTATTCTGTGACCAGAATACTTGTAATACTGCCAGTGGGGTAATGATGGAGTT-3 ′ (SEQ ID NO: 180) were used.
• sense strand 5'-CTAGACCGGAATTCTCCATCATTACCCGGCAGTATTACTCGAGCGGAGGCCGG-3 '(SEQ ID NO: 183) and antisense strand 5'-CCTCCGCTCGAGTAATACTGCCGGGTAATGATGGAGAATTCCGGT-3' (SEQ ID NO: 184) were used.
• mU6-TuD-miR200c-4ntin-3L In an experiment in which 1 ng of the miRNA-inhibiting RNA (TuD200) expression plasmid vector of the present invention targeting miR200 was transfected, mU6-TuD-miR200c-4ntin-3L, mU6-TuD-miR200c-4ntin-3pL, h7SK-TuD-miR200c -4ntin-3L and h7SK-TuD-miR200c-4ntin-3pL increased the expression of the miR200c reporter by about 5.7 times, about 6.7 times, about 6.1 times, and about 6.7 times, respectively, compared with mU6-TuD-NC.
• h7SK-TuD-NC was almost equivalent (FIG. 28B).
• mU6-TuD-miR200c-4ntin-3L, mU6-TuD-miR200c-4ntin-3pL, h7SK-TuD-miR200c-4ntin-3L, h7SK-TuD-miR200c-4ntin -3pL increased the expression of the miR200c reporter by about 8.2 times, about 8.7 times, about 8.0 times, and about 8.5 times than mU6-TuD-NC, respectively.
• h7SK-TuD-NC was almost equivalent.
• 1 ng of transfection exhibited an effect that is not inferior to that of 10 ng (FIG. 28C).
• TuD-200c can sufficiently inhibit endogenous miR-200 with a small introduction amount.
• mU6 promoter, h7SK promoter, TuD-miR200c-4ntin-3L, and TuD-miR200c-4ntin-3pL all showed high inhibitory activity.
• the TuD-miR200c expression lentiviral vector was also introduced into TuD RNA stable expression cells, and luciferase reporter assay was performed 23 days after the virus introduction.
• -4ntin-3pL-expressing cells increased miR200c reporter expression by about 6.9 and 6.9 times, respectively, compared to mU6-TuD-NC-expressing cells.
• h7SK-TuD-NC expressing cells were almost equivalent (FIG. 28D). From these results, it was shown that miR-200 can be efficiently inhibited for a long period of time by using the TuD-miR200c expression lentiviral vector.
• RNA-inhibiting RNA-expressing lentiviral vectors pLCG-mU6-TuD-miR200c-4ntin-3L, pLCG-mU6-TuD-NC, pLCG-h7SK- TuD-miR200c-4ntin-3pL and pLCG-h7SK-TuD-NC were introduced, and GFP-expressing cells were collected.
• the proteins of these cells were collected, and the expression levels of E-cadherin and Vimentin, which are gene markers of epithelial cells and mesenchymal cells, were analyzed by Western blotting.
• E-cadherin is expressed in pLCG-mU6-TuD-miR200c-4ntin-3L, pLCG-h7SK-TuD-miR200c-4ntin compared to cells transfected with pLCG-mU6-TuD-NC -3pL was significantly reduced in cells, and vimentin was not expressed in cells transfected with pLCG-mU6-TuD-NC and pLCG-h7SK-TuD-NC, but pLCG-mU6- It was expressed in cells transfected with TuD-miR200c-4ntin-3L and pLCG-h7SK-TuD-miR200c-4ntin-3pL (FIG. 28E). These results indicated that the inhibition of miR-200 family by TuD-miR200c transformed HCT116, an epithelial cell, into a mesenchymal cell.
• the present invention provides a miRNA-inhibiting complex that can efficiently and specifically inhibit miRNA.
• the miRNA-inhibiting complex of the present invention can stably inhibit miRNA for a long period of time, for example, by expressing it from a retroviral vector, and enables an in vivo assay such as a knockdown mouse. Furthermore, it is possible to perform miRNA knockdown in a time-specific and tissue-specific manner using Cre-loxP. As illustrated in FIG. 6, since the expression cassette of miRNA-inhibiting RNA of the present invention can be easily constructed, an RNA library for comprehensive analysis of miRNA can also be constructed. Thus, the present invention provides a very useful tool for miRNA research.
• miRNAs In vivo genes are also expected to be a significant proportion of miRNA targets, and miRNAs play an important role in a variety of settings, including differentiation, development, tumorigenesis, and cellular defense against infections. Has been suggested. The method of the present invention is useful for controlling the functions of these miRNAs in elucidation of gene regulatory mechanisms and gene therapy for tumors and infectious diseases.

Abstract

Description

Claims (18)

Priority Applications (4)

Applications Claiming Priority (4)

Related Child Applications (1)

Publications (1)

Family

ID=42119260

Family Applications (1)

Country Status (5)

Cited By (15)

Families Citing this family (15)

Citations (2)

Family Cites Families (3)

• 2009
  • 2009-10-02 EP EP09821914.0A patent/EP2363467B1/en active Active
  • 2009-10-02 JP JP2010534765A patent/JP4936343B6/ja active Active
  • 2009-10-02 CN CN200980152926XA patent/CN102264898B/zh active Active
  • 2009-10-02 WO PCT/JP2009/067251 patent/WO2010047216A1/ja active Application Filing
• 2011
  • 2011-03-02 US US13/039,156 patent/US8563709B2/en active Active

Patent Citations (2)

Non-Patent Citations (82)

Also Published As

Similar Documents

Legal Events