WO2010075303A1 - Splicing factors with a puf protein rna-binding domain and a splicing effector domain and uses of same - Google Patents

Abstract

Embodiments of the invention provide a fusion protein comprising a PUF RNA-binding domain of any of SEQ ID NOS: 1-7 and an RNA processing domain of any of SEQ ID NOS: 8-16. The invention also provides related nucleic acids, recombinant expression vectors, host cells, populations of cells, antibodies, or antigen binding portions thereof, and pharmaceutical compositions relating to the fusion proteins of the invention. The invention also provides methods of treating or preventing diseases associated with RNA processing. The invention also provides methods of detecting in a host a disease associated with RNA processing and detecting the RNA processing capability of a test molecule.

Description

SPLICING FACTORS WITH A PUF PROTEIN RNA-BINDING DOMAIN AND A SPLICING EFFECTOR DOMAIN AND USES OF SAME

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This patent application claims the benefit of U.S. Provisional Patent Application No. 61/140,326, filed December 23, 2008, which is incorporated by reference.

INCORPORATION-BY-REFERENCE OF MATERIAL SUBMITTED

ELECTRONICALLY

[0002] Incorporated by reference in its entirety herein is a computer-readable nucleotide/amino acid sequence listing submitted concurrently herewith and identified as follows: One 162,442 Byte ASCII (Text) file named "705588ST25.txt" created on December 21, 2009.

BACKGROUND OF THE INVENTION

[0003] As a key regulatory step in gene expression, alternative splicing is common in humans with most genes producing multiple splicing isoforms with distinct and sometimes opposing functions. Generally, the splicing process is regulated by a combination of exonic or intronic m-elements that recruit protein trans-factois (i.e., splicing factors) to either promote or inhibit the use of nearby splice sites. Some splicing factors have modular organization, with separate sequence-specific RNA binding modules and splicing effector domains.

[0004] There exists a need for the development of modular splicing factors and the use of these for the treatment or prevention of disease.

BRIEF SUMMARY OF THE INVENTION

[0005] An embodiment of the invention provides a fusion protein selected from the group consisting of a PUF RNA-binding domain of any of SEQ ID NOS: 1-7 and an RNA processing domain of any of SEQ ID NOS: 8-16. The invention provides a fusion protein comprising a PUF RNA-binding domain of any of SEQ ID NOS: 1-7 and an RNA processing domain of SEQ ID NO: 8 or 12. The invention also provides a fusion protein comprising a PUF RNA-binding domain of any of SEQ ID NOS: 1-7 and an RNA processing domain of any of SEQ ID NOS: 9-11 or 13-16. The invention further provides a fusion protein comprising a PUF RNA-binding domain of any of SEQ ID NOS: 1-7 and an RNA processing domain of any of SEQ ID NO: 8-1 1. The invention also provides a fusion protein comprising a PUF RNA-binding domain of any of SEQ ID NOS: 1-7 and an RNA processing domain of any of SEQ ID NO: 12-16.

[0006] The invention also provides related nucleic acids, recombinant expression vectors, host cells, and populations of cells. Further provided by the invention are antibodies, or antigen binding portions thereof, and pharmaceutical compositions relating to the fusion proteins of the invention.

[0007] The invention also provides methods of treating or preventing diseases associated with RNA processing comprising administering to a host in need thereof an effective amount of the fusion proteins, the nucleic acids, the recombinant expression vectors, the host cells, the population of cells, the antibodies, and/or the antigen binding portions thereof of the invention.

[0008] Another embodiment of the invention provides use of an effective amount of a fusion protein of the invention, and/or a nucleic acid, recombinant expression vector, host cell, population of cells, and/or antibody, or antigen binding portions thereof, relating to a fusion protein of the invention, in the manufacture of a medicament for treating or preventing a disease associated with RNA processing.

[0009] The invention also provides methods of detecting in a host a disease associated with RNA processing comprising obtaining a first sample and a second sample each comprising one or more cells from the host; detecting the RNA processing of the first sample; contacting the second sample with the fusion proteins, the nucleic acids, the recombinant expression vectors, the host cells, the population of cells, the antibodies, and/or antigen binding portions thereof of the invention; detecting the RNA processing of the second sample; and comparing the RNA processing of the first and second samples. [0010] The invention also provides a method of detecting the RNA processing capability of a test molecule comprising attaching the test molecule to a PUF domain of any of SEQ ID NOS: 1-7, contacting the attached test molecule with a RNA molecule that is recognized by the PUF domain, and detecting the RNA processing of the RNA molecule, wherein the RNA processing of the RNA molecule detects the RNA processing capability of the test molecule. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 is a schematic diagram of the interaction of the human Pumiliol PUF domain with RNA, Each "R" oval represents one PUF motif, and each "N" circle represents one RNA base.

[0012] Figure 2 is a representative electrophoretic mobility shift assay (EMSA) of a mutated PUF domain (PUF⁵³¹) with Bcl-x RNA.

[0013] Figure 3 is a diagram showing a detail of a region of amino acids used in the construction of the chimeras of Example 2.

[0014] Figure 4 is a chart showing diagrams of the chimeras of Example 2 and the associated β-galactosidase activity of the chimeras in three yeast hybrid assays. The numbered boxes represent individual PUF motifs of the chimeras. [0015] Figure 5 is a schematic diagram showing the modular domain organization of engineered splicing factors (ESFs) described, e.g., in Example 3.

[0016] Figure 6 is a schematic diagram showing inhibition of exon inclusion by GIy-PUF type ESFs in exon-skipping reporters containing an 8-nt cognate sequence in the cassette exon.

[0017] Figure 7 is a bar graph showing the fold change of cassette exon inclusion of target RNAs Nanos Response Element (NRE), A6G, and GU/UG in the presence of GIy- PUF^wl, GIy-PUF^3"2, and GIy-PUF⁶^^7"2 ESFs relative to the reporters alone (i.e., in the absence of ESFs). The means of replicated experiments are plotted with error bars indicating the range of replicated experiments.

[0018] Figure 8 is a graph showing the correlation of ESF activities with the binding affinity of their PUF domains to target sequences. The fold changes of the ESFs (i.e., ESF activities) were plotted against the binding affinity between target 8-mers and ESF PUF domains, indicated as -logarithm of Kd (raM).

[0019] Figure 9 is a schematic diagram showing the promotion of exon inclusion by RS- PUF type ESFs with the exon-skipping reporters containing an 8-nt cognate sequence in the cassette exon.

[0020] Figure 10 is a bar graph showing the fold change of cassette exon inclusion of target RNAs NRE, A6G, and GU/UG in the presence of RS-PUF^wt, RS-PUF^3'2, and RS- pyp^ό-^2/7-² £gp_{s re}i_at_lve to the reporters alone (i.e., in the absence of ESFs). The means of replicated experiments are plotted with error bars indicating the data ranges. [0021] Figure 11 is a schematic diagram showing the regulation of alternative 5' splice sites (ss) by RS-PUF type ESFs.

[0022] Figure 12 is a bar graph showing the percentage of product with 5' ss (upper band) to total product of target RNAs NRE, A6G, and GU/UG in the presence of RS-PUF^, RS-PUF^3"2, and RS-PUF^6"2/7"2 ESFs relative to the reporters alone (i.e., in the absence of ESFs). The means of replicated experiments are plotted with error bars indicating the range of replicated experiments.

[0023] Figure 13 is a schematic diagram showing the regulation of alternative 3' ss usage by RS-PUF type ESFs.

[0024] Figure 14 is a bar graph showing fold change of product with 3' ss of target RNAs NRE₅ A6G, and GU/UG in the presence of RS-PUF^, RS-PUF^3'2, and RS-PUF^6"2'^7'2 ESFs relative to the reporters alone (i.e., in the absence of ESFs). The means of replicated experiments are plotted with error bars indicating the data ranges.

[0025] Figure 15 is a schematic diagram showing the alternative splicing of Bcl-x pre- mRNA by GIy-PUF⁵³'.

[0026] Figure 16 is a bar graph showing the percentage of cells undergoing apoptosis (i.e. with fragmented nuclear DNA) in the presence of GIy-PUF⁵³¹ and Gly-PUF^wt (control ESF). [0027] Figure 17 is a bar graph showing the modulation of alternative splicing of Bcl-x in four cancer cell types transfected with GIy-PUF⁵³¹ or GIy-PUF"¹ (control ESF). Bcl-x splicing products were detected with RT-PCR.

[0028] Figure 18 A is a bar graph showing the effect of ESFs on cisplatin (5 μM) sensitivity of different cancer cell lines. The asterisks indicate samples with significant difference (P<0.05, judged by paired T-test) of cell viabilities between the GIy-PUF⁵³¹ and GIy-PUF^ transfected cells.

[0029] Figure 18B is a bar graph showing the effect of ESFs on paclitaxel (10 nM) sensitivity of different cancer cell lines. The asterisks indicate samples with significant difference (PO.05, judged by paired T-test) of cell viabilities between the GIy-PUF⁵³¹ and Gly-PUF^wt transfected cells.

[0030] Figure 18C is a bar graph showing the effect of ESFs on TNF-α (20 ng/ml) sensitivity of different cancer cell lines. The asterisks indicate samples with significant difference (PO.05, judged by paired T-test) of cell viabilities between the GIy-PUF⁵³¹ and Gly-PUF^wt transfected cells. [0031] Figure 18D is a bar graph showing the effect of ESFs on TRAIL (100 ng/ml) sensitivity of different cancer cell lines. The asterisks indicate samples with significant difference (PO.05, judged by paired T-test) of cell viabilities between the GIy-PUF⁵³¹ and Gly-PUF^wt transfected cells.

[0032] Figure 19 is a schematic diagram showing three different ESFs that can be designed (ESF #1, ESF #2, and ESF #3) to shift VEGF-A splicing towards producing more anti-angiogenic isoforms.

[0033] Figure 20 is a bar graph showing the percent of the b isoform of the VEGF-A gene generated with ESF #1 of Figure 19, where VEGF-A₁₆₅b is the major isoform measured. [0034] Figure 21 is a bar graph showing fold change of cassette exon inclusion for various ESFs relative to the reporter alone (without ESF).

DETAILED DESCRIPTION OF THE INVENTION

[0035] One embodiment of the invention provides a fusion protein comprising a PUF RNA-binding domain of any of SEQ ID NOS: 1 -7 and an RNA processing domain of any of SEQ ID NOS: 8-16. Another embodiment of the invention provides a fusion protein selected from the group consisting of a PUF RNA-binding domain of any of SEQ ID NOS: 1-7 and an RNA processing domain of any of SEQ ID NOS: 8-16. The invention provides a fusion protein comprising a PUF RNA-binding domain of any of SEQ ID NOS: 1-7 and an RNA processing domain of SEQ ID NO: 8 or 12. The invention also provides a fusion protein comprising a PUF RNA-binding domain of any of SEQ ID NOS: 1-7 and an RNA processing domain of any of SEQ ID NOS: 9-11 or 13-16. The invention further provides a fusion protein comprising a PUF RNA-binding domain of any of SEQ ID NOS: 1-7 and an RNA processing domain of any of SEQ ID NO: 8-11. The invention also provides a fusion protein comprising a PUF RNA-binding domain of any of SEQ ID NOS: 1-7 and an RNA processing domain of any of SEQ ID NO: 12- 16.

[0036] Another embodiment of the invention provides a fusion protein comprising a PUF RNA-binding domain of SEQ ID NO: 1 and an RNA processing domain of SEQ ID NO: 8, a PUF RNA-binding domain of SEQ ID NO: 1 and an RNA processing domain of SEQ ID NO: 9, a PUF RNA-binding domain of SEQ ID NO: 1 and an RNA processing domain of SEQ ID NO: 10, a PUF RNA-binding domain of SEQ ID NO: 1 and an RNA processing domain of SEQ ID NO: 11, a PUF RNA-binding domain of SEQ ID NO: 1 and an RNA processing domain of SEQ ID NO: 12, a PUF RNA-binding domain of SEQ ID NO: 1 and an RNA processing domain of SEQ ID NO: 13, a PUF RNA-binding domain of SEQ ID NO: 1 and an RNA processing domain of SEQ ID NO: 14, a PUF RNA-binding domain of SEQ ID NO: 1 and an RNA processing domain of SEQ ID NO: 15, or a PUF RNA-binding domain of SEQ ID NO: 1 and an RNA processing domain of SEQ ID NO: 16.

[0037] Another embodiment of the invention provides a fusion protein comprising a PUF RNA-binding domain of SEQ ID NO: 2 and an RNA processing domain of SEQ ID NO: 8, a PUF RNA-binding domain of SEQ ID NO: 2 and an RNA processing domain of SEQ ID NO: 9, a PUF RNA-binding domain of SEQ ID NO: 2 and an RNA processing domain of SEQ ID NO: 10, a PUF RNA-binding domain of SEQ ID NO: 2 and an RNA processing domain of SEQ ID NO: 11, a PUF RNA-binding domain of SEQ ID NO: 2 and an RNA processing domain of SEQ ID NO: 12, a PUF RNA-binding domain of SEQ ID NO: 2 and an RNA processing domain of SEQ ID NO: 13, a PUF RNA-binding domain of SEQ ID NO: 2 and an RNA processing domain of SEQ ID NO: 14, a PUF RNA-binding domain of SEQ ID NO: 2 and an RNA processing domain of SEQ ID NO: 15, or a PUF RNA-binding domain of SEQ ID NO: 2 and an RNA processing domain of SEQ ID NO: 16.

