WO2011008803A2 - Novel δ9-elongase for production of polyunsaturated fatty acid-enriched oils - Google Patents

Novel δ9-elongase for production of polyunsaturated fatty acid-enriched oils Download PDF

Info

Publication number
WO2011008803A2
WO2011008803A2 PCT/US2010/041893 US2010041893W WO2011008803A2 WO 2011008803 A2 WO2011008803 A2 WO 2011008803A2 US 2010041893 W US2010041893 W US 2010041893W WO 2011008803 A2 WO2011008803 A2 WO 2011008803A2
Authority
WO
WIPO (PCT)
Prior art keywords
acid
plant
polyunsaturated fatty
seq
nucleotide sequence
Prior art date
Application number
PCT/US2010/041893
Other languages
French (fr)
Other versions
WO2011008803A3 (en
Inventor
Suzette Pereira
Tapas Das
Padmavathy Krishnan
Pradip Mukerji
Original Assignee
Abbott Laboratories
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Abbott Laboratories filed Critical Abbott Laboratories
Priority to JP2012520732A priority Critical patent/JP2012533303A/en
Priority to CN201080041384.1A priority patent/CN102782124B/en
Priority to NZ597679A priority patent/NZ597679A/en
Priority to AU2010273508A priority patent/AU2010273508B2/en
Priority to IN469DEN2012 priority patent/IN2012DN00469A/en
Priority to MX2012000825A priority patent/MX2012000825A/en
Priority to BRBR112012001125-1A priority patent/BR112012001125A2/en
Priority to CA2768318A priority patent/CA2768318A1/en
Priority to RU2012103248/10A priority patent/RU2558302C2/en
Priority to UAA201201733A priority patent/UA107468C2/en
Priority to EP10737154A priority patent/EP2454365A2/en
Publication of WO2011008803A2 publication Critical patent/WO2011008803A2/en
Publication of WO2011008803A3 publication Critical patent/WO2011008803A3/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0071Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8247Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified lipid metabolism, e.g. seed oil composition
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93Ligases (6)

Definitions

  • the present disclosure relates to isolated polynucleotides encoding a deha-9 elongase, deIta-9 elongases encoded by the isolated polynucleotides, expression vectors comprising the isolated polynucleotides, host ceils comprising the expression vectors, and methods for producing delta-9 elongases and polyunsaturated fatty acids.
  • PUFAs Polyunsaturated fatty acids
  • PUFAs are important components of the plasma membrane of a cell, where they are found in the form of phospholipids. They also serve as precursors to mammalian prostacyclins, eicosanoids, leukotrienes and prostaglandins. Additionally, PUFAs are necessary for the proper development of the developing infant brain as well as for tissue formation and repair. In view of the biological significance of PUFAs. attempts are being made to efficiently produce them, as well as intermediates leading to their production.
  • a number of enzymes are involved in PUFA biosynthesis (see Figure 1).
  • Desaturases catalyze the introduction of unsaturations (e.g., double bonds) between carbon atoms within the fatty acid alkyl chain of the substrate.
  • Elongases catalyze the addition of a 2-carbon unit to a fatty acid substrate.
  • linole ⁇ c acid LA. 18:2n-6
  • OA oleic acid
  • Eicosadienoic acid (EDA, 20:2n-6) is produced from linolcic acid (LA, 18:2n-6) by a ⁇ 9 ⁇ longase.
  • D ⁇ homo- ⁇ -li ⁇ olenic acid (DGLA. 20:3n-6) is produced from eicosadienoic acid (EDA. 20:2n-6) by a ⁇ 8- ⁇ iesaturase.
  • Arachidonic acid (ARA. 20:4n-6) is produced from dihomo- ⁇ -Hnolenic acid (DGLA. 20:3n-6) by a ⁇ 5-desaturase (see Figure 1).
  • Elo ⁇ gases catalyze the conversion of v- ⁇ nofenic acid (GLA. 18:3n-6) to dihomo- ⁇ -linofertic acid (DGLA. 20:3n-6) and the conversion of stearidonic acid (SDA- 18:4n-3) to etcosatetraenoic acid (ETA. 2G:4n-3).
  • Elongasc also catalyzes the conversion of arachidonic acid (ARA. 20:4n-6) to adren ⁇ c acid (ADA, 22:4n-6) and the conversion of eicosapentaenoic acid (EPA.
  • ⁇ 9-elongase elongates polyunsaturated fatty acids containing unsaturation at the carbon 9 position. For example, ⁇ 9-elongase catalyzes the conversion of linoleic acid (LA, 18:2n-6) to eicosadienoic acid (EDA. 20:2n-6). and the conversion of ⁇ -linoienic acid (ALA- lS:3n-3) to eicosatrienoic acid (ETrA. 20:3 ⁇ -3).
  • ⁇ 3-ETrA may then be converted to ⁇ n3-ETA by a ⁇ 8-desaturase.
  • ⁇ 3-ETA may then be utilized in the production of other polyunsaturated fatty acids, such as ⁇ 3-EPA. which may be added to pharmaceutical compositions, nutritional compositions, animal feeds, as well as other products such as cosmetics.
  • CoA is the acyl carrier.
  • Step one involves condensation of malonyl-CoA with a Jong- chain acyl-CoA to yield carbon dioxide and a ⁇ -ketoacyl-CoA in which the acyl moiety has been elongated by two carbon atoms.
  • Subsequent reactions include reduction to ⁇ -hydroxyacyl-CoA, dehydration to an enoyl-CoA, and a second reduction to yield the elongated acyl-CoA.
  • the initial condensation reaction is not only the substrate-specific step but also the rate-limiting step.
  • the major polyunsaturated fatty acids of animals therefore are either derived from diet and/or from desaturation and elongation of linoleic acid or ⁇ - linolenic acid.
  • linoleic acid or ⁇ - linolenic acid.
  • oils containing levels of PUFAs beyond those naturally present as well as those enriched in novel PUFAs can be made by isolation and expression of elongase genes.
  • EPA eicosapentaenoic acid
  • DHA Docosahexaenoic acid
  • DFLA is another important long-chain PUFA.
  • DFLA is most often found in fish oil and can also be purified from mammalian brain tissue.
  • Arachidonic acid (ARA) is a third important long-chain PUFA. ARA is found in filamentous fungi and can also be purified from mammalian tissues including the liver and the adrenal glands.
  • ARA EPA and/or DHA. for example, can be produced via either the alternate ⁇ -8 desaturase/ ⁇ 9-elongase pathway or the conventional ⁇ 6 pathway (see Figure i).
  • Elongases which are active on substrate tatty acids in the conventional ⁇ 6 pathway for the production of long-chain PUFAs. particularly ARA, EPA and DHA. have previously been identified.
  • the conventional ⁇ 6 pathway for converting LA to DGLA and ALA Io ⁇ 3-ETA utilizes the ⁇ 6-desaturase enzyme to convert LA to GLA, and ALA to stcaridonic acid (SDA).
  • the alternate ⁇ 8-desaturase/ ⁇ 9-e!ongase pathway may be preferred over the conventional A6 pathway.
  • the alternate ⁇ 8-desaturase/ ⁇ 9-e!ongase pathway may be used as an alternative to the conventional ⁇ 6 pathway, to bypass GLA and SDA formation.
  • the present disclosure relates to an isolated nucleic acid molecule or fragment thereof comprising or complementary to an isolated nucleotide sequence encoding a polypeptide having elongase activity, wherein the amino acid sequence of the polypeptide has at least 68% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO: 18 and SEQ ID NO: 20.
  • the present disclosure relates to an isolated nucleotide sequence or fragment thereof comprising or complementary to at least 68% of a nucleotide sequence selected from the group consisting of SEQ ID NO: 17 and SEQ ID NO: 19.
  • the isolated nucleotide sequence or fragment thereof encodes a furtcliona ⁇ y active eiongase which utilizes a polyunsaturated fatty acid as a substrate, and in particular a functional fy active ⁇ 9-eiongase.
  • the nucleotide sequence may be from, for example, a Eiigknoid sp.. and may specifically be isolated from, for example. Euglena deses Ehr. CCMP 2916.
  • the present disclosure relates to a purified polypeptide encoded by the above-described isolated nucleotide sequence as well as a purified polypeptide which elongates polyunsaturated fatty acids containing unsaturalion at the carbon 9 position and has at least 68% amino acid identity Io an amino acid sequence selected from the group consisting of SEQ ID NO: 18 and SEQ ID NO: 20.
  • the present disclosure relates to an expression vector.
  • the expression vector comprises a nucleotide sequence operably finked to a regulatory sequence, wherein the nucleotide sequence comprises or si complementary to at least 68% of a nucleotide sequence selected from the group consisting of SEQ ID NO: 17 and SEQ ID NO: 19.
  • the disclosure aiso relates to a host cell comprising this expression vector.
  • the host cell may be, for example, a eukaryotic cell or a prokaryotic cell. Suitable eukaryotic cells and prokaryotic cells are set forth herein.
  • the disclosure also relates to a transgenic seed comprising the expression vector.
  • the present disclosure relates to a plant cell, plant seed, plant or plant tissue comprising the above-described expression vector, wherein expression of the nucleotide sequence of the expression vector results in production of at least one polyunsaturated fatty acid by the plant cell, plant or plant tissue.
  • the polyunsaturated fatty acid may be. for example, selected from the group consisting of (06-EDA and ⁇ >3-ETrA. and combinations thereof.
  • the present disclosure also includes one or more plant oils or fatty acids expressed by the above plant cell, plant seed, plant or plant tissue.
  • the present disclosure relates to a method of producing a ⁇ 9-elongase.
  • the method comprises the steps of: a) isolating a nucleotide sequence comprising or complementary to at least 68% of a nucleotide sequence selected from the group consisting of SEQ ID NO: 17 and SEQ ID NO: 19; b) constructing an expression vector comprising: i) the isolated nucleotide sequence operably linked to ii) a regulatory sequence; and c) introducing the expression vector into a host cell for a time and under conditions sufficient for expression of the ⁇ 9-elongase, as appropriate.
  • the host cell may be. for example, a eukaryot ⁇ c eel!
  • the eukaryotic cell may be. for example, a mammalian cell, an insect cell, a plant cell or a fungal cell.
  • the plant cell may be from an oilseed plant selected from the group consisting of soybean. Brassica species, safflower. sunflower, maize, cotton, and flax.
  • the present disclosure relates to a method for producing a polyunsaturated fatty acid comprising the steps of: a) isolating a nucleotide sequence comprising or complementary to at least 68% of a nucleotide sequence selected from the group consisting of SEQ ID NO: 17 and SEQ ID NO: 19; b) constructing an expression vector comprising the isolated nucleotide sequence operab ⁇ y linked to a regulatory sequence; c) introducing the expression vector into a host cell under time and conditions sufficient for expression of ⁇ 9-elongase; and d) exposing the expressed ⁇ 9-elongase to a substrate polyunsaturated fatty acid in order to convert the substrate polyunsaturated fatty acid to a first product polyunsaturated fatty acid.
  • the "substrate" polyunsaturated fatty acid is, for example, LA or ALA
  • the "first product" polyunsaturated fatty acid is. for example, ⁇ 6-EDA or GJ3- ETrA, respectively.
