WO2010062502A1 - Carriers for the delivery of nucleic acids to cells and methods of use thereof - Google Patents

Abstract

Described herein are compounds and methods useful for the delivery of nucleic acids to cells. The compounds and methods are useful in delivering all types of nucleic acids to cells including sensitive nucleic acids such as, for example, siRNA.

Description

CARRIERS FOR THE DELIVERY OF NUCLEIC ACIDS TO CELLS AND METHODS

OF USE THEREOF

CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims benefit of U.S. Provisional Application No. 61/110,661, filed November 3, 2008, and U.S. Provisional Application No. 61/166,916, filed April 6, 2009, which are hereby incorporated herein by reference in their entirety.

BACKGROUND

Gene therapy is an effective treatment for diseases including genetic, metabolic diseases and cancers. Gene therapy involves the treatment of a disease by replacing, supplementing or silencing a gene that is absent or abnormal in the cells of the subject. The plasmid DNA can be an efficient vector to inoculate functional gene to replace or supplement disease-related gene into target cells. To specifically silence a gene that is abnormal or overexpressed, RNAi provides an effective treatment. Specifically, the siRNA containing 21-29 bp of RNA can selectively induce the degradation of complementary mRNA leading to the down-regulation of related protein expression. To conduct effective gene therapy, plasmid DNA and siRNA have to be effectively delivered into the target cells. However, due to their large size and high density of negative charges, plasmid DNA and siRNA can barely pass through the negatively charged outer membrane of cells, thus necessitating the use of carriers or delivery devices.

Versatile types of carriers have developed for gene delivery, such as cationic polymers, cationic lipids and surfactants. However, the use of these carriers is not completely effective in delivering nucleic acids such as siRNA to cells. First, siRNA, with 21-23 base pairs of nucleotides, is much shorter than DNA which could contain thousands of base pairs. Consequently, nanoparticles formed by siRNA are less stable and more prone to dissociate than the DNA complexes. Secondly, siRNA is more easily degradable than DNA, therefore it requires extra protection in extracellular environments before entering the target cells.

Thus, what is needed is a delivery carrier that is non-toxic, non-immunogenic, and protects nucleic acids such as siRNA, microRNA, antisense oligonucleotides, RNA and DNA from enzymatic degradation during the delivery process. It is also desirable that the delivery system prevents rapid elimination from the body, facilitate specific uptake by target tissue and target cells, and rapidly release the nucleic acid intracellularly at the site of action. The compounds and methods described herein address many of the shortcomings of current delivery systems.

BRIEF SUMMARY

In accordance with the purpose of this invention, as embodied and broadly described herein, this invention relates to compounds and methods useful for the delivery of nucleic acids to cells. The compounds and methods are useful in delivering all types of nucleic acids to cells including sensitive nucleic acids such as, for example, siRNA. The advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the aspects described below. The advantages described below will be realized and attained by means of the elements and combinations particularly pointed out in the appended claims. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive.

BRIEF DESCRIPTION OF THE DRAWINGS The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate several embodiments of the disclosed methods and compositions and together with the description, serve to explain the principles of the disclosed methods and compositions.

Figure 1 shows chemical structures of multifunctional functional carriers. Figure 2 shows synthetic procedure of SKACO.

Figure 3 shows agarose gel electrophoretic shift assay of plasmid DNA (pCMV-Luc) complexed with multifunctional carriers at different N/P ratios. A: SKHCO, B: SKCO; C: SHKCO; D: SHHKCO; E: SKAHCO, F: SKACO; G: SHKACO; H: SHHKACO pCMV-Luc: 0.5 Dg/lane. o.c, open circular plasmid DNA; s.c, supercoiled plasmid DNA.

Figure 4 shows particle size of pDNA (A) and siRNA (B) compled with multifunctional carriers at N/P ration 12. ( Mean +/- SD, n=3). Lipo-2000 was abbreviated from Lipofectamine- 2000.

Figure 5 shows hemolytic activity of pDNA complexes formed with MFCs and Lipofectamine-2000 (Lipo-2000) at pH 7.4 and 5.5. The carrier/pDNA complexes were prepared at N/P ratio 12. The relative haemolytic efficiency was normalized to the cells treated with Triton X-100 (1% v/v).

Figure 6 shows cellular uptake of pDNA mediated by multifunctional carriers at N/p ratio 12 on U87 cells. 1 μg pDNA was labeled with YOYO-I. FLl channel was focused on the green fluorescence of YOYO- 1.

Figure 7 shows in vitro transfection efficiency of pCMV-Luc (0.5 μg) mediated by multifunctional carriers at N/P ratio 12 on U87 cell line. Lipofectamine 2000 (Lipo-2000) was used as control.

Figure 8 shows flow cytometry analysis of multifunctional carriers mediated expression of plasmid DNA encoding GFP plasmid on U87 cell line. Lipofectamine-2000 was used as control. FLl channel was focused on the green fluorescence of GFP.

Figure 9 shows cytotoxicity of multifunctional carriers/plasmid DNA complexes at N/P ratio 12 on U87 cell line. Lipofectamine-2000 (Lipo-2000) was used as control.

Figure 10 shows cellular uptake of siRNA mediated by multifunctional carriers on U87 cell line. The Lipo-2000 is used as control.

Figure 11 shows luciferase gene silencing in U87-Luc cells mediated by complexes formed by anti-Luc siRNA (50 nM) and carriers. The relative gene silencing efficiency was normalized to untreated cells.

Figure 12 shows green fluorescent protein (GFP) silencing in CHO-eGFP cells mediated by complexes formed by anti-GFP siRNA (100 nM) and carriers. FL-I channel was set on GFP fluorescence.

Figure 13 shows cytotoxicity of siRN A/surfactant complex at N/P ratio 12 on U87 cells. siRNA concentration was 50 nM. Lipofectamine 2000 (Lipo-2000) was used as control.

Figure 14 shows the synthesis of EKHCO. Figure 15 shows the agarose gel electrophoresis shift assay results of (A) EKHCO; and

(B) EHHKCO/Plasmid DNA, 0.5 μg/lane, where o.c. is open circle plasmid DNA and s.c. is supercoiled plasmid DNA.

Figure 16 shows the average particle sizes of EHHKCO/plasmid DNA and EKHCO/plasmid DNA at varying N/P ratios. (■) EHHKCO; (A) EKHCO. Figure 17 shows average particle sizes of EHHKCO, EKHCO complexed with siRNA at varying N/P ratios. (■) EHHKCO; (A) EKHCO. Figure 18 shows the critical micelle concentration (CMC) of EHHKCO, EKHCO in pure water. The CMC are 9.50 μM and 6.87 μM for EHHKCO and EKHCO, respectively.

Figure 19 shows the hemolytic activities of EHHKCO, EKHCO, and DOTAP at variable concentrations at pH 5.5 and pH 7.4. Triton X-IOO (1%, w/v) and PBS were used as controls. Figure 20 shows the hemolytic activities of surfactant/plasmid DNA complexes

(EHHKCO, EKHCO) with variable surfactant concentrations at pH 5.5 and pH 7.4. The surfactant/plasmid NDA complex was prepared at N/P = 12. DOTAP/plasmid DNA complex was prepared at N/P = 4. Triton X-IOO (1%, w/v) and PBS were used at controls.

Figure 21 shows the hemolytic activities of surfactant/siRNA complexes (EHHKCO, EKHCO) with variable surfactant concentrations at pH 5.5 and pH 7.4. The surfactant/plasmid NDA complex was prepared at N/P = 12. DOTAP/plasmid DNA complex was prepared at N/P = 4. Triton X-IOO (1%, w/v) and PBS were used at controls.

Figure 22 shows in vitro transfection efficiency of EHHKCO/pCMV-Luc and EKHCO/pCMV-Luc complexes on U87 cell line at varying N/P ratios. Figure 23 shows in vitro transfection efficiency of EHHKCO/pCMV-Luc and

EKHCO/pCMV-Luc complexes at indicated N/P rations on U87 cell line using DOTAP as a control.

Figure 24 shows flow cytometry studies of cellular uptake of plasmid DNA with EHHKCO and EKHCO and expression of GFP encoding plasmid on U87 cell line using DOTAP as a control.

Figure 25 shows the flow cytometry analysis of carrier mediated siRNA uptake (EHHKCO, EKHCO) on U87 cell line. siRNA was labeled with AlexaFluor 488.

Figure 26 shows flow cytometry analysis of gene silencing in luciferase expressing U87 cells with anti-luc siRNA. Figure 27 shows EKHCO/anti-Luc siRNA and EHHKCO/anti-Luc siRNA complexes mediated luciferase gene silencing in U87-Luc cells. siRNA concentration was fixed at 20 nM in all cases.

Figure 28 shows the relative cell viabilities of EHHKCO/pCMV-Luc and EKHCO/pCMV-Luc complexes at different N/P ratios in U87 cell line. (■) EHHKCO; (A) EKHCO. Figure 29 shows relative cell viabilities of EHHKCO/siRNA and EKHCO/siRNA complexes at different N/P ratios in U87 cell line. (■) EHHKCO; (A) EKHCO.

Figure 30 shows the hemolytic activities of surfactant/siRNA complexes (EHHKCO, EKHCO) with variable surfactant concentrations at pH 5.5 and pH 7.4. The surfactant/plasmid NDA complex was prepared at N/P = 12. DOTAP/plasmid DNA complex was prepared at N/P = 4. Triton X-IOO (1%, w/v) and PBS were used at controls.

Figure 31 shows the surfactant mediated plasmid DNA transfection and viability on U87 cell line (SKHCO, SKCO, SHKCO, SHHKCO, SKAHCO, SKACO, SHKACO, SHHKACO).

Figure 32 shows the cytotoxicity of surfactants/plasmid DNA complexes on U87 cell line (SKHCO, SKCO, SHKCO, SHHKCO, SKAHCO, SKACO, SHKACO, SHHKACO).

Figure 33 shows the flow cytometry results of cellular uptake of YOYO-I labeled plasmid DNA mediated by polymerizable surfactants (SKHCO, SKCO, SHKCO, SHHKCO, SKAHCO, SKACO, SHKACO, SHHKACO).

Figures 34 and 35 show the FACS results of GFP expression from GFP encoding plasmid DNA transfected by polymerizable surfactants (SKHCO, SKCO, SHKCO, SHHKCO, SKAHCO, SKACO, SHKACO, SHHKACO).

Figure 36 shows flow cytometry result of surfactant mediated siRNA uptake (SKHCO, SKCO, SHKCO, SHHKCO, SKAHCO, SKACO, SHKACO, SHHKACO).

Figure 37 shows the gene silencing on CHO-GFP cells by SKHCO, SKCO, SHKCO, SHHKCO, SKAHCO, SKACO, SHKACO, and SHHKACO (20 nM siRNA).

Figure 38 shows luciferase gene silencing in U87-Luc cells mediated by complexes formed by anti-Luc siRNA and surfactants of the present invention (20 nM siRNA).

Figure 39 shows the flow cytometry study of gene silencing on CHO-GFP cell lines by surfactants of the present invention (20 nM siRNA). DETAILED DESCRIPTION

Before the present compounds, compositions, and methods are disclosed and described, it is to be understood that the aspects described below are not limited to specific compounds, synthetic methods, or uses as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular aspects only and is not intended to be limiting. In this specification and in the claims that follow, reference will be made to a number of terms that shall be defined to have the following meanings:

It must be noted that, as used in the specification and the appended claims, the singular forms "a," "an" and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a pharmaceutical carrier" includes mixtures of two or more such carriers, and the like.

"Optional" or "optionally" means that the subsequently described event or circumstance can or cannot occur, and that the description includes instances where the event or circumstance occurs and instances where it does not. For example, the phrase "optionally substituted lower alkyl" means that the lower alkyl group can or cannot be substituted and that the description includes both unsubstituted lower alkyl and lower alkyl where there is substitution.

The term "alkenyl group" is defined herein as a C₂-C_2O alkyl group possessing at least one C=C double bond.

The term "alkyl group" as used herein is a branched or unbranched saturated hydrocarbon group of 1 to 25 carbon atoms, such as methyl, ethyl, w-propyl, isopropyl, « -butyl, isobutyl,

£-butyl, pentyl, hexyl, heptyl, octyl, decyl, tetradecyl, hexadecyl, eicosyl, tetracosyl and the like. A "lower alkyl" group is an alkyl group containing from one to six carbon atoms.

The term "cycloalkyl group" as used herein is a non-aromatic carbon-based ring composed of at least three carbon atoms. Examples of cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, etc. The term "heterocycloalkyl group" is a cycloalkyl group as defined above where at least one of the carbon atoms of the ring is substituted with a heteroatom such as, but not limited to, nitrogen, oxygen, sulphur, or phosphorus.

The term "acyl" group as used herein is represented by the formula C(O)R, where R is an organic group such as, for example, an alkyl or aromatic group as defined herein.

The term "alkylene group" as used herein is a group having two or more CH₂ groups linked to one another. The alkylene group can be represented by the formula -(CH₂)_a-, where a is an integer of from 2 to 25.

The term "aromatic group" as used herein is any group containing an aromatic group including, but not limited to, benzene, naphthalene, etc. The term "aromatic" also includes "heteroaryl group," which is defined as an aromatic group that has at least one heteroatom incorporated within the ring of the aromatic group. Examples of heteroatoms include, but are not limited to, nitrogen, oxygen, sulfur, and phosphorus. The aryl group can be substituted or unsubstituted. The aryl group can be substituted with one or more groups including, but not limited to, alkyl, alkynyl, alkenyl, aryl, halide, nitro, amino, ester, ketone, aldehyde, hydroxy, carboxylic acid, or alkoxy.

The term "amino group" is defined herein as a primary, secondary, or tertiary amino group. In the alternative, the nitrogen containing substituent can be a quaternary ammonium group. The nitrogen containing substituent can be an aromatic or cycloaliphatic group, where the nitrogen atom is either part of the ring or directly or indirectly attached by one or more atoms (i.e., pendant) to the ring. The nitrogen containing substituent can be an alkylamino group having the formula -R-NH₂, where R is a branched or straight alkyl group, and the amino group can be substituted or unsubstituted.

The phrase "nitrogen containing group" is defined herein as any amino group. The nitrogen containing substituent can be a primary, secondary, or tertiary amino group. In the alternative, the nitrogen containing substituent can be a quaternary ammonium group. The nitrogen containing substituent can be an aromatic or cycloaliphatic group, where the nitrogen atom is either part of the ring or directly or indirectly attached (i.e., pendant) to the ring. The nitrogen containing substituent can be an alkylamino group having the formula -R-NH₂, where R is a branched or straight alkyl group, and the amino group can be substituted or unsubstituted. Variables such as A, AA¹, AA², AA³, F¹, F², F³, R¹, R², R¹⁴-R¹⁹, R²¹-R²⁹, X, x, y, and z used throughout the application are the same variables as previously defined unless stated to the contrary.