[0038] Another embodiment of the invention provides a fusion protein comprising a PUF RNA-binding domain of SEQ ID NO: 3 and an RNA processing domain of SEQ ID NO: 8, a PUF RNA-binding domain of SEQ ID NO: 3 and an RNA processing domain of SEQ ID NO: 9, a PUF RNA-binding domain of SEQ ID NO: 3 and an RNA processing domain of SEQ ID NO: 10, a PUF RNA-binding domain of SEQ ID NO: 3 and an RNA processing domain of SEQ ID NO: 11 , a PUF RNA-binding domain of SEQ ID NO: 3 and an RNA processing domain of SEQ ID NO: 12, a PUF RNA-binding domain of SEQ ID NO: 3 and an RNA processing domain of SEQ ID NO: 13, a PUF RNA-binding domain of SEQ ID NO: 3 and an RNA processing domain of SEQ ID NO: 14, a PUF RNA-binding domain of SEQ ID NO: 3 and an RNA processing domain of SEQ ID NO: 15, or a PUF RNA-binding domain of SEQ ID NO: 3 and an RNA processing domain of SEQ ID NO: 16.

[0039] Another embodiment of the invention provides a fusion protein comprising a PUF RNA-binding domain of SEQ ID NO: 4 and an RNA processing domain of SEQ ID NO: 8, a PUF RNA-binding domain of SEQ ID NO: 4 and an RNA processing domain of SEQ ID NO: 9, a PUF RNA-binding domain of SEQ ID NO: 4 and an RNA processing domain of SEQ ID NO: 10, a PUF RNA-binding domain of SEQ ID NO: 4 and an RNA processing domain of SEQ ID NO: 11, a PUF RNA-binding domain of SEQ ID NO: 4 and an RNA processing domain of SEQ ID NO: 12, a PUF RNA-binding domain of SEQ ID NO: 4 and an RNA processing domain of SEQ ID NO: 13, a PUF RNA-binding domain of SEQ ID NO: 4 and an RNA processing domain of SEQ ID NO: 14, a PUF RNA-binding domain of SEQ ID NO: 4 and an RNA processing domain of SEQ ID NO: 15, or a PUF RNA-binding domain of SEQ ID NO: 4 and an RNA processing domain of SEQ ID NO: 16.

[0040] Another embodiment of the invention provides a fusion protein comprising a PUF RNA-binding domain of SEQ ID NO: 5 and an RNA processing domain of SEQ ID NO: 8, a PUF RNA-binding domain of SEQ ID NO: 5 and an RNA processing domain of SEQ ID NO: 9, a PUF RNA-binding domain of SEQ ID NO: 5 and an RNA processing domain of SEQ ID NO: 10, a PUF RNA-binding domain of SEQ ID NO: 5 and an RNA processing domain of SEQ ID NO: 11, a PUF RNA-binding domain of SEQ ID NO: 5 and an RNA processing domain of SEQ ID NO: 12, a PUF RNA-binding domain of SEQ ID NO: 5 and an RNA processing domain of SEQ ID NO: 13, a PUF RNA-binding domain of SEQ ID NO: 5 and an RNA processing domain of SEQ ID NO: 14, a PUF RNA-binding domain of SEQ ID NO: 5 and an RNA processing domain of SEQ ID NO: 15, or a PUF RNA-binding domain of SEQ ID NO: 5 and an RNA processing domain of SEQ ID NO: 16.

[0041] Another embodiment of the invention provides a fusion protein comprising a PUF RNA-binding domain of SEQ ID NO: 6 and an RNA processing domain of SEQ ID NO: 8, a PUF RNA-binding domain of SEQ ID NO: 6 and an RNA processing domain of SEQ ID NO: 9, a PUF RNA-binding domain of SEQ ID NO: 6 and an RNA processing domain of SEQ ID NO: 10, a PUF RNA-binding domain of SEQ ID NO: 6 and an RNA processing domain of SEQ ID NO: 11, a PUF RNA-binding domain of SEQ ID NO: 6 and an RNA processing domain of SEQ ID NO: 12, a PUF RNA-binding domain of SEQ ID NO: 6 and an RNA processing domain of SEQ ID NO: 13, a PUF RNA-binding domain of SEQ ID NO: 6 and an RNA processing domain of SEQ ID NO: 14, a PUF RNA-binding domain of SEQ ID NO: 6 and an RNA processing domain of SEQ ID NO: 15, or a PUF RNA-binding domain of SEQ ID NO: 6 and an RNA processing domain of SEQ ID NO: 16.

[0042] Another embodiment of the invention provides a fusion protein comprising a PUF RNA-binding domain of SEQ ID NO: 7 and an RNA processing domain of SEQ ID NO: 8, a PUF RNA-binding domain of SEQ ID NO: 7 and an RNA processing domain of SEQ ID NO: 9, a PUF RNA-binding domain of SEQ ID NO: 7 and an RNA processing domain of SEQ ID NO: 10, a PUF RNA-binding domain of SEQ ID NO: 7 and an RNA processing domain of SEQ ID NO: 11, a PUF RNA-binding domain of SEQ ID NO: 7 and an RNA processing domain of SEQ ID NO: 12, a PUF RNA-binding domain of SEQ ID NO: 7 and an RNA processing domain of SEQ ID NO: 13, a PUF RNA-binding domain of SEQ ID NO: 7 and an RNA processing domain of SEQ ID NO: 14, a PUF RNA-binding domain of SEQ ID NO: 7 and an RNA processing domain of SEQ ID NO: 15, or a PUF RNA-binding domain of SEQ ID NO: 7 and an RNA processing domain of SEQ ID NO: 16.

[0043] A "fusion protein" is a protein comprising two or more sequences and/or domains from two different polypeptide chains, one or both of which may be naturally occurring. An engineered splicing factor (ESF) is a fusion protein. A "PUF domain" is a protein domain comprising one or more PUF α-α-α motifs, such as those in the Pumiliol protein. An "RNA-binding domain" is a protein sequence that recognizes and/or interacts with RNA. As in the case of the RNA-binding domains of the invention, the recognition of the domain is specific for particular RNA sequences. An "RNA processing domain" is a protein sequence that alters the structure of RNA, e.g., through exon inclusion or removal. Alteration of RNA structure includes providing for alternative splice variants of mRNA from pre-mRNA. A "marker sequence" is a protein sequence for which the protein may be marked for detection. Non-limiting examples include the FLAG epitope and green fluorescent protein, GFP. [0044] PUF proteins (named for Drosophila Pumilio and C. elegans fern- 3 binding factor), whose known functions involve mediating mRNA stability and translation, contain a unique RNA-binding domain. The RNA-binding domain of human Pumiliol (SEQ ID NO: 1) contains eight PUF motif repeats that recognize eight consecutive RNA bases with each repeat recognizing a single base in anti-parallel orientation, with repeat Rl to R8 recognizing nucleotides N8 to Nl, respectively (Figure 1). The code to recognize base U is the amino acid sequence "NYxxQ", whereas "(C/S)RxxQ" recognizes A and "SNxxE" recognizes G. These amino acids correspond to positions 12, 13, and 16 in the human Pumiliol PUF motif. The two recognition amino acid side chains at positions 12 and 16 in each PUF α-α-α repeat recognize the Watson-Crick edge of the corresponding base and largely determine the specificity of that repeat. Therefore, altering these amino acids would alter the specificity of the PUF domain.

[0045] Some RNA splicing factors have modular organization, with separate sequence- specific RNA binding modules and splicing effector domains. For example, members of the Serine/ Arginine-rich (SR) protein family contain N-terminal RNA recognition motifs (RRMs) that bind to exonic splicing enhancers (ESEs) in pre-mRNAs and C-terminal RS domains that promote exon inclusion. As another example, the hnRNP protein hnRNP Al binds to exonic splicing silencers (ESSs) through its RRM domains and inhibits exon inclusion through a C-terminal Glycine-rich domain.

[0046] Some splicing factors can regulate alternative use of splice site (ss) by binding to regulatory sequences between the two alternative sites. For example, ASF/SF2 can recognize ESEs and promote the use of intron proximal sites, whereas hnRNP Al can bind to ESSs and shift splicing towards the use of intron distal sites. One application for such factors is to generate ESFs that modulate alternative splicing of endogenous genes, particularly disease associated genes. For example, Bcl-x pre-mRNA produces two splicing isoforms with two alternative 5' ss to encode proteins of opposite functions. The long splicing isoform Bcl-xL is a potent apoptosis inhibitor expressed in long-lived postmitotic cells and is up-regulated in many cancer cells, protecting cells against apoptotic signals. The short isoform Bcl-xS is a pro-apoptotic isoform and expressed at high levels in cells with a high turnover rate (e.g., developing lymphocytes). The ratio of the two Bcl-x splicing isoforms is regulated by multiple cώ-elements that are located in either the core exon region or the exon extension region (i.e., between the two alternative 5' ss).

[0047] Examples of diseases associated with abnormal RNA processing (or of the pre- mRNA involved) include diabetes (insulin receptor), psoriasis (fibronectin), polycystic kidney disease (PKD2), and prostate cancer (fibroblast growth factor receptor 2). Other diseases include cystic fibrosis (CFTR), neurofibromatosis type 1 (NFl), muscular dystrophy (dystrophin), and beta-thalassemia (HBB). An example of a disease associated with abnormal RNA exclusion is spinal muscular atrophy, where the pre-mRNA of SMN2 is incorrectly spliced to exclude exon 7. An example of a disease associated with disruption of use of an alternative splice site includes Frasier syndrome, where abnormal use of the 5' splice site for exon 9 alters the ratio of expressed isoforms. Normally, the expression of the isoform with additional amino acids of the exon 9 is greater than the expression of the isoform excluding these amino acids, whereas in the disease there is a shift in the expression ratio to the isoform without the additional amino acids.

[0048] Another example of a gene where alternative splicing is indicated in disease is that of the VEGF-A gene (which is often denoted VEGFS-A when specifying VEGF in the serum and VEGFP-A when specifying VEGF in plasma). The VEGF-A gene contains 8 exons, of which exons 6 and 7 undergo extensive alternative splicing to produce multiple isoforms, named VEGF- A_xxx, with xxx denoting the amino acid number of the mature protein. VEGF- A may also be alternatively spliced to VEGF- A_xxxb, which uses a distal 3' ss of exon 8, producing six different amino acids at the C-terminal. Surprisingly, the b isoforms have anti- angiogenic activity that is opposite to the canonical VEGF-A_XXJt isoforms. The basal expression of VEGF-A in most normal human tissues is predominantly the b isoforms, with the only exception of placenta where angiogenesis is known to occur. However, in melanoma, colorectal carcinoma, and bladder cancer cells, as well as proliferating podocytes, the VEGF- A_xxx isoforms comprise the majority of VEGF-A expression. Many cancers are associated with a switch from the VEGF- A_xxxb isoforms to the pro-angio genie VEGF- A_xxx isoforms, and the over-expression OfVEGF-A_16Sb can inhibit human tumor growth in mice models. This suggests that angiogenesis is orchestrated by the VEGF-A splicing isoform balance.

[0049] Embodiments of the present invention may encompass other RNA processing besides RNA alternative splicing (e.g., polyadenylation or RNA degradation) that are regulated through interactions between RNA-binding c/s-factors and other RNA-processing /rørø-factors. Appropriate selections of a particular trarø-factor protein for coupling to a particular cw-factor PUF domain allow for sequence specificity, due to the PUF domain selected, and specific RNA processing, depending upon the selected trarø-factor. Examples of /ram-factor proteins include, but are not limited to, deadenylases and Argonaute proteins involved in RNA interference.

[0050] Another embodiment of the invention provides for varying the length of the PUF domain. By increasing or decreasing the number of PUF motifs, the length of the recognized RNA will be correspondingly increased or decreased. Since one PUF motif recognizes one RNA base (Figure 1), decreasing the domain by one motif decreases the length of the RNA recognized by one base; increasing the domain by one motif increases the length of the RNA recognized by one base. Any number of motifs may be present, including 5, 6, 7, 8, 9, 10, 1 1, 12, or longer, so long as the PUF domain binds the RNA. Therefore, the specificity of the ESFs may be altered due to changes in PUF domain length.

[0051] Another embodiment of the invention provides for a PUF domain with PUF motifs of different proteins in the PUF domain. For example, a PUF domain may be constructed with PUF motifs from the Pumiliol protein and one or more other PUF proteins. The one or more other PUF motifs may be from, for example, the PUF domain of PuDp or FBF.

[0052] The RNA binding pockets of PUF domains have natural concave curvatures. Since different PUF proteins may have different curvatures, different PUF motifs in a PUF domain may be used to alter the curvature of the PUF domain. Altering the curvature is another method for altering the specificity of the PUF domain since flatter curvatures allow for the recognition of more RNA bases.

[0053] Another embodiment of the invention provides for varying the length of the trans- factor domains. For example, since RS and Gly-rich domains consist of highly repetitive sequences, smaller fragments of such domains may have sufficient activity to regulate splicing, as shown in Example 10 below.

[0054] Another embodiment of the invention provides use of nucleic acids encoding the ESFs of the invention to generate animal models of splicing disease or animal models to examine the physiological effects of particular alternative splicing choices. Another embodiment of the invention provides ESFs to study the self-regulation of splicing factors that regulate splicing through a feedback loop.

[0055] The invention also provides related nucleic acids, recombinant expression vectors, host cells, and populations of cells related to the fusion proteins of the invention. Further provided by the invention are antibodies, or antigen binding portions thereof, and pharmaceutical compositions relating to the fusion proteins of the invention. [0056] Another embodiment of the invention provides a method of treating or preventing a disease associated with RNA processing comprising administering to a host in need thereof an effective amount of a fusion protein of the invention. Another embodiment of the invention provides a method of treating or preventing a disease associated with RNA processing comprising administering to a host in need thereof an effective amount of a nucleic acid, recombinant expression vector, host cell, population of cells, and/or antibody, or antigen binding portions thereof, relating to a fusion protein of the invention. [0057] Another embodiment of the invention provides use of an effective amount of a fusion protein of the invention, a nucleic acid, recombinant expression vector, host cell, population of cells, and/or antibody, or antigen binding portions thereof, relating to a fusion protein of the invention in the manufacture of a medicament for treating or preventing a disease associated with RNA processing.