  • This method may further comprise the step of exposing the first product polyunsaturated fatty acid to at least one desaturase, at least one additional elongase, or combinations thereof, in order to convert the first product
  • the second or subsequent product polyunsaturated fatty acid may be, for example. DGLA or ⁇ 3-ETA, ARA T EPA. DPA, DHA, or combinations thereof.
  • the present disclosure relates to a method for producing a polyunsaturated fatty acid in a host cell comprising the steps of: a) isolating a nucleotide sequence comprising or complementary to at least 68% of a nucleotide sequence selected from the group consisting of SEQ ⁇ D NO: 17 and SEQ ID NO: 19; b) constructing an expression vector comprising the isolated nucleotide sequence operabiy linked to a regulatory sequence; c) introducing ⁇ ) the expression vector and ii) at least one additional recombinant DNA construct comprising an isolated nucleotide sequence encoding a ⁇ 8-desaturase and operabiy linked to at least one regulatory sequence, into a host cell for a time and under conditions sufficient for expression of a ⁇ 9-elongase and the ⁇ 8-desalurase; and d) exposing the expressed ⁇ 9-elongase and the ⁇ 8-desaturase to
  • the first product polyunsaturated fatty acid may be, for example, DGLA. ⁇ 3-ETA. or combinations thereof.
  • This method may further comprise the step of exposing the first product polyunsaturated fatty acid to at least one desaturase, at least one additional elongase. or combinations thereof, in order to convert the first product polyunsaturated fatty acid to a second or subsequent polyunsaturated fatty acid.
  • the second or subsequent product polyunsaturated fatty acid may be, for example. ARA, EPA, DPA, DHA. or combinations thereof.
  • this method may further comprise introducing into the host cell a recombinant DNA construct comprising i) an isolated nucleotide sequence encoding a ⁇ 5-desaturase operabiy linked to ii) a regulatory sequence.
  • the host cell may be as described above.
  • the present disclosure relates to a method for producing a transgenic plant comprising transforming a plant cell with at least one isolated nucleotide sequence or fragment thereof comprising or complementary to at least 68% of a nucleotide sequence selected from the group consisting of SEQ ID NO: 17 and SEQ ID NO: 19. and regenerating a transgenic plant from the transformed plant cell.
  • the plant cell may be from an oilseed plant selected from the group consisting of soybean. Brassica species, safflower. sunflower, maize, cotton, and flax.
  • the present disclosure relates to a seed obtained from the transgenic plant produced by this method.
  • Figiire 1 shows the fatty acid biosynthelic pathway and the role of ⁇ 9-elongase in this pathway.
  • Figures 2A and 2B show alignment of nucleotide sequences SEQ ID NO: 26 and SEQ ID NO: 27. which are nucleotide sequences of Eug-MO7-ELO# 10 and the Eug-MO7-ELO#14 variant, respectively, cloned into the Bam Hi/Hind III sites of vector pYX242. as discussed in Example 3. A box is drawn around variants.
  • Figures 3A and 3B show alignment of amino acid sequences of ⁇ 9- elongase from Eugkna deses Ehr. CCMP 2916 (E ⁇ g-MO7-ELO-10) (SEQ ID NO: 18) with known ⁇ 9-elongases from Englena gracialis (SEQ IDNO: 4), Isochrysis galbana (SEQ ID NO: 2): Mouse ElovH elongase (Accession # AAG47667; SEQ ID NO: 21), human ELOVL2 elongase (Accession # NP 060240; SEQ ID NO: 22). and C. elegans elongase (Ascess ⁇ on # AF244356: SEQ ID NO: 23). Invariant residues are shaded.
  • Figure 4A shows the ⁇ 9-elongase amino acid sequence from Pavlova salm ' a (Accession # AAY 15135; SEQ ID NO: 1 ).
  • Figure 4B shows the ⁇ 9-elongase amino acid sequence from Isochrysis galbana (Accession #AF39O174; SEQ ID NO: 2).
  • Figure 4C shows the ⁇ 9-elongase amino acid sequence from Eutreptiella sp. (SEQ ID NO: 3).
  • Figare 4D shows the ⁇ 9-elongase amino acid sequence from Eiigkna gracialis (Accession # CAT 16687; SEQ ID NO: 4).
  • Figure 4E shows the A9-eio ⁇ gase amino add sequence from Euglena anahena (SEQ ID NO: 5).
  • Figure 5A shows the nucleotide sequence (SEQ ID NO: 6) of clone piate2 MO7. obtained as described in Example 1.
  • Figure SB shows the deduced amino acid sequence (SEQ ID NO: 7) of clone plate2_MO7, obtained as described in Example I.
  • Figare 6A shows the nucleotide sequence (SEQ ID NO: 13) of the pIate2_MO7 gene fragment putative 3 " -end. obtained as described in Example 2.
  • Figare 6B shows the predicted amino acid sequence (SEQ ID NOs: 14 and 30-32) of the piate2_MO7 gene fragment putative 3 * -end. obtained as described in Example 2. SEQ ID NOs: 14 and 30-32 are separated by an "*". which represents a stop codon.
  • Fig ⁇ re 6C shows SEQ ID NO: 14.
  • Figure 6D shows SEQ ID NO: 30.
  • Figure 6E shows SEQ ID NO: 31.
  • Figure 6F shows SEQ ID NO: 32.
  • Figure 7A shows the nucleotide sequence (SEQ ID NO: 17) of the putative ⁇ 9-elongase from Euglena deses Ehr. CCMP 2916 (Eug-MO7-ELO#10). obtained as described in Example 3.
  • Figare 7B shows the predicted amino acid sequence (SEQ ID NO: 18) encoded by the nucleotide sequence (SEQ ID NO: 17) of the putative ⁇ 9-e!ongase from Euglena deses Ehr. CCMP 2916 (Eug-MO7-ELO# 10), obtained as described in Example 3.
  • Figure 8A shows the nucleotide sequence (SEQ ID NO: 19) of a variant ⁇ 9-elongase from Euglena deses Ehr. CCMP 2916 (Eug-MO7-ELO# 14), obtained as described in Example 3.
  • Fig ⁇ re 8B shows the predicted amino acid sequence (SEQ ID NO: 20) encoded by nucleotide sequence (SEQ ID NO: 19) of the variant ⁇ 9-elongase from Euglena deses Ehr. CCMP 2916 (Eug-MO7-ELO#14). obtained as described in Example 3.
  • Figare 9 A shows the amino acid sequence from Mouse ElovH elongase (Accession # AAG47667: SEQ ID NO: 21).
  • Figure 9B shows the amino acid sequence from human ELOVL2 elongase (Accession # NP 060240; SEQ ID NO: 22).
  • Figure 9C shows the amino acid sequence from C. elegans elongase (Accession # AF244356; SEQ ID NO: 23).
  • the present disclosure is directed to the nucleotide (e.g.. gene) and translated amino acid sequences of a ⁇ 9-elongase gene from Euglenoid sp., for example. Euglena deses Ehr., specifically Euglena deses Ehr. CCMP 2916,
  • the present disclosure also includes uses of the gene and of the enzyme encoded by the gene.
  • the gene and corresponding enzyme may be used in the production of polyunsaturated fatty acids such as. for instance, ⁇ 6-EDA. ⁇ 3- EtrA. DGLA, ⁇ 3-ETA, ARA, EPA. ⁇ 3-docosapentaenoic acid. ⁇ 6-docosapentaenoic acid. ADA. DHA. or any combinations thereof, which may be added to
  • compositions pharmaceutical compositions, nutritional compositions and to other valuable products.
  • Chimeric Construct refers to a combination of nucleic acid molecules that are not normally found together in nature. Accordingly, a chimeric construct may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that normally found in nature.
  • Coding Sequence refers to a DN ⁇ sequence that codes for a specific amino acid sequence.
  • Regulatory sequences refer to nucleotide sequences located upstream (5' non-coding sequences), within, or downstream (3 1 non-coding sequences) of a coding sequence, and which influence the transcription. RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences may include, but are not limited to. promoters, translation leader sequences, introns. and polyadenylation recognition sequences.
  • Complementarity refers to the degree of relatedness between two DNA segments. H is determined by measuring the ability of the sense strand of one DNA segment to hybridize with the antisense strand of the other DNA segment, under appropriate conditions, to form a double helix. In the double helix, adenine appears in one strand, thymine appears in the other strand. Similarly, wherever guanine is found in one strand, cytos ⁇ ne is found in the other. The greater the relatedness between the nucleotide sequences of two DNA segments, the greater the ability to form hybrid duplexes between the strands of the two DNA segments.
  • encoded by refers to a nucleic acid sequence which codes for a polypeptide sequence, wherein the polypeptide sequence or a portion thereof contains an amino acid sequence of at least 3 consecutive amino acids, more preferably at least 8 consecutive amino acids, and even more preferably at least 15 consecutive amino acids from a polypeptide encoded by the nucleic acid sequence.
  • the present disclosure also encompasses an isolated nucleotide sequence which encodes for an enzyme having PUFA e ⁇ ongase activity and that is hybridizable. under moderately stringent conditions, to a nucleic acid having a nucleotide sequence comprising or complementary to a nucleotide sequence comprising SEQ ID NO: 17 or SEQ ID NO: 19 (shown in Figures 7 A and 8A.
  • a nucleic acid molecule is "hybridizable" to another nucleic acid molecule when a single-stranded form of the nucleic acid molecule can anneal to the other nucleic acid molecule under the appropriate conditions of temperature and ionic strength (See, Sambrook et a!.. Molecular Cloning: A Laboratory Manual, Second Edition (1989), Cold Spring Harbor Laboratory Press. Coid Spring Harbor, New York)). The conditions of temperature and ionic strength determine the "stringency" of the hybridization. "Hybridization " requires that two nucleic acids contain complementary sequences. However, depending on the stringency of the
  • mismatches between bases may occur.
  • the appropriate stringency for hybridizing nucleic acids depends on the length of the nucleic acids and the degree of complementation. Such variables are well known to those skilled in the art. More specifically, the greater the degree of similarity or homology between two nucleotide sequences, the greater the value of Tm for hybrids of nucleic acids having those sequences- For hybrids of greater than 100 nucleotides in length, equations for calculating Tm have been derived (See. Sambrook et ai., supra). For hybridization with shorter nucleic acids, the position of mismatches becomes more important, and the length of the oligonucleotide determines its specificity (See, Sambrook et al., supra).
  • stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion. typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30 0 C for short probes (e.g., IO to 50 nucleotides) and at least about 60 0 C for !ong probes (e.g.. greater than 50 nucleotides).
  • Stringent conditions may also be achieved with the addition of destabilizing agents such as fcrmam ⁇ de.
  • An example of low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, ⁇ M NaCL 1% SDS (sodium dodecy! sulphate) at 37°C.
  • X SSC 3.0 M NaCI/0.3 M trisodium citrate
  • An example of moderate stringency conditions include hybridization in 40 to 45% formamide, 1 M NaCl, 1% SDS at 37°C. and a wash in 0.5 X to 1 X SSC at 55 to 60 0 C.
  • An example of high stringency conditions include hybridization in 50% formamide. 1 M NaCl. 1% SDS at 37°C, and a wash in 0.1 X SSC at 60 to 65°C.