Described herein are compounds useful for the delivery of nucleic acids to cells. The compounds described herein possess a variety of groups that collectively facilitate the delivery of nucleic acids to cells. The compounds generally are composed of (1) one or more amino acids covalently attached to one another, (2) an alkyl amino group covalently attached to one of the amino acids via an amide bond, and (3) at least one hydrophobic group covalently attached to one of the amino acids.

In one aspect, the synthesis of the compounds can be accomplished by first covalently attaching the alkylamino group to an amino acid to form an amide bond. For example, the alkylamino group can be attached to a solid support, and an amino group present on the alkylamino group can react with a carboxylic acid group on the amino acid to form a covalent bond (i.e., an amide bond). Additional amino acids can them be attached top the amino acid using techniques known in the art. Depending upon the selection of the amino acid, linear and branched peptides can be produced by the addition of amino acids to the molecule. Techniques for producing peptides with an alkylamino group covalently bonded to the peptide are described in the Examples and Figures 2. For example, solid phase techniques known in the art can be used to assemble the compounds herein. The amino acids also possess groups that can react with hydrophobic compounds. For example, free amino groups present on the amino acid can react with fatty acids in order to incorporate hydrophobic groups in the compound. The Examples and Figures 2 also provide exemplary techniques for attaching one or more hydrophobic groups to the compounds herein. The alkylamino groups, amino acids, and hydrophobic groups useful herein will be discussed below.

In one aspect, the compound comprises the formula I

wherein (AA¹)_*, (AA²)_y and (AA³)_Z are the same or different sequences, each amino group of the amino acid is, independently, unsubstituted or substituted with an alkyl group, an alkenyl group, an acyl group, or an aromatic group; x, y and z are each an integer from 0 to 50;

T comprises a residue derived from a group comprising at least three functional groups capable of forming a covalent bond with AA¹, AA² and AA³, or when AA¹, AA² and/or AA³ are not present, the functional group is capable of forming a covalent bond with F¹, F² and F³, wherein the functional group comprises an amino group, a hydroxyl group, a carboxylic group, a carbonyl group, a carbamate group, a ureyl group, a thiol group or an amide group;

R¹ and R² are each a hydrophobic group; X comprises an alkylamino group; and

F¹, F² and F³ are each a functional group, containing an amino group, -O-, -S-, a carboxylic group, a carbonyl group, , a carbamate group, a ureyl group, or an amide group. In certain aspects, when AA¹, AA² and/or AA³ are present, AA¹, AA² and AA³ can be a single amino acid or a plurality of amino acids to form a sequence. In general, the individual amino acids are linked to one another via amide bonds (-NC(O)-). The amino acids AA¹, AA² and AA³ can be composed of the same or different amino acid sequence. In certain aspects, the amino group of each amino acid is, independently, unsubstituted or substituted with an alkyl group, an alkenyl group, an acyl group, or an aromatic group.

When a plurality of amino acids are used in AA¹, AA² and AA³, the number can vary depending upon the mechanism of delivering nucleic acids to cells. In one aspect, x, y, and z in formula I are an integer from 1 to 50, 1 to 40, 1 to 30, 1 to 20, 1 to 10, or 1 to 5. Referring to formula I, the compound is a branched peptide (i.e., two branches). Multiple branches are contemplated depending upon the selection of amino acids and the reaction sequence for producing the peptide. Alternatively, linear peptides can be produced with an alkylamino group and hydrophobic group attached to the peptide. Not wishing to be bound by theory, the amino acid sequences can act as pH buffers, nucleic acid complexation agents, amphiphiles, polymerizable monomers, reactive groups for chemical modifications and conjugating targeting groups, receptor binders, enhance cellular uptake, and facilitate release of the nucleic acid once in the cell.

Any natural or non-natural amino acid can be used herein. In one aspect, the compound having the formula I comprises at least one thiol (SH) group. For example, one of the amino acids of AA¹, AA² and AA³ is a residue of cysteine, homocysteine, or a thiol containing derivative of an amino acid. It is also contemplated that one or more amino acids of AA¹, AA² and AA can be derivatized such that thiol groups are introduced into the sequence. Using techniques known in the art, it is possible to react functional groups present on the amino acid with compounds containing thiol groups. In certain aspects, once the nucleic acid is complexed with the compound having the formula I to produce nanoparticles, the thiol groups can produce disulfide (S-S) bonds by oxidation to form oligomers and polymers or cross-linking to further stabilize the nanoparticles. The disulfide bonds will be reduced in the cytoplasm to facilitate the release of nucleic acid from the delivery system.

With respect to T, it is a residue derived from a group comprising at least three functional groups that are capable of forming covalent bonds. The functional groups in T can be the same or different. Examples of such functional groups include, but are not limited to, an amino group, a hydroxyl group, a carboxylic group, a carbonyl group, a carbamate group, a ureyl group, a thiol group or an amide group. The compound can be any naturally-occuring or synthetic compound. In one aspect, the compound can be a polyamine or polyol having at least three amino or hydroxyl groups, respectively. In another aspect, the T can be derived from an amino acid such as, for example, lysine, which has one carboxylic acid group and two amino groups capable of forming covalent bonds. In certain aspects, when x, y, and/or z is zero, T is directly bonded to F¹, F² and/or F³ in formula I. Thus, in certain aspects, the functional groups F¹, F² and/or F³ and T are capable of forming covalent bonds with one another. In certain aspects, T may be selected from the residues described herein to ideally optimize bond angles or the distance between (AA²)_y-F²-R¹ and (AA³) _Z-F³-R². For example, when R¹ and R² are hydrophobic groups (including alkyl groups of any length), T may be selected from the residues described herein to optimize the distances between the two hydrophobic groups. In this aspect, increased efficiency of intracellular delivery of the compounds described herein may be obtained based on this optimization of the distances. In a further aspect, intracellular delivery of targeting groups including nucleic acids and peptides covalently linked to the compounds described herein by linking groups may be increased.

As described above, the alkylamino group possesses at least one amino group. The term "alkylamino group" as used herein is any alkyl groups as defined herein possessing at least one amino group, where the amino group can be substituted or unsubstituted. The alkyl groups can be branched or straight chain and can possess a plurality of amino groups. In one aspect, the alkylamino group is incorporated into the compounds of formula I by a functional group F¹ with an amino acid. In certain aspects, when x is zero, F¹ is directly bonded to T in formula I. Thus, in certain aspects, the functional group F¹ and a functional group present on T are capable of forming covalent bonds with one another. Examples of alkylamino compounds useful herein include, but are not limited to, compounds depicted in formulae II- IV -R¹⁴-NR¹⁵R¹⁶ II

^■R¹⁷-N R¹⁹-NR²¹ R^{22 m}

R¹⁸

IV

wherein R , R , R , R , R and R are, independently, a straight chain or branched aliphatic hydrocarbon group, a cyclic aliphatic hydrocarbon group, or an aromatic group;

R¹⁵' R¹⁶, R¹⁸, R²¹, R²², R²⁴, R²⁶, R²⁸ and R²⁹ are, independently, hydrogen, an alkyl group, a nitrogen containing group, or a hydrophobic group; and

A is an integer from 1 to 50.

In one aspect, X-F¹- in formula I is -CH₂NH₂, -CH₂CH₂NH₂, -CH₂CH₂CH₂NH₂, -(CH₂CH₂)₂NH, - (CH₂CH₂)₂NCH₃, - (CH₂CHa)₂NCH₂CH₃, - (CH₂CHa)₂NCH₂CH₂NH₂, -CH₂CH₂N(CH₂CHa)₂NH, -CH₂CH₂N(CH₂CHa)₂NCH₃, -CH₂CH₂N(CH₂CHa)₂NCH₂CH₃, -CH₂CH₂CH₂CH₂NH₂, -CH₂CH₂CH₂CH₂CH₂NH₂, -CH₂NHCH₂CH₂CH₂NH₂,

-CH₂CH₂NHCH₂CH₂CH₂NH₂₅ -CH₂CH₂CH₂NHCH₂CH₂CH₂CH₂NHCH₂CH₂CH₂NH₂, -CH₂CH₂NHCH₂CH₂CH₂CH₂NH₂, -CH₂CH₂NHCH₂CH₂CH₂NHCH₂CH₂CH₂NH₂, or -CH₂CH₂NH(CH₂CH₂NH)_dCH₂CH₂NH₂, where d is from 0 to 50

In one aspect, the alkylamino group X can be incorporated at any amino acid in the compound where there is a free carboxylic acid group that is capable of reacting with an alkylamino compound. For example, if the terminal amino acid possesses a reactive carboxylic acid group, the alkylamino group can be attached at the terminal amino acid. In this aspect, an amino group of the alkylamino group reacts with the carboxylic acid of the amino acid to form an amide bond. Thus, in this aspect, X is the residue of the alkylamino group, and F¹ is an amino group covalently attached to the amino acid.

The compounds described herein possess at least one hydrophobic group covalently attached to the compound. For example, an amino group present on an amino acid can react with a hydrophobic compound in order to incorporate the hydrophobic group into the molecule. In one aspect, the hydrophobic group can be derived from a saturated or unsaturated C₁-C₂₅ fatty acid (RCOOH, where R is a C₁-C₂₅ alkyl or alkylene group) or C₁-C₂₅ alkyl or alkylene group. For example, the fatty acid can be oleic acid. Alternatively, the hydrophobic group can be derived from a steroid compound or an aromatic compound. Not wishing to be bound by theory, the hydrophobic groups help form compact, stable nanoparticles with the nucleic acids and introduce amphiphilic properties to facilitate pH sensitive escape of nanoparticles from endosomal and lysosomal compartments. This is particularly useful when the compounds are used as in vivo delivery devices.

Referring to formula I, two hydrophobic groups are present (R¹ and R²). The hydrophobic groups are bonded to the molecule via functional groups F and F , respectively. Thus, when an amino group of an amino acid reacts with a fatty acid, an amide group is formed (F² or F³). In certain aspects, the hydrophobic groups (R¹ and R²) are separated by a distance of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 atoms. In another aspect, R¹ and R² are separated by 5 to 40 atoms, or by 10 to 30 atoms. The atoms which separate the hydrophobic groups (R¹ and R₂) include F², (AA^_y, T, (AA³)_Z, F³ or any combination thereof.

In other aspects, a targeting group can be attached to at least one amino acid. The targeting agents can be useful in the delivery of nucleic acids into cells. The targeting agent can be a protein, peptide, an antibody, an antibody fragment, one of their derivatives, or other ligands that can specifically bind to receptors on targeted cells. For example, target- specific peptides can be conjugated directly to the compound or indirectly via a second linker (e.g., polyethylene glycol) prior or during the formation of nanoparticles. Depending upon the selection of the targeting compound, the targeting group can be covalently bonded to either an amino group present on the amino acid or the thiol group or an amino group present in the compound. In one aspect, the targeting group is indirectly attached to the compounds described herein by a linker. Examples of linkers include, but are not limited to, a polyamine group, a polyalkylene group, a polyamino acid group or a polyethylene glycol group. The selection of the linker as well as the molecular weight of the linker can vary depending upon the desired properties. In one aspect, the linker is polyethylene glycol having a molecular weight from 500 to 10,000, 500 to 9,000, 500 to 8,000, 500 to 7,000, or 2,000 to 5,000. In certain aspects, the targeting group is first reacted with the linker in a manner such that the targeting group is covalently attached to the linker. For example, the linker can possess one or more groups that can react with an amino group present on a peptide. The linker also possesses additional groups that react with and form covalent bonds with the compounds described herein. For example, if one or more thiol groups are present on the compound, the linker can possess maleimide groups that readily react with the thiol groups. The selection of functional groups present on the linker can vary depending upon the functional groups present on the compound. In one asepct, the targeting compound is a peptide such as, for example, an RGD peptide or bombesin peptide that is covalently attached to polyethylene glycol. In other aspects, it is also desirable to attach the targeting compound to a nanoparticle produced by the compounds described herein. For example, after a nanoparticle composed of a nucleic acid has been produced using the compounds and techniques described herein, the targeting compound can be attached to the nanoparticle via a linker.

In one aspect, the compound has the formula I, wherein R¹ and R² are Ci to C₂₅ straight chain or branched alkyl groups or alkenyl groups such as, for example, oleyl groups; and X is -NHCH₂CH₂NHCH₂CH₂NHCH₂CH₂NH₂, -NHCH₂CH₂NH₂, or -NHCH₂CH₂CH₂NHCH₂CH₂CH₂CH₂NHCH₂CH₂CH₂NH₂.

In certain aspects, the compounds described herein have at least two thiol groups that are capable of forming disulfide (S-S) bonds under oxidative conditions. Not wishing to be bound by theory, the disulfide bonds stabilize the delivery systems and help achieve release of the nucleic acid once it is in the cell. For example, the reducing environment in the cytoplasm (e.g., the presence of oxy-reductase in released by endosomes and lysosomes) can degrade the disulfide bond so as to dissociate the nanoparticle and facilitate the release of the nucleic acid into the cell. The disulfide compounds will be stable in the plasma at very low free thiol concentration (e.g., 15 μM). When the disulfide compounds are incorporated into target cells, the high concentration of thiols present in the cell (e.g., cytoplasm) will reduce the disulfide bonds to facilitate the dissociation and release of the nucleic acid.

The disulfides can be readily produced by reacting the same or different compounds before complexation with nucleic acid or during the complexation in the presence of an oxidant. The oxidant can be air, oxygen or other chemical oxidants. Depending upon the dithiol compound selected and oxidative conditions, the degree of disulfide formation can vary in free polymers or in complexes with nucleic acids. Thus, for example, compounds having the formula I are monomers, and the monomers can be dimerized, oligomerized, or polymerized depending upon the reaction conditions.

Any of the compounds described herein can exist or be converted to the salt thereof. In one aspect, the salt is a pharmaceutically acceptable salt. The salts can be prepared by treating the free acid with an appropriate amount of a chemically or pharmaceutically acceptable base. Representative chemically or pharmaceutically acceptable bases are ammonium hydroxide, sodium hydroxide, potassium hydroxide, lithium hydroxide, calcium hydroxide, magnesium hydroxide, ferrous hydroxide, zinc hydroxide, copper hydroxide, aluminum hydroxide, ferric hydroxide, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, 2-dimethylaminoethanol, 2-diethylaminoethanol, lysine, arginine, histidine, and the like. In one aspect, the reaction is conducted in water, alone or in combination with an inert, water- miscible organic solvent, at a temperature of from about 0 ⁰C to about 100 ⁰C such as at room temperature. The molar ratio of the compound to base used is chosen to provide the ratio desired for any particular salts. For preparing, for example, the ammonium salts of the free acid starting material, the starting material can be treated with approximately one equivalent of base to yield a salt.