[0058] Another embodiment of the invention provides a method of detecting in a host a disease associated with RNA processing due to inclusion of additional one or more exons comprising: (a) obtaining a first sample and a second sample each comprising one or more cells from the host; (b) detecting the RNA processing of the first sample; (c) contacting the second sample with the fusion proteins, the nucleic acids, the recombinant expression vectors, the host cells, the population of cells, the antibodies, and/or antigen binding portions thereof of the invention; (d) detecting the RNA processing of the second sample; and (e) comparing the RNA processing of the first and second samples; wherein detection of the additional one or more exons in a lower amount in the second sample compared to the first sample is indicative of the presence of a disease associated with RNA processing in the host. [0059] Another embodiment of the invention provides a method of detecting in a host a disease associated with RNA processing due to removal of one or more exons comprising: (a) obtaining a first sample and a second sample each comprising one or more cells from the host; (b) detecting the RNA processing of the first sample; (c) contacting the second sample with the fusion proteins, the nucleic acids, the recombinant expression vectors, the host cells, the population of cells, the antibodies, and/or antigen binding portions thereof of the invention; (d) detecting the RNA processing of the second sample; and (e) comparing the RNA processing of the first and second samples; wherein detection of removal of the one or more exons in a higher amount in the first sample compared to the second sample is indicative of the presence of a disease associated with RNA processing in the host. [0060] The host referred to herein can be any host. The host may be a mammal. As used herein, the term "mammal" refers to any mammal, including, but not limited to, mammals of the order Rodentia, such as mice and hamsters, and mammals of the order Logomorpha, such as rabbits. The mammals may be from the order Carnivora, including Felines (cats) and Canines (dogs). The mammals may be from the order Artiodactyla, including Bovines (cows) and S wines (pigs) or of the order Perssodactyla, including Equines (horses). The mammals may be of the order Primates, Ceboids, or Simoids (monkeys) or of the order Anthropoids (humans and apes). The mammal may be a human. [0061] Included in the scope of the invention are functional variants of the inventive ESFs described herein. The term "functional variant" as used herein refers to an ESF having substantial or significant sequence identity or similarity to a parent ESF, which functional variant retains the biological activity of the ESF of which it is a variant. Functional variants encompass, for example, those variants of the ESFs described herein (the parent ESFs) that retain the ability to recognize target RNA to a similar extent, the same extent, or to a higher extent, as the parent ESFs. In reference to the parent ESFs, the functional variant can, for instance, be at least about 30%, 50%, 75%, 80%, 90%, 98% or more identical in amino acid sequence to the parent ESF. [0062] The functional variant can, for example, comprise the amino acid sequence of the parent ESF with at least one conservative amino acid substitution, for example, conservative amino acid substitutions in the scaffold of the PUF domain (i.e., amino acids that do not interact with the RNA). Alternatively or additionally, the functional variants can comprise the amino acid sequence of the parent ESF with at least one non-conservative amino acid substitution. In this case, it is preferable for the non-conservative amino acid substitution to not interfere with or inhibit the biological activity or of the functional variant. The non- conservative amino acid substitution may enhance the biological activity of the functional variant, such that the biological activity of the functional variant is increased as compared to the parent ESF, or may alter the stability of the ESF to a desired level (e.g., due to substitution of amino acids in the scaffold).

[0063] The ESF can consist essentially of the specified amino acid sequence or sequences described herein, such that other components e.g., other amino acids, do not materially change the biological activity of the functional variant.

[0064] The ESFs of the invention (including functional portions and functional variants) can be of any length, i.e., can comprise any number of amino acids, provided that the ESFs (or functional portions or functional variants thereof) retain their biological activity, e.g., the ability to specifically bind to RNA or treat or prevent disease in a host, etc. For example, the polypeptide can be about 50 to about 5000 amino acids long, such as 50, 70, 75, 100, 125, 150, 175, 200, 300, 400, 500, 60O₅ 700, 800, 900, 1000 or more amino acids in length. [0065] The ESFs of the invention (including functional portions and functional variants) of the invention can comprise synthetic amino acids in place of one or more naturally- occurring amino acids. Such synthetic amino acids are known in the art, and include, for example, aminocyclohexane carboxylic acid, norleucine, α-amino n-decanoic acid, homoserine, S-acetylaminomethyl-cysteine, trans-3- and trans-4-hydroxyproline, 4- aminophenylalanine, 4 -nitrophenyl alanine, 4-chlorophenylalanine, 4-carboxyphenylalanine, β-phenylserine β-hydroxyphenylalanine, phenylglycine, α-naphthylalanine, cyclohexylalanine, cyclohexylglycine, indoline-2-carboxylic acid, 1,2,3,4- tetrahydroisoquinoline-3-carboxylic acid, aminomalonic acid, aminomalonic acid monoamide, N'-benzyl-N'-methyl-lysine, N',N'-dibenzyl-lysine, 6-hydroxylysine, ornithine, α-aminocyclopentane carboxylic acid, α-aminocyclohexane carboxylic acid, α- aminocycloheptane carboxylic acid, α-(2-amino-2-norbornane)-carboxylic acid, α,γ- diaminobutyric acid, α,β-diaminopropionic acid, homophenylalanine, and α-tert- butylglycine.

[0066] The ESFs of the invention (including functional portions and functional variants) can be, for example, glycosylated, amidated, carboxylated, phosphorylated, esterified, N- acylated, cyclized via, e.g., a disulfide bridge, or converted into an acid addition salt and/or optionally dimerized or polymerized, or conjugated.

[0067] When the ESFs of the invention (including functional portions and functional variants) are in the form of a salt, the polypeptides may be in the form of a pharmaceutically acceptable salt. Suitable pharmaceutically acceptable acid addition salts include those derived from mineral acids, such as hydrochloric, hydrobromic, phosphoric, metaphosphoric, nitric, and sulphuric acids, and organic acids, such as tartaric, acetic, citric, malic, lactic, fumaric, benzoic, glycolic, gluconic, succinic, and arylsulphonic acids, for example, p- toluenesulphonic acid.

[0068] The ESFs of the invention (including functional portions and functional variants thereof) can be obtained by methods known in the art. Suitable methods of de novo synthesizing polypeptides and proteins are described in references, such as Chan et al., Fmoc Solid Phase Peptide Synthesis, Oxford University Press, Oxford, United Kingdom, 2005; Peptide and Protein Drug Analysis, ed. Reid, R., Marcel Dekker, Inc., 2000; Epitope Mapping, ed. Westwood et al., Oxford University Press, Oxford, United Kingdom, 2000; and U.S. Patent No. 5,449,752. Also, polypeptides and proteins can be recombinantly produced using the nucleic acids described herein using standard recombinant methods. See, for instance, Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Press, Cold Spring Harbor, NY 2001; and Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates and John Wiley & Sons, NY, 1994. Further, some of the ESFs of the invention (including functional portions and functional variants thereof) can be isolated and/or purified from a source, such as a plant, a bacterium, an insect, a mammal, e.g., a rat, a human, etc. Methods of isolation and purification are well- known in the art. Alternatively, the ESFs described herein (including functional portions and functional variants thereof) can be commercially synthesized by companies, such as Synpep (Dublin, CA), Peptide Technologies Corp. (Gaithersburg, MD), and Multiple Peptide Systems (San Diego, CA). In this respect, the inventive ESFs can be synthetic, recombinant, isolated, and/or purified. [0069] The invention further provides an antibody, or antigen binding portion thereof, which specifically binds to an epitope of the ESF of the invention. The antibody can be any type of immunoglobulin that is known in the art. For instance, the antibody can be of any isotype, e.g., IgA, IgD, IgE, IgG, IgM, etc. The antibody can be monoclonal or polyclonal. The antibody can be a naturally-occurring antibody, e.g., an antibody isolated and/or purified from a mammal, e.g., mouse, rabbit, goat, horse, chicken, hamster, human, etc. Alternatively, the antibody can be a genetically- engineered antibody, e.g., a humanized antibody or a chimeric antibody. The antibody can be in monomelic or polymeric form. Also, the antibody can have any level of affinity or avidity for the functional portion of the inventive ESF.

[0070] Methods of testing antibodies for the ability to bind to any functional portion of the inventive ESF are known in the art and include any antibody-antigen binding assay, such as, for example, radioimmunoassay (RIA), ELISA, Western blot, immunoprecipitation, and competitive inhibition assays (see, e.g., Janeway et al., infra, and U.S. Patent Application Publication No. 2002/0197266 Al).

[0071] Suitable methods of making antibodies are known in the art. For instance, standard hybridoma methods are described in, e.g., Kδhler and Milstein, Eur. J. Immunol., 5, 511-519 (1976), Harlow and Lane (eds.), Antibodies: A Laboratory Manual, CSH Press (1988), and CA. Janeway et al. (eds.), Immunobiology, 5th Ed., Garland Publishing, New York, NY (2001)). Alternatively, other methods, such as EBV-hybridoma methods (Haskard and Archer, J. Immunol. Methods, 74(2), 361-67 (1984), and Roder et al., Methods Enzymol., 121, 140-67 (1986)), and bacteriophage vector expression systems (see, e.g., Huse et al., Science, 246, 1275-81 (1989)) are known in the art. Further, methods of producing antibodies in non-human animals are described in, e.g., U.S. Patents 5,545,806, 5,569,825, and 5,714,352, and U.S. Patent Application Publication No. 2002/0197266 Al). [0072] Phage display furthermore can be used to generate the antibody of the invention. In this regard, phage libraries encoding antigen-binding variable (V) domains of antibodies can be generated using standard molecular biology and recombinant DNA techniques (see, e.g., Sambrook et al. (eds.), Molecular Cloning, A Laboratory Manual, 3rd Edition, Cold Spring Harbor Laboratory Press, New York (2001)). Phage encoding a variable region with the desired specificity are selected for specific binding to the desired antigen, and a complete or partial antibody is reconstituted comprising the selected variable domain. Nucleic acid sequences encoding the reconstituted antibody are introduced into a suitable cell line, such as a myeloma cell used for hybridoma production, such that antibodies having the characteristics of monoclonal antibodies are secreted by the cell (see, e.g., Janeway et al., supra, Huse et al., supra, and U.S. Patent 6,265,150).

[0073] Antibodies can be produced by transgenic mice that are transgenic for specific heavy and light chain immunoglobulin genes. Such methods are known in the art and described in, for example U.S. Patents 5,545,806 and 5,569,825, and Janeway et al., supra. [0074] Methods for generating humanized antibodies are well known in the art and are described in detail in, for example, Janeway et al., supra, U.S. Patents 5,225,539, 5,585,089 and 5,693,761, European Patent No. 0239400 Bl, and United Kingdom Patent No. 2188638. Humanized antibodies can also be generated using the antibody resurfacing technology described in U.S. Patent 5,639,641 and Pedersen et al., J. MoL Biol, 235, 959-973 (1994). [0075] The invention also provides antigen binding portions of any of the antibodies described herein. The antigen binding portion can be any portion that has at least one antigen binding site, such as Fab, F(ab')2, dsFv, sFv, diabodies, and triabodies. [0076] A single-chain variable region fragment (sFv) antibody fragment, which consists of a truncated Fab fragment comprising the variable (V) domain of an antibody heavy chain linked to a V domain of a light antibody chain via a synthetic peptide, can be generated using routine recombinant DNA technology techniques (see, e.g., Janeway et al., supra). Similarly, disulfide-stabilized variable region fragments (dsFv) can be prepared by recombinant DNA technology (see, e.g., Reiter et al., Protein Engineering, 7, 697-704 (1994)). Antibody fragments of the invention, however, are not limited to these exemplary types of antibody fragments.

[0077] Also, the antibody, or antigen binding portion thereof, can be modified to comprise a detectable label, such as, for instance, a radioisotope, a fluorophore (e.g., fluorescein isothiocyanate (FITC), phycoerythrin (PE)), an enzyme (e.g., alkaline phosphatase, horseradish peroxidase), and element particles (e.g., gold particles). [0078] Further provided by the invention is a nucleic acid comprising a nucleotide sequence encoding any of the ESFs described herein (including functional portions and functional variants thereof).

[0079] By "nucleic acid" as used herein includes "polynucleotide," "oligonucleotide," and "nucleic acid molecule," and generally means a polymer of DNA or RNA, which can be single-stranded or double-stranded, synthesized or obtained (e.g., isolated and/or purified) from natural sources, which can contain natural, non-natural or altered nucleotides, and which can contain a natural, non-natural or altered internucleotide linkage, such as a phosphoroamidate linkage or a phosphorothioate linkage, instead of the phosphodiester found between the nucleotides of an unmodified oligonucleotide. It is generally preferred that the nucleic acid does not comprise any insertions, deletions, inversions, and/or substitutions. However, it may be suitable in some instances, as discussed herein, for the nucleic acid to comprise one or more insertions, deletions, inversions, and/or substitutions. [0080] The nucleic acids of the invention may be recombinant. As used herein, the term "recombinant" refers to (i) molecules that are constructed outside living cells by joining natural or synthetic nucleic acid segments to nucleic acid molecules that can replicate in a living cell, or (ii) molecules that result from the replication of those described in (i) above. For purposes herein, the replication can be in vitro replication or in vivo replication. [0081] A recombinant nucleic acid may be one that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination is often accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques, such as those described in Sambrook et al., supra.