  • Exon refers to a portion of the sequence of a gene that is transcribed and is found in the mature messenger RNA derived from the gene, but is not necessarily a part of the sequence that encodes the final gene product.
  • Expression refers to the production of a functional end-product. Expression of a gene involves transcription of the gene and translation of the mRNA into a precursor or mature protein.
  • antisense inhibition refers to the production of antisense RNA transcripts capable of suppressing the expression of the target protein.
  • co suppression refers to the production of sense RNA transcripts capable of suppressing the expression of identical or substantially similar foreign or endogenous genes (See. U.S. Patent No. 5.231,020).
  • fragment or subfragment that is functionally equivalent refers to a portion or subsequence of an isolated nucleic acid molecule in which the ability to alter gene expression or produce a certain phenotype is retained whether or not the fragment or subfragment encodes an active enzyme.
  • the fragment or subfragment can be used in the design of chimeric constructs to produce the desired phenotype in a transformed plant. Chimeric constructs can be designed for use in co-suppression or antisense inhibition by linking a nucleic acid fragment or subfragment thereof, whether or not it encodes an active enzyme, in the appropriate orientation relative to a plant promoter sequence.
  • Gene refers to a nucleic acid molecule that expresses a specific protein, including regulatory sequences preceding (5 1 non-coding sequences) and following (3' non-coding sequences) the coding sequence.
  • the phrase "native gene” refers to a gene as found in nature with its own regulatory sequences.
  • a "foreign" gene refers to a gene not ⁇ ormaily found in the host organism, but that is introduced into the host organism by gene transfer.
  • Foreign genes can comprise native genes inserted into a non-native organism, or chimeric constructs.
  • transgene refers to gene that has been introduced into the genome by a transformation procedure.
  • Gossvpium species refers to any plants of Gossypium arboreum, Gossypium barbadense, Gossypium herbaceum, Gossypium hirsutum. Gossypium hirsutum var h ⁇ rsutum. Gossypium hirsutum var marie-galante. Gossypium lapideum. Gossypium sturtianum. Gossypium thuberi, Gossypium thurberi, Gossypium tomentosum or Gossypium tormenlosuin.
  • homology refers to nucleic acid molecules wherein changes in one or more nucleotide bases does not affect the ability of the nucleic acid molecule to mediate gene expression or produce a certain phenotype. These terms also refer to modifications of the nucleic acid molecules of the instant disclosure such as a deletion or insertion of one or more nucleotides that do not substantially alter the functional properties of the resulting nucleic acid moiecule relative to the initial, unmodified molecu ⁇ e. It is therefore understood, as those skilled in the art will appreciate, that the disclosure encompasses more than the specific exemplary sequences.
  • Host Cell As used herein, the phrase "host cell” is meant a cell, which comprises an isolated nucleic acid sequence or fragment thereof of the present disclosure.
  • Host cells may be prokaryotic cells (e.g. such as Escherichia colL cyanobacteria and Bacillus subtifis), or eukaryotic cells (e.g. such as fungal, insect, plant or mammalian cells).
  • fungal cells that can be used are Saccharomyces spp.. Candida spp., Lipomyces spp., Yarrowia spp., K ⁇ uyveromyces spp., Hansemda spp.. Aspergillus spp., Penicillium spp., Neurospora spp.. Trichodenna spp. and Pichia spp.
  • a particularly preferred fungal cell is Saccharomyces cerevisiae.
  • Plant cells can be monocotyledonous or dicotyledonous plant cells. Particularly preferred plant cells are from oilseed plants such as Glycine max (e.g., soybean), a Brassica species, Cartham ⁇ s linctorius L. (e.g., safflower), Helianthus anntius (e.g., sunflower), Zea mays (e.g., maize), a Gossypium species (cotton) and Limtm usUatissimitm (e.g. flax).
  • oilseed plants such as Glycine max (e.g., soybean), a Brassica species, Cartham ⁇ s linctorius L. (e.g., safflower), Helianthus anntius (e.g., sunflower), Zea mays (e.g., maize), a Gossypium species (cotton) and Limtm usUatissimitm (e.g. flax).
  • Glycine max
  • Identity Sequence Identity, and Percentage of Sequence Identity (% Identity): The terms "identity” or "sequence identity,” used interchangeably herein, when used in the context of nucleotide or polypeptide sequences refer to the nucleic acid bases or amino acid residues in two sequences that are the same when aligned for maximum correspondence over a specified comparison window. Thus, identity is defined as the degree of sameness, correspondence or equivalence between the same strands (either sense or antisense) of two DNA or polypeptide segments.
  • Percentage of sequence identity is calculated by comparing two optimally aligned sequences over a particular region, determining the number of positions at which the identical base occurs in both sequence in order to yield the number of matched positions, dividing the number of such positions by the total number of positions in the segment being compared and multiplying the result by 100.
  • Optimal alignment of sequences may be conducted by the algorithm of Smith & Waterman. Appi Math. 2:482 (1981). by the algorithm of Needleman & Wunsch, j. MoL Biol. 48:443 (1970), by the method of Pearson & Lipman, Proc. Mat!. Acad. Sci. (USA) 85:2444 (1988) and by computer programs which implement the relevant algorithms (e.g., Higgins et aL CABlOS. 5Ll 51-153 (1989)), FASTDB
  • percent sequence identities include, but are not limited to, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78% ⁇ 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%.
  • identities can be determined using any of the programs described herein.
  • the term "indirectly” when used in connection with the use of a gene and its corresponding enzyme in the production of polyunsaturated fatty acids encompasses the situation where a first acid is converted to second acid (i.e., a pathway intermediate) by a first enzyme (e.g., LA to ⁇ 6-EDA, by, for example a ⁇ 9-elongase) and then the second acid is converted to third acid by use of a second enzyme (e.g., ⁇ 6-EDA to DGLA by, for example, ⁇ 8- desaturase).
  • a first enzyme e.g., LA to ⁇ 6-EDA, by, for example a ⁇ 9-elongase
  • a second enzyme e.g., ⁇ 6-EDA to DGLA by, for example, ⁇ 8- desaturase
  • the term "directly" when used in connection with the use of a gene and its corresponding enzyme in the production of polyunsaturated fatly acids encompasses the situation where the enzyme directly converts a first acid to a second acid, wherein the second acid is then utilized in a composition (e.g.. the conversion of LA to ⁇ -EDA by. for example a ⁇ 9-eIongase or ⁇ >3-ETrA Io ⁇ 3 ⁇ ETA by, for example a ⁇ 8-desaturasae).
  • Intron refers to an intervening sequence in a gene that does not encode a portion of the protein sequence. Thus, such sequences are transcribed into RNA but are then excised and are not translated. The term is also used for the excised RNA sequences.
  • Isolated refers to a nucleic acid mo ⁇ ecule (DNA or RNA) or a protein or a biologically active portion thereof that is removed from its naturally occurring environment or source using routine techniques known in the art (e.g., from bacteria, algae, fungi, pJants, vertebrates, mammals, etc.). Isolated nucleic acid molecules or proteins are substantially or essentially free from components that normally accompany or interact with the nucleic acid molecules or proteins in their naturally occurring environment.
  • Isolated Nucleic Acid Fragment or Isolated Nucleic Acid Sequence refers to a polymer of RNA or DNA that is single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases.
  • An isolated nucleic acid fragment in the form of a polymer of DNA may be comprised of one or more segments of cDNA. genomic DNA or synthetic DNA.
  • a "fragment " of a specified polynucleotide refers to a polynucleotide sequence which comprises a contiguous sequence of approximately at least about 6 consecutive nucleotides, preferably at least about 8 consecutive nucleotides, more preferably at least about 10 consecutive nucleotides, at least about 15 consecutive nucleotides, at least about 20 consecutive nucleotides, at least about 25 consecutive nucleotides, etc., identical or complementary to a region of the specified nucleotide sequence.
  • Nucleotides (usually found in their 5' monophosphate form) are referred to by their single letter designation as follows: "A " for adenylate or deoxyadenylate (for RNA or DNA.
  • Mature and Precursor ⁇ s used herein, the term, “mature " when used in connection with the term “protein” refers to a post-translationally processed polypeptide: i.e.. one from which any pre- or propeptides present in the primary translation product have been removed.
  • the term “precursor” when used in connection with the term “protein” refers to the primary product of translation of mRNA; i.e.. with pre- and propeptides still present. Pre- and propeptides may be, but are not limited to. intracellular localization signals.
  • 3' non-coding sequences refers to DNA sequences located downstream of a coding sequence and include polyadenyiation recognition sequences and other sequences encoding regulatory signals capable of affecting mRNA processing or gene expression.
  • the polyadenyiation signal is usually characterized by affecting the addition of polyadenylic acid tracts to the 3' end of the mRNA precursor.
  • the use of different 3' non-coding sequences is exemplified by lngelbrecht et al.. (1989) Plant Cell 1:671 6SO.
  • TNon-Naturally Occurring As used herein, the phrase. * 'non-naturally occurring" refers to something that is artificial, not consistent with what is normally found in nature.
  • operably linked refers to the association of nucleic acid sequences on a single nucleic acid molecule so that the function of one is regulated by the other.
  • a promoter is operably linked with a coding sequence when it is capable of regulating the expression of that coding sequence (i.e.. that the coding sequence is under the transcriptional control of the promoter).
  • Coding sequences can be operably linked to regulatory sequences in a sense or antisense orientation.
  • the complementary RNA regions of the disclosure can be operably linked- either directiy or indirectly. 5 1 to the target mRNA. or 3' to the target mRNA. or within the target mRNA. or a first
  • Plant refers to whole plants, plant organs, plant tissues, seeds, plant cells, seeds and progeny of the same. Plant ceils include, without limitation, cells from seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen and microspores.
  • Polymerase Chain Reaction refers to a technique for the synthesis of large quantities of specific DNA segments, consists of a series of repetitive cycles (Perkin Elmer Cetus instruments, Norwalk, CT). Typically, the double stranded DNA is heat denatured, the two primers complementary to the 3' boundaries of the target segment are annealed at low temperature and then extended at an intermediate temperature. One set of these three consecutive steps is referred to as a cycle.
  • PCR is a powerful technique used to amplify DNA millions of fold, by repeated replication of a template, in a short period of time (Mullis et al. Cold Spring Harbor Symp. Quant. Biol. 51:263 273 (1986); Erlich et al, European Patent Application 50,424; European Patent Application 84,796; European Patent
  • radioactive dNTPs can be added to the PCR in order Io incorporate label into the products.
  • the products of PCR are visualized by exposure of the gel to x-ray film.
  • the added advantage of radio label ing PCR products is that the leve ⁇ s of individual amplification products can be quantitated.
  • promoter * refers to a DNA sequence capable of controlling the expression of a coding sequence or functional RNA.
  • the promoter sequence consists of proximaE and more distal upstream elements, the latter elements often referred to as enhancers.
  • the term “enhancer” refers to a DNA sequence which can stimulate promoter activity and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue-specifictly of a promoter.
  • Promoter sequences can also be located within the transcribed portions of genes, and/or downstream of the transcribed sequences. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental conditions.