In another aspect, any of the compounds described herein can exist or be converted to the salt with a Lewis base thereof. The compounds can be treated with an appropriate amount of Lewis base. Representative Lewis bases are ammonium hydroxide, sodium hydroxide, potassium hydroxide, lithium hydroxide, calcium hydroxide, magnesium hydroxide, ferrous hydroxide, zinc hydroxide, copper hydroxide, aluminum hydroxide, ferric hydroxide, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, 2- dimethylaminoethanol, 2-diethylaminoethanol, lysine, arginine, histidine, THF, ether, thiol reagent, alcohols, thiol ethers, carboxylates, phenolates, alkoxides, water, and the like. In one aspect, the reaction is conducted in water, alone or in combination with an inert, water-miscible organic solvent, at a temperature of from about 0 ⁰C to about 100 ⁰C such as at room temperature. The molar ratio of the compound to base used is chosen to provide the ratio desired for any particular complexes. For example, the ammonium salts of the free acid starting material, the starting material can be treated with approximately one equivalent of chemically or pharmaceutically acceptable Lewis base to yield a complex. If the compounds possess carboxylic acid groups, these groups can be converted to pharmaceutically acceptable esters or amides using techniques known in the art. Alternatively, if an ester is present on the dendrimer, the ester can be converted to a pharmaceutically acceptable ester using transesterification techniques. The compounds described herein have numerous applications with respect to the delivery of nucleic acids to a subject. In other aspect, the compounds described herein can be used in gene therapy to deliver genetic materials to cells and tissues.

The nucleic acid can be an oligonucleotide, deoxyribonucleic acid (DNA), ribonucleic acid (RNA), or peptide nucleic acid (PNA). The nucleic acid of interest introduced by the present method can be nucleic acid from any source, such as a nucleic acid obtained from cells in which it occurs in nature, recombinantly produced nucleic acid, or chemically synthesized nucleic acid. For example, the nucleic acid can be cDNA or genomic DNA or DNA synthesized to have the nucleotide sequence corresponding to that of naturally-occurring DNA. The nucleic acid can also be a mutated or altered form of nucleic acid (e.g., DNA that differs from a naturally occurring DNA by an alteration, deletion, substitution or addition of at least one nucleic acid residue) or nucleic acid that does not occur in nature.

In one aspect, the nucleic acid can be a functional nucleic acid. Functional nucleic acids are nucleic acid molecules that have a specific function, such as binding a target molecule or catalyzing a specific reaction. Functional nucleic acid molecules can be divided into the following categories, which are not meant to be limiting. For example, functional nucleic acids include antisense molecules, aptamers, ribozymes, triplex forming molecules, siRNA, miRNA, shRNA and external guide sequences. The functional nucleic acid molecules can act as affectors, inhibitors, modulators, and stimulators of a specific activity possessed by a target molecule, or the functional nucleic acid molecules can possess a de novo activity independent of any other molecules.

Functional nucleic acids can be a small gene fragment that encodes dominant- acting synthetic genetic elements (SGEs), e.g., molecules that interfere with the function of genes from which they are derived (antagonists) or that are dominant constitutively active fragments (agonists) of such genes. SGEs can include, but are not limited to, polypeptides, inhibitory antisense RNA molecules, ribozymes, nucleic acid decoys, and small peptides. The small gene fragments and SGE libraries disclosed in U.S. Patent Publication No. 2003/0228601, which is incorporated by reference, can be used herein.

The functional nucleic acids of the present method can function to inhibit the function of an endogenous gene at the level of nucleic acids, e.g., by an antisense, RNAi or decoy mechanism. Alternatively, certain functional nucleic acids can function to potentiate (including mimicking) the function of an endogenous gene by encoding a polypeptide that retains at least a portion of the bioactivity of the corresponding endogenous gene, and may in particular instances be constitutively active.

Other therapeutically important nucleic acids include antisense polynucleotide sequences useful in eliminating or reducing the production of a gene product, as described by Tso, P. et al Annals New York Acad. Sci. 570:220-241 (1987). Also contemplated is the delivery of ribozymes. These antisense nucleic acids or ribozymes can be expressed (replicated) in the transfected cells. Therapeutic polynucleotides useful herein can also code for immunity- conferring polypeptides, which can act as endogenous immunogens to provoke a humoral or cellular response, or both. The polynucleotides employed according to the present invention can also code for an antibody. In this regard, the term "antibody" encompasses whole immunoglobulin of any class, chimeric antibodies and hybrid antibodies with dual or multiple antigen or epitope specificities, and fragments, such as F(ab)₂, Fab², Fab and the like, including hybrid fragments. Also included within the meaning of "antibody" are conjugates of such fragments, and so-called antigen binding proteins (single chain antibodies) as described, for example, in U.S. Patent No. 4,704,692, the contents of which are hereby incorporated by reference.

In one aspect, the nucleic acid is siRNA. siRNAs are double stranded RNA molecules (dsRNAs) with approximately 20 to 25 nucleotides, which are generated by the cytoplasmic cleavage of long RNA with the RNase III enzyme Dicer. siRNAs specifically incorporate into the RNA-induced silencing complex (RISC) and then guide the RNAi machinery to destroy the target mRNA containing the complementary sequences. Since RNAi is based on nucleotide base-pairing interactions, it can be tailored to target any gene of interest, rendering siRNA an ideal tool for treating diseases with gene silencing. Gene silencing with siRNAs has a great potential for the treatment of human diseases as a new therapeutic modality. Numerous siRNAs have been designed and reported for various therapeutic purposes and some of the siRNAs have demonstrated specific and effective silencing of genes related to human diseases. Therapeutic applications of siRNAs include, but are not limited to, inhibition of viral gene expression and replication in antiviral therapy, anti- angiogenic therapy of ocular diseases, treatment of autoimmune diseases and neurological disorders, and anticancer therapy. Therapeutic gene silencing has been demonstrated in mammals, which bodes well for the clinical application of siRNA. It is believed that siRNA can target every gene in human genome and has unlimited potential to treat human disease with RNAi.

The nucleic acid can be complexed to the compounds described herein by admixing the nucleic acid and the compound or, in certain aspects, the corresponding disulfide oligomer or polymer. The pH of the reaction can be modified to convert the amino groups present on the compounds described herein to cationic groups. For example, the pH can be adjusted to protonate the amino groups present on the alkylamino group or amino acid. With the presence of cationic groups on the compound, the nucleic acid can electrostatically bond (i.e., complex) to the compound. In one aspect, the pH is from 1 to 7.4. In another aspect, the N/P ratio is from 0.5 to 100, where N is the number of nitrogen atoms present on the compound that can be form a positive charge and P is the number of phosphate groups present on the nucleic acid. Thus, by modifying the compound with the appropriate number of amino groups, it is possible to tailor the bonding (e.g., type and strength of bond) between the nucleic acid and the compound. In one aspect, the nucleic acid/carrier complex is a nanoparticle. In one aspect, the nanoparticle has a diameter of about 1,000 nanometers or less.

In other aspects, the compounds described herein can be designed so that the resulting nucleic acid nanoparticle escapes endosomal and/or lysosomal compartments at the endosomal- lysosomal pH. For example, the compound forming nanoparticles with nucleic acids can be designed such that its structure and amphiphilicity in the nanoparticles changes at endosomal- lysosomal pH (5.0 - 6.0) and disrupts endosomal-lysosomal membranes, which allows entry of the nanoparticles into the cytoplasm. The pH sensitivity of the carriers can be modified by adjusting the distance between two lipid tails. In this example, the compound forming nanoparticles with nucleic acids can be designed such that its structure and amphilicity in the nanoparticels changes at endosomal-lysosomal pH 5.5, which permits entry of the nanoparticles into the cytoplasm and subsequent pH-sensitive endosomal escape. In one aspect, the ability of specific endosomal-lysosomal membrane disruption of the compounds described herein can be tuned by modifying their pH sensitive amphiphlicity by altering the number and structure of protonatable amines and lipophilic groups. For example, decreasing the number of protonatable amino groups can reduce the amphiphilicity of a nanoparticle produced by the compound at neutral pH. In one aspect, the compounds herein have 1 to 50, 1 to 40, 1 to 30, 1 to 20, 1 to 10, 1 to 8, 1 to 6, 1 to 4, or 2 protonatable amino or substituted amino or aromatic amino groups. For example, the amino and/or substituted and/or imidazolyl amino groups (e.g., histidine) can be present in the compound. In other aspects, the compounds include 2, 3, 4, 5, 6, 7, 8, 9, or 10 histidine residues. Thus, the pH- sensitive amphiphilicity of the compounds and nanoparticles produced by the compounds can be used to fine-tune the overall pKa of the nanoparticle. Low amphiphilicity of the nanoparticles at physiological pH can minimize non-specific cell membrane disruption and nonspecific tissue uptake of the nucleic acid nanoparticles. In certain aspects, it is desirable that the carriers have low amphiphilicity at the physiological pH and high amphiphilicity at the endosomal-lysosomal pH, which will only cause selective endosomal- lysosomal membrane disruption with the nanoparticles. In certain aspects, the surface of the nanoparticle complexes can be modified. For example, polyethylene glycol can be reacted with unpolymerized free thiol compounds (e.g., of formula I) of the nanoparticle to reduce non-specific tissue uptake in vivo. For example, PEG- maleimide reacts rapidly with free thiol groups. The molecular weight of the PEG can vary depending upon the desired amount of hydrophilicity to be imparted on the carrier. PEG- modification of the carrier can also protect nanoparticles composed of the nucleic acid from enzymatic degradation upon uptake by the cell (e.g., endonucleases). Targeting agents, including peptides, proteins, antibodies, antibody fragment or other receptor-binding molecules, can also be incorporated into the nanoparticle complexes during the preparation of the complexes to enhance the delivery specificity and efficiency of the genetic materials to the target cells. Polyethylene glycol can be used as the spacer to conjugate targeting agents to the nanoparticle complexes.

The compounds described herein can be used to introduce a nucleic acid into a cell. The method generally involves contacting the cell with a complex, wherein the nucleic acid is taken up into the cell. In one aspect, the compounds described herein can facilitate the delivery of DNA or RNA as therapy for genetic disease by supplying deficient or absent gene products to treat any genetic disease or by silencing gene expression. Techniques known in the art can be used to measure the efficiency of the compounds described herein to deliver nucleic acids to a cell.

The term "cell" as used herein is intended to refer to well-characterized homogenous, biologically pure populations of cells. These cells may be eukaryotic cells that are neoplastic or which have been "immortalized" in vitro by methods known in the art, as well as primary cells, or prokaryotic cells. The cell line or host cell is preferably of mammalian origin, but cell lines or host cells of non-mammalian origin may be employed, including plant, insect, yeast, fungal or bacterial sources.

In one aspect, the cell comprises stem cells, committed stem cells, differentiated cells, primary cells, and tumor cells. Examples of stem cells include, but are not limited to, embryonic stem cells, bone marrow stem cells and umbilical cord stem cells. Other examples of cells used in various embodiments include, but are not limited to, osteoblasts, myoblasts, neuroblasts, fibroblasts, glioblasts, germ cells, hepatocytes, chondrocytes, keratinocytes, smooth muscle cells, cardiac muscle cells, connective tissue cells, glial cells, epithelial cells, endothelial cells, hormone- secreting cells, cells of the immune system, and neurons.

Atypical or abnormal cells such as tumor cells can also be used herein. Tumor cells cultured on substrates described herein can provide more accurate representations of the native tumor environment in the body for the assessment of drug treatments. Growth of tumor cells on the substrates described herein can facilitate characterization of biochemical pathways and activities of the tumor, including gene expression, receptor expression, and polypeptide production, in an in vivo-like environment allowing for the development of drugs that specifically target the tumor.

The complexes (i.e., nanoparticles) described above can be administered to a subject using techniques known in the art. For example, pharmaceutical compositions can be prepared with the complexes. It will be appreciated that the actual preferred amounts of the complex in a specified case will vary according to the specific compound being utilized, the particular compositions formulated, the mode of application, and the particular situs and subject being treated. Dosages for a given host can be determined using conventional considerations, e.g., by customary comparison of the differential activities of the subject compounds and of a known agent, e.g., by means of an appropriate conventional pharmacological protocol. Physicians and formulators, skilled in the art of determining doses of pharmaceutical compounds, will have no problems determining dose according to standard recommendations (Physicians Desk

Reference, Barnhart Publishing (1999).

Pharmaceutical compositions described herein can be formulated in any excipient the biological system or entity can tolerate. Examples of such excipients include, but are not limited to, water, saline, Ringer's solution, dextrose solution, Hank's solution, and other aqueous physiologically balanced salt solutions. Nonaqueous vehicles, such as fixed oils, vegetable oils such as olive oil and sesame oil, triglycerides, propylene glycol, polyethylene glycol, and injectable organic esters such as ethyl oleate can also be used. Other useful formulations include suspensions containing viscosity enhancing agents, such as sodium carboxymethylcellulose, sorbitol, or dextran. Excipients can also contain minor amounts of additives, such as substances that enhance isotonicity and chemical stability. Examples of buffers include phosphate buffer, bicarbonate buffer and Tris buffer, while examples of preservatives include thimerosol, cresols, formalin and benzyl alcohol.

Pharmaceutical carriers are known to those skilled in the art. These most typically would be standard carriers for administration to humans, including solutions such as sterile water, saline, and buffered solutions at physiological pH.

Molecules intended for pharmaceutical delivery can be formulated in a pharmaceutical composition. Pharmaceutical compositions can include carriers, thickeners, diluents, buffers, preservatives, surface active agents and the like in addition to the molecule of choice. Pharmaceutical compositions can also include one or more active ingredients such as antimicrobial agents, antiinflammatory agents, anesthetics, and the like.

The pharmaceutical composition can be administered in a number of ways depending on whether local or systemic treatment is desired, and on the area to be treated. Administration can be topically, including ophthalmically, vaginally, rectally, intranasally. Administration can also be intravenously or intraperitoneally. In the case of contacting cells with the nanoparticular complexes of nucleic acid and MFC described herein, it is possible to contact the cells in vivo or ex vivo.

Preparations for administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles, if needed for collateral use of the disclosed compositions and methods, include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils. Intravenous vehicles, if needed for collateral use of the disclosed compositions and methods, include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives can also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like.

Formulations for topical administration can include ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like can be necessary or desirable.

Dosing is dependent on severity and responsiveness of the condition to be treated, but will normally be one or more doses per day, with course of treatment lasting from several days to several months or until one of ordinary skill in the art determines the delivery should cease. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. It is understood that any given particular aspect of the disclosed compositions and methods can be easily compared to the specific examples and embodiments disclosed herein, including the non- polysaccharide based reagents discussed in the Examples. By performing such a comparison, the relative efficacy of each particular embodiment can be easily determined. Particularly preferred compositions and methods are disclosed in the Examples herein, and it is understood that these compositions and methods, while not necessarily limiting, can be performed with any of the compositions and methods disclosed herein. A. EXAMPLES

The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how the compounds, compositions, and methods described and claimed herein are made and evaluated, and are intended to be purely exemplary and are not intended to limit the scope of what the inventors regard as their invention. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.) but some errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, temperature is in ⁰C or is at ambient temperature, and pressure is at or near atmospheric. There are numerous variations and combinations of reaction conditions, e.g., component concentrations, desired solvents, solvent mixtures, temperatures, pressures and other reaction ranges and conditions that can be used to optimize the product purity and yield obtained from the described process. Only reasonable and routine experimentation will be required to optimize such process conditions.

1. Example 1: Synthesis and Characterization of SKCO, SKHCO, SHKCO, SHHKCO, SKACO, SKAHCO, SHKACO, and SHHKACO i. Materials and Methods a. Materials

2-Chlorotrityl chloride resin, N-a-Fmoc-N-ε-l -(4, 4-dimethyl-2, 6-dioxocyclohex-l- ylidene)ethyl-L-Lysine (Fmoc-Lys(Dde)-OH), N-fluorenylmethoxycarbonyl-N-im-trityl-L- histidine (Fmoc-His(Trt)-OH), N-α-Fmoc-L-alanine, N-fluorenylmethoxycarbonyl-S-trityl-L- cysteine (Fmoc-Cys(Trt)-OH), PyBOP, oleic acid and 2-acetyldimedone (Dde-OH) were purchased from EMD bioscience (San Diego, CA). Ethylenediamine, spermine, N, N- diisopropylethylamine (DIPEA), hydrazine, 4-dithiothreitol (DTT), piperidine, trifluroacetic acid, N-(2, 3-dioleoyloxy-l-propyl)trimethylammonium methyl sulfate (DOTAP), bovine serum albumin (BSA), oleic acid and 2, 5-diphenyl-3-(4, 5-dimethyl-2-thiazolyl)tetrazolium bromide (MTT) were purchased from Sigma-Aldrich (St. Louis, MO). Anhydrous dimethyl sulfoxide (DMSO), N,N-dimethylformamide (DMF) and dichloromethane (DCM) were purchased from Acros (Pittsburgh, PA). YOYO-I was purchased from Pierce (Rockford, IL). ISOLUTE columns (Charlottesville, VA) were used for solid phase synthesis. U87 MG cell line was purchased from ATCC. The plasmid pCMV-GFP containing a green fluorescent protein gene and the plasmid pCMV-Luc containing firefly lucif erase gene were purchased from Promega (Madison, WI). The anti-luc siRNA (sense sequence: 5'-CUUACGCUGAGUACUUCGAdTdT-3'; antisense sequence: 5'-UCGAAGUACUCAGCGUAAGdTdT-S') and the anti-GFP siRNA (sense sequence: 5'-GCAAGCUGACCCUGAAGUUCAU -3'; antisense sequence: 5'- GAACUUCAGGGUCAGCUUGCCG -3') and Alexa Fluor 488 labeled negative control siRNA were purchased from Qiagen (Valencia, CA). b. Synthesis of multifunctional carriers

Here the synthesis of [N,N'-bis(oleicyl-cysteinyl)β-alaninyl-α-lysinyl]-spermine monoamide (SKACO) is described as an example, see Figure 2. Briefly, excess amount of free spermine (0.5 g) with DIPEA (200 mg) in DMF was coupled to pre-swelled TGT resin (0.5 g) for 2 hours in ISOLUTE column. The solvent was removed and the resin was sequentially washed with DCM/methanol/DIPEA (17:2:1) mixture, anhydrous DCM and DMF. The spermine in resin was first reacted with excess amount Dde-OH followed by (Boc)₂O. The Dde- protection group was removed by 2% hydrazine in DMF. Fmoc-Lys(ivDde)-OH (0.24 g) was then coupled to the resin using PyBOP (0.52 g) and DIPEA (0.13 g) for 2 hours. After that, the Fmoc- protection was removed by 20% piperidine in anhydrous DMF. The resin was then reacted with N-α-Fmoc-β-alanine, followed by sequential treatment with 2% hydrazine in DMF and 20% piperidine in DMF. The Fmoc-Cys(Trt)-OH was added to the resin using PyBOP (0.52 g) and DIPEA (0.13 g) in DMF, followed by Fmoc- removal. At last, oleic acid (0.28 g) with PyBOP (0.52 g) and DIPEA (0.13g) in DMF was reacted with the resin for 2 hours to introduce oleicyl groups. Each previous coupling and deprotection reaction steps were followed by extensive washing with anhydrous DCM and DMF, and the reaction quality was assured with a Kaiser test. The product was cleaved out of the resin by the cocktail DCM/TFA/H₂O/EDT/TIBS (50/47.5/1.25/1.25/0.5) for 3 hours at room temperature. The final product SKACO was purified by preparative-HPLC (1100 series, Agilent) equipped with a ZORBAX PrepHT C-18 column. The chemical structure of SKACO was analyzed by MALDI-TOF mass spectrometry and ¹H NMR spectrometry (400 MHz) using a Varian Mercury 400 (Palo Alto, CA). ¹H-NMR (400 MHz, methanol-d4, ppm) of SKACO: 0.95 (t, 6H, (CH₂)₇CH₃), 1.29 (m, 40Η, (CH₂)₄CH₂CHCHCH2(CH₂)6CH3), 1.29 (m, 2H, CHCH₂CH₂CH₂CH₂NH), 1.46 (m, 4H, NHCH₂CH₂NH), 1.5 (s, 2H, CH₂SH), 1.61 (m, 4Η, COCH₂CH₂(CH₂)₆CH), 1.61 (m, 2H, CHCH₂CH₂CH₂CH₂NH), 1.65 (m, 2H, CHCH₂CH₂CH₂CH₂NH), 1.79 (q, 2H, NH₂CH₂CH₂CH₂NH), 1.79 (m, 2H, NHCH₂CH₂CH₂NHCO), 1.96 (m, 8H, CH₂CHCHCH₂), 2.24 (t, 4Η, NHCOCH₂(CH₂)₆CH), 2.44 (t, 2H, NHCOCH₂CH₂NHCO), 2.69 (t, 2H, NH₂CH₂CH₂), 2.93 (s, 2H, CH₂SH), 3.05 (m, 8H, CH₂NHCH₂), 3.20 (t, 2Η, CHCH₂CH₂CH₂CH₂NH), 3.40 (m, 2H, NHCH₂CH₂CH₂NHCO), 3.48 (t, 2H, NHCOCH₂CH₂NHCO), 4.20 (t, IH, COCHCH₂CH₂), 4.40 (m, 2H, COCHCH₂SH), 5.39 (t, 4H, CH₂CHCHCH₂). MS (MALDI-TOF, m/z) of SKACO: 1136.83 (M⁺+l, calculated 1135.76).

(A)N,N'-bis(oleicyl-cysteinyl-histidinyl)lysine spermine monoamide (SKHCO) 1H-NMR (400MHz, methanol-d4, ppm): 0.95 (t, 6H, (CH₂)₇CH₃), 1.29 (m, 40Η, (CH₂)₄CH₂CHCHCH₂(CH₂)₆CH₃), 1.29 (m, 2H, CHCH₂CH₂CH₂CH₂NH), 1.46 (m, 4H, NHCH₂CH₂NH), 1.5 (s, 2H, CH₂SH), 1.61 (m, 4Η, COCH₂CH₂(CH₂)₆CH), 1.61 (m, 2H, CHCH₂CH₂CH₂CH₂NH), 1.65 (m, 2H, CHCH₂CH₂CH₂CH₂NH), 1.79 (q, 2H, NH₂CH₂CH₂CH₂NH), 1.79 (m, 2H, NHCH₂CH₂CH₂NHCO), 1.96 (m, 8H, CH₂CHCHCH₂), 2.24 (t, 4Η, NHCOCH₂(CH₂)₆CH), 2.69 (t, 2H, NH₂CH₂CH₂), 2.93 (s, 2H, CH₂SH), 3.05 (m, 8H, CH₂NHCH₂), 3.20 (t, 2Η, CHCH₂CH₂CH₂CH₂NH), 3.17 (m, 4H, CHCH₂Imidazole), 3.40 (m, 2Η, NHCH₂CH₂CH₂NHCO), 4.20 (t, IH, COCHCH₂CH₂), 4.40 (m, 2H, COCHCH₂SH), 4.60 (m, 2H, COCHCH₂Imidazole), 5.39 (t, 4H, CH₂CHCHCH₂), 7.39 (s, 2H, CCHNH in imidazole), 8.79 (s, 2H, NCHNH in imidazole). MS (MALDI-TOF, m/z) of SKHCO: 1339.98 (M⁺+l, calculated 1338.94).

(B) N,N'-bis(oleicyl-cysteinyl)lysine spermine monoamide (SKCO) 1H-NMR (400 MHz, methanol-d4, ppm): 0.95 (t, 6H, (CH₂)₇CH₃), 1.29 (m, 40Η,

(CH₂)₄CH₂CHCHCH₂(CH₂)₆CH₃), 1.29 (m, 2H, CHCH₂CH₂CH₂CH₂NH), 1.46 (m, 4H, NHCH₂CH₂NH), 1.5 (s, 2H, CH₂SH), 1.61 (m, 4Η, COCH₂CH₂(CH₂)₆CH), 1.61 (m, 2H, CHCH₂CH₂CH₂CH₂NH), 1.65 (m, 2H, CHCH₂CH₂CH₂CH₂NH), 1.79 (q, 2H, NH₂CH₂CH₂CH₂NH), 1.79 (m, 2H, NHCH₂CH₂CH₂NHCO), 1.96 (m, 8H, CH₂CHCHCH₂), 2.24 (t, 4Η, NHCOCH₂(CH₂)₆CH), 2.69 (t, 2H, NH₂CH₂CH₂), 2.93 (s, 2H, CH₂SH), 3.05 (m, 8H,

CH₂NHCH₂), 3.20 (t, 2Η, CHCH₂CH₂CH₂CH₂NH), 3.40 (m, 2H, NHCH₂CH₂CH₂NHCO), 4.20 (t, IH, COCHCH₂CH₂), 4.40 (m, 2H, COCHCH₂SH), 5.39 (t, 4H, CH₂CHCHCH₂). MS (MALDI-TOF, m/z) of SKCO: 1065.83 (M⁺+l, calculated 1164.82).

(C) [N,N'-bis(oleicyl-cysteinyl)lysinyl]-histidine spermine monoamide (SHKCO) 1H-NMR (400 MHz, methanol-d4, ppm): 0.95 (t, 6H, (CH₂)₇CH₃), 1.29 (m, 40Η,

(CH₂)₄CH₂CHCHCH₂(CH₂)6CH₃), 1.29 (m, 2H, CHCH₂CH₂CH₂CH₂NH), 1.46 (m, 4H, NHCH₂CH₂NH), 1.5 (s, 2H, CH₂SH), 1.61 (m, 4Η, COCH₂CH₂(CH₂)₆CH), 1.61 (m, 2H, CHCH₂CH₂CH₂CH₂NH), 1.65 (m, 2H, CHCH₂CH₂CH₂CH₂NH), 1.79 (q, 2H, NH₂CH₂CH₂CH₂NH), 1.79 (m, 2H, NHCH₂CH₂CH₂NHCO), 1.96 (m, 8H, CH₂CHCHCH₂), 2.24 (t, 4Η, NHCOCH₂(CH₂)₆CH), 2.69 (t, 2H, NH₂CH₂CH₂), 2.93 (s, 2H, CH₂SH), 3.05 (m, 8H, CH₂NHCH₂), 3.20 (t, 2Η, CHCH₂CH₂CH₂CH₂NH), 3.17 (m, 2H, CHCH2Imidazole), 3.40 (m, 2Η, NHCH₂CH₂CH₂NHCO), 4.20 (t, IH, COCHCH₂CH₂), 4.40 (m, 2H, COCHCH₂SH), 4.60 (m, IH, COCHCH₂Imidazole), 5.39 (t, 4H, CH₂CHCHCH₂), 7.39 (s, IH, CCHNH in imidazole), 8.79 (s, IH, NCHNH in imidazole). MS (MALDI-TOF, m/z) of SHKCO: 1202.91 (M⁺+l, calculated 1201.88). (D) [N,N'-bis(oleicyl-cysteinyl)lysinyl]histinyl-histidine spermine monoamide (SHHKCO)

¹H-NMR (400MHz, methanol-d4, ppm): 0.95 (t, 6H, (CH₂)₇CH₃), 1.29 (m, 40Η, (CH₂)₄CH₂CHCHCH₂(CH₂)₆CH₃), 1.29 (m, 2H, CHCH₂CH₂CH₂CH₂NH), 1.46 (m, 4H, NHCH₂CH₂NH), 1.5 (s, 2H, CH₂SH), 1.61 (m, 4Η, COCH₂CH₂(CH₂)₆CH), 1.61 (m, 2H, CHCH₂CH₂CH₂CH₂NH), 1.65 (m, 2H, CHCH₂CH₂CH₂CH₂NH), 1.79 (q, 2H, NH₂CH₂CH₂CH₂NH), 1.79 (m, 2H, NHCH₂CH₂CH₂NHCO), 1.96 (m, 8H, CH₂CHCHCH₂), 2.24 (t, 4Η, NHCOCH₂(CH₂)₆CH), 2.69 (t, 2H, NH₂CH₂CH₂), 2.93 (s, 2H, CH₂SH), 3.05 (m, 8H, CH₂NHCH₂), 3.20 (t, 2Η, CHCH₂CH₂CH₂CH₂NH), 3.17 (m, 4H, CHCH₂Imidazole), 3.40 (m, 2Η, NHCH₂CH₂CH₂NHCO), 4.20 (t, IH, COCHCH₂CH₂), 4.40 (m, 2H, COCHCH₂SH), 4.60 (m, 2H, COCHCH₂Imidazole), 5.39 (t, 4H, CH₂CHCHCH₂), 7.39 (s, 2H, CCHNH in imidazole group), 8.79 (s, 2H, NCHNH in imidazole group). MS (MALDI-TOF, m/z) of SHHKCO: 1340.02 (M⁺+l, calculated 1338.96).

(E) [N, N'-bis(oleicyl-cysteinyl-histidinyl)β-analinyl-α-lysinyl]histidine spermine monoamide (SKAHCO)

¹H-NMR (400MHz, D₂O, ppm): 0.95 (t, 6H, (CH₂)₇CH₃), 1.29 (m, 40Η, (CH₂)₄CH₂CHCHCH₂(CH₂)₆CH₃), 1.29 (m, 2H, CHCH₂CH₂CH₂CH₂NH), 1.46 (m, 4H, NHCH₂CH₂NH), 1.5 (s, 2H, CH₂SH), 1.61 (m, 4Η, COCH₂CH₂(CH₂)₆CH), 1.61 (m, 2H, CHCH₂CH₂CH₂CH₂NH), 1.65 (m, 2H, CHCH₂CH₂CH₂CH₂NH), 1.79 (q, 2H, NH₂CH₂CH₂CH₂NH), 1.79 (m, 2H, NHCH₂CH₂CH₂NHCO), 1.96 (m, 8H, CH₂CHCHCH₂), 2.24 (t, 4Η, NHCOCH₂(CH₂)₆CH), 2.44 (t, 2H, NHCOCH₂CH₂NHCO), 2.69 (t, 2H, NH₂CH₂CH₂), 2.93 (s, 2H, CH₂SH), 3.05 (m, 8H, CH₂NHCH₂), 3.20 (t, 2Η, CHCH₂CH₂CH₂CH₂NH), 3.17 (m, 4H, CHCH₂Imidazole), 3.40 (m, 2Η, NHCH₂CH₂CH₂NHCO), 3.48 (t, 2H, NHCOCH₂CH₂NHCO), 4.20 (t, IH, COCHCH₂CH₂), 4.40 (m, 2H, COCHCH₂SH), 4.60 (m, 2H, COCHCH₂Imidazole), 5.39 (t, 4H, CH₂CHCHCH₂), 7.39 (s, 2H, CCHNH in imidazole), 8.79 (s, 2H, NCHNH in imidazole). MS (MALDI-TOF, m/z) of SKAHCO: 1410.81 (M⁺+l, calculated 1410.04). (F) [N, N'-bis(oleicyl-cysteinyl)β-alaninyl-α-lysinyl]histidine spermine monoamide (SHKACO)

¹H-NMR (400 MHz, methanol-d4, ppm): 0.95 (t, 6H, (CH₂)₇CH₃), 1.29 (m, 40Η, (CH₂)₄CH₂CHCHCH₂(CH₂)₆CH₃), 1.29 (m, 2H, CHCH₂CH₂CH₂CH₂NH), 1.46 (m, 4H, NHCH₂CH₂NH), 1.5 (s, 2H, CH₂SH), 1.61 (m, 4Η, COCH₂CH₂(CH₂)₆CH), 1.61 (m, 2H, CHCH₂CH₂CH₂CH₂NH), 1.65 (m, 2H, CHCH₂CH₂CH₂CH₂NH), 1.79 (q, 2H, NH₂CH₂CH₂CH₂NH), 1.79 (m, 2H, NHCH₂CH₂CH₂NHCO), 1.96 (m, 8H, CH₂CHCHCH₂), 2.24 (t, 4Η, NHCOCH₂(CH₂)₆CH), 2.44 (t, 2H, NHCOCH₂CH₂NHCO), 2.69 (t, 2H, NH₂CH₂CH₂), 2.93 (s, 2H, CH₂SH), 3.05 (m, 8H, CH₂NHCH₂), 3.20 (t, 2Η, CHCH₂CH₂CH₂CH₂NH), 3.17 (m, 2H, CHCH₂Imidazole), 3.40 (m, 2Η, NHCH₂CH₂CH₂NHCO), 3.48 (t, 2H,

NHCOCH₂CH₂NHCO), 4.20 (t, IH, COCHCH₂CH₂), 4.40 (m, 2H, COCHCH₂SH), 4.60 (m, IH, COCHCH₂Imidazole), 5.39 (t, 4H, CH₂CHCHCH₂), 7.39 (s, IH, CCHNH in imidazole), 8.79 (s, IH, NCHNH in imidazole). MS (MALDI-TOF, m/z) of SHKACO: 1273.86 (M⁺+l, calculated 1272.92). (G) [N, N'-bis(oleicyl-cysteinyl)β-analinyl-α-lysinyl]histinyl-histidine spermine monoamide (SHHKACO)

¹H-NMR (400 MHz, methanol-d4, ppm): 0.95 (t, 6H, (CH₂)₇CH₃), 1.29 (m, 40Η, (CH₂)₄CH₂CHCHCH₂(CH₂)₆CH₃), 1.29 (m, 2H, CHCH₂CH₂CH₂CH₂NH), 1.46(m, 4H, NHCH₂CH₂NH), 1.5(s, 2H, CH₂SH), 1.61 (m, 4Η, COCH₂CH₂(CH₂)₆CH), 1.61 (m, 2H, CHCH₂CH₂CH₂CH₂NH), 1.65 (m, 2H, CHCH₂CH₂CH₂CH₂NH), 1.79 (q, 2H,

NH₂CH₂CH₂CH₂NH), 1.79 (m, 2H, NHCH₂CH₂CH₂NHCO), 1.96 (m, 8H, CH₂CHCHCH₂), 2.24 (t, 4Η, NHCOCH₂(CH₂)₆CH), 2.44 (t, 2H, NHCOCH₂CH₂NHCO), 2.69 (t, 2H, NH₂CH₂CH₂), 2.93 (s, 2H, CH₂SH), 3.05 (m, 8H, CH₂NHCH₂), 3.20 (t, 2Η, CHCH₂CH₂CH₂CH₂NH), 3.17 (m, 4H, CHCH2Imidazole), 3.40 (m, 2Η, NHCH₂CH₂CH₂NHCO), 3.48 (t, 2H, NHCOCH₂CH₂NHCO), 4.20 (t, IH, COCHCH₂CH₂), 4.40 (m, 2H, COCHCH₂SH), 4.60 (m, 2H, COCHCH₂Imidazole), 5.39 (t, 4H, CH₂CHCHCH₂), 7.39 (s, 2H, CCHNH in imidazole), 8.79 (s, 2H, NCHNH in imidazole). MS (MALDI-TOF, m/z) of SHHKACO: 1411.06 (M⁺+l, calculated 1410.04).

The detailed results of NMR and mass spectroscopy can be seen in supporting information. c. Agarose gel electrophoresis shift assay

The complexes formed between the multifunctional carriers and plasmid DNA were examined by gel electrophoresis shift assay. Briefly, agarose gel (0.8% w/v) containing 0.5 μg/ml ethidium bromide was prepared in TAE buffer. Multifunctional carrier/plasmid DNA complexes, prepared by mixing 0.5 μg pDNA and multifunctional carrier at certain N/P ratios between 0 and 5 and incubating 30 minutes, were loaded on the gel and run at 100 V electric field for 30 minutes, and visualized with a UV illuminator using a Gel Documentation System (Bio-Rad, Hercules, CA). The agarose gel retardation assay (Figure 3) shows that all those eight surfactants can compact with DNA and completely retard the DNA shift in agarose gel from N/P ratio 2. d. Particle size measurements

Nanoparticular multifunctional carrier/ pDNA or siRNA complexes were prepared by mixing 1 μg plasmid DNA or siRNA with multifunctional carriers at an N/P ratio of 12 and incubating at room temperature for 30 minutes. The size of the nanoparticles was analyzed using a Brookhaven Instruments BI- 200SM equipped with a 5 mW helium- neon laser with output at 633 nm (Brookhaven Instrument Incorporation, Holtsville, NY). Measurements were performed at room temperature in triplicate. The effective diameters were computed using BIC Dynamic Light Scattering Software (Brookhaven Instrument Incorporation, Holtsville, NY). e. pH-sensitive hemolytic activity study Triton X-100 (1%, w/v) and pDNA/multifunctional carrier complexes at an N/P ratio of

12 with carrier containing 80 μM and 200 μM of protonable amine, were dissolved in 50 μl phosphate buffer saline (PBS) at pH 7.4 and 5.5 and placed in 0.6 ml microcentrifuge tubes. Rat erythrocytes (RBCs) were diluted in PBS at pH 5.5 or pH 7.4 to the concentration 1% (w/v). 200 μl of RBC solution was mixed with the sample solution and incubated at 37 ⁰C for 1 hour. The mixture was then centrifuged at 1500 rpm for 5 minutes. 100 μl of supernatant was collected from each sample and the absorbance was measured at 540 nm to determine the released hemoglobin using a microplate reader. pDNA/Lipofectamine-2000 complex with Lipofectamine-2000 concentration at 2.5 mg/ml was used as control. The relative hemolytic efficiency was calculated by normalizing the absorbance of the samples to that treated with Triton X-100. The pH-sensitive hemolytic activities were determined by the hemolysis imposed on fresh rat red blood cells. The hemolytic activities of the surfactants are concentration dependent and much higher than that of DOTAP. The pH had little influence, as seen in both pH 5.5 and pH 7.4, the pH representing endosomal-lysosomal compartments and extracellular matrix, the hemolytic activities of those surfactants are similar. However, using the same protocol, the hemolytic activities of surfactant/plasmid DNA nanoparticles were determined to be pH- dependent. Figure 5 shows that at pH 5.5, the surfactant/plasmid complexes have much higher hemolytic activities than in pH 7.4, where the hemolytic activities of the complexes are very low. At pH 5.5, the SKACO/plasmid DNA complex has the highest hemolytic activity in the presence of both low and high concentration of surfactant. The hemolytic results suggest that the complexation with plasmid DNA provides pH-sensitive amphiphilic membrane disrupting abilities to the surfactants.

/ Multifunctional carriers mediated cellular uptake of plasmid DNA Approximate 3xlO⁵ U87 cells per well were plated in 12-well plates. After 24 hours, nanoparticles prepared by complexing multifunctional carrier with 1 μg of YOYO-I labeled plasmid DNA at an N/P ratio of 12 were incubated with cells in each well for 4 hours at 37 ⁰C in serum free medium, using complexes formed with bPEI at an N/P ratio of 10 was used as control. The medium was removed and cells were washed twice with PBS and then trypsinized. Cells were collected and fixed by 4% para-formaldehyde in ice-cold PBS for 20 minutes. Samples were analyzed using a FACSCalibur flow cytometer (BD Bioscience). FL-I channel was focused on the green fluorescence of YOYO-I. Results were analyzed using Cell-Quest (BD Bioscience) software.

After complexing with the surfactants, the plasmid DNA was incorporated into nanoparticles with positive surface charges. The positive-charged nanoparticles can be easily engulfed by cells through endocytosis. The flow cytometry study showed that the surfactant/plasmid DNA complexes can transfect 64.2-90.2% of cells in situ. In the same situation, bPEI can only transfect 65.6% cells (Figure 33). g. Intracellular delivery of plasmid DNA expressing lucif erase In vitro transfection efficiency of carriers was evaluated on the U87 cell line. Briefly, U87 cells were plated in 24-well plates at 4xlO⁴ cells per well and incubated for 24 hours prior to transfection. The medium was replaced with 0.5 ml of fresh medium without serum. The plasmid pCMV-Luc complexed with the multifunctional carriers at an N/P ratio of 12 or bPEI at an N/P ratio of 10 was incubated with the cells for 4 hours at 37 ⁰C. The medium was then replaced with complete medium. After 44 hours, cells were washed with fresh PBS, treated with 200 μl reporter lysis buffer and subjected to a freezing-thawing cycle. Cell debris was precipitated through 1.5xlO⁴ g centrifugation for 5 minutes. The luciferase activity in 20 μl of each sample was analyzed by Luminmeter (Dynex Technologies, Inc., Chantilly, VA). The relative light units (RLU) were normalized by protein concentration in cell lysates which was determined by a BCA kit (Pierce, Rockford, IL). h. Multifunctional carriers mediated GFP encoding plasmid expression

Approximately 3x10⁵ U87 cells were plated in each well of a 12- well plate 24 hours prior to transfection. The GFP encoding plasmid (1 μg) pCMV-GFP was premixed with the multifunctional carriers at an N/P ratio of 12 or bPEI at an N/P ratio of 10 and allowed 30 minutes to form complexes. The plasmid/carrier complexes were incubated with U87 cells in serum-free medium at 37 ⁰C for 4 hours. The cells were then allowed to grow in complete medium for additional 44 hours. After that, the cells were washed with pre-warmed PBS buffer and trypsinized. The cells were collected and fixed in ice-cold PBS with 4% paraformaldehyde for 20 minutes. Samples were analyzed using a FACSCalibur flow cytometer (BD Bioscience). Results were analyzed using Cell-Quest (BD Bioscience) software. L Cytotoxicity study of pDN^~ A/multifunctional carrier complexes

The cytotoxicity of pDNA/multifunctional carrier complexes was evaluated using U87 cells. The cells were seeded in 96- well plates at a density of 5x10⁴ cells per well and cultured for 24 hours. After that, 0.1 μg DNA complexed with the MFCs at N/P ratios between 4 and 20 was incubated with cells for 4 hours in 1 ml serum free DMEM medium. Cells were incubated in complete medium for additional 20 hours. MTT solution (20 μl, 5 mg/ml) was then added and incubated in 37 ⁰C for 2 hours. After that, the medium was drained and 200 μl DMSO was added to each well, and the absorption was read at 570 nm using a micro plate reader (model 680, Bio- Rad, Hercules, CA). The relative cell viability was calculated by the equation: ([Abs]_sampi_e- [Abs]_bi_ank)/([Abs]_controi-[Abs]_bi_ank)xl00%. j. Evaluation of Transfection Efficiency for Plasmid DNA

In vitro transfection efficiency of surfactants/DNA complex was performed on U87 MG cell line as described previously. The results in Figure 31 show that eight surfactants can induce as high efficiency as bPEI. SKCO, SKHCO, AHHKCO and SHKCO, SKCO showed higher transfection efficiency than others. With SKCO, it had the highest transfection efficiency at N/P ratio 8, which was approximately 4.7 times higher than that of bPEI. With surfactants SKACO, SKAHCO, SHHKACO and SHKACO, SKACO maintained higher transfection efficiency than the other three surfactants. SKAHCO at N/P ratio 8 and SHKACO at N/P ratio 16 and 20 already showed higher transfection efficiency than bPEI. SKAHCO at N/P ratio 20 had the highest transfection efficiency, which is approximately 56 times higher than that of bPEI.

Cytotoxicity studies were also performed on U87 MG cell line. As shown in Figure 32, the complexes formed by the eight surfactants and plasmid DNA had minimal cytotoxicity. The luciferase assay only showed cumulative plasmid transfection efficiency. In contrast, the flow cytometry study of GFP encoding plasmid expression can statistically show the percentage of transfected cells. The results of GFP expression (Figures 34 and 35) showed that the eight surfactants can transfect much high percentage of cells in situ than bPEI, which transfected only 0.5 % of cells in situ. Of those eight surfactants, SKCO and SKACO transfected 21.9% and 9.6 % of cells in situ, which was much higher than the other surfactants.

From the results of plasmid DNA transfection, the presence of histidine residuals showed adverse effects both in luciferase plasmid transfection and in GFP plasmid transfection. The histidine residues did not result in hemolytic activities at pH 5.5, as seen in the surfactant EKHCO, EHHKCO and EHCO. In other words, histidine residues in present in the surfactants did not attribute to endosomal-lysosomal release. Furthermore, the presence of histidine residuals increased the CMC level of the surfactant. As a result, the stability of surfactant/DNA complex was decreased. Furthermore, the presence of histidine residues also decreased the DNA packaging ability. This could explain why the surfactants SKCO and SKACO exhibited the highest luciferase transfection efficiency. k. Multifunctional carriers mediated siRNA uptake

Approximately 3xlO⁵ U87 cells per well were plated in 12-well plates. After 24 hours, the nanoparticles, which were prepared by mixing 1 μg AlexaFluor 488 labeled all negative siRNA (Qiagen, Valencia, CA) with multifunctional carrier at an N/P ratio of 12 or lipofectamine-2000 for 30 minutes, were added into each well and incubated for 4 hours at 37 ⁰C in 1 ml serum free medium. The medium was removed and the cells were washed twice with PBS and then trypsinized. The cells were collected and fixed by 4% paraformaldehyde in PBS for 20 minutes. The samples were analyzed using a FACSCalibur flow cytometer (BD

Bioscience) with FL-I channel focused on the green fluorescence of AlexaFluor 488. Results were analyzed using Cell-Quest (BD Bioscience) software.

The surfactant mediated cellular uptake of siRNA labeled with Alexa Fluor-488 was measured by flow cytometry. Figure 36 shows that the surfactant can deliver siRNA from 23.1 % to 83.5 % of cells in situ, which is lower than DOTAP, which delivered siRNA to 87.8 +/- 1.3% of cells.

/. Multifunctional carrier mediated silencing of lucif erase with siRNA siRNA delivery efficiency of the multifunctional carriers was measured through delivering anti-Luc siRNA into U87-Luc cells, which stably expressed firefly luciferase. U87-luc cells were seeded in 96 well plates at a density of 5x10³ cells/well in DMEM medium containing 10% FBS, G418 (300 μg/ml), streptomycin (100 μg/ml) and penicillin (100 units/ml) 24 hours prior transfection. Anti-luc siRNA was complexed with multifunctional carriers at an N/P ratio of 12 or lipofectamine-2000 for 30 minutes and then incubated with cells for 4 hours at 37 ⁰C in serum free DMEM medium. The medium was then replaced with complete DMEM medium and incubated for additional 44 hours. Cells were washed with pre-warmed PBS, and treated with 200 μl/well lysis buffer followed by a freezing-thawing cycle. Luciferase activity in cell lysates was then measured by a luciferase assay kit (Promega, Madison, WI) on a luminometer (Dynex Tech., Chantilly, VA). The gene silencing efficiency was normalized against the luciferase activity of untreated cells. As shown in Figure 38, the surfactants mediated as high as 87.4 % gene silencing efficiency (SKAHCO, N/P ratio 12) with 20 nM siRNA. In contrast, DOTAP only mediated 45.3+/- 2.6% gene silencing efficiency with siRNA at the same concentration. m. Multifunctional carrier mediated GFP silencing with siRNA CHO cells integrated with GFP gene are cultured in F12-K medium. Cells are seeded into 12- well plates at the density of 2x10⁵ cells per well and further cultured overnight. The nanoparticles formed by incubating 1 μg anti-GFP siRNA with multifunctional carriers at an N/P ratio of 12 or lipofectamine-2000 for 30 minutes at room temperature. The formed nanoparticles were then added to CHO-GFP cells in serum free F-12K medium. After 4 hours incubation at 37 ⁰C, the medium is replaced with fresh complete F12-K medium and cultured for additional 20 hours. Cells are then washed with pre-warmed PBS, harvested through trypsinization, and fixed in cold PBS containing 4% paraformaldehyde for 20 minutes. Samples were analyzed using a FACSCalibur flow cytometer (BD Bioscience) with FL-I channel focused on green fluorescence. Results were analyzed using Cell-Quest (BD Bioscience) software.

The flow cytometry result showed that SKAHCO at N/P ratio 12 mediated the highest GFP expression silencing (69.0+/-6.6 %) in contrast to DOTAP (28.5+/- 9.8 %). In all, the gene silencing assays suggested that SKAHCO has the highest siRNA delivery efficiency among those eight surfactants. n. Cytotoxicity study of siRN A/multifunctional carrier complexes The cytotoxicity of siRNA/multifunctional carrier complexes on U87 cells was evaluated by MTT assay. Briefly, the U87 cells were plated in 96- well plates with IxIO⁴ cells per well and cultured overnight. 10 pmol of anti-Luc siRNA was mixed with multifunctional carriers at N/P ratios 12 or lipofectamine-2000 at indicated dose and incubated at room temperature for 30 minutes to form nanoparticles. The formed nanoparticles were then incubated with U87 cells in serum free MEM medium for 4 hours. After that, the medium was replaced with complete MEM medium and continued culturing for additional 20 hours. The medium was then removed and cells were degisted by 200 μl DMSO. The absorption was read at 570 nm using a plate reader (Model 680, Bio-Rad, Hercules, CA). The relative cell viability was calculated by the equation: ([Abs] _sample- [Abs]_Wank) / ([Abs]_controi-[Abs]_bi_ank)xl00%. ii. Results Spermine, a natural oligoamine can bind nucleic acids and stabilize its double helical structures, is incorporated into the novel multifunctional carriers to pack nucleic acids. With SKCO, SKHCO, SHKCO and SHHKCO, L-lysine is used to provide "Y" form joint. Meanwhile, in the carriers (SKACO, SKAHCO, SHKACO and SHHKACO), the β-alanine is coupled to α- amine group of lysine to further extend the hydrophobic tails, aiming to increase the packing parameter of the carrier. The dual unsaturated oleic acids were introduced into the surfactant carrier as lipid tails; the unsaturation would avoid crystal-like packing of saturated lipids, bring more flexibility and correspondently facilitate the phase transition (23). The histidine residual was added to the surfactant to variable extent, aiming to improve the transfection efficiency by introducing pH- sensitive amphophilicity (22). According to previous study, presence of dual free thiols would utilize polymerization to improve the in vivo circulating time of DNA/surfactant nanoparticles (19); thereby cysteine residuals containing free thiols are incorporated into the surfactants to promote their in vivo application.

Structures of those eight carriers are shown in Figure 1. The MFCs were synthesized using solid phase chemistry. The synthetic procedure of SKACO is used as an example and described in Figure 2. The structures were confirmed by NMR and MALDI-TOF mass spectrometry. The mass spectroscopy results are summarized in Table 1. The critical micelle concentrations (CMC) of these surfactants were not determined, because they have poor solubility in aqueous solution, while to be determined by fluorescent method, CMC must be around or higher than 10 μM(24). Those carriers were stored in 70% ethanol aqueous solution. The solubility in 70% ethanol is: SKHCO and SKAHCO > SHHKCO and SHHKACO >

SHKACO and SHKCO > SKACO and SKCO. The difference in solubility could be attributed to the histidine residuals, which contain protonable aromatic amines.

Table 1. Measured Mass of the surfactants by MALDI-TOF mass spectroscopy Surfactant (abbr) Formula Mw(calcd) m/z Mw(found) [M+l]⁺

SKCO C₅₈H₁₁₂N₈O5S₂ 1164.82 1165.83

SHKCO Ce₄Hi_IgNnOeS₂ 1201.88 1202.91

SHHKCO C_7OHi₂₆Ni₄O₇S₂ 1338.96 1340.02

SKHCO C₇₀Hi₂₆Ni₄O₇S₂ 1338.94 1339.98

SKAHCO C₇₃Hi_3θNi₅θsS₂ 1410.04 1410.81

SKACO C_6IHn₆NgO₆S₂ 1135.76 1136.83

SHKACO C₆₇Hi₂₄Ni₂O₇S₂ 1272.92 1273.86

SHHKACO C₇₃H₁₃ON₁SORS₂ 1410.04 1411.06

The cationic surfactant can pack nucleic acids through charge-charge interaction and hydrophobic interactions (25). The agarose gel electrophoretic shift assay in Figure 3 shows that all those eight carriers compact with plasmid DNA and completely eliminates its electrophoretic mobility from N/P ratio 2. The sizes of the nanoparticles formed by plasmid DNA or siRNA with multifunctional carriers at N/P ratio 12 were measured by dynamic light scattering; their effective diameters are around 100 nm, with little fluctuation, as seen in Figure 4. In the same experiment, Lipofectamine-2000 complexed plasmid DNA or siRNA to form nanoparticles with similar sizes. The pH-sensitive membrane disrupting activities were determined by the haemolysis assay on rat red blood cells. The hemolytic activities of nanoparticular pDNA/multifunctional carrier complexes at N/P ratio 12 were determined to be pH-dependent. Figure 5 shows that at pH 5.5, the complexes have much higher hemolytic activities than at pH 7.4, where complexes at both low and high concentrations induce low hemolysis. At pH 5.5, the pDNA/SKACO complex enticed the highest hemolytic activity. The concentrations of the pDNA/carrier complexes are within the range used in transfection. Therefore, it would allow for low toxicity on cells owing to low cellular membrane disruption in physiological pH, while high endosomal-lysosomal breaking down to released loaded plasmid DNA by their significantly high membrane disrupting abilities in lower pH. Under the same condition, the lipofectamine-2000/plasmid DNA complex at the dose used for transfection only induced low hemolytic activity.

The flow cytometry study in Figure 6 shows that the multifunctional carriers can deliver plasmid DNA into 94.77-99.04% of U87 cells. Under the same condition, Lipofectamine-2000 transfers pDNA into 65.6% of U87 cells.

The in vitro accumulative transfection efficiency of multifunctional carriers is evaluated by transfect luciferase gene into U87 cells. Figure 7 shows that those eight carriers could produce much higher transfection efficiency than Lipofectamine-2000. The multifunctional carrier/pDNA complexes were prepared at N/P ratio 12, an N/P ratio predetermined to have optimal gene delivery efficiency. Among the carriers, SKACO transfected pDNA encoding luciferase into U87 cells to induce luciferase activity as high as approximate 425 times of that transfected by Lipofectamine-2000. Other carriers, including SKCO, SHKCO, SHHKCO and SHKACO also preserve higher luciferase transfection efficiency that Lipofectamine-2000.

The efficiency of delivering pDNA into individual cells was evaluated by transfecting GFP-encoding plasmid pCMV-Luc, followed by flow cytometry analysis. Figure 8 shows that the MFCs introduces GFP expression in much higher percentage of cells than Lipofectamine- 2000, which only induces GFP expression in 6.16% CHO cells expressing GFP. Among those MFCs, SKCO and SHKACO transfect 86.19% and 74.36% of cells, respectively; both are higher than other carriers. The cytotoxicity of pDNA/multifunctional carrier complexes was evaluated on U87 cells, Figure 9. MTT assay results demonstrate that the pDNA complexes of those carriers produce minimal cytotoxicity. The multifunctional carrier mediated cellular uptake of siRNA was measured by flow cytometry. Figure 10 shows that MFCs can deliver siRNA to 91.78% to 96.33% of U87 cells, which is higher than the 73.48% by Lipofectamine-2000. In vitro accumulative siRNA delivery efficiency was evaluated by delivering anti-Luc siRNA to U87-Luc cells constantly expressing luciferase and measured through luciferase assay. As shown in Figure 11, these MFCs mediated as high as 84.6+/-5.5% gene silencing efficiency (SKAHCO, N/P ratio 12) with 50 nM siRNA. In contrast, Lipofectamine-2000 only mediated 62.8+/-3.4% gene silencing efficiency. The siRNA delivery efficiency was further measured by delivering anti-GFP siRNA to CHO cells integrated with GFP gene. The flow cytometry result (Figure 12) shows that SKAHCO at N/P ratio 12 mediated the highest GFP silencing (61.29%) in contrast to Lipofectamine-2000 (40.40%). In the same situation, the naked siRNA showed little gene silencing efficiency. In summary, the gene silencing assays suggested that SKAHCO has the highest siRNA delivery efficiency among those eight surfactants.

The cytotoxicity of siRNA/multifunctional carrier complexes was evaluated on U87 cell line. In Figure 13, The MTT assay shows that those carriers when complex with siRNA at the 50 nM, the concentration used for luciferase silencing assay, induces low cytotoxicity, with more than 82.3% cells survived in all cases.

2. Example 2: Synthesis and Characterization of EKHCO and EHHKCO i. Materials and Methods a. Materials 2-Chlorotrityl chloride resin, N-fluorenylmethoxycarbonyl-N-im-trityl-L-histidine, N- fluorenylmethoxycarbonyl-S-trityl-L-cysteine, PyBOP, and 2-acetyldimedone (Dde-OH) were purchased from EMD bioscience (San Diego, CA). Ethylenediamine, spermine, N₅N- diisopropylethylamine, hydrazine, 4-dithiothreitol (DTT), piperidine, trifluoroacetic acid, N-(2,3- dioleoyloxy-1 -propyl) trimethylammonium methyl sulfate (DOTAP), bovine serum albumin (BSA), and 2,5-diphenyl-3-(4,5-dimethyl-2-thiazolyl)tetrazolium bromide (MTT) were purchased from Sigma-Aldrich (St. Louis, MO). Anhydrous dimethyl sulfoxide (DSO), N₅N- dimethylformamide (DMF) and methyl chloride (DCM) were purchased from Acros (Pittsburgh, PA). ISOLUTE columns (Charlottesville, VA) were used for solid phase synthesis. b. Synthetic Procedures The structures and synthetic procedure for preparing EKHCO and EHHKCO are provided in Figures 1 and 14, respectively. Both compounds were synthesized by solid phase chemistry. 2-chlorotrityl resin (1 g) was swelled in anhydrous dichloromethane (DCM) in ISOLUTE column. Then, a mixture of ethylenediamine (5 ml) and diisopropylethyleneamine (DIPEA 200 mg) and 5 ml anhydrous DCM was added o the resin and reacted for 30 minutes. The solvent was removed and the resin was sequentially washed with DCM/Methanol/DIPEA

(17:2:1) mixture and anhydrous DCM and anhydrous dimethylformamide (DMF). The resin was coupled with excess di-Fmoc-Lys-OH (0.59 g) using coupling agent containing PyBOP (0.52 g) and DIPEA (0.13 g) for 2 hours. The resin was then extensively washed with DMF and DCM. After that, the Fmoc- protection was removed by 20% piperidine in anhydrous DMF (5 min X 3) to yield the resin containing ethylene-lysine. The resin was washed with another washing cycle and then coupled to Fmoc-His(Trt)-OH (0.62 g) with PyBOP (0.52 g) and DIPEA (0.13 g) for 2 hours. The Fmoc- was removed and the resin was washed by similar protocol as above. The Fmoc-Cys(Trt)-OH (0.3g) was coupled to the resin with PyBOP (0.52 g) and DIPEA (0.13 g) in DMF, followed by Fmoc- removal and DCM and DMF washing. Finally, oleicyl groups were incorporated by reacting the resin with oleic acid (0.28 g) in presence of PyBOP (0.52 g) and DIPEA (0.13g) in DMF for 2 hours. The reaction quality of each coupling step and Fmoc- removal step was assured with Kaiser test. The resin was then extensively washed with anhydrous DCM and anhydrous DMF, and the product was cleaved out of the resin by the cocktail DCM/TFA/H₂O/EDT/TIBS (50/47.5/1.25/1.25/0.5) for 3 hours at room temperature. The final product EKHCO was purified by preparative HPLC (1100 series, Agilent) equipped with a ZORBAX PrepHT C- 18 column. The chemical structure of EKHCO was analyzed by MALDI-TOF mass spectrometry and ¹H NMR spectrometry (400 MHz) using a Varian Mercury 400 (Palo Alto, CA).

Using a similar procedure, EHHKCO was synthesized by sequentially incorporating ethylenediamine, Fmoc-His(Trt)-OH, Fmoc-His(TrT)-OH, Fmoc-Lys(Fmoc)-OH, Fmoc- Cys(TrT)-OH and oleic acid into the 2-clorotrityl resin. ¹H-NMR (methanol-d4, ppm) of EKHCO: 0.95 (t, 6H, (CH₂)₇CH₃), 1.29 (m, 40Η, (CH₂)4CH2CHCHCH₂(CH2)6CH3), 1.29 (m, 2H, CHCH₂CH₂CH₂CH₂NH), 1.5 (s, 2H, CH₂SH), 1.61 (m, 4Η, COCH₂CH₂(CH₂)₆CH), 1.61 (m, 2H, CHCH₂CH₂CH₂CH₂NH), 1.65 (m, 2H, CHCH₂CH₂CH₂CH₂NH), 1.96 (m, 8H, CH₂CHCHCH₂), 2.24 (t, 4Η, NHCOCH₂(CH₂)₆CH), 2.71 (m, 2H, NH₂CH₂CH₂NH), 2.93 (s, 2H, CH₂SH), 3.20 ( t, 2H, CHCH₂CH₂CH₂CH₂NH), 3.17 (m, 4H, CHCH2Imidazole), 3.40 (m, 2Η, NH₂CH₂CH₂NH), 4.20 (t, IH, COCHCH₂CH₂), 4.40 (m, 2H, COCHCH₂SH), 4.60 (m, 2H, COCHCH₂Imidazole), 5.39 (t, 4H, CH₂CHCHCH₂), 7.39 (s, 2H, CCHNH in imidazole), 8.79 (s, 2H, NCHNH in imidazole). MS (MALDI-TOF, m/z) of EKHCO: 1197.9 (M⁺+l, calculated 1196.8). 1H-NMR (methanol-d4, ppm) of EHHKCO: 0.95 (t, 6H, (CH₂)₇CH₃), 1.29 (m, 40Η,

(CH₂)₄CH₂CHCHCH₂(CH₂)₆CH₃), 1.29, (m, 2H, CHCH₂CH₂CH₂CH₂NH), 1.5(s, 2H, CH₂SH), 1.61 (m, 4Η, COCH₂CH₂CH₂CHCH), 1.61 (m,2H, CHCH₂CH₂CH₂CH₂NH), 1.65 (m, 2H, CHCH₂CH₂CH₂CH₂NH), 1.96 (m, 8H, CH₂CHCHCH₂), 2.24 (t, 4Η, NHCOCH₂(CH₂)₆CH), 2.71 (m, 2H, NH₂CH₂CH₂NH), 2.93 (s, 2H, CH₂SH), 3.20 (t, 2H, CHCH₂CH₂CH₂CH₂NH), 3.17 (m, 4H, CHCH₂Imidazole), 3.40 (m, 2Η, NH₂CH₂CH₂NH), 4.20 (t, IH, COCHCH₂CH₂), 4.40 (m, 2H, COCHCH₂SH), 4.60 (m, 2H, COCHCH₂Imidazole), 5.39 (t, 4H, CH₂CHCHCH₂), 7.39 (s, 2H, CCHNH in imidazole), 8.79 (s, 2H, NCHNH in imidazole). MS (MALDI-TOF, m/z) of EHHKCO: 1197.9 (M⁺+l, calculated 1196.8). c. Agarose Gel Retardation Assay The complexes formed by EKHCO and EHHKCO ("the surfactant") and plasmid DNA was determined by gel electrophoresis assay. Briefly, agarose gel (0.8% w/v) containing 0.5 μg/ml ethidium bromide was prepared in TAE buffer. EKHCO or EHHKCO /plasmid DNA complexes, prepared by mixing 0.5 μg DNA and surfactant solution at certain N/P ratios were loaded on the gel and ran at 100 V for 30 minutes, followed by visualized with a UV illuminator using a Gel Documentation System (Bio-Rad, Hercules, CA).

The surfactant can complex with nucleic acids through charge-charge interaction with nucleic acids and hydrophobic interaction among lipid tails. Gel retardation study (Figure 15) showed that from N/P ratio 2, all those eight surfactants can completely retard the shift of plasmid DNA in 0.8 % agarose gel. d. Particle Size Measurements

Plasmid/carrier complex nanoparticles were prepared by mixing plasmid solution with surfactants at predetermined N/P ratios and incubating for 30 minutes. The size of the nanoparticles was analyzed using a Brookhaven Instruments BI- 200SM equipped with a 5 mW helium-neon laser with output at 633 nm. Measurements were performed at room temperature in triplicates. The effective diameters were computed using software of the instruments.

Nucleic acid complexed with surfactant entered the cells through endocytosis, where the size of the complex played critical role in endocytosis efficiency. Sizes of the plasmid DNA /surfactant nanoparticles were determined (n=10) by dynamic light scattering. For both EKHCO and EHHKCO, at N/P ratio 2, they form nanoparticles with size as large as 500 nm and 700 nm in diameter respectively (Figure 16). The variation is huge, suggesting that these nanoparticles are not very stable and their size vary in a big range. In contrasts, from N/P ratio 4, both EKHCO and EHHKCO form stable nanoparticles when complexed with plasmid DNA, affirmed by the little variation of the particle size. From N/P ratio 4 to 16, size of plasmid DNA/ EKHCO complex is around 150 nm in diameter. In the same conditions, EHHKCO and plasmid DNA formed nanoparticles with a diameter around 200 nm. All these sizes are suitable for endocytosis. Both sizes are smaller than 250 nm, which is the reported cut-off size for efficient cellular uptake.

Both EKHCO and EHHKCO formed and maintained stable nanoparticles with siRNA below their CMCs as shown by dynamic light scattering. EKHCO and EHHKCO complexed with siRNA formed stable nanoparticles at the N/P ratio of 6 or higher (Figure 17). The sizes of EHHKCO/siRNA nanoparticles were around 100 nm, while EKHCO formed nanoparticles with siRNA with sizes in range of 200-250 nm. The difference between the sizes of pDNA and siRNA complexes could be attributed to the different sizes and topography of pDNA and siRNA. e. Determination of Critical Micelle Concentration

Briefly, a known amount of pyrene in ethanol was added to each series of 2 ml of various concentrations of surfactants to reach a final concentration of 0.6 μM. The aqueous surfactant solutions were shaken at room temperature for 48 hours. The fluorescent spectra were scanned using a Shimadzu RF-5301PC spectrofluorometer with slit with of 3 nm. Emission wavelength was set at 393 nm, while the excitation wavelength was scanned from 330 to 340 nm. With increased surfactant concentration, the fluorescent intensity was enhanced. A red shift in excitation wavelength was also observed when pyrene transferred from water to a more hydrophobic domain. The ratio I₃₃₆/I₃₃₃ was plotted against the surfactant concentration. The critical micelle concentration was determined by the onset of I₃₃₆/I₃₃₃ shifting. Using fluorescent method, the critical micelle concentration of EKHCO and EHHKCO were determined to be 6.87 μM and 9.50 μM, respectively (Figure 18). Both CMC values are lower than the CMC of those surfactants with one lipid tail, indicating that by incorporating two lipid tails, the lipophiphilicity of the surfactants was increased as indicted by the lowering of CMC value. Furthermore, with low CMC values, the surfactants are expected to form stable nanoparticles with nucleic acids against dilution as well as against the dissociation force from cellular lipid bilayers.

/ pH-Sensitive Hemolytic Activity Study

The surfactants, Triton X-IOO (1%, w/v), free surfactants, surfactant/plasmid DNA complexes and surfactant/siRNA complexes at N/P ratio 12 with surfactants at variant concentrations were dissolved in 50 μl phosphate buffer saline (PBS) with pH adjusted to 7.4 and 5.5 and plated in 0.6 ml microcentrifuge tubes. Rat erythrocytes (RBCs) were suspended in PBS at appropriate pH at the concentration 1% (w/v) and 200 μl of RBC solution was mixed with the sample solution and incubated at 37 ⁰C for 1 hour. The mixture was then centrifuged at 1500 rpm for 5 minutes. 100 μl of supernatant was collected from each sample and the absorbance was measured at 540 nm using a microplate reader to determine the released hemoglobin. The relative hemolysis efficiency was calculated by normalizing the absorbance of samples to that treated with Triton X-100.

Amphiphilic cellular membrane disruption is a common phenomenon is nature. Some viruses take the advantage of membrane disrupting oligo-peptides by incorporating them into their outer shells. Furthermore, cationic lipids were also reported to have membrane disrupting abilities since it was proposed that they can bind and neutralize the anionic lipids in cellular membranes. The membrane disrupting ability was already applied in gene delivery, and some carriers were developed by incorporating membrane disrupting moieties. However, the pH sensitive membrane disrupting abilities were more appreciated since such materials show little hemolytic activity in pH 7.4, the pH of extracellular environment, therefore little cytotoxicity, and the high hemolytic activity in pH around 5-6, the pH of endosomal-lysosomal compartment, facilitating endosomal escape of loaded nucleic acids.

The pH sensitive amphiphilic membrane disruption abilities of the free surfactants were evaluated by the hemolysis of rat red blood cells at different pH (Figure 19). The hemolytic activity was measured in PBS buffer at pH 7.4 and pH 5.5, the pH representing extracellular environment and endosomal-lysosomal compartment. The Triton X-100 (1% w/v) could introduce complete hemolysis and therefore was used as positive control. The PBS buffer alone caused less than 5% hemolysis. Little hemolysis was observed with DOTAP at 40 μM at both pH 7.4 and pH 5.5. EHHKCO and EKHCO, however, resulted in pH-dependent hemolytic activity. When diluted to concentrations ranging from 0.67 μM to 6.67 μM, the concentration lower than their respective CMC value, both EHHKCO and EKHCO resulted in significant hemolysis. The hemolytic activity increased with increasing surfactant concentration at both pH values. However, EHHKCO and EKHCO resulted in higher hemolytic activity at pH 5.5 than at pH 7.4. In lower concentrations, EHHKCO exhibited higher hemolytic activities than EKHCO, which is probably due to charge distribution since the positive charge of EHHKCO is more localized at the head while the positive charges of EKHCO are more evenly distributed throughout the whole lipid.

The surfactant with dual lipid tails can readily complex with nucleic acids to form nanoparticles even in lower CMC concentrations. EHHKCO and EKHCO were dissolved in PBS at a pH of 5.5 or 7.4 and complexed with plasmid DNA at N/P ratio of 12. The hemolytic activity of the DNA/surfactant complex was evaluated through the same procedure above. Figure 20 shows that the DNA/surfactant nanoparticles have significant hemolytic activity at pH 5.5 and minimal hemolytic activity at pH 7.4. Compared to free surfactants, the DNA/surfactant complexes lost almost all hemolytic activity at pH 7.4 and gain extra hemolytic activity at pH 5.5. The plasmid DNA/DOTAP nanoparticles with a DOTAP concentration of 40 μM showed little hemolytic activity at both pH 7.4 and pH 5.5.

The pH-sensitive amphiphilic membrane disruption abilities of siRNA/ surfactant complexes were also evaluated using similar procedure. As shown in Figure 21, siRNA complexed with both EHHKCO and EKHCO showed higher membrane disruption ability at pH 5.5 than at pH 7.4. The results of the hemolytic studies showed that the surfactants, surfactants/plasmid DNA complex and surfactant/siRNA complex have significant Ph-sensitive hemolytic activities at very low concentrations. With high hemolytic activity at pH 5.5, the pH for endosomal- lysosomal compartment, these surfactants are expected to facilitate the endosomal-lysosomal escape of loaded genetic materials and result in high transfection efficiency. g. Surfactants Mediated In Vitro Transfection

Surfactant mediated in vitro transfection assay was evaluated on U87 MG cell line (Human glioblastoma-astrocytoma, epithelial-like cell line, ATCC), which was cultured in DMEM medium containing 10% FBS, streptomycin (100 μg/ml) and penicillin (100 units/ml) at 37 ⁰C in a humidified atmosphere with 5% CO₂. Cells were seeded 24 hours prior transfection in 24-well plates at density of 4xlO⁴ cell/well. The medium was then replaced with 1 ml fresh DMEM medium without FBS. The complexes containing 0.5 μg luciferase-encoding plasmid DNA (pCMV-Luc) and surfactants at different N/P ratios were incubated with the cells for 4 hours at 37 ⁰C. After that, the medium was replaced 1 ml of fresh complete DMDM medium and incubated for additional 44 hours. The cells were then washed with pre- warmed PBS, treated with lysis buffer at 200 μl/well, and subjected to a freeze-thaw cycle. Cell debris was removed by centrifuge at 10000 g for 5 min. The luciferase activity in cell lysate (20 μl) was measured by a luciferase kit (Promega, Madison, WI). The relative luciferase unit (RLU) was normalized by a BCA protein assay kit (Pierce, Rockford, IL). All transfections were performed in triplicate. Cells without transfection and cells transfected with bPEI were used as control.

The in vitro transfection efficiency of the DNA/surfactant complexes was evaluated on U87 cell line with pCMV plasmid encoding luciferase as a reporter gene. As shown in Figure 22, at N/P ratio 12, both EHHKCO and EKHCO mediated the highest transfection efficiency. Interestingly, EKHCO mediated higher transfection efficiency than EHHKCO; the transfection efficiency could be correlated to the particle size and hemolytic activities.

Intracellular expression of reporter genes mediated by the multifunctional carriers was evaluated in U87 cells with pCMV-luc and pCMV-GFP. Figure 23 shows intracellular expression of luciferase in U87 cells mediated by EHHKCO and EKHCO at various N/P ratios. Both carriers resulted in the highest transfection efficiency of luciferase at the N/P ratio of 12, which was less than that mediated by DOTAP. EKHCO was more effective in luciferase transfection than EHHKCO. EHHKCO, EKHCO resulted in GFP expression in 9.8% and 3.3% of the cells at the N/P ratio of 12, respectively, much higher than 0.5% expression mediated by DOTAP. h. Plasmid DNA Cellular Uptake Approximately 300,000 U87 cells per well were plated in 12-well plate. After 24 hours,

YOYO-I labeled plasmid DNA nanoparticles (1 μg per well) were incubated with cells for 4 hours at 37 ⁰C in serum free medium. The medium was removed and the cells were washed twice with PBS and then trypsinized. The cells were collected and fixed by 4% paraformaldehyde in PBS for 20 minutes. The samples were analyzed using a FACSCalibur flow cytometer (BD Bioscience). Results were analyzed using Cell-Quest (BD Bioscience) software.

The surfactant mediated plasmid DNA uptake and surfactant mediated green fluorescent protein (GFP) expression were measured by flow cytometry. Figure 24 shows the flow cytometry diagrams of cellular uptake in U87 cells of fluorescence labeled pDNA complexes of EKHCO and EHHKCO. Both carriers resulted in approximately 93% of cellular uptake of plasmid DNA, while DOTAP only transfects 65.6% of the cells.

L GFP Plasmid Expression Assay

Approximately 3x10⁵ U87 cells were plated in each well of a 12-well plate 24 hours prior transfection. The GFP encoding plasmid (1 μg) was premixed with carriers at N/P ratio 12 and allowed 30 minutes to form complex. The plasmid/carrier complex was then incubated with U87 cells in serum- free medium and incubated at 37 ⁰C for 4 hours. The cells were then allowed to grow in complete medium for additional 44 hours. After that, the cells were washed with prewarmed PBS buffer and trypsinized. The cells were then collected and fixed in ice-cold PBS with 4% paraformaldehyde for 20 minutes. The samples were analyzed using a FACSCalibur flow cytometer (BD Bioscience). Results were analyzed using Cell-Quest (BD Bioscience) software (Figure 24). j. Surfactant Mediated siRNA Uptake

Approximately 300,000 U87 cells per well were plated in 12-well plate. After 24 hours, siRNA conjugated with Alexa Fluor 488 fluorescent dye (1 μg per well) complexed surfactants were incubated with cells for 4 hours at 37 ⁰C in serum free medium. The medium was removed and the cells were washed twice with PBS and then trypsinized. The cells were collected and fixed by 4% paraformaldehyde in PBS for 20 minutes. The samples were analyzed using a FACSCalibur flow cytometer (BD Bioscience). Results were analyzed using Cell-Quest (BD Bioscience) software.

The surfactant mediated siRNA uptake was also measured by flow cytometry. The result shows that both EKHCO and EHHKCO can deliver higher percentage of cells in situ than both bPEI and DOTAP (see Figure 25). k. Surfactants Mediated Gene Silencing with siRNA

The siRNA delivery efficiency of the surfactants was measured using anti-Luc siRNA in U87-Luc cell line which can stably express firefly luciferase. U87-luc cells were seeded in 96 well plates at the density of 5xlO³ cells/well in DMEM medium containing 10% FBS, G418 (300 μg/ml), streptomycin (100 μg/ml) and penicillin (100 units/ml) 24 hours prior transfection. Anti- luc siRNA (sequence of antisense is 5'-UCGAAGUACUCAGCGUAAGdTdT-S' and that of sense is 3'-dTdTAGCUUCAUGAGUCGCAUUC-5\ from Dharmacon, Chicago, IL) was complexed with surfactants for 30 minutes and then incubated with cells for 4 hours at 37 ⁰C in serum free DMEM medium. The medium was then replaced with complete DMEM medium and incubated for additional 44 hours. The cells were washed with pre-warmed PBS, and treated with 200 μl/well reporter lysis buffer followed by a freezing-thawing cycle. Luciferase activity in cell lysates was then measured by a luciferase assay kit (Promega, Madison, WI) on a luminometer (Dynex Tech., Chantilly, VA). The gene silencing efficiency was normalized against the luciferase activity of untreated cells.

The efficiency of surfactant mediated siRNA delivery was evaluated using anti-luciferase siRNA on a U87 cell line with stable expression of firefly luciferase. siRNA was complexed with EKHCO and EHHKCO at N/P ratios raging from 4 to 20. Cells in 96 well plates were incubated with 20 nM siRNA, where little to no cytotoxicity. The gene silencing efficiency mediated by the multifunctional carriers was evaluated in luciferase expressing U87 cells with an anti-luc siRNA. The complexes of anti-Luc siRNA with EKHCO and EHHKCO showed N/P ratio dependent gene silencing efficiency in U87-luc cells, Figure 26. EKHCO with 20 nM siRNA resulted in 57.4+12.3 % silencing efficiency at the N/P ratio of 12 and EHHKCO at the N/P ratio of 12 resulted in 71.4+18.8% gene silencing efficiency, while DOTAP only mediated 45.3 + 2.6 % of gene silencing efficiency under the same condition, EKHCO mediated gene silencing efficiency as high as 57.4+/-12.3% at N/P ratio 8 (Figure 27). EHHKCO at N/P ratio 12 mediated the highest gene silencing efficiency at 71.4+/-18.8%. In contrast, PEI only induced -70% gene silencing efficiency with siRNA concentration as high as 100 nM.

/. Cytotoxicity Cytotoxicity assays of the surfactant/plasmid DNA complexes was performed on the U87

MG cell line. The cells were seeded in 96-well plates at a density of 5xlO⁴ cell/well and cultured for 24 hours. After that, 0.1 μg DNA complexed with surfactants at certain N/P ratios were incubated with cells for 4 hours in serum free DMEM medium. After that, cells were incubated in complete medium for addition 20 hours. MTT solution (20 μl, 5 mg/ml) was then added and incubated in 37 ⁰C for 2 hours. After that, the medium was drained and 200 μl DMSO was added to each well, and the absorption was read at 570 nm using a micro plate reader (model 680, Bio- Rad, Hercules, CA). The relative cell viability was calculated by the equation: ([Abs]_sampi_e-

[Abs]blank)/([Abs]_Contror[Abs]blank)xl00%.

The cytotoxicity of the carriers was measured by MTT study. The results showed that the surfactant/plasmid DNA complex had little or no cytotoxicity on U87 cell line (Figure 28) and similar results were shown for the surfactant/ siRNA complex (Figure 29).

Throughout this application, various publications are referenced. The disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the compounds, compositions and methods described herein.

Various modifications and variations can be made to the compounds, compositions and methods described herein. Other aspects of the compounds, compositions and methods described herein will be apparent from consideration of the specification and practice of the compounds, compositions and methods disclosed herein. It is intended that the specification and examples be considered as exemplary.

Claims

CLAIMSWhat is claimed is:

1. A compound comprising the formula I

wherein (AA^_x, (AA²)_y and (AA³)_Z are the same or different sequences, each amino group of the amino acid is, independently, unsubstituted or substituted with an alkyl group, an alkenyl group, an acyl group, or an aromatic group; x, y and z are, independently, an integer from 0 to 50;

T comprises a residue derived from a group comprising at least three functional groups capable of forming a covalent bond with AA¹, AA² and AA³, or when AA¹, AA² and/or AA³ are not present, the functional group is capable of forming a covalent bond with F¹, F² and F³, wherein the functional group comprises an amino group, a hydroxyl group, a carboxylic group, a carbonyl group, a carbamate group, a ureyl group, a thiol group or an amide group;

R¹ and R² are each a hydrophobic group; X comprises an alkylamino group; and

F¹, F² and F³ are each a functional group, containing an amino group, -O-, -S-, a carboxylic group, a carbonyl group, a carbamate group, a ureyl group, or an amide group.

2. The compound of claim 1, wherein T comprises lysine.

3. The compound of claim 1, wherein R¹ and R² comprise a Ci to C₂₅ straight chain or branched alkyl group or alkenyl group.

4. The compound of claim 1, wherein R¹ and R² are the same alkyl group or different alkyl group or alkenyl group.

5. The compound of claim 1, wherein the alkylamino group X comprises the formula II, III, or IV -R¹⁴— NR¹⁵R¹⁶ II

-R¹⁷-N R¹⁹-NR²¹ R^{22 m}

R¹⁸

I_V

wherein R¹⁴, R¹⁷, R¹⁹, R²³, R²⁵ and R²⁷ are, independently, a straight chain or branched aliphatic hydrocarbon group, or a cyclic aliphatic hydrocarbon group, or an aromatic group;

R¹⁵' R¹⁶, R¹⁸, R²¹, R²², R²⁴, R²⁶, R²⁸ and R²⁹ are, independently, hydrogen, an alkyl group, a nitrogen containing group, or a hydrophobic group; and

A is an integer from 1 to 50.

6. The compound of claim 1, wherein the alkylamino group X comprises

-CH₂NH₂, -CH₂CH₂NH₂, -CH₂CH₂CH₂NH₂, - (CH₂CH₂)₂NH, - (CH₂CH₂)₂NCH₃, -(CH₂CHa)₂NCH₂CH₃, - (CH₂CHa)₂NCH₂CH₂NH₂, -CH₂CH2N(CH₂CH2)₂NH, -CH₂CH2N(CH2CH₂)2NCH3, -CH₂CH2N(CH2CH2)2NCH₂CH3, -CH₂CH₂CH₂CH₂NH₂, -CH₂CH₂CH₂CH₂CH₂NH₂, -CH₂NHCH₂CH₂CH₂NH₂, -CH₂CH₂NHCH₂CH₂CH₂NH₂, -CH₂CH₂CH₂NHCH₂CH₂CH₂CH₂NHCH₂CH₂CH₂NH₂,

-CH₂CH₂NHCH₂CH₂CH₂CH₂NH₂, -CH₂CH₂NHCH₂CH₂CH₂NHCH₂CH₂CH₂NH₂, or -CH₂CH₂NH(CH₂CH₂NH)_dCH₂CH₂NH₂, where d is from 0 to 50.

7. The compound of claim 1, wherein F¹ is an amino group, and F² and F³ are each an amide carbonyl group.

8. The compound of claim 1, wherein R¹ and R² are derived from oleic acid; X is -CH₂CH₂NHCH₂CH₂NHCH₂CH₂NH₂, -CH₂CH₂NHCH₂CH₂NH_2, -CH₂CH₂NH₂, or -CH₂CH₂CH₂NHCH₂CH₂CH₂CH₂NHCH₂CH₂CH₂NH₂; T is lysine; and F¹ is an amino group, and F² and F³ are each an amide carbonyl group.

9. The compound of claim 1, wherein at least one cysteinyl residue is in any two of AA¹, AA² and AA³ sequences.

10. The compound of claim 1, wherein the compound is EHHKCO, EHKCO, SKCO, SKHCO, SHKCO, SHHKCO, SKACO, SKAHCO, SHKACO, or SHHKACO.

11. The compound in any of claims 1-10, wherein polyethylene glycol is covalently attached to the compound.

12. The compound in any of claims 1-11, wherein a targeting group is covalently attached to the compound by a linker.

13. The compound of claim 12, wherein the linker comprises a polyamino acid group, a polyalkylene group, or a polyethylene glycol group.

14. The compound of claim 12, wherein the targeting group comprises a protein, peptide, an antibody, an antibody fragment, one of their derivatives or other ligands that can specifically bind to receptors on targeted cells.

15. The compound of claim 12, wherein the targeting group comprises an RGD peptide or bombesin peptide.

16. The compound of claim 1, wherein R¹ and R² are separated by 10 to 30 carbon atoms, and wherein F², (AA¹)^ T, (AA³)_Z, F³ or any combination thereof comprises the 10 to 40 atoms.

17. A disulfide oligomer or polymer produced by the process comprising reacting the same or different compound in any of claims 1-16 in the presence of an oxidant, wherein the same or different compound comprises at least one thiol group.

18. A nanosized complex comprising a nucleic acid and one or more compounds in any of claims 1-17.

19. The complex of claim 18, wherein the complex further comprises a targeting agent.

20. The complex of claim 19, wherein the targeting agent comprises a protein, peptide, an antibody, an antibody fragment, one of their derivatives or other ligands that can specifically bind to receptors on targeted cells.

21. The complex of claim 19, wherein the targeting agent comprises an RGD peptide or bombesin peptide.

22. The complex of claim 19, wherein the targeting agent is covalently attached to the nanosized complex via a linker.

23. The complex of claim 22, wherein the linker comprises a polyamino acid group, a polyalkylene group, or a polyethylene glycol group.

24. The complex of claim 18, wherein the nucleic acid comprises, a natural or synthetic oligonucleotide, a natural or modified/blocked nucleotide/nucleoside, a DNA or fragment there of, or an RNA or fragment there of.

25. The complex of claim 18, wherein the nucleic acid comprises a siRNA.

26. The complex of claim 18, wherein the nucleic acid comprises a plasmid DNA.

27. A complex produced by the process comprising admixing a nucleic acid and one or more compounds in any of claims 1-17.

28. The complex in any of claims 18-27, wherein the complex undergoes cellular membrane disruption at a pH of 5 to 6.

29. The complex in any of claims 18-27, wherein the complex undergoes cellular membrane disruption at a pH of 5 to 5.5.

30. A method for introducing a nucleic acid into a cell comprising contacting the cell with a complex in any of claims 18-27, wherein the nucleic acid is taken up into the cell.

31. The method of claim 30, wherein said contacting step occurs in vitro.

32. The method of claim 30, wherein said contacting step occurs in vivo.