[0082] The nucleic acids can be constructed based on chemical synthesis and/or enzymatic ligation reactions using procedures known in the art. See, for example, Sambrook et al., supra, and Ausubel et al., supra. For example, a nucleic acid can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed upon hybridization (e.g., phosphorothioate derivatives and acridine substituted nucleotides). Examples of modified nucleotides that can be used to generate the nucleic acids include, but are not limited to, 5-fluorouracil, 5-bromouracil, 5-chlorouracil. 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl) uracil, 5- carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1 -methylguanine, 1 -methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3 -methyl cytosine, 5-methylcytosine, Nό-substituted adenine, 7-methylguanine, 5 -methyl aminomethyluracil, 5- methoxyaminornethyl-2-thiouracil, beta-D-mannosylqueosine, 5'- methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil- 5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2- thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil- 5 -oxyacetic acid methylester, 3- (3 -amino- 3 -N-2-carboxy propyl) uracil, and 2,6-diaminopurine. Alternatively, one or more of the nucleic acids of the invention can be purchased from companies, such as Macromolecular Resources (Fort Collins, CO) and Synthegen (Houston, TX).

[0083] The nucleic acid can comprise any isolated or purified nucleotide sequence which encodes any of the ESFs, or functional portions or functional variants thereof. Alternatively, the nucleotide sequence can comprise a nucleotide sequence which is degenerate to any of the sequences or a combination of degenerate sequences.

[0084] The invention also provides an isolated or purified nucleic acid comprising a nucleotide sequence which is complementary to the nucleotide sequence of any of the nucleic acids described herein or a nucleotide sequence which hybridizes under stringent conditions to the nucleotide sequence of any of the nucleic acids described herein. [0085] The nucleotide sequence which hybridizes under stringent conditions may hybridize under high stringency conditions. By "high stringency conditions" is meant that the nucleotide sequence specifically hybridizes to a target sequence (the nucleotide sequence of any of the nucleic acids described herein) in an amount that is detectably stronger than non-specific hybridization. High stringency conditions include conditions which would distinguish a polynucleotide with an exact complementary sequence, or one containing only a few scattered mismatches from a random sequence that happened to have a few small regions (e.g., 3-10 bases) that matched the nucleotide sequence. Such small regions of complementarity are more easily melted than a full-length complement of 14-17 or more bases, and high stringency hybridization makes them easily distinguishable. Relatively high stringency conditions would include, for example, low salt and/or high temperature conditions, such as provided by about 0.02-0.1 M NaCl or the equivalent, at temperatures of about 50-70 ⁰C. Such high stringency conditions tolerate little, if any, mismatch between the nucleotide sequence and the template or target strand, and are particularly suitable for detecting expression of any of the inventive ESFs. It is generally appreciated that conditions can be rendered more stringent by the addition of increasing amounts of formamide. [0086] The nucleic acids of the invention can be incorporated into a recombinant expression vector. In this regard, the invention provides recombinant expression vectors comprising any of the nucleic acids of the invention. For purposes herein, the term "recombinant expression vector" means a genetically-modified oligonucleotide or polynucleotide construct that permits the expression of an mRNA, protein, polypeptide, or peptide by a host cell, when the construct comprises a nucleotide sequence encoding the mRNA, protein, polypeptide, or peptide, and the vector is contacted with the cell under conditions sufficient to have the mRNA, protein, polypeptide, or peptide expressed within the cell. The vectors of the invention are not naturally-occurring as a whole. However, parts of the vectors can be naturally-occurring. The inventive recombinant expression vectors can comprise any type of nucleotides, including, but not limited to DNA and RNA, which can be single- stranded or double-stranded, synthesized or obtained in part from natural sources, and which can contain natural, non-natural or altered nucleotides. The recombinant expression vectors can comprise naturally-occurring, non-naturally-occurring internucleotide linkages, or both types of linkages. Preferably, the non-naturally occurring or altered nucleotides or internucleotide linkages does not hinder the transcription or replication of the vector. [0087] The recombinant expression vector of the invention can be any suitable recombinant expression vector, and can be used to transform or transfect any suitable host. Suitable vectors include those designed for propagation and expansion or for expression or both, such as plasmids and viruses. The vector can be selected from the group consisting of the pUC series (Fermentas Life Sciences, Glen Burnie, MD), the pBluescript series (Stratagene, LaJolla, CA), the pET series (Novagen, Madison, WI), the pGEX series (Pharmacia Biotech, Uppsala, Sweden), and the pEX series (Clontech, Palo Alto, CA). Bacteriophage vectors, such as λGTIO, λGTl 1, λZapII (Stratagene), λEMBL4, and λNMl 149, also can be used. Examples of plant expression vectors include pBIOl, pBI101.2, pBI101.3, pBI121 and pBIN19 (Clontech). Examples of animal expression vectors include pEUK-Cl, pMAM and pMAMneo (Clontech). The recombinant expression vector may be a viral vector, e.g., a retroviral vector.

[0088] The recombinant expression vectors of the invention can be prepared using standard recombinant DNA techniques described in, for example, Sambrook et al., supra, and Ausubel et al., supra. Constructs of expression vectors, which are circular or linear, can be prepared to contain a replication system functional in a prokaryotic or eukaryotic host cell. Replication systems can be derived, e.g., from CoIEl, 2 μ plasmid, λ, SV40, bovine papilloma virus, and the like.

[0089] The recombinant expression vector may comprise regulatory sequences, such as transcription and translation initiation and termination codons, which are specific to the type of host (e.g., bacterium, fungus, plant, or animal) into which the vector is to be introduced, as appropriate, and taking into consideration whether the vector is DNA- or RNA-based, [0090] The recombinant expression vector can include one or more marker genes, which allow for selection of transformed or transfected hosts. Marker genes include biocide resistance, e.g., resistance to antibiotics, heavy metals, etc., complementation in an auxotrophic host to provide prototrophy, and the like. Suitable marker genes for the inventive expression vectors include, for instance, neomycin/G418 resistance genes, hygromycin resistance genes, histidinol resistance genes, tetracycline resistance genes, and ampicillin resistance genes.

[0091] The recombinant expression vector can comprise a native or nonnative promoter operably linked to the nucleotide sequence encoding the ESF (including functional portions and functional variants thereof), or to the nucleotide sequence which is complementary to or which hybridizes to the nucleotide sequence encoding the ESF. The selection of promoters, e.g., strong, weak, inducible, tissue-specific and developmental-specific, is within the ordinary skill of the artisan. Similarly, the combining of a nucleotide sequence with a promoter is also within the skill of the artisan. The promoter can be a non- viral promoter or a viral promoter, e.g., a cytomegalovirus (CMV) promoter, an SV40 promoter, an RSV promoter, and a promoter found in the long-terminal repeat of the murine stem cell virus. [0092] The inventive recombinant expression vectors can be designed for either transient expression, for stable expression, or for both. Also, the recombinant expression vectors can be made for constitutive expression or for inducible expression.

[0093] Further, the recombinant expression vectors can be made to include a suicide gene. As used herein, the term "suicide gene" refers to a gene that causes the cell expressing the suicide gene to die. The suicide gene can be a gene that confers sensitivity to an agent, e.g., a drug, upon the cell in which the gene is expressed, and causes the cell to die when the cell is contacted with or exposed to the agent. Suicide genes are known in the art (see, for example, Suicide Gene Therapy: Methods and Reviews, Springer, Caroline J. (Cancer Research UK Centre for Cancer Therapeutics at the Institute of Cancer Research, Sutton, Surrey, UK), Humana Press, 2004) and include, for example, the Herpes Simplex Virus (HSV) thymidine kinase (TK) gene, cytosine daminase, purine nucleoside phosphorylase, and nitroreductase.

[0094] Included in the scope of the invention are conjugates, e.g., bioconjugates, comprising any of the inventive ESFs (including any of the functional portions or variants thereof), nucleic acids, recombinant expression vectors, host cells, populations of host cells, or antibodies, or antigen binding portions thereof. Conjugates, as well as methods of synthesizing conjugates in general, are known in the art (See, for instance, Hudecz, F., Methods MoI. Biol. 298: 209-223 (2005) and Kirin et al., Inorg Chem. 44(15): 5405-5415 (2005)).

[0095] The invention further provides a host cell comprising any of the recombinant expression vectors described herein. As used herein, the term "host cell" refers to any type of cell that can contain the inventive recombinant expression vector. The host cell can be a eukaryotic cell, e.g., plant, animal, fungi, or algae, or can be a prokaryotic cell, e.g., bacteria or protozoa. The host cell can be a cultured cell or a primary cell, i.e., isolated directly from an organism, e.g., a human. The host cell can be an adherent cell or a suspended cell, i.e., a cell that grows in suspension. Suitable host cells are known in the art and include, for instance, DH5α E, coli cells, Chinese hamster ovarian (CHO) cells, monkey VERO cells, COS cells, HEK293 cells, and the like. For purposes of amplifying or replicating the recombinant expression vector, the host cell may be a prokaryotic cell, e.g., a DH5α cell. For purposes of producing a recombinant ESF, the host cell may be a mammalian cell. The host cell may be a human cell.

[0096] Also provided by the invention is a population of cells comprising at least one host cell described herein. The population of cells can be a heterogeneous population comprising the host cell comprising any of the recombinant expression vectors described, in addition to at least one other cell, e.g., a host cell which does not comprise any of the recombinant expression vectors, or another cell, e.g., a B cell, a macrophage, a neutrophil, an erythrocyte, a hepatocyte, an endothelial cell, an epithelial cells, a muscle cell, a brain cell, etc. Alternatively, the population of cells can be a substantially homogeneous population, in which the population comprises mainly of host cells (e.g., consisting essentially of) comprising the recombinant expression vector. The population also can be a clonal population of cells, in which all cells of the population are clones of a single host cell comprising a recombinant expression vector, such that all cells of the population comprise the recombinant expression vector. In one embodiment of the invention, the population of cells is a clonal population comprising host cells comprising a recombinant expression vector as described herein.

[0097] The inventive ESFs (including functional portions and variants thereof), nucleic acids, recombinant expression vectors, and host cells (including populations thereof), all of which are collectively referred to as "inventive ESF materials" hereinafter, can be isolated and/or purified. The term "isolated" as used herein means having been removed from its natural environment. The term "purified" or "isolated" does not require absolute purity or isolation; rather, it is intended as a relative term. Thus, for example, a purified (or isolated) protein preparation is one in which the protein is more pure than the protein in its natural environment within a cell. Such proteins may be produced, for example, by standard purification techniques, or by recombinant expression. In some embodiments, a preparation of a protein is purified such that the protein represents at least 50%, for example at least 70%, of the total protein content of the preparation. For example, the purity can be at least about 50%, can be greater than about 60%, about 70% or about 80%, or can be about 100%. [0098] The inventive ESF materials can be formulated into a composition, such as a pharmaceutical composition. In this regard, the invention provides a pharmaceutical composition comprising any of the ESFs, polypeptides, proteins, functional portions, functional variants, nucleic acids, expression vectors, and host cells (including populations thereof) and a pharmaceutically acceptable carrier. The inventive pharmaceutical compositions may contain stabilizing agents. The ESFs of the invention may be stabilized by, for example, reducing agents (DTT, beta-mercaptoethanol, TCEP), glycerol, or higher NaCl. The inventive pharmaceutical compositions containing any of the inventive ESF materials can comprise more than one inventive ESF material, e.g., a polypeptide and a nucleic acid, or two or more different ESFs. Alternatively, the pharmaceutical composition can comprise an inventive ESF material in combination with another pharmaceutically active agents or drugs, such as a chemotherapeutic agents, e.g., asparaginase, busulfan, carboplatin, cisplatin, daunorubicin, doxorubicin, fluorouracil, gemcitabine, hydroxyurea, methotrexate, paclitaxel, rituximab, vinblastine, vincristine, etc.

[0099] With respect to pharmaceutical compositions, the pharamaceutically acceptable carrier can be any of those conventionally used and is limited only by chemico-physical considerations, such as solubility and lack of reactivity with the active(s), and by the route of administration. The pharmaceutically acceptable carriers described herein, for example, vehicles, adjuvants, excipients, and diluents, are well-known to those skilled in the art and are readily available to the public. It is preferred that the pharmaceutically acceptable carrier be one which is chemically inert to the active agent(s) and one which has no detrimental side effects or toxicity under the conditions of use.

[0100] The choice of carrier will be determined in part by the particular inventive ESF material, as well as by the particular method used to administer the inventive ESF material. Accordingly, there are a variety of suitable formulations of the pharmaceutical composition of the invention.

[0101] Preservatives may be used. Suitable preservatives may include, for example, methylparaben, propylparaben, sodium benzoate, and benzalkonium chloride. A mixture of two or more preservatives optionally may be used. The preservative or mixtures thereof are typically present in an amount of about 0.0001% to about 2% by weight of the total composition.

[0102] Suitable buffering agents may include, for example, citric acid, sodium citrate, phosphoric acid, potassium phosphate, and various other acids and salts. A mixture of two or more buffering agents optionally may be used. The buffering agent or mixtures thereof are typically present in an amount of about 0.001% to about 4% by weight of the total composition.

[0103] The concentration of inventive ESFs in the pharmaceutical formulations can vary, e.g., from less than about 1%, usually at or at least about 10%, to as much as 20% to 50% or more by weight, and can be selected primarily by fluid volumes, and viscosities, in accordance with the particular mode of administration selected. [0104] Methods for preparing administrable (e.g., parenterally administrable) compositions are known or apparent to those skilled in the art and are described in more detail in, for example, Remington: The Science and Practice of Pharmacy, Lippincott Williams & Wilkins; 21st ed. (May 1, 2005).

[0105] An "effective amount" refers to a dose that is adequate to prevent or treat a disease or disorder in an individual. Amounts effective for a therapeutic or prophylactic use will depend on, for example, the stage and severity of the disease or disorder being treated, the age, weight, and general state of health of the patient, and the judgment of the prescribing physician. The size of the dose will also be determined by the active selected, method of administration, timing and frequency of administration as well as the existence, nature, and extent of any adverse side-effects that might accompany the administration of a particular active and the desired physiological effect. It will be appreciated by one of skill in the art that various diseases or disorders could require prolonged treatment involving multiple administrations, perhaps using the inventive ESF materials in each or various rounds of administration.

[0106] The following formulations for oral, aerosol, parenteral (e.g., subcutaneous, intravenous, intraarterial, intramuscular, intradermal, interperitoneal, and intrathecal), and rectal administration are merely exemplary and are in no way limiting. More than one route can be used to administer the inventive ESF materials, and in certain instances, a particular route can provide a more immediate and more effective response than another route. [0107] Formulations suitable for oral administration can consist of (a) liquid solutions, such as an effective amount of the inventive ESF material dissolved in diluents, such as water, saline, or orange juice; (b) capsules, sachets, tablets, lozenges, and troches, each containing a predetermined amount of the active ingredient, as solids or granules; (c) powders; (d) suspensions in an appropriate liquid; and (e) suitable emulsions. Liquid formulations may include diluents, such as water and alcohols, for example, ethanol, benzyl alcohol, and the polyethylene alcohols, either with or without the addition of a pharmaceutically acceptable surfactant. Capsule forms can be of the ordinary hard or soft shelled gelatin type containing, for example, surfactants, lubricants, and inert fillers, such as lactose, sucrose, calcium phosphate, and corn starch. Tablet forms can include one or more of lactose, sucrose, mannitoi, corn starch, potato starch, alginic acid, microcrystalline cellulose, acacia, gelatin, guar gum, colloidal silicon dioxide, croscarmellose sodium, talc, magnesium stearate, calcium stearate, zinc stearate, stearic acid, and other excipients, colorants, diluents, buffering agents, disintegrating agents, moistening agents, preservatives, flavoring agents, and other pharmacologically compatible excipients. Lozenge forms can comprise the inventive ESF material in a flavor, usually sucrose and acacia or tragacanth, as well as pastilles comprising the inventive ESF material in an inert base, such as gelatin and glycerin, or sucrose and acacia, emulsions, gels, and the like containing, in addition to, such excipients as are known in the art.

[0108] Formulations suitable for parenteral administration include aqueous and non-aqueous isotonic sterile injection solutions, which can contain anti oxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and preservatives. The inventive ESF material can be administered in a physiologically acceptable diluent in a pharmaceutical carrier, such as a sterile liquid or mixture of liquids, including water, saline, aqueous dextrose and related sugar solutions, an alcohol, such as ethanol or hexadecyl alcohol, a glycol, such as propylene glycol or polyethylene glycol, dimethylsulfoxide, glycerol, ketals such as 2,2- dimethyl-l,3-dioxolane-4-methanol, ethers, poly(ethyleneglycol) 400, oils, fatty acids, fatty acid esters or glycerides, or acetylated fatty acid glycerides with or without the addition of a pharmaceutically acceptable surfactant, such as a soap or a detergent, suspending agent, such as pectin, carbomers, methylcellulose, hydroxypropylmethylcellulose, or carboxymethylcellulose, or emulsifying agents and other pharmaceutical adjuvants. [0109] Oils, which can be used in parenteral formulations include petroleum, animal, vegetable, or synthetic oils. Specific examples of oils include peanut, soybean, sesame, cottonseed, corn, olive, petrolatum, and mineral. Suitable fatty acids for use in parenteral formulations include oleic acid, stearic acid, and isostearic acid. Ethyl oleate and isopropyl myristate are examples of suitable fatty acid esters.

[0110] Suitable soaps for use in parenteral formulations include, for example, fatty alkali metal, ammonium, and triethanolamine salts, and suitable detergents include (a) cationic detergents such as, for example, dimethyl dialkyl ammonium halides, and alkyl pyridinium halides, (b) anionic detergents such as, for example, alkyl, aryl, and olefin sulfonates, alkyl, olefin, ether, and monoglyceride sulfates, and sulfosuccinates, (c) nonionic detergents such as, for example, fatty amine oxides, fatty acid alkanolamides, and polyoxyethylenepolypropylene copolymers, (d) amphoteric detergents such as, for example, alkyl-β-aminopropionates, and 2-alkyl-imidazoline quaternary ammonium salts, and (e) mixtures thereof.

[0111] The parenteral formulations will typically contain from about 0.5% to about 25% by weight of the inventive ESF material in solution. Preservatives and buffers may be used. In order to minimize or eliminate irritation at the site of injection, such compositions may contain one or more nonionic surfactants, for example, having a hydrophile-lipophile balance (HLB) of from about 12 to about 17. The quantity of surfactant in such formulations will typically range from about 5% to about 15% by weight. Suitable surfactants include polyethylene glycol sorbitan fatty acid esters, such as sorbitan monooleate and the high molecular weight adducts of ethylene oxide with a hydrophobic base, formed by the condensation of propylene oxide with propylene glycol. The parenteral formulations can be presented in unit-dose or multi-dose sealed containers, such as ampoules and vials, and can be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid excipient, for example, water, for injections, immediately prior to use. Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules, and tablets of the kind previously described.

[0112] Injectable formulations are in accordance with the invention. The requirements for effective pharmaceutical carriers for injectable compositions are well-known to those of ordinary skill in the art (see, e.g., Pharmaceutics and Pharmacy Practice, J.B. Lippincott Company, Philadelphia, PA, Banker and Chalmers, eds., pages 238-250 (1982), and ASHP Handbook on Injectable Drugs, Toissel, 4th ed., pages 622-630 (1986)), [0113] In addition to the aforedescribed pharmaceutical compositions, the inventive ESFs materials can be formulated as, for example, inclusion complexes, such as cyclodextrin inclusion complexes, or liposomes. Liposomes can serve to target the inventive ESF materials to a particular tissue. Liposomes also can be used to increase the half-life of the inventive ESF materials. Many methods are available for preparing liposomes, as described in, for example, Szoka et al., Ann. Rev. Biophys. Bioeng., 9, 467 (1980) and U.S. Patents 4,235,871, 4,501,728, 4,837,028, and 5,019,369.

[0114] The delivery systems useful in the context of embodiments of the invention may include time-released, delayed release, and sustained release delivery systems such that the delivery of the inventive composition occurs prior to, and with sufficient time to cause, sensitization of the site to be treated. The inventive composition can be used in conjunction with other therapeutic agents or therapies. Such systems can avoid repeated administrations of the inventive composition, thereby increasing convenience to the subject and the physician, and may be particularly suitable for certain composition embodiments of the invention.

[0115] Many types of release delivery systems are available and known to those of ordinary skill in the art. They include polymer base systems such as poly(lactide-glycolide), copolyoxalates, polycaprolactones, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and polyanhydrides. Microcapsules of the foregoing polymers containing drugs are described in, for example, U.S. Patent 5,075,109. Delivery systems also include non-polymer systems that are lipids including sterols such as cholesterol, cholesterol esters, and fatty acids or neutral fats such as mono-di-and tri-glycerides; hydrogel release systems; sylastic systems; peptide based systems; wax coatings; compressed tablets using conventional binders and excipients; partially fused implants; and the like. Specific examples include, but are not limited to: (a) erosional systems in which the active composition is contained in a form within a matrix such as those described in U.S. Patents 4,452,775, 4,667,014, 4,748,034, and 5,239,660 and (b) diffusional systems in which an active component permeates at a controlled rate from a polymer such as described in U.S. Patents 3,832,253 and 3,854,480. In addition, pump-based hardware delivery systems can be used, some of which are adapted for implantation. [0116] A number of transfection techniques are generally known in the art (see, e.g., Graham et al., Virology, 52: 456-467 (1973); Sambrook et al., supra; Davis et al., Basic Methods in Molecular Biology, Elsevier (1986); and Chu et al., Gene, 13: 97 (1981). Transfection methods include calcium phosphate co precipitation (see, e.g., Graham et al., supra), direct micro injection into cultured cells (see, e.g., Capecchi, Cell, 22: 479-488 (1980)), electroporation (see, e.g., Shigekawa et al., BioTechniques, 6: 742-751 (1988)), liposome mediated gene transfer (see, e.g., Mannino et al., BioTechniques, 6: 682-690 (1988)), lipid mediated transduction (see, e.g., Feigner et al., Proc. Natl. Acad. Sci. USA, 84: 7413-7417 (1987)), and nucleic acid delivery using high velocity microprojectiles (see, e.g., Klein et al. Nature, 327: 70-73 (1987)).

[0117] One of ordinary skill in the art will readily appreciate that the inventive ESF materials of the invention can be modified in any number of ways, such that the therapeutic or prophylactic efficacy of the inventive ESF materials is increased through the modification. For instance, the inventive ESF materials can be conjugated either directly or indirectly through a linker to a targeting moiety. The practice of conjugating compounds, e.g., inventive ESF materials, to targeting moieties is known in the art. See, for instance, Wadwa et al., J. Drug Targeting 3: 1 11 (1995) and U.S. Patent No. 5,087,616. The term "targeting moiety" as used herein, refers to any molecule or agent that specifically directs the ESF to a particular location. Targeting moieties include, but are not limited to, antibodies, or fragments thereof, peptides (such as a nuclear localization sequence, NLS, which may be, e.g., incorporated in to the sequence of a fusion protein), hormones, growth factors, and cytokines. The term "linker" as used herein, refers to any agent or molecule that bridges the inventive ESF materials to the targeting moiety. One of ordinary skill in the art recognizes that sites on the inventive ESF materials, which are not necessary for the function of the inventive ESF materials, are ideal sites for attaching a linker and/or a targeting moiety, provided that the linker and/or targeting moiety, once attached to the inventive ESF materials, do(es) not interfere with the function of the inventive ESF materials, i.e., the ability to bind to RNA.

[0118] Alternatively, the inventive ESF materials can be modified into a depot form, such that the manner in which the inventive ESF materials is released into the body to which it is administered is controlled with respect to time and location within the body (see, for example, U.S. Patent No. 4,450,150). Depot forms of inventive ESF materials can be, for example, an implantable composition comprising the inventive ESF materials and a porous or non-porous material, such as a polymer, wherein the inventive ESF materials is encapsulated by or diffused throughout the material and/or degradation of the non-porous material. The depot is then implanted into the desired location within the body and the inventive ESF materials are released from the implant at a predetermined rate.

[0119] For purposes of the invention, the amount or dose of the inventive ESF material administered should be sufficient to effect, e.g., a therapeutic or prophylactic response, in the subject or animal over a reasonable time frame. For example, the dose of the inventive ESF material should be sufficient to bind to antigen, or detect, treat or prevent disease in a period of from about 2 hours or longer, e.g., 12 to 24 or more hours, from the time of administration. In certain embodiments, the time period could be even longer. The dose will be determined by the efficacy of the particular inventive ESF material and the condition of the animal (e.g., human), as well as the body weight of the animal (e.g., human) to be treated. [0120] The dose of the inventive ESF material also will be determined by the existence, nature and extent of any adverse side effects that might accompany the administration of a particular inventive ESF material. Typically, the attending physician will decide the dosage of the inventive ESF material with which to treat each individual patient, taking into consideration a variety of factors, such as age, body weight, general health, diet, sex, inventive ESF material to be administered, route of administration, and the severity of the condition being treated. By way of example and not intending to limit the invention, the dose of the inventive ESF material can be about 0.001 to about 1000 mg/kg body weight of the subject being treated/day, from about 0.01 to about 10 mg/kg body weight/day, about 0,01 mg to about 1 mg/kg body weight/day.

[0121] When the inventive ESF materials are administered with one or more additional therapeutic agents, one or more additional therapeutic agents can be coadministered to the mammal. By "coadministering" is meant administering one or more additional therapeutic agents and the inventive ESF materials sufficiently close in time such that the inventive ESF materials can enhance the effect of one or more additional therapeutic agents. In this regard, the inventive ESF materials can be administered first and the one or more additional therapeutic agents can be administered second, or vice versa. Alternatively, the inventive ESF materials and the one or more additional therapeutic agents can be administered simultaneously. [0122] For purposes of the inventive methods, wherein host cells or populations of cells are administered to the host, the cells can be cells that are allogeneic or autologous to the host. The cells may be autologous to the host.

[0123] It is contemplated that the inventive pharmaceutical compositions, ESFs, polypeptides, proteins, nucleic acids, recombinant expression vectors, host cells, or populations of cells can be used in methods of treating or preventing a disease in a host. Without being bound to a particular theory, the inventive ESFs have biological activity, e.g., ability to recognize RNA and inhibit or promote RNA processing. In this regard, the invention provides a method of treating or preventing a disease in a host, comprising administering to the host any of the pharmaceutical compositions in an amount effective to treat or prevent the disease in the host. The disease may be any disease due to aberrant splicing of RNA, such as cancer.

[0124] The terms "treat," and "prevent" as well as words stemming therefrom, as used herein, do not necessarily imply 100% or complete treatment or prevention. Rather, there are varying degrees of treatment or prevention of which one of ordinary skill in the art recognizes as having a potential benefit or therapeutic effect. In this respect, the inventive methods can provide any amount of any level of treatment or prevention of cancer in a mammal. Furthermore, the treatment or prevention provided by the inventive method can include treatment or prevention of one or more conditions or symptoms of the disease, e.g., cancer, being treated or prevented. Also, for purposes herein, "prevention" can encompass delaying the onset of the disease, or a symptom or condition thereof.

[0125] Diseases associated with RNA processing include those where improper RNA splicing occurs, for example where exons are improperly included or removed. Such diseases include cervical cancer, lung cancer, and breast cancer. As shown in the Examples below, the ESFs of the present invention alter the splicing of cells associated with these diseases and generate apoptotic signals.

[0126] A biopsy is the removal of tissue and/or cells from an individual. Such removal may be to collect tissue and/or cells from the individual in order to perform experimentation on the removed tissue and/or cells. This experimentation may include experiments to determine if the individual has and/or is suffering from a certain condition or disease-state. The condition or disease may be, e.g., cancer.

[0127] With respect to the inventive method of detecting a diseased cell in a host, the sample comprising cells of the host can be a sample comprising whole cells, lysates thereof, or a fraction of the whole cell lysates, e.g., a nuclear or cytoplasmic fraction, a whole protein fraction, or a nucleic acid fraction. If the sample comprises whole cells, the cells can be any cells of the host, e.g., the cells of any organ or tissue, including blood cells. [0128] For purposes of the inventive detecting method, the contacting step can take place in vitro or in vivo with respect to the host. The contacting may be in vitro. [0129] The invention also provides a method of detecting the RNA processing capability of a test molecule comprising attaching the test molecule to a PUF domain of any of SEQ ID NOS: 1-7, contacting the attached test molecule with a RNA molecule that is recognized by the PUF domain, and detecting the RNA processing of the RNA molecule, wherein the RNA processing of the RNA molecule detects the RNA processing capability of the test molecule. [0130] A test molecule can be any molecule suspected of interacting with RNA, for example, a protein domain of a protein. The interaction can involve alternative splicing of the RNA or any other RNA processing, including polyadenylation or RNA degradation. The inventive ESFs provide a new approach to study the activities of natural splicing factors by, for example, specifically recruiting different protein domains to certain regions of pre- mRNAs. Compared to conventional tethering experiments using the MS2 coat protein or lambda N-B box systems, the inventive ESFs can recognize the pre-mRNA in a natural context without introducing foreign RNA and are thus more advantageous for in vivo applications.

[0131] Also, detection of the RNA processing can occur through any number of ways known in the art. Detection may occur through the RNA methods described in the Examples below.

[0132] The following examples further illustrate the invention but, of course, should not be construed as in any way limiting its scope.

EXAMPLE 1

[0133] This example demonstrates the affinities of several PUF domains for binding RNA.

[0134] Electrophoretic mobility shift assays (EMSAs): The generated recombinant proteins were expressed and purified as described previously (Cheong and Hall, Proc. Natl. Acad. Sci. USA, 2006, 103: 13635-13639). RNA oligonucleotides were obtained from Dharmacon, Inc. (Lafayette, CO) and radiolabeled at the 5' end by using [γ-³²P]-ATP (PerkinElmer Life Sciences, Waltham, MA) and T4 polynucleotide kinase (New England BioLabs, Ipswich, MA) following manufacturer directions. The radiolabeled RNAs were purified on 20% polyacrylamide gels (Invitrogen, Carlsbad, CA) run with IX Tris-Borate- EDTA buffer (89 mM Tris, 89 mM boric acid, 2.5 mM EDTA, pH 8.3) at room temperature. Binding reactions included radiolabeled RNA (-15 pM for NRE (5'-

CCAGAAUUGUAUAUAUUCG-3'; SEQ ID NO: 17), and -15 pM or 100 pM for A6G (5^!- CCAGAAUUGUAUGUAUUCG-3'; SEQ ID NO: 18) and GU/UG (5'- CCCAGAUUUGAUAUAUUCG-3'; SEQ ID NO: 19) RNAs and 1-2 pM for Bcl-x RNA ((S'-CCAGAAUUGUGCGUGUUCG-S'; SEQ ID NO: 20)) and varying concentrations of protein incubated in binding buffer (10 mM Hepes, pH 7.4, 50 mM KCl, 1 mM EDTA, 0.01% (v/v) Tween-20, 0.1 mg/ml BSA, 1 mM DTT). Binding reactions were incubated for 1-2 h at room temperature and immediately analyzed by electrophoresis on 6% nondenaturing polyacrylamide gels (Invitrogen). Gels were dried and exposed to storage phosphor screens (GE Healthcare, Piscataway, NJ), scanned with a Typhoon 8600 Imager (GE Healthcare), and analyzed with Image Quant 5.2 software (Molecular Dynamics/GE Healthcare), The data were analyzed using Origin 7.5 software (OriginLab, Northampton, MA). All binding assays were performed at least in triplicate. Figure 2 gives a representative binding curve. [0135] Dissociation constants (Kd) are presented in Table 1 (an asterisk indicates cognate pairs). Wild-type PUF (SEQ ID NO: 1) specifically binds Nanos Response Element (NRE) RNA, bearing a core 8-nt sequence 5'-UGUACAUA-3' (SEQ ID NO: 21), whereas the mutated PUF (3-2) (SEQ ID NO: 2) with two point mutations (C935S/Q939E) in the PUF repeat 3 recognizes a cognate RNA with a mutation at position 6 of the NRE (A6G; 5'- UGUACGUA-3'; SEQ ID NO: 22), and the mutated PUF (6-2/7-2) (SEQ ID NO: 3) with mutations (N1043S/Q1047E and S1079N/E1083Q) in repeats 6 and 7 recognizes a cognate RNA sequence with two mutations at positions 2 and 3 of the NRE (GU/UG; 5'- UUGACAUA-3'; SEQ ID NO: 23).

[0136] Table 1 : Dissociation constants (nM) for wt, 3-2, and 6-2/7-2 PUF domains for NRE, A6G, and GU/UG RNAs. An asterisk indicates cognate pairs.

[0137] The PUF domain PUF⁵³¹ recognizes the sequence UGUGCGUG (SEQ ID NO: 24). PUF^{53 i} (SEQ ID NO: 4) has mutations (Q867E/Q939E/C935S/Q1011E/C1007S) in wild type PUF repeats 1, 3 and 5. The binding of PUF⁵³¹ to its target RNA sequence was too tight to allow an accurate determination of its Kd. Thus, a value of ~4 pM was reported. PUF^{53 !} can recognize its new target sequence with very high affinity, compared to the wild type PUF RNA (Kd = 661± 17 nM).

[0138] The affinities of several PUF domains for binding RNA were demonstrated in this example.

EXAMPLE 2

[0139] This example demonstrates the production of chimeric PUF domain proteins and provides an analysis of their RNA binding.

[0140] DNA constructs utilized in a yeast three-hybrid system: FBF-I (aa 121-614; SEQ ID NO: 25, full nucleotide sequence given in GenBank accession number NM 062815), FBF-2 (aa 121-632; SEQ ID NO: 26, full nucleotide sequence given in GenBank accession number NM_062819) and PUF-8 (aa 143-535; SEQ ID NO: 27, full nucleotide sequence given in GenBank accession number NM_063122) were used both in the three-hybrid analysis and as templates for creating the chimeric proteins. The portions of FBF and PUF-8 (listed N-terminal to C -terminal) employed in the chimeric proteins are as follows: Chimera 1 (PUF-8 M143-V320; FBF-I 1326- V399; PUF-8 H380-H535; SEQ ID NO: 28), Chimera 2 (PUF-8 M143-H366; FBF-I L371-V399; PUF-8 H380-H535; SEQ ID NO: 29), Chimera 3 (PUF-8 M143-V320; FBF-I I326-K370; PUF-8 C367-H535; SEQ ID NO: 30), Chimera 4 (PUF-8 M143-I325; FBF-2 A333-F342; PUF-8 I336-H535; SEQ ID NO: 31), and Chimera 5 (PUF-8 M143-T346; FBF-2 L353-G362; PUF-8 C357-H535; SEQ ID NO: 32). Proteins were expressed in yeast using the pACT2 plasmid. For chimeras 1 , 2, and 3, the fragments were blunt-end ligated together. Ligated fragments were selected via PCR and subsequently cloned into the EcoRI and Ncol sites of pACT2. For chimeras 4 and 5, site-directed mutagenesis was utilized to create the chimeric protein. The single residue changes (triangles, Figure 3) were generated in FBF-2 (aa 121-632) via site-directed mutagenesis. DNA oligonucleotides designed to express various RNA sequences were cloned into the Xmal/Smal and Sphl sites of pllla MS2-2.

[0141] Yeast three-hybrid assays: Gal4-activation domain fusion proteins were expressed from either pACT or pACT2 plasmids. RNA-protein interactions were analyzed using the B-glo assay described in Hook, et al. (RNA, 2005, 11, 227-233) with the following modification: Saturated cultures (36-48 hrs growth) were diluted 100 μL into 4 ml selective media and allowed to grow 2-2.5 hrs to reach an OD_66O of 0.1-0.2. For data analysis, the relative light units (RLUs) were adjusted to an OD₆₆₀ of 0.1 and divided by the sample volume to give RLUs/μL. The values reported are an average of four separate experiments. [0142] To identify the region of FBF required to impose its specificity, chimeras between PUF proteins FBF-2 and PUF-8, a close C. elegans homolog of PUMl, were analyzed using the yeast three-hybrid system. To monitor RNA binding, an FBF-2 site, the gld-1 FBEa (5'- UGUGCCAUA-3' (SEQ ID NO: 33)), or a PUF-8 site, the PBE (PUF-8 binding element, 5'- UGUACAUA-3 ' (SEQ ID NO: 34), similar to the NRE) was used. FBF-2 has distinctive features: an extended 3^rd helix in its repeat 5 ("R5c," Figure 3) and a long extended loop between repeats 4 and 5. A 74-aa fragment of FBF-2 (I328-V401; corresponding to 1326- V399 of FBF-I) grafted into PUF-8 generates a chimeric protein with FBF-2 's RNA recognition specificity (Figure 4, Chimera 1). However, a smaller fragment with both the extended helix and loop of FBF-2 (corresponding to L371-V399 in FBF-I) does not transfer that specificity, as the chimera still binds the PBE (Figure 4, Chimera 2). The minimal region of FBF-2 that transferred specificity was a 45-aa fragment (I328-K372; corresponding to I326-K370 in FBF-I) containing portions of PUF repeats 4 and 5 outside the extended helix and loop (Chimera 3, Figure 4). Subsections of this region did not alter specificity, but instead bound the PBE (Chimeras 4 and 5, Figure 4). The packing of α-helices in the 45-aa region likely yield a flatter curvature; however, swapping single amino acid identities between PUF-8 and FBF-2 did not alter either protein's RNA specificity (Figure 3, triangles). The minimal segment of FBF-2 (I328-K372) lies directly opposite flipped bases. This fragment of FBF-2 is sufficient to alter the structure of PUF-8 to allow it to bind tightly to an FBF-2 target sequence, imposing the requirement for an "extra" base. It is proposed that this change in specificity reflects imposition of flattened curvature and base flipping. [0143] The production of chimeric PUF domain proteins and an analysis of their RNA binding were described in this example.

EXAMPLE 3

[0144] This example demonstrates the alternative splicing of PUF ESFs with a cw-factor PUF RNA binding domain and /rαrø-factors that promote or inhibit RNA splicing. [0145] ESF expression constructs: To express ESFs in cultured cells, expression constructs were generated using the pCI-neo vector (Promega, Madison, WI; SEQ ID NO: 35). An expression construct that encodes from N- to C-terminal a FLAG epitope (MDYKDDDDK; SEQ ID NO: 36), Gly-rich domain of hnRNP Al (residues 195-320 of GenBank Ace. No. NP_002127; SEQ ID NO: 8), and the MS2 coat protein (SEQ ID NO: 37) (gift of Dr. R. Breathnach from Institut deBiologie-CHR, France; see Del Gatto-Konczak et al, MoI. Cell Biol., 1999, 19: 251-260) was generated. The fragment encoding the MS2 coat protein fragment was removed using BamHI/Sall digestion and replaced with a fragment encoding an NLS sequence (PPKKKRKV; SEQ ID NO: 38) and the PUF domain of human Pumiliol (SEQ ID NO: 1), which was amplified using primers Pum-Fl and Pum-Rl (Table 2). The resulting construct can express a GIy-PUF type of ESF under the control of a CMV promoter (Figure 5). To make an expression construct for an RS-PUF type ESF, the fragment encoding the FLAG/Gly-rich domain was removed with Nhel/BamHI digestion and replaced with a fragment that encodes the RS domain (SEQ ID NO: 12) of ASF/SF2 protein with an N-terminal FLAG epitope, which was amplified using primers ASF-RS-F and ASF- RS-R (Table 2). To generate constructs for different ESFs with mutated PUF domains (PUF^3"2, PUF^6"2/7"2, PUF⁵³¹), the point mutations were introduced in consecutive steps using a QuikChange Site-Directed Mutagenesis kit (Stratagene, LaJoIIa₅ CA) following the manufacturer's instructions. The sequences are provided as GLY-PUF^WT (SEQ ID NO: 39), GLY-PUF^3'2 (SEQ ID NO: 40), GLY-PUF^6"2'^7'2 (SEQ ID NO: 41), RS-PUF^WT (SEQ ID NO: 42), RS-PUF^3"2 (SEQ ID NO: 43), RS-PUF^6"2/7"2 (SEQ ID NO: 44), AND GLY-PUF⁵³¹ (SEQ ID NO: 45).

[0146] Table 2: Primers used in constructing ESF expression vectors (restriction enzyme digestion sites are underlined).

[0147] Splicing reporter constructs: To assess the effects of ESFs on exon skipping, a "modular reporter system" was used that allows changes in an inserted splicing regulatory sequence near a test exon (Exon 12 of the human IGF-II mRNA-binding protein 1 (IGF2BP1, Ensembl ID ENSG00000159217); SEQ ID NO: 50) and assay for the inclusion of this test exon. The test exon, together with its flanking introns, was inserted between two GFP exons in pEGFP-Cl vectors as described previously (Wang Z. et al., Cell, 2004, 119:831-45). To insert target sequences of PUF domains into this reporter vector, a forward primer (CACCTCGAGAAT(N8)TTCGGGCCCCAC; SEQ ID NO: 51) and a reverse primer (GTGGGGCCCGAA(N8)ATTCTCGAGGTG; SEQ ID NO: 52) were used, which contained the candidate sequences (designated by N8; full sequences given in SEQ ID NOS: 53-56 for forward and SEQ ID NOS: 57-60 for reverse primers) flanked by Xhol and Apal sites. The two primers were annealed, digested, and ligated into the Xhol/Apal digested vector (inside the test exon). The inclusion of test exon was assayed by RT-PCR with primers corresponding to the first and third exon (two GFP exons) of the reporter minigene. [0148] All combinations of splicing reporters and ESF expression vectors were co- transfected into 293T or HeLa cells. Total RNA was isolated 24 hours after transfection and body-labeled RT-PCR was carried out using primers at exons 1 and 2 of the reporter minigene. All transfections were repeated at least twice. [0149] The GIy-PUF type ESFs of PUF^wt, PUF^3"2, and PUF^6"2'^7"2 repressed inclusion of the cassette exon containing a cognate target sequence (Figures 6 and 7). Such inhibitions are sequence specific, with the maximal inhibition of exon inclusion occurring between cognate ESFs and reporters. The splicing repressor activities of GIy-PUF type ESFs correlated with the binding affinities between PUF motifs and their targets (Figure 8), suggesting that the binding affinity to its target is one of the variables to determine the splicing factor strength. The RS-PUF type ESFs had the opposite activity on splicing and promoted inclusion of cassette exons containing the cognate targets (Figures 9 and 10). Similarly the splicing activator activities of ESFs are correlated with the binding affinities between PUF motifs and their targets (Figure 8), supporting the modular activities of splicing factors. These ESFs were shown to modulate splicing in a similar manner in HeLa cells as compared to 293 T cells.

[0150] However, the correlation between ESF activities and their binding affinities to targets was not completely linear (Figure 8), due to considerable exon skipping or, less prominently, inclusion, between some noncognate pairs of ESFs and targets. This nonlinearity is likely due to a combination of sequence-specific and nonspecific effects of splicing factors. A 1 :5 ratio of GIy-PUF expression plasmid to splicing reporter plasmid was used, which represents the lower end of the range that gave robust activity and is substantially lower than the ratios typically used in splicing factor/splicing reporter transfection experiments. This ratio was optimized by titrating the amount of the ESF expression plasmid to a fixed amount (0.2 μg in 1 ml cell culture) of splicing reporter plasmid. At the low amounts (0.02 μg), the inhibition effect of exon inclusion by ESFs is sequence specific as only the GIy-PUF^3"2 that bind to A6G target clearly increases the exon skipping. With the increased amounts of ESF vectors, all ESFs can cause exon skipping even between the low affinity PUF-RNA pairs, leading to a sequence non-specific effect in splicing modulation. Higher amounts of splicing factor expression vector caused exon skipping for all reporters, including those with pseudospecific target sequences. Similar effects are seen with hnRNP Al and ASF/SF2 in tethering experiments with MS2 coat protein. Therefore, as for other processes involving protein-RNA binding, the sequence specificity of splicing factors should be considered in the context of certain concentration ranges.

[0151] Described in this example was the alternative splicing of PUF ESFs with a cis- factor PUF RNA binding domain and /rørø-factors that promote or inhibit RNA splicing. EXAMPLE 4

[0152] This example demonstrates PUF ESFs can modulate alternative splice site usage. [0153] The general methods of Example 3 were used. To assess the effect of ESFs on the alternative use of 5' and 3' ss, reporters with competing 5' and 3' ss were used (see Wang et al, MoI. Cell, 2006, 23: 61-70). The same target sequences of PUF domains were inserted into these reporters using either Xhol/Apal sites (for the competing 3' ss reporter) or XhoI/EcoRI sites (for the competing 5' ss reporter).

[0154] Splicing reporters were designed containing cognate target sequences between two tandem 5' ss and were co-transfected with the RS-PUF type ESF expression constructs. These ESFs increased the use of the downstream intron proximal 5' ss, having strongest effect with reporters bearing their cognate sequence (Figures 11 and 12. For Figure 12, the percentage 5' ss product was used to avoid exaggerating the relative change because there is little or undetectable upper band in the absence of ESF.). Similarly, the ESFs modulated alternative 3' ss usage in a sequence-specific fashion (Figures 13 and 14). [0155] PUF ESF modulation of alternative splice site usage was shown in this example.

EXAMPLE 5

[0156] This example demonstrates the GIy-PUF⁵³¹ ESF modulates splicing of endogenous Bcl-x pre-mRNA.

[0157] The GIy-PUF⁵³¹ and Gly-PUF^wl ESF expression constructs of Example 3 were used.

[0158] Cell culture, transfection, RNA purification and semi -quantitative RT-PCR: The human embryonic kidney cell line 293T, lung cancer cell line A549, breast cancer cell line MDA-MB-231, and human cervical cancer cell line HeLa were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum. Breast cancer cell line BT474 was cultured in F12/DMEM supplemented with 10% fetal bovine serum. For cell transfections, cells were seeded onto 24-well plates 1 day prior to transfection. For each well, in separate tubes 0.2 μg of splicing mini-gene reporter constructs were mixed with appropriate amounts of ESF expression vector and 2 μl of Lipofectamine 2000 (Invitrogen, Carlsbad, CA) were added to 50 μl of Opti-MEM I (Invitrogen). The solutions were then combined and mixed gently, allowed to sit for 20 min at room temperature, and added to the plates for 24 h at 37 ⁰C and then harvested for RNA or protein isolation. Total RNA was isolated from transfected cells with TRIzol reagent (Invitrogen) according to the manufacturer's instructions, followed by 1 h DNase I (Invitrogen) treatment at 37 ⁰C and then heat inactivation of DNase I. Total RNA (2 μg) was then reverse- transcribed with Superscript III (Invitrogen) with poly T primer (for Bcl-x) or gene specific primer (for splicing reporter), and one-tenth of the RT product was used as the template for PCR amplification (25 cycles of amplification, with trace amount of Cy5-dCTP in addition to non-fluorescent dNTPs). The primers used to detect splicing reporter (GFP exons) were AGTGCTTCAGCCGCTACCC (forward; SEQ ID NO: 61) and GTTGTACTCCAGCTTGTGCC (reverse; SEQ ID NO: 62) and for Bcl-x were CATGGCAGCAGTAAAGCAAG (forward; SEQ ID NO: 63) and GCATTGTTCCCATAGAGTTCC (reverse; SEQ ID NO: 64). RT-PCR products were separated on 10% PAGE gels run with IX TBE buffer, and scanned with a Typhoon 9400 scanner (Amersham Biosciences, Piscataway, NJ). The amount of each splicing isoform was measured with ImageQuant 5.2. All experiments were repeated at least three times. [0159] Western blot: Cells were transfected with GIy-PUF^ or GIy-PUF⁵³¹ constructs, respectively and harvested 24 h after transfection. The total cell pellets were boiled in 2X SDS-PAGE loading buffer for 10 min and then resolved by 12% SDS-PAGE and transferred to nitrocellulose membrane. The following antibodies were used in this study: Caspase-3 (#9668) and PARP (#9542) antibodies were purchased from Cell Signaling Technology (Danvers, MA). Antibodies against actin (A5441) and FLAG M5 (F4042) were purchased from Sigma- Aldrich (St. Louis, MO). Antibodies to Bcl-x (610211) were purchased from BD Bioscience. Bound antibodies were visualized with the ECL kit (GE Healthcare, Piscataway, NJ).

[0160] When transfected into HeLa cells where Bcl-xL is the predominant form, GIy- PUF⁵³¹ increased splicing of the Bcl-xS isoform (see Figure 15) in a dose-dependent manner, whereas the control ESF (GIy-PUF'*) did not affect the Bcl-xS level. (No ESF gave 12% Bcl-xS of total RNA, l μg GIy-PUF^ gave 12%, 0.2μg GIy-PUF⁵³¹ gave 24%, and l μg GIy- PUF³³¹ gave 32%). The increase of Bcl-xS splicing was detected as early as 4 hours after transfection and can last at least 36 hours. In addition, induction of the pro-apoptotic Bcl-xS isoform by GIy-PUF³³¹ led to cleavage of caspase 3 and poly (ADP-ribose) polymerase (PARP), two known molecular markers in the apoptosis pathway. The PUF⁵³¹ domain alone did not affect the Bcl-x mRNA level.

[0161] The increase in the amount of Bcl-xS was observed using western blots, suggesting that the change of steady-state Bcl-xS/Bcl-xL ratio is probably due to a splicing shift rather than destabilization of Bcl-xL mRNA by PUF⁵³¹ binding. The amounts of Bcl-xL were not notably different under the experimental conditions, probably owing to a higher sensitivity of the Bcl-x antibody in detecting Bcl-xL than Bcl-xS.

[0162] GIy-PUF⁵³¹ ESF modulation of the splicing of endogenous Bcl-x pre-mRNA was described in this example.

EXAMPLE 6

[0163] This example demonstrates nuclear localization of the GIy-PUF^{5 l} ESF with greater DNA fragmentation, indicative of apoptosis, in the presence of the GIy-PUF⁵³¹ ESF. [0164] Immunofluorescence: HeLa cells were seeded onto poly-lysine coated glass coverslips in a 6- well plate, and then transfected with GIy-PUF^¹ or GIy-PUF⁵³¹ constructs of Example 3 using Lipofectamine 2000 (Invitrogen, Carlsbad, CA). At 24 h after transfection, the cells were fixed on the coverslips with 4% formaldehyde in IX PBS for 20 min at room temperature and washed with IX PBS three times. Cells were then permeabilized with 0.2% Triton X-100 in IX PBS for 10 min and washed with IX PBS three times. Cells were blocked with 3% BSA in IX PBS for 10 min, washed with IX PBS three times, and then incubated with primary antibody (monoclonal anti-FLAG antibody from Sigma- Aldrich (St. Louis, MO), clone M2) for 1 h at room temperature. The cells were washed with IX PBS three times and incubated with FITC-conjugated goat anti-mouse IgG for 30 min. The cells were washed with IX PBS three times and the cover slips were mounted with mounting medium (vector mounting medium with DAPI (4 '-6- diamidino-2-phenylindole dihydrochloride), Vector Laboratories, Burlingame, CA). Cells were visualized using an Olympus fluorescence microscope, and photographs were generated using a Kodak digital camera.

[0165] Using immunofluorescence microscopy with anti-FLAG antibodies, it was found that the ESFs are predominantly localized in the nuclei of transfected cells. In addition, many cells transfected with GIy-PUF⁵³¹ have fragmented nuclear DNA, suggesting that they are undergoing apoptosis. Examination of >200 cells from randomly chosen fields indicated that -10% of cells transfected with GIy-PUF⁵³¹ have fragmented nuclear DNA (i.e. undergoing apoptosis) vs. only -3% of cells transfected with control ESF (Figure 16). [0166] Nuclear localization of the GIy-PUF⁵³¹ ESF and greater DNA fragmentation, indicative of apoptosis, in the presence of the GIy-PUF⁵³¹ ESF were shown in this example. EXAMPLE 7

[0167] This example demonstrates a shift of splicing in and apoptosis of cancer cells due to the presence of GIy-PUF⁵³¹.

[0168] The GIy-PUF⁵³¹ ESF expression construct of Example 3 was used. [0169] The general cell culture, transfection, RNA purification and semi-quantitative RT- PCR methods of Example 5 were used, using MDA-MB-231, BT474, and A549 cells. [0170] Propidium iodide staining and flow cytometry: Cells were harvested at 24 hours after transfection and stained for 5 minutes in a PBS solution containing a final concentration of 2 μg/ml propidium iodide (PI). The Pi-stained cells were analyzed with a FACSCalibur fluorescence -activated cell sorter (FACS) using CELLQuest software (Becton Dickinson, Franklin Lakes, NJ).

[0171] Lentivirus infection and cell viability assay: The full-length ESFs were PCR amplified from original expression vectors and integrated in the lenti viral expression vector pWPXLd (SEQ ID NO: 65) between Mlul/Spel sites. Lentiviruses were generated by co- transfecting 293T cells with packaging vectors pPAX2 and pMD2.G with either pWPXLd- Gly-Puf(531), pWPXLd-Gly-Puf(WT) (control), or pWPXLd-GFP (mock) using the standard calcium phosphate precipitation method. The titer of lentivirus was determined by infecting 293 cells with serial dilutions of virus preparation. Cell viability was determined with the WST-I assay (Roche) following the manufacturer's instructions. MDA-MB-231, A549 and HeLa cells were infected with lentivirus expressing GFP (as non-ESF control), control ESF or designer ESF, and then seeded 72 h after infection in a 96-well plate for overnight incubation.

[0172] The effectiveness of GIy-PUF⁵ ' in other cancer cells, including two breast cancer cell lines (MDA-MB-231 and BT474) and a lung cancer cell line (A549), was tested using a pCI vector. In all cell types tested, the designer ESF caused a significant shift of splicing to produce more Bcl-xS isoform compared with control ESF, as well as increased numbers of apoptotic cells as determined by flow cytometry of propidium iodide stained cells (Figure 17). In the absence of apoptotic signals, the increases in the fraction of apoptotic cells are modest but statistically significant in all cell types tested (p < 0.05 by paired T-test), consistent with BcI -xL being an important survival factor for most cancers. [0173] GIy-PUF⁵³¹ was tested in other cells, including HeLa, a breast cancer cell line (MDA-MB-231) and a lung cancer cell line (A549), using a lentivirus vector. The GIy- PUF⁵³¹ caused a considerable shift of splicing to produce more Bcl-xS isoform in all cell types tested. The lenti virus-infected HeIa cells had an elevated basal amount of Bcl-xS for unknown reasons. As was seen for the pCI construct, the splicing shift increased apoptosis as determined by flow cytometry of propidium iodide-stained cells. In the absence of an exogenous stimulus that induces apoptosis, the increases of apoptotic cells were modest (about threefold) but significant in all cell types tested (P < 0.05, paired t-test), consistent with Bcl-xL being an important apoptosis inhibitor for most cancers.

[0174] A shift of splicing in cancer cells and the apoptosis of cancer cells, both due to the presence of GIy-PUF⁵³¹, were shown in this example.

EXAMPLE 8

[0175] This example demonstrates the greater sensitivity of cells to cancer treatments due to the presence of GIy-PUF⁵³¹.

[0176] Cell viability assay: Cell viability was determined with the WST-I assay (Roche, Indianapolis, IN) following the manufacturer's instructions. MDA-MB-231, A549, BT474 and HeLa cells (1x10⁴) were transfected with Gly-PUF^wt or GIy-PUF⁵³¹ pCI constructs of Example 3 or lentivirus constructs of Example 7 (except for the BT474 cells), and then seeded 12 h after transfection in a 96-well plate for overnight incubation. Cisplatin (P4394, Sigma, St. Louis, MO), Paclitaxel (Sigma, T7191), TNF-alpha (ZOlOOl, GeneScript, Piscataway, NJ) and TRAIL (10663-45267, Gen Way, San Diego, CA) were added to each cell line at 5 μM, 10 nM, 20 ng/rαl, and 100 ng/ml, respectively. After 24 h incubation at 37 °C in the presence of 5% CO₂, 10 μl of cell proliferation reagent WST-I was added to each well. The cells were incubated with WST-I reagent for 0.5 h and the absorbance at 450 nm was measured using a Benchmark microplate reader (Bio-Rad, Hercules, CA). At least three independent experiments were performed, and the means and standard deviations were calculated and plotted.

[0177] To examine the effect of the ESFs in the presence of apoptotic signals, cancer cells were treated with either GIy-PUF⁵³¹ or control GIy-PUF^*1 pCI constructs in combination with anti-tumor drugs (cisplatin and paclitaxel) or cytokines (TNF-α and TRAIL, TNF- related apoptosis inducing ligand) that are commonly used in cancer treatments. In all cell types, expression of GIy-PUF⁵³¹ sensitized cells to the anti-cancer agents tested, leading to significant decrease of cell viability compared to controls (Figures 18A-D). Even for the cisplatin treated A549 or BT474 cells where the decreases of cell viability are not significant in 5 μM drug (Figure 18A), statistically significant decreases at a higher cisplatin concentration were observed. Different cell lines responded to the combinations of the anticancer drugs and ESFs with varying sensitivities, consistent with the diverse mechanisms by which these drugs kill cancer cells.

[0178] To achieve robust expression during the entire period of drug treatment, MDA- MB-231, A549 and HeLa cells were infected with lentivirus expressing GIy-PUF⁵³¹ or control ESF and then treated the infected cells with low doses of drugs for 24 h, conditions under which most mock- infected cancer cells were viable. As seen with the pCI constructs, in all cell types tested, expression of GIy-PUF⁵³¹ sensitized cells to the antitumor drugs tested, leading to significant decreases of cell viability compared to controls (P < 0.05) as judged by WST-I cell proliferation assay. Again, different cell lines responded to the combinations of antitumor drugs and ESFs with varying sensitivities, consistent with the diverse mechanisms by which these drugs kill cancer cells. The enhancements of drug sensitivity in ESF-treated cancer cells were in the same range as cells treated with small- molecule inhibitors of Bcl-xL.

[0179] This example showed that the presence of GIy-PUF⁵³¹ provided for greater sensitivity of cells to cancer treatments.

EXAMPLE 9

[0180] This example demonstrates a GIy-PUF ESF that modulates splicing of the VEGF- A gene.

[0181] The general methods of Example 3 were used to produce a GIy-PUF ESF (ESF #1 of Figure 19; SEQ ID NO: 66) in a pCI-neo vector where the ESF recognizes the GTGACAAG sequence downstream of the proximal 3' splice site of exon 8 of the VEGF-A gene. The sequence of ESF #1 comprises the PUF domain of SEQ ID NO: 5 and the GIy domain of SEQ ID NO: 8. Cultured MDA-MB-231 cells were transfected with different amounts of the expression vector containing ESF #1, and total RNAs were then purified 24 hours after transfection to detect VEGF-A mRNA by RT-PCR.

[0182] The ESF shifts the splicing towards more VEGF-A b isoforms in the cultured breast cancer cells (Figure 20). The splicing shift caused an increase in the anti-angiogenic b isoforms, where VEGF-Ai ₅₅b is the major isoform measured.

[0183] Modulation of VEGF-A gene alternative splicing, through the presence GIy-PUF ESF, was shown in this example. EXAMPLE 10

[0184] This example demonstrates the use of PUF domains as RNA tethers to investigate the RNA processing functions of various protein domains.

[0185] The ASF/SF2 ESF of Example 3 was used. Also, the general methods of Example 3 were used to generate ESFs in the pCI-neo vector using the PUF^3"2 domain (SEQ ID NO: 2) and the RS domains of 9G8 (residues 123-238 of GenBank Accession No. NP_001026854; SEQ ID NO: 13; full length at SEQ ID NO: 67), SC35 (residues 117-221 of GenBank Accession No. NP 003007; SEQ ID NO: 14; full length at SEQ ID NO: 68), SRP40 (residues 180-272 of GenBank Accession No. NP_008856; SEQ ID NO: 15; full length at SEQ ID NO: 69), and a short RS repeat ((RS)₆; SEQ ID NO: 16; full length at SEQ ID NO: 70). Additional ESFs were generated using PUF^3"2 (SEQ ID NO: 2) and the Gly-rich domains from members of the hnRNP Al family (hnRNP Al; SEQ ID NO: 8; full length at SEQ ID NO: 71), hnRNP A2/B1 (residues 203-353 of GenBank Accession No. NP_112533; SEQ ID NO: 9; full length at SEQ ID NO: 72), hnRNP A3 (residues 211-378 of GenBank Accession No. NP_919223; SEQ ID NO: 10; full length at SEQ ID NO: 73) and with a Gly-rich short peptide (19 amino acids in length; SEQ ID NO: 11 ; full length at SEQ ID NO: 74). The RS/Gly domains or fragments were amplified by PCR or synthesized and cloned between Xhol and BamHI.

[0186] The general methods of Example 4 were used for the splicing reporter. The splicing reporter and ESF expression plasmids were co-transfected into 293 cells, and the splicing outcomes of the reporter minigene were detected by RT-PCR. All transfections were repeated at least twice.

[0187] Compared to the non-ESF control, all RS-PUFs promoted inclusion of the cassette exon containing their cognate sequences. The activity of the short RS repeat to promote exon inclusion is similar to the other RS domains, with the only exception that the RS domain from 9G8 is slightly more active than the others (Figure 21). All GIy-PUFs suppressed the inclusion of the cassette exon containing their cognate sequence, indicating that the Gly-rich domains in all members of the hnRNP Al family are likely responsible for their splicing suppression activity (Figure 21). The 19-aa Gly-rich sequence was sufficient for splicing inhibition activity, suggesting that other splicing factors with a Gly-rich domain may function as splicing suppressors when binding to exons. the activities are not due to the PUF domain since, when tested alone, the PUF^3"2 domain did not affect splicing of the same reporters. [0188] This example described the investigation of various protein domain RNA processing functions through the use of PUF domains as RNA tethers.

EXAMPLE I l

[0189] This example illustrates additional VEGF-A ESFs.

[0190] The additional ESFs of Figure 19 will be constructed using the methods of Examples 3 and 9. ESF #2 (PUF domain of SEQ ID NO: 6; GIy domain of SEQ ID NO: 8; full length at SEQ ID NO: 75) should inhibit the angiogenic VEGF-A_XXX isoforms, whereas ESF #3 (PUF domain of SEQ ID NO: 7; RS domain of SEQ ID NO: 13; full length at SEQ ID NO: 76) should promote the anti-angio genie b isoforms. Both should thus shift VEGF-A splicing towards more anti-angio genie isoforms. [0191] VEGF-A ESFs are illustrated in this example.

[0192] All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein.

[0193] The use of the terms "a" and "an" and "the" and similar referents in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms "comprising," "having," "including," and "containing" are to be construed as open-ended terms (i.e., meaning "including, but not limited to,") unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., "such as") provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention. [0194] Preferred embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.

Claims

CLAIM(S):

1. A fusion protein comprising a PUF RNA-binding domain of any of SEQ ID NOS: 1-7 and an RNA processing domain of SEQ ID NO: 8 or 12.

2. A fusion protein comprising a PUF RNA-binding domain of any of SEQ ID NOS: 1-7 and an RNA processing domain of any of SEQ ID NOS: 9-11 or 13-16.

3. A fusion protein comprising a PUF RNA-binding domain of any of SEQ ID NOS: 1 -7 and an RNA processing domain of any of SEQ ID NO: 8-11.

4. A fusion protein comprising a PUF RNA-binding domain of any of SEQ ID NOS: 1-7 and an RNA processing domain of any of SEQ ID NO: 12-16.

5. The fusion protein of any one of claims 1-4 further comprising a targeting sequence.

6. The fusion protein of claim 5 wherein the targeting sequence is a nuclear localization sequence.

7. The fusion protein of any one of claims 1 -4 further comprising a marker sequence.

8. The fusion protein of claim 7 wherein the marker sequence comprises a FLAG or GFP sequence.

9. A nucleic acid comprising a nucleotide sequence encoding the fusion protein of claim 1 or 2.

10. A nucleic acid comprising a nucleotide sequence encoding the fusion protein of claim 3.

1 1. A nucleic acid comprising a nucleotide sequence encoding the fusion protein of claim 4.

12. A recombinant vector comprising the nucleic acid of claim 9.

13. A recombinant vector comprising the nucleic acid of claim 10.

14. A recombinant vector comprising the nucleic acid of claim 1 1.

15. A host cell comprising the recombinant expression vector of claim 12.

16. A host cell comprising the recombinant expression vector of claim 13.

17. A host cell comprising the recombinant expression vector of claim 14.

18. A population of cells comprising at least one cell of claim 15.

19. A population of cells comprising at least one cell of claim 16.

20. A population of cells comprising at least one cell of claim 17.

21. An antibody, or antigen binding portion thereof, which specifically binds to a fusion protein of claim 1 or 2.

22. An antibody, or antigen binding portion thereof, which specifically binds to a fusion protein of claim 3.

23. An antibody, or antigen binding portion thereof, which specifically binds to a fusion protein of claim 4.

24. A composition comprising the fusion protein of any one of claims 1-4 and a pharmaceutically acceptable carrier.

25. A composition comprising the nucleic acid of any one of claims 9-11 and a pharmaceutically acceptable carrier.

26. A composition comprising the recombinant vector of any one of claims 12-14 and a pharmaceutically acceptable carrier.

27. Use of an effective amount of the fusion proteins of claims 3 or 4, the nucleic acids of claims 10 or 11, the recombinant expression vectors of claims 13 or 14, the host cells of claims 16 or 17, the population of cells of claims 19 or 20, or the antibodies, or antigen binding portions thereof, of claims 22 or 23 in the manufacture of a medicament for treating or preventing a disease associated with RNA processing.

28. A method of detecting in a host a disease associated with RNA processing due to inclusion of additional one or more exons comprising:

(a) obtaining a first sample and a second sample each comprising one or more cells from the host;

(b) detecting the RNA processing of the first sample;

(c) contacting the second sample with the fusion protein of claim 3, the nucleic acid of claim 10, the recombinant expression vector of claim 13, the host cell of claim 16, the population of cells of claim 19, or the antibody, or antigen binding portion thereof, of claim 22;

(d) detecting the RNA processing of the second sample; and

(e) comparing the RNA processing of the first and second samples;

wherein detection of the additional one or more exons in a lower amount in the second sample compared to the first sample is indicative of the presence of a disease associated with RNA processing in the host.

29. A method of detecting in a host a disease associated with RNA processing due to removal of one or more exons comprising:

(a) obtaining a first sample and a second sample each comprising one or more cells from the host;

(b) detecting the RNA processing of the first sample;

(c) contacting the second sample with the fusion protein of claim 4, the nucleic acid of claim 11 , the recombinant expression vector of claim 14, the host cell of claim 15, the population of cells of claim 20, or the antibody, or antigen binding portion thereof, of claim 23;

(d) detecting the RNA processing of the second sample; and

(e) comparing the RNA processing of the first and second samples; wherein detection of removal of the one or more exons in a higher amount in the first sample compared to the second sample is indicative of the presence of a disease associated with RNA processing in the host.

30. A method of detecting the RNA processing capability of a test molecule comprising:

(a) attaching the test molecule to a PUF domain of any of SEQ ID NOS: 1-7;

(b) contacting the attached test molecule of (a) with a RNA molecule that is recognized by the PUF domain of (a); and

(c) detecting the RNA processing of the RNA molecule;

wherein the RNA processing of the RNA molecule detects the RNA processing capability of the test molecule.