  • Promoters which cause a gene to be expressed in most cell types at most times are commonly referred to as "constitutive promoters.” New promoters of various types useful in plant cells are constantly being discovered; numerous examples may be found in the compilation by Okamuro and Goldberg. (1989) Biochemistry of Plants 15:1 82. It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined. DNA molecules of some variation may have identical promoter activity.
  • Recombinant refers to an artificial combination of two otherwise separated segments of sequence, e.g., by chemical synthesis or by the manipulation of isolated segments of nucleic acids by genetic engineering techniques.
  • Recombinant Construct Expression Construct, and Recombinant Expression Construct The phrases “recombinant construct”, “expression construct “ and “recombinant expression construct” are used interchangeably herein and refer to a functional unit of genetic materia! lhat can be inserted into the genome of a ceil using standard methodology well known to one skilled in the art. Such construct may be itself or may be used in conjunction with a vector.
  • a vector is used then the choice of vector is dependent upon the method that will be used to transform host plants as is well known to those skilled in the art.
  • a plasmid vector can be used.
  • the skilled artisan is well aware of the genetic elements that must be present on the vector in order to successfully transform, select and propagate host cells comprising any of the isolated nucleic acid molecules of the disclosure.
  • the skilled artisan will also recognize that different independent transformation events will result in different levels and patterns of expression (Jones et aL (1985) EMBOJ. 4:241 1 2418; De Almeida et aL (1989) MoI. Gen. Genetics 218:78 86). and thus that multiple events must be screened in order to obtain lines displaying the desired expression level and pattern.
  • Such screening may be accomplished by Southern analysis of DNA, Northern analysis of mRNA expression. Western analysis of protein expression, or phenotypic analysis.
  • RNA transcript refers to the product resulting from RNA polymerase-catalyzed transcription of a DNA sequence.
  • the primary transcript or it may be a RNA sequence derived from post- transcript ⁇ onal processing of the primary transcript and is referred to as the mature RNA.
  • mRNA messenger RNA
  • cDNA refers to a DNA that is complementary to and synthesized from a mRNA template using the enzyme reverse transcriptase.
  • the cDNA can be single-stranded or converted into the double- stranded form using the Klenow molecule of DNA polymerase I.
  • Sense RNA refers to RNA transcript that includes the mRNA and can be translated into protein within a cell or in vitro.
  • Antisense RNA refers to an RNA transcript that is complementary to all or part of a target primary transcript or mRNA and that blocks the expression of a target gene (U.S. Patent No. 5,107.065). The complementarity of an antisense RNA may be with any part of the specific gene transcript, i.e., at the 5" non-coding sequence, 3* non-coding sequence, introns, or the coding sequence.
  • RNA refers to antisense RNA, ribozyme RNA. or other RNA that may not be translated but yet has an effect on cellular processes.
  • complement and “reverse complement” are used interchangeably herein with respect to mRNA transcripts, and are meant to define the antisense RNA of the message.
  • endogenous RNA refers to any RNA which is encoded by any nucleic acid sequence present in the genome of the host prior to transformation with the recombinant construct of the present disclosure, whether naturally-occurring or non-naturally occurring, i.e.. introduced by recombinant means, mutagenesis, etc.
  • Similarity when referring to the “similarity” between two amino acid sequences, proteins or polypeptides, refers to the presence of a series of identical as well as conserved amino acid residues in both sequences. The higher the degree of similarity between two amino acid sequences, the higher the correspondence, sameness or equivalence of the two sequences.
  • stable transformation refers to the transfer of a nucleic acid molecule into a genome of a host organism, including both nuclear and organellar genomes, resulting in genetically stable inheritance.
  • transient transformation refers to the transfer of a nucleic acid molecule into the nucleus, or DTNA-containing organelle, of a host organism resulting in gene expression without integration or stable inheritance.
  • Host organisms containing the transformed nucleic acid molecules are referred to as "transgenic " organisms. The preferred method of cell
  • transformation refers to both stable transformation and transient transformation.
  • translation leader sequence refers to a DNA sequence located between the promoter sequence of a gene and the coding sequence.
  • the translation leader sequence is present in the fully processed mRNA upstream of the translation start sequence.
  • the translation leader sequence may affect processing of the primary transcript to mRNA. mRNA stability or translation efficiency. Examples of translation leader sequences have been described (Turner. R. and Foster, G. D. (1995) Molecular Biotechnology 3:225).
  • the enzyme encoded by the ⁇ 9-elongase gene of the present disclosure is essential in the production, via the alternate ⁇ 8-desaturase/ ⁇ 9-elongase pathway, of long-chain polyunsaturated fatty acids (LC-PUFAs), having a length of 20 or greater carbons.
  • LC-PUFAs long-chain polyunsaturated fatty acids
  • the conversion of LA to DGLA and ALA to o>3-ETA using a ⁇ 9- elongase enzyme and a ⁇ 8-desatorasc enzyme is referred to as the alternate ⁇ 8- desaturase/ ⁇ 9-elongase pathway.
  • the conventional ⁇ 6 pathway for converting LA to DGLA and ALA to ⁇ 3-ETA utilizes a ⁇ 6-desafurase enzyme to convert LA to GLA, and ALA to SDA. and a ⁇ 6-eIongase to convert GLA to DGLA, and SDA to ⁇ 3- ETA. respectively.
  • DHA ⁇ 5-desaturase
  • DPA ⁇ 3-docosapentaenoic acid
  • ⁇ 3- docosapentaenoic acid utilizing, for example, a ⁇ 5-elongase and a ⁇ 4- desaturase, respectively.
  • DGLA ⁇ 3-ETA, ARA. EPA, ⁇ 3- docosapentaenoic acid, ⁇ 6-docosapentaenoic acid.
  • ADA and/or DHA can be produced via either the alternate ⁇ 8-desaturase/ ⁇ 9 ⁇ eIongase pathway or the conventional A6 pathway, in certain instances, the alternate ⁇ 8-desaturase/ ⁇ 9- elongase pathway may be preferred over the conventional ⁇ 6 pathway.
  • omega-6 or omega-3 fatty acid intermediates such as GLA or SDA
  • GLA or SDA residual omega-6 or omega-3 fatty acid intermediates
  • ⁇ 3-ETA, ARA, EPA ⁇ 3- docosapentaenoic acid.
  • ADA and/or DHA the alternate ⁇ 8-desaturase/ ⁇ 9-e!ongase pathway may be used as an alternative to the conventional ⁇ pathway, to bypass GLA and SDA formation.
  • ⁇ 9-elongase is a necessary enzyme in the alternate ⁇ 8-desaturase/ ⁇ 9-elongase pathway.
  • EPA for example, cannot be synthesized via the alternate ⁇ 8-desaturase/ ⁇ 9-elongase pathway without the ⁇ 9- elongase gene and enzyme encoded thereby.
  • the isolated ⁇ 9- elongase enzyme of the present disclosure converts, for example, ALA to ⁇ >3-ETrA and LA to ⁇ 6-EDA.
  • ⁇ 3-ETA from co3-ETrA, and EPA from ⁇ 3- ETA is then catalyzed by, for example, a ⁇ 8-desaturase and a ⁇ 5-desaturase, respectively.
  • a ⁇ 8-desaturase and a ⁇ 5-desaturase, respectively.
  • the intermediate GLA and SDA fatty acids are bypassed.
  • the present disclosure also encompasses nucleotide sequences (and the corresponding encoded proteins) having sequences comprising, consisting of, or complementary to at least 68%. 69%. 70%, 71%. 72%. 73%. 74%, 75%. 76%. 77%. 78%.
  • SEQ ID NO: 17 i.e.. the isolated nucleotide sequence of the ⁇ 9-eiongase gene of Euglena deses Ehr. CCMP 2916
  • SEQ ID NO: 19 i.e.. a variant ⁇ 9-elongase gene of Euglena deses Ehr. CCMP 2916.
  • sequences may be from human sources as well as other non- human sources (e.g., C elegcms or mouse).
  • the present disclosure also encompasses fragments and derivatives comprising or consisting of the nucleotide sequence of SEQ ID NO: 17 (shown in Figure 7A) or SEQ ID NO: 19 (shown in Figure 8A)). as well as of the sequences from other sources, and having the above-described complementarity or correspondence.
  • Functional equivalents of the above-sequences i.e.. sequences having ⁇ 9-elongase activity are also encompassed by the present disclosure.
  • Fragments derived from SEQ ID NO: 17 or SEQ ID NO: 19 can have a length comprising or consisting of 10 to about 780 nucleotides. 10 to about 700 nucleotides. 10 to about 650 nucleotides. 10 to about 500 nucleotides. 10 to about 250 nucleotides. 10 to about 100 nucleotides, 10 to about 50 nucleotides, or 15 to 40 nucleotides.
  • the fragments of SEQ ID TNO: 17 and SEQ ID NO: 19 encode a polypeptide having ⁇ 9-elongase activity.
  • fragments of the SEQ ID NO: 17 and SEQ ID NO: 19 can be used as primers and probes. Methods of making primers and probes are well known to those skilled in the art. Such primers and probes can have a length of 10 to 50 nucleotides, preferably from 15 to 40 nucleotides.
  • variants of the nucleotide sequence of SEQ ID NO: 17 or SEQ ID NO: 19 are also contemplated herein. Such variants may contain one or more base pair additions, substitutions, or deletions.
  • Non-limiting examples of nucleotide variants of SEQ ID NO: 17 encompassed by the present disclosure are shown in Tabic A below.
  • One specific example of a variant of SEQ ID NO: 17 is SEQ ⁇ D NO: 19 (see Figure 8A).
  • GCT 24 GCC 24
  • the present disclosure also encompasses nucleotide sequences from other sources, and having the above-described complementarity or correspondence to SEQ ID NO: 17 or SEQ ID NO: 19.
  • Functional equivalents of SEQ ID NO: 17 or SEQ ID NO: 19 i.e., sequences having A9-elongase activity are also encompassed by the present disclosure.
  • the present disclosure also encompasses nucleotide sequences or fragments thereof encoding a polypeptide having ⁇ 9-elongase activity, wherein the amino acid sequence of said polypeptide has at least 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%. 79%. 80%, 81%. 82%, 83%, 84%. 85%, 86%. 87%. 88%, 89%, 90%, 91%, 92%, 93%. 94%, 95%, 96%, 97%, 98% or 99% sequence identity to an amino acid sequence comprising SEQ ID NO: 18 or SEQ ID NO: 20.
  • the disclosure a!so includes an isolated and/or purified polypeptide which eiongales polyunsaturated fatty acids containing unsaturation at the carbon 9 position (i.e.. has ⁇ 9-e!ongase activity) and has at least 68%, 69%. 70%, 7i%. 72%. 73%. 74%. 75%. 76%, 77%, 78%. 79%. 80%. 81%. 82%. 83%. 84%, 85%, 86%. 87%. 88%, 89%. 90%, 91%. 92%. 93%. 94%.95%. 96%.
  • the present disclosure includes a purified polypeptide having an amino acid sequence of SEQ ID NO: 18 or SEQ ID NO: 20.
  • Fragments of the polypeptide having the sequence of SEQ ID TNO: 18 or SEQ ID NO: 20 are also contemplated herein. Such fragments can have a length comprising or consisting of 10 to about 260 consecutive amino acids. 10 to about 200 consecutive amino acids. 10 to about 100 consecutive amino acids. 10 to about 50 consecutive amino acids. 10 to about 40 consecutive amino acids. 10 to about 30 consecutive amino acids, or 10 to about 20 consecutive amino acids.
  • variants of the polypeptide having the sequence of SEQ ID NO: 18 or SEQ ID NO: 20 are also contemplated herein. Such variants may contain one or more amino acid additions, substitutions, or deletions.
  • Non-limiting examples of amino acid variants of SEQ ID NO: 18 encompassed by the present disclosure are shown in Table B below.
  • One specific example of a variant of SEQ ID NO: 18 is SEQ ID NO: 20 (see Figure 8B).
  • nucleic acid e.g.. gene
  • a prokaryot ⁇ c or eukaryotic host cell may be introduced into cither a prokaryot ⁇ c or eukaryotic host cell through the use of a vector or construct.
  • the vector for example, a bacteriophage, cosmid. or plasmid. may comprise the nucleotide sequence encoding the ⁇ 9-elongase enzyme, as well as any regulatory sequence ⁇ e.g.. promoter) which is functional in the host cell and is able to elicit expression of the ⁇ 9-eIongase encoded by the nucleotide sequence.
  • the regulatory sequence is in operable association with or operabJy linked to the nucleotide sequence.
  • regulatory is said to be "operably linked" with a coding sequence if the regulatory sequence affects transcription or expression of the coding sequence.
  • Suitable promoters include, for example, those from genes encoding alcohol dehydrogenase, glyceraldehyde-3 -phosphate dehydrogenase, phosphoglucoisomerase,
  • nucleotide sequences which encode other proteins, oligosaccharides, lipids, etc. may also be included within the vector as well as other regulatory sequences such as a polyadenylation signal (e.g.. the poly-A signal of SV-40T-anligen. ovalalbumin or bovine growth hormone).
  • a polyadenylation signal e.g. the poly-A signal of SV-40T-anligen. ovalalbumin or bovine growth hormone.
  • the vector may then be introduced into the host cell of choice by methods known to those of ordinary skill in the art including, for example, transfcct ⁇ on. transformation and electroporation (see Molecular Cloning: A Laboratory? Manual. 2nd ed.. Vol. 1-3. ed. Sambrook et al.. Cold Spring Harbor Laboratory Press (1989)).
  • the host cell is then cultured under suitable conditions permitting expression of the genes leading to the production of the desired PUFA. which is then recovered and purified using routine techniques known in the art.
  • prokarjotic host ceils include, but are not limited to. bacteria such as Escherichia coli. Bacillus s ⁇ btilis as well as c>anobacteria such as Spirtdina spp. (i.e.. blue-green algae).
  • the eukaryotic cell may be. for example, a mammalian cell, an insect cell, a plant cell or a fungal cell.
  • the fungal ceil may be. for example, Saccharomyces spp., Candida spp., L ⁇ omyces spp., Yarrowia spp.. Aspergillus spp.. Peniciilium spp..
  • the fungal cell may be a yeast cell such as. for example. Saccharomyces spp.. Candida spp..
  • the yeast cell may also be Saccharomyces cerevisiae.
  • the plant cell includes, but is not limited to. plant ceils from oilseed plants such as Glycine max (e.g., soybean), a Brassica species, Carthamus tinctorius L. (e.g., safflower). Helianthus anmts (e.g., sunflower), Zea mays (e.g.. maize), a Gossypium species (e.g., cotton), and Linum usitatissimiim (e.g.. flax).
  • oilseed plants such as Glycine max (e.g., soybean), a Brassica species, Carthamus tinctorius L. (e.g., safflower).
  • Helianthus anmts e.g., sunflower
  • Zea mays e.g.. maize
  • Gossypium species e.g., cotton
  • Linum usitatissimiim e.g.. flax
  • Transient expression in a host cell can be accomplished in a transient or stable fashion. Transient expression can occur from introduced constructs which contain expression signals functional in the host cell, but which constructs do not replicate and rarely integrate in the host cell, or where the host cell is not proliferating.
  • Transient expression also can be accomplished by inducing the activity of a regulatable promoter operably linked to the gene of interest, although such inducible systems frequently exhibit a low basal level of expression.
  • Stable expression can be achieved by introduction of a construct that can integrate into the host genome or that autonomously replicates in the host cell. Stable expression of the gene of interest can be selected for through the use of a selectable marker located on or transfected with the expression construct followed by selection for cells expressing the marker.
  • the site of the construct s integration can occur randomly within the host genome or can be targeted through the use of constructs containing regions of homology with the host genome sufficient to target recombination with the host locus. Where constructs are targeted to an endogenous locus, ail or some of the transcriptional and trans ⁇ ationa! regulatory regions can be provided by the endogenous locus.
  • a transgenic mammal may also be used in order to express the ⁇ 9- elongase enzyme and ultimately the PUFA(s) of interest. More specifically, once the above-described construct is created, it may be inserted into the pronucleus of an embryo. The embryo may then be implanted into a recipient female. Alternatively, a nuclear transfer method could also be utilized (Schnieke, et al.. Science 278:2130- 2133 (1997)). Gestation and birth are then permitted (see, e.g.. U.S. Patent No.
  • Milk, tissue or other fluid samples from the offspring should then contain altered levels of PUFAs, as compared to the levels normally found in the non-transgenic animal. Subsequent generations may be monitored for production of the altered or enhanced levels of PLJFAs and thus incorporation of the gene encoding the desired desaturase enzyme into their genomes.
  • the mammal utilized as the host may be selected from the group consisting of. for example, a mouse, a rat, a rabbit, a pig. a goat a sheep, a horse and a cow. However, any mammal may be used provided it has the ability? to incorporate DNA encoding the enzyme of interest into its genome.
  • Transcriptional and translational initiation and termination regions are operably linked to the DNA encoding the elongase polypeptide.
  • Transcriptional and translational initiation and termination regions are derived from a variety of nonexclusive sources, including the DNA to be expressed, genes known or suspected to be capable of expression in the desired system, expression vectors, chemical synthesis, or from an endogenous locus in a host cell.
  • Expression in a plant tissue and/or plant part presents certain efficiencies, particularly where the tissue or part is one which is harvested early, such as seed, leaves, fruits, flowers, roots, etc. Expression can be targeted to that location with the plant by utilizing specific regulatory sequence such as those of U.S. Patent Nos.
  • the expressed protein can be an enz) me which produces a product which may be incorporated, either directly or upon further modifications, into a fluid fraction from the host plant.
  • Expression of a ⁇ 9-elongase gene, or antisense ⁇ 9-elongase transcripts can alter the levels of specific PUFAs. or derivatives thereof, found in plant parts and/or plant tissues.
  • the ⁇ 9-eIongase polj peptide coding region may be expressed either b> itself or with other genes (e.g.. a gene encoding a ⁇ 8-desaturase, a gene encoding a ⁇ 5-desaturase, a gene encoding a ⁇ 17-desaturase, a gene encoding a ⁇ 5-elongase. and/or a gene encoding a ⁇ 4-desaturase). in order to produce tissues and/or plant parts containing higher proportions of desired PUFAs or in which the PLJFA composition more closely resembles that of human breast milk (see WO 95/24494).
  • genes e.g.. a gene encoding a ⁇ 8-desaturase, a gene encoding a ⁇ 5-desaturase, a gene encoding a ⁇ 17-desaturase, a gene encoding a ⁇ 5-elongase.
  • the termination region may be derived from the 3 " region of the gene from which the initiation region was obtained or from a different gene.
  • a large number of termination regions are known to and have been found to be satisfactory in a variety of hosts from the same and different genera and species.
  • the termination region usually is selected as a matter of convenience rather than because of any particular property.
  • a plant e.g.. Glycine max (soybean) or Brassica napus (canola)
  • plant tissue may also be utilized as a host or host cell, respectively, for expression of the ⁇ 9-eiongase enzyme which may, in turn, be utilized in the production of polyunsaturated fatty acids.
  • desired PLJFAS can be expressed in seed.
  • Methods of isolating seed oils are known in the art.
  • seed oil components may be manipulated through the expression of the ⁇ 9-elongase gene, as w r ell as perhaps desaturase genes (e.g.. ⁇ 8-desaturase.
  • ⁇ 17-desaturasc. ⁇ 5-desaturases, ⁇ 4-desaturase. etc.) and other elongase genes e.g.. ⁇ 5-eio ⁇ gase. etc.
  • a vector which comprises a DNA sequence encoding the ⁇ 9- elongase operably linked to a promoter will be introduced into the plant tissue or plant for a time and under conditions sufficient for expression of the ⁇ 9-elongase gene.
  • the vector ma ⁇ " also comprise one or more genes that encode other enzymes. for example. ⁇ 4-desat ⁇ rase, ⁇ 5-desaturase.
  • the plant tissue or plant may produce the relevant substrate upon which the enzymes act or a vector encoding enzymes which produce such substrates may be introduced into the plant tissue, plant cell or plant. In addition, substrate may be sprayed on plant tissues expressing the appropriate enzymes. Using these various techniques, one may produce PUFAs by use of a plant cell, plant tissue or plant.
  • the disclosure also encompasses a transgenic plant comprising the above-described vector, wherein expression of the nucleotide sequence of the vector results in production of a polyunsaturated fatty acid in. for example, the seeds of the transgenic plant.
  • the development or regeneration of plants containing the foreign, exogenous gene that encodes a protein of interest is well known in the art.
  • the regenerated plants are self-pollinated to provide homozygous transgenic plants. Otherwise, pollen obtained from the regenerated plants is crossed to seed-grown plants of agronomically important lines. Conversely, pollen from plants of these important lines is used to pollinate regenerated plants.
  • a transgenic plant of the present disclosure containing a desired polypeptide is cultivated using methods well known to one skilled in the art.
  • soybean (U.S. Patent No. 5.569,834, U.S. Patent No. 5,416,0i l, McCabe et. aL. BiolTechnology 6:923 (1988). Christou et aL, Plant Physiol 87:671 674 (1988)); Brassica (U.S. Patent No. 5,463.174); peanut (Cheng et ah. Plant Cell Rep. 15:653 657 (1996), McKently. et aL, Plant Cell Rep. 14:699 703 (1995)): papaya; and pea (Grant et aL, Plant Cell Rep. 15:254258, ( 1995)).
  • Assays for gene expression based on the transient expression of cloned nucleic acid constructs have been developed by introducing the nucleic acid molecules into plant celis by polyethylene glycol treatment, elcctroporation. or particle bombardment (Marcotte et aL Nature 335:454457 (1988): Marcotte ct a!.. Plant Cell 1 :523 532 (1989): McCarty et aL. Cell 66:895 905 (1991): Hattori et al.. Genes Dev. 6:609 618 (1992): Goff et al., EMBOJ. 9:2517 2522 (1990)).
  • Transient expression systems may be used to functionally dissect gene constructs (see generally. MaI iga et al.. Methods in Plant Molecular Biology. Cold Spring Harbor Press (1995)). It is understood that any of the nucleic acid molecules of the present disclosure can be introduced into a plant cell in a permanent or transient manner ⁇ n combination with other genetic elements such as vectors, promoters, enhancers etc.
  • the present disclosure encompasses a method of producing the ⁇ 9-elongase enzyme comprising the steps of: I) isolating a nucleotide sequence comprising or complementary to at least 68% of the nucleotide sequence encoding the ⁇ 9-eIongase enzyme (e.g.. a nucleotide sequence selected from the group consisting of SEQ ID NO: 17 and SEQ ID NO: 19): 2) constructing an expression vector comprising the nucleotide sequence operably linked to a regulatory sequence: and 3) introducing the vector into a host cell under time and conditions sufficient for the production of the ⁇ 9-ebngase enzyme.
  • a nucleotide sequence comprising or complementary to at least 68% of the nucleotide sequence encoding the ⁇ 9-eIongase enzyme (e.g.. a nucleotide sequence selected from the group consisting of SEQ ID NO: 17 and SEQ ID NO: 19): 2) constructing an expression vector comprising the
  • the present disclosure also encompasses a method of producing polyunsaturated fatly acids, ⁇ n one aspect, the method involves: I) isolating a nucleotide sequence comprising or complementary to at least 68% of the nucleotide sequence encoding the ⁇ 9-elongase enzyme (e.g., a nucleotide sequence selected from the group consisting of SEQ ID NO: 17 and SEQ ID NO: 19); 2) constructing an expression vector comprising the nucleotide sequence operabiy linked to a regulatory sequence; 3) introducing the expression vector into a host cell under time and conditions sufficient for the production of a ⁇ 9-eIongase enzyme; and 4) exposing the expressed ⁇ 9-elongase to a substrate polyunsaturated fatty acid in order to convert the substrate polyunsaturated fatty acid to a first product polyunsaturated fatty acid.
  • a nucleotide sequence comprising or complementary to at least 68% of the nucleotide
  • substrate PUFAs examples include LA. ALA. and combinations thereof.
  • first product polyunsaturated fatty acid that can be produced by this method are ⁇ 6-EDA, ⁇ 3-ETrA, or both ⁇ 6-EDA and ⁇ 3-ETrA.
  • LA is exposed to a ⁇ 9-elongase enzyme
  • ALA is exposed to a ⁇ 9-elongase enzyme
  • it is converted to ⁇ >3-ETrA.
  • the method can further involve the step(s) of exposing the first product polyunsaturated fatty acid to at least one desaturase, at least one additional elongase, or combinations thereof, and optionally repeating this step (i.e.. exposing the second or subsequent product polyunsaturated fatty acid to a desaturase or elongase (which can be the same or different from any previously used desaturase or elongase) to convert the first product polyunsaturated fatty acid to a second or subsequent (e.g.. third, fourth, fifth, sixth, etc.) product polyunsaturated fatty acid).
  • This step can be repeated as many times as necessary until the desired product polyunsaturated fatty acid is obtained. For example, if the first product
  • the method can further comprise exposing ⁇ - EDA to. for example. ⁇ 8-desaturase which converts the ⁇ 6-EDA to DGLA (a second product polyunsaturated fatty acid).
  • the EKJLA then may optionally be converted to ARA (a third product polyunsaturated fatty acid) by exposing the DGLA to. for example, ⁇ 5-desaturase.
  • the ARA can then be exposed to a ⁇ 17-desaturase to produce EPA (a fourth product polyunsaturated fatty acid).
  • the EPA can be exposed to a ⁇ 5 ⁇ efongase to produce DPA (a fifth product polyun saturated fatty acid).
  • the DPA can then optionally be exposed to a ⁇ 4- desaturase to produce DHA (a sixth product polyunsaturated fatty acid).
  • the method can further comprise exposing the oo3-ETrA to, for example. ⁇ 8-desaturase which converts the ⁇ 3-ETrA to ETA (a second product polyunsaturated fatty acid).
  • the ETA may then be converted to EPA (a third product polyunsaturated fatty acid) by- exposing the ETA to, for example. ⁇ 5-desaturase.
  • the EPA may be further converted to other polyunsaturated fatty acids as described above.
  • the method involves: 1) isolating a nucleotide sequence comprising or complementary to at least 68% of a nucleotide sequence encoding the ⁇ 9-elongase enzyme (e.g., a nucleotide sequence selected from the group consisting of SEQ ID NO: 17 and SEQ ID NO: 19); 2) constructing an expression vector comprising the isolated nucleotide sequence operabiy linked to a regulatory sequence; 3) introducing the expression vector and at least one additional recombinant DNA construct comprising an isolated nucleotide sequence encoding a ⁇ 8-desaturase and operabiy linked to at least one regulator ⁇ ' sequence into a host cell for a time and under conditions sufficient for expression of a ⁇ 9-elongase and the ⁇ 8- desaturase; and 4) exposing the expressed ⁇ 9-elongase and the ⁇ 8-desaturase to a substrate polyunsaturated fatty acid selected from the group
  • the method can further involve the step(s) of exposing the first product polyunsaturated fatty acid to at least one additional desaturase or at least one additional elongase and. optionally, repeating this step ⁇ namely, exposing the second or subsequent product polyunsaturated fatty acid to a desaturase or eiongase (which can be the same or different from any desaturase or eiongase used previously)) to convert the first product polyunsaturated fatty acid (e.g.. DGLA and/or OJ3-ETA) to a second or subsequent (e.g.. third, fourth, fifth, sixth, etc.) product polyunsaturated fatty acid.
  • a desaturase or eiongase which can be the same or different from any desaturase or eiongase used previously
  • the method further includes introducing into the host cell a recombinant DNA construct comprising an isolated nucleotide sequence encoding a ⁇ 5-desaturase operably linked to a regulatory sequence.
  • polyunsaturated fatty acids which may be used, in turn, for particular beneficial purposes, or may be used in the production of other PUFAs.
  • the ⁇ 9-isolated eiongase gene and the ⁇ 9-eIongase enzyme encoded thereby have many uses.
  • the gene and corresponding enzyme may be used indirectly or directly in the production of polyunsaturated fatty acids, for example.
  • ⁇ 9-elongase may be used in the production of ⁇ 6-EDA.
  • ⁇ 3-ETrA DGLA- ⁇ 3-ETA.
  • ARA EPA, ⁇ 3-docosapentaenotc acid. ⁇ 6-docosapentaenoic acid. ADA and/or DHA.
  • Directly is meant to encompass the situation where the enzyme directly converts the acid to another acid, the latter of which is utilized in a composition (e.g.. the conversion of LA to ⁇ 6-EDA).
  • Indirectly is meant to encompass the situation where an acid is converted to another acid (i.e., a pathway intermediate) by the enzyme (e.g., LA to ⁇ 6-EDA) and then the latter acid is converted to another acid by use of a non-elongase enzyme (e.g.. ⁇ 6-EDA to DGLA by. for example. ⁇ 8-desaturase.
  • a non-elongase enzyme e.g.. ⁇ 6-EDA to DGLA by. for example. ⁇ 8-desaturase.
  • Nutritional Compositions those produced either directiy or indirectly by activity of the ⁇ 9-elongase enzyme may be added to.
  • nutritional compositions for example, nutritional compositions, pharmaceutical compositions, cosmetics, and animal feeds, all of which are encompassed by the present disclosure. These uses are described, in detail, below.
  • compositions for purposes of the present disclosure, include any food or preparation for human consumption including for enteral or parenteral consumption, which when taken into the body (a) serve to nourish or build up tissues or supply energy and/or (b) maintain, restore or support adequate nutritional status or metabolic function.
  • the nutritional composition of the present disclosure comprises at least one oil or acid produced directly or indirectly by use of the ⁇ 9-elongase gene, as described herein, and may either be in a solid or liquid form. Additionally, the composition may include edible macronutrients. vitamins and minerals in amounts desired for a particular use. The amount of such ingredients will vary depending on whether the composition is intended for use with normal, healthy infants, children or adults having specialized needs such as those which accompany certain metabolic conditions (e.g.. metabolic disorders).
  • Examples of macronutrients which may be added to the composition include but are not limited to edible fats, carbohydrates and proteins.
  • edible fats include but are not limited to coconut oil, soy oil, and mono- and diglycerides.
  • carbohydrates include but are not limited to glucose, edible lactose and hydrolyzed search.
  • proteins which may be utilized in the nutritional composition of the disclosure include but are not limited to soy proteins, electrodialysed whey, electrodialysed skim milk, milk whey, or the hydrolysates of these proteins.
  • vitamins and minerals the following may be added to the nutritional compositions of the present disclosure: calcium, phosphorus, potassium, sodium, chloride, magnesium, manganese, iron, copper, zinc, selenium, iodine, and Vitamins A, E. D. C. and the B complex. Other such vitamins and minerals may also be added.
  • the components utilized in the nutritional compositions of the present disclosure will be of semi-purified or purified origin. By semi-purified or purified is meant a material which has been prepared by purification of a natural material or by synthesis.
  • Examples of nutritional compositions of the present disclosure include but are not limited to infant formulas, dietary supplements, dietary substitutes, and rehydration compositions.
  • Nutritional compositions of particular interest include but are not limited to those utilized for enteral and parenteral supplementation for infants, specialty infant formulas, supplements for the elderly, and supplements for those with gastrointestinal difficulties and/or malabsorption.
  • the nutritional composition of the present disclosure may also be added to food even when supplementation of the diet is not required.
  • the composition may be added to food of any type including but not limited to margarines, modified butters, cheeses, milk, yogurt, chocolate, candy, snacks, salad oils, cooking oils, cooking fats, meats, fish and beverages.
  • the nutritional composition is an enteral nutritional product more preferably, an adult or pediatric enteral nutritional product. Tills composition may be administered to adults or children experiencing stress or having specialized needs due to chronic or acute disease states.
  • the composition may comprise, in addition to polyunsaturated fatty acids produced in accordance with the present disclosure, macronutrients, vitamins and minerals as described above.
  • the macronutrients may be present in amounts equivalent to those present in human milk or on an energy basis, i.e., on a per calorie basis.
  • the enteral formula for example, may be sterilized and
  • the powder can be prepared by spray drying the formula prepared as indicated above, and reconstituting it by rehydrating the concentrate.
  • Adult and pediatric nutritional formulas arc well known ⁇ n the art and are commercially available (e.g.. Similac®. Ensure®. Jev ⁇ ty® and Alimentum® from Ross Products Division, Abbott Laboratories, Columbus. Ohio).
  • An oil or acid produced in accordance with the present disclosure may be added Io any of these formulas.
  • the energy density of the nutritional compositions of the present disclosure when in liquid form, may range from about 0.6 Kcal to about 3 Kcal per ml.
  • the nutritional supplements may contain from about 1.2 to more than 9 Kcais per gram, preferably about 3 to 7 Kcals per gm.
  • the osmolality of a liquid product should be less than 700 mOsm and. more preferably, less than 660 mOsm.
  • the nutritional formula may include macronutrients, vitamins, and minerals, as noted above, in addition to the PUFAs produced in accordance with the present disclosure.
  • the presence of these additional components helps the individual ingest the minimum daily requirements of these elements.
  • a pharmaceutical composition may also be supplemented with these elements.
  • the nutritional composition comprises, in addition to antioxidants and at least one PUFA, a source of
  • the nutritional composition additionally comprises protein, taurine, and carnitine.
  • the PUFAs produced in accordance with the present disclosure, or derivatives thereof, may be added to a dietary substitute or supplement, particularly an infant formula, for patients undergoing intravenous feeding or for preventing or treating malnutrition or other conditions or disease states.
  • human breast milk has a fatty acid profile comprising from about 0.15% Io about 0.36% as DHA. from about 0.03% to about 0.13% as EPA. from about 030% to about 0.88% as ⁇ RA, from about 0.22% to about 0.67% as DGLA. and from about 0.27% to about 1.04% as GLA.
  • fatty acids such as ARA.
  • EPA and/or DHA produced in accordance with the present disclosure, can be used to alter, for example, the composition of infant formulas in order to better repiicate the PUFA content of human breast milk or to alter the presence of PUFAs no ⁇ naily found in a non-human mammal's milk.
  • a composition for use in a pharmacologic or food supplement particularly a breast milk substitute or supplement will preferably comprise one or more of ARA, EPA. DGLA. and DHA. More preferably, the oil will comprise from about 0.3 to 30% ARA. and from about 0.2 to 30% DGLA.
  • Parenteral nutritional compositions comprising from about 2 to about 30 weight percent fatty acids calculated as triglycerides are encompassed by the present disclosure.
  • Other vitamins particularly fat-soluble vitamins such as vitamin A- D, E and L-carnit ⁇ ne can optionally be included.
  • a preservative such as alpha-tocopherol may be added in an amount of about 0.1% by weight.
  • the ratios of ARA and DGLA can be adapted for a particular given end use.
  • a composition which comprises one or more of ARA, DGLA and GLA will be provided in a ratio of about 1:19:30 to about 6:1:0.2, respectively.
  • the breast milk of animals can vary in ratios of ARA:DGLA:GLA ranging from 1 : 19:30 to 6: 1 :0.2, which includes intermediate ratios which are preferably about 1:1: 1. 1 :2:1. 1 : 1 :4.
  • adjusting the rate and percent of conversion of a precursor substrate such as EDA and DGLA to ARA can be used to precisely control the PUFA ratios.
  • a 5% to 10% conversion rate of DGLA to ARA can be used to produce an ARA to DGLA ratio of about 1 : 19.
  • a conversion rate of about 75% to 80% can be used to produce an ARA to DGLA ratio of about 6:1. Therefore, whether in a cell culture system or in a host animal, regulating the timing, extent and specificity of elongase expression, as well as the expression of desaturases (such as but nol limited to ⁇ 8-desaturases) and other elongases. can be used to modulate PUFA levels and ratios.
  • the PUFAs/acids produced in accordance with the present disclosure e.g.. ARA and EPA
  • may then be combined with other PUFAs/acids e.g.. DGLA in the desired concentrations and rat ⁇ os.
  • PUFA produced in accordance with the present disclosure or host cells containing them may also be used as animal food supplements to alter an an ⁇ maFs tissue or milk fatty acid composition to one more desirable for human or animal consumption.
  • infant Formulations examples include, but are not limited to, ⁇ somii® Soy Formula with Iron. Isomil® DF Soy Formula For Diarrhea, Isomil® Advance® Soy Formula with Iron. Isomil® Advance® 20 Soy Formula With Iron Ready To Feed. Similac® Infant Formula, Similac® Advance® Infant Formula with Iron, Similac® NeoSure® Advance® Infant Formula With iron. Similac Natural Care Advance Low-Iron Human Milk Fortifier Ready To Use. all commercially available from Abbott Nutrition (Columbus, OH).
  • the various PUFAs of the present disclosure can be substituted and/or added to the infant formulae described herein and to other infant formulae known to those in the art.
  • Nutritional Formulations examples include, but are not limited to. ENSURE®. ENSURE® HIGH PROTEIN. ENSURE PLUS®. ENSURE® POWDER, ENSURE® PUDDING- ENSURE® WITH FIBER. OxepaTM Nutritional Product, all commercially available from Abbott Nutrition (Columbus. OH), The various nutritional supplements described above and known to others of skill in the art can be substituted and/or supplemented with the PUFAs produced in accordance with the present disclosure. Pharmaceutical Compositions
  • the present disclosure also encompasses a pharmaceutical composition comprising one or more of the acids and/or resulting oils produced using the ⁇ 9-elongase genes described herein, in accordance with the methods described herein. More specifically, such a pharmaceutical composition may comprise one or more of the acids and/or oi ⁇ s as weli as a standard, well-known, non-toxic pharmaceutically acceptab ⁇ e carrier, adjuvant or vehicle such as. for example, phosphate buffered saline, water, ethanol. polyols. vegetable oils, a wetting agent or an emu ⁇ sion such as a water/oil emulsion.
  • the composition may be in either a liquid or solid form.
  • the composition may be in the form of a tablet capsule, ingestible liquid or powder, injectible. or topical ointment or cream.
  • Proper fluidity can be maintained, for example, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants.
  • isotonic agents for example, sugars, sodium chloride and the like.
  • the composition can also include adjuvants, such as wetting agents, emulsifying and suspending agents, sweetening agents, flavoring agents and perfuming agents.
  • Suspensions in addition to the active compounds, may comprise suspending agents such as. for example, ethoxylated isostearyl alcohols,
  • polyoxyethylene sorbitol and sorbitan esters polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide. bentonite, agar-agar and tragacanth or mixtures of these substances.
  • Solid dosage forms such as tablets and capsules can be prepared using techniques weli known in the art.
  • PUFAs produced in accordance with the present disclosure can be tableted with conventional tablet bases such as lactose, sucrose, and cornstarch in combination with binders such as acacia, cornstarch or gelatin, disintegrating agents such as potato starch or alginic acid, and a lubricant such as stearic acid or magnesium stearate.
  • Capsules can be prepared by incorporating these excip ⁇ ents into a gelatin capsule along with antioxidants and the
  • the antioxidant and PUFA components should fit ⁇ , ⁇ lhin the guidelines presented above.
  • the PUFAs produced in accordance w ith the present disclosure or derivatives thereof may be incorporated into commercial formulations such as IntralipidsTM.
  • the typical normal adult plasma fatty acid profile comprises 6.64 to 9.46% ARA. 1.45 to 3. N % of DGLA. and 0.02 to 0.08% of GLA.
  • These PUFAs or their metabolic precursors can be administered alone or in combination with other PUFAs in order to achieve a normal fatty acid profile in a patient
  • the individual components of the formulations may be provided individually, in kit fo ⁇ n. for single or multiple use.
  • a typical dosage of a particular fatty acid is from 0.1 mg to 20 g (up to 100 g) daily and is preferably from 10 mg to 1. 2. 5 or 10 g daily.
  • compositions of the present disclosure include, for example, enteral (e.g., oral and rectal) and parenteral.
  • enteral e.g., oral and rectal
  • parenteral e.g., a liquid preparation may be administered, for example, orally or rectally.
  • a homogenous mixture can be completely dispersed in water, admixed under sterile conditions with physiologically acceptable diluents, preservatives, buffers or prope Hants in order to form a spray or inhalant.
  • the route of administration will, of course, depend upon the desired effect. For example, if the composition is being utilized to treat rough, dry. or aging skin, to treat injured or burned skin, or to treat skin or hair affected by a disease or condition, it may perhaps be applied topically.
  • composition to be administered to the patient may be determined by one of ordinary skill in the art and depends upon various factors such as weight of the patient age of the patient immune status of the patient, etc.
  • the composition may be. for example, a solution, a dispersion, a suspension, an emulsion or a sterile powder which is then reconstituted.
  • the present disclosure also includes the treatment of various disorders by use of the pharmaceutical and/or nutritional compositions described herein.
  • the compositions of the present disclosure may be used to treat restenosis after angioplasty.
  • symptoms of inflammation, rheumatoid arthritis, asthma and psoriasis may also be treated with the compositions of the disclosure.
  • Evidence also indicates that PUFAs may be involved in calcium metabolism; thus, the compositions of the present disclosure may. perhaps, be utilized in the treatment or prevention of osteoporosis and of kidney or urinary tract stones.
  • compositions of the present disclosure may also be used in the treatment of cancer.
  • Malignant cells have been shown to have altered fatty acid compositions.
  • Addition of fatty acids has been shown to slow their growth, cause eel! death and increase their susceptibility to chemotherapeutic agents.
  • compositions of the present disclosure may also be useful for treating cachexia associated with cancer.
  • compositions of the present disclosure may also be used to treat diabetes (see U.S. Patent No. 4.826.877 and Horrobin et aL Am. J. Clin. Nutr. 1993) Vol. 57 (Suppi.) 732S-737S). Altered fatty acid metabolism and composition have been demonstrated in diabetic animals.
  • compositions of the present disclosure comprising PUFAs produced either directly or indirectly through the use of the ⁇ 9-elongase enzyme, may also be used in the treatment of eczema, in the reduction of blood pressure- and in the improvement of mathematics examination scores. Additionally, the compositions of the present disclosure may be used in inhibition of platelet aggregation, induction of vasodilation, reduction in cholesterol levels, inhibition of proliferation of vessel wall smooth muscle and fibrous tissue (Brenner et ah. Adv. Exp. Med. Biol. (1976) Vol. 83. p.85-101). reduction or prevention of gastrointestinal bleeding and other side effects of non-steroidal anti-inflammatory drugs (see U.S. Patent No.
  • compositions of the present disclosure include use in the treatment of AIDS, multiple sclerosis, and inflammatory skin disorders, as well as for maintenance of general health.
  • composition of the present disclosure may be utilized for cosmetic purposes. It may be added to pre-existing cosmetic
  • compositions such that a mixture is formed or may be used as a sole composition.
  • compositions may be utilized in connection with animals (i.e.. domestic or non-domestic), as well as humans, as animals experience many of the same needs and conditions as humans.
  • animals i.e.. domestic or non-domestic
  • the oil or acids of the present disclosure may be utilized in animal or aquaculture feed supplements, animal feed substitutes, animal vitamins or in animal topical ointments.
  • Example 1 cDN A Library Construction from Eug ⁇ ena deses Ehr. CCMP 2916 and
  • Table 1 Fatty acid profile of Euglena deses Ehr. CCMP 2916
  • micro-cDNA ⁇ ibrary was constructed by Agencourt Biosciences (Waltham, MA), using 50 ⁇ g of RNA from Euglena deses Ehr. CCMP 2916 by proprietary technology. Agencourt uses several unique and proprietary steps during first strand that ultimately yields a 25 to 30% increased efficiency over commonly used techniques. During the proprietary process, the R]NA is reverse transcribed into ssDNA using conditions designed to reduce or eliminate internal priming events. The combination of this and a specialized cycling program increases the number of full- length clones.
  • the cDNA clones are then size selected at greater than 1.2kb to decrease preferential cloning of small, truncated cDNAs.
  • the insert size selected is >4kb to enhance for the larger insert clones.
  • cDNA ends are polished and the cDNAs are digested using the rare cutting enzyme.
  • a "rare-cutter " restriction enzyme, the site for which is introduced into the clones during the cDNA priming step, is then used to prepare the clones for directional cloning into the pAGEN vector.
  • the "rare-cutter" restriction enzyme is 20 times less likely to cut within the cDNA clones, thus yielding many more full-length clones versus other cDNA library construction processes, which utilize more common restriction enzymes that cut at random intervals along the clone.
  • the result is an insert with a 5 * blunt end and a 3 " overhang created from the rare cutting restriction enzyme. Because of this process, no additional adapter ligation is required to ensure directional cloning. This improves the overall efficiency of the cloning process.
  • the vector is specially engineered for directional cloning without the use of 5 * adaptors, further enhancing the
  • Example 2 isolation of the 3 ' -end of the plate2 MO7 elongase from Euslena deses
  • the first strand cDNA was diluted in 100 ⁇ l of Tricine-EDTA buffer [10 mM Tricine-KOH (pH 8.5). 1.0 mM EDTA] and enzymes heat inactivated at 72°C for 7 minutes.
  • Amplification was carried out using 0.25 ⁇ l ( 100 mM) of the gene specific primer. 0.25 ⁇ l (100 mM) ofthe UPM primer. 2.5 ⁇ l of cDNA template, 2.5 ⁇ l of 2.5 mM dNTP. 5 ⁇ l of 5X PCR Buffer (Advantage® GC II polymerase buffer (Clontcch). 200 mM Tricine-KOH (pH 9.2), 75 mM potassium acetate. 17.5 mM magnesium acetate. 25% DMSO. 18.75 ⁇ g/ml BSA. 0.005 % Tween 20. 0.005% Nomdet-P40).
  • 64°C for 30 seconds, and 68°C for 3.3 minutes 3 cycles of 94°C for 30 seconds, 62°C for 30 seconds, and 68°C for 1.30 minutes: 4 cycles of 94°C for 30 seconds, 60 0 C for 30 seconds, and 68°C for 1.30 minutes: and 26 cycles of 94°C tor 30 seconds, 58°C for 30 seconds, and 68°C for 1.30 minutes.
  • a final extension cycle at 68°C for 10 minutes was carried out before the reaction was terminated at 4°C.
  • a 548 bp amplicon (SEQ ID NO: 13; Figure 6A). obtained by nested PCR. was gel purified using the Qiagen GeI Purification kit (Qiagen). and was cloned into pTZ57R/T vector (T/A cloning vector. MBI Fermentas) and sequenced. Sequencing revealed that this fragment (SEQ ID NO: 13) was contained the complete 3 * - end of the pIate2_MO7 elongase fragment along with the 'TAG * stop codon and downstream region containing the polyA tail. The predicted amino acid sequence of this fragment (SEQ ID NOs: 14 and 30-32) is shown in Figure 6B. The first asterisk denotes the stop site of the plate 2 MO7 encoded protein.
  • Example 3 Isolation of the FuH-Length plate2 M07 Eiongase Gene from Eug/ena deses Ehr. CCMP 2916
  • the fi ⁇ li-length gene sequence of piate2_MO7 elongase was isolated by PCR amplification using the Euglena deses Ehr. cDNA library as the template, and primers that were designed Io contain the 5 * - and 3 " - ends of the piate2JVfG7 gene based upon sequence information obtained in Example I and Exainp ⁇ e 2.
  • primers that were designed Io contain the 5 * - and 3 " - ends of the piate2JVfG7 gene based upon sequence information obtained in Example I and Exainp ⁇ e 2.
  • BamW/HindlH sites were incorporated into the primers (underlined) to facilitate cloning of the gene into the BamHVHindlll sites of the yeast expression vector, pYX242.
  • the follow ing primer sequences were used:
  • M07-E1O forward primer 5 ' - CAC CAT GGA TCC ATG G ⁇ C GTC GCG ACT ACG CTG G -3 " (SEQ ID NO: 15).
  • M07-E ⁇ O reverse primer 5 " - ACG CGT AAG CTT CTA GTC CAC TTT CTT CTC ATC Crr C-3- ⁇ SEQ ID NO: 16).
  • Amplification was carried out using 0.5 ⁇ l ( 100 ⁇ M) of each primer.
  • 1 ⁇ l (— I IOng) of the E ⁇ glena deses Ehr. cDNA library plasmid pool as the template.
  • 5 ⁇ l of 2.5 mM dNTP. 10 ⁇ l of 5X Phusion GC Buffer (Finnzymes).
  • Samples were denatured initially at 98°C for 3 minutes, followed by 2 cycles of 98°C for 8 seconds, 60 0 C for 12 seconds, and 72°C for 45 seconds; and 28 cycles of 98°C for 8 seconds. 58°C for 12 seconds, and 72°C for 45 seconds. A final extension cycle at 72°C for 3 minutes was carried out before the reaction was terminated at 4°C.
  • Eug- MO7-ELG #14 revealed a number of nucleotide and corresponding amino acid changes when compared to the original Eug-MO7-ELO#10 clone (see Table 2 and Figures 2A and 2B).
  • the nucleotide (SEQ ID NO: 19) and predicted amino acid sequence (SEQ ID NO: 20) of Eug-MO7-ELO #14 are shown in Figures 8A and 8B. respective! ⁇ 5 . Both the original Eug-MQ7-£LO#i0 clone arid the variant Eug-MO7- ELO #14 were used for expression analysis.
  • Pair wise alignment of SEQ ID NO: 18 to the known ⁇ 9-eIongase from E ⁇ glena grac ⁇ alis (Accession # CAT ( 6687: SEQ ID NO: 4) revealed a much higher amino acid sequence identity (66% identity).
  • the default parameters of Vector NTI@AlignX program were used for pair wise alignment.
  • Pair wise alignment with the Pavlova salinu ⁇ 9-eIongase (SEQ ID NO: 1) revealed only -15% sequence identity .
  • -HXXHH * motif (SEQ ID NO: 28) is replaced with a Glutam ⁇ ne (Q) resulting in -QXXHH" (SEQ ID NO: 29) as the conserved motif.
  • This QXXHH (SEQ ID NO: 29) motif is found in most of the ⁇ 9-eSongases including Eug-MO7-ELO#10. In addit ⁇ on. the Eug-MO7-ELO# 10 elongase contains other invariant residues that are present in most eiongases to date, as described by Leonard, et a!.. "Elongation of long-chain fatty acids, " Prog Lipid Res. (2004) Vol. 43. p. 36-54.
  • Figures 3A and 3B depict an alignment of the amino acid sequence from Eug-MO7-ELO#10 elongase with other known eiongases that have varying substrate specificity. These include the Mouse ElovI4 elongase (Accession #
  • AAG47667 SEQ ID NO: 21 ; Figure 9A).
  • human ELOVL2 elongase (Acession # NPJ)60240; SEQ ID NO: 22: Figure 9B), and C. elegans eiongase (Accession # AF244356; SEQ ID NO: 23).
  • C. elegans eiongase accesion # AF244356; SEQ ID NO: 23
  • Invariant amino acids in the alignment are shaded. It is assumed that these invariant residues are important determinants for functionality of these elongating enzymes due to high degree of conservation across species.
  • the Eug-MO7 ⁇ ELG#1G and Eug-MO7-ELG#14 variant encoding a putative ⁇ 9-elongase were cloned into BamHHHimlIII sites of the yeast expression vector. pYX242 (Novagen), respectively. These constructs were transformed into competent Saccharamyces cerevisiae strain SC334 cells. Yeast transformation was carried out using the Aikal ⁇ - €at ⁇ on Yeast Transformation Kit (QBioGene) according to conditions specified by the manufacturer. Transforrnants were selected for leucine auxotrophy on media lacking leucine (DOB [-Leu]).
  • Linoleic acid (18:2 n-6) Eicosadienoic acid (EDA, 20:2 n-6)
  • GLA Gamma-li ⁇ olenic acid
  • DGLA Dihomo- ⁇ -l ⁇ nolenic acid
  • Arachidonic acid (ARA, 20:4 n-6) ⁇ > Adrenic acid ( ⁇ 6-ADA. 22:4 n-6)
  • the negative control strain consisted of ⁇ YX242 vector expressed in S. cerevisiae 334.
  • yeast cells were spun down at 2000 rpm for 15 minutes and 0.5 ml water was added, samples vortexed, followed by addition of 10 ml methanol with gentle swirling. 20 ml chloroform w?as then added, samples were vortexed for 1 minute at high speed and allowed to stand for 2 hours at room temperature. 6 m ⁇ saline was then added to the sample followed by centrifugation at 2200 rpm for 10 minutes. The upper chloroform layer was removed to a clean/dry 30 ml vial and chloroform evaporated to dryness at 40 0 C under a stream of nitrogen. Once the solvents had completely evaporated, 2 ml chloroform was added to each vial and samples were derivatized.
  • each tube was spiked with 100 ⁇ l internal standard (17.216 ⁇ g/100 ⁇ l) Triheptadecanoin. Chloroform was evaporated to dryness under nitrogen at 40 0 C, 2 ml Boron Trifluoride in 14% Methanol was added, followed by addition of 2 drops (-50 ⁇ l) Toluene. Each vial was flushed with nitrogen, and heated for 15 minutes at 95°C. After vials had cooled. 2 ml saline was added and lipids extracted with 4 ml hexane by vigorously vortexing for 1 minute.
  • FAME Fatty acid methyl esters
  • the hexane extract was then transferred into a 20 ml clean/dry screw-cap tube, 5 mi d ⁇ -H 2 O was added and sample vortexed, and centrifiiged at 1500 rpm for 4 minutes.
  • the washed hexane was then transferred into a 20 ml reagent tube. Hexane was evaporated to dryness and each sample reconstituted with 0.5 nil fresh iiexane. The reconstituted final hexane was vortexed to disperse the lipids.
  • the entire samp ⁇ e was then loaded into the GC auto sampler vials and 4 ⁇ l was injected for analysis.
  • the GC was calibrated with the NuChek Std. 461.
  • Table 3 represents the enzyme activity of the Eug-MO7-ELO# ⁇ 0- and Eug-MO7-ELO#14 encoded proteins based on the percent conversion of substrate added.
  • Eug-MO7-ELO# i 0 encoded protein converted 10.5% of LA (18:2n-6) to EDA (20:2 n-6), and 23.2% of ALA (18:3n-3) to ETrA (20:3n-3). This indicated that the Eug-MO7-ELO#10 gene encodes a ⁇ 9-elongase that can recognize both n-6 and n-3 fatty acid substrates.
  • the variant clone, Eug-M07-ELO#14 encoded protein also displayed ⁇ 9 elongase activity, converting converted 7.84% of LA (18:2n-6) to EDA (20:2 n-6), and 11.15% of ALA (1 S:3 ⁇ -3) to ETrA (20:3n-3).
  • this activity was lower that that of the original Eug-MO7-ELO#10 encoded protein.
  • TaMe 3 ⁇ 9-elongase activity of Eug-MO7-ELO#10 and E ⁇ g-MO7-ELO#14 encoded proteins expressed in Saccharomyces cerevisiae strain SC334
  • Table 4 Specificity of E ⁇ ongasc Activity of Eug-MO7-ELO#10 & Eug-MO7- ELO#14 encoded proteins expressed in Saccharomyces cerevisiae strain SC334
  • the coding sequence of the Eug-MO7-ELO#l 0 eiongase was amplified by PCR from a plasmid containing the corresponding gene with the following sense and antisense oligonucleotide primers (added restriction enzyme sites are underlined):
  • the PCR reaction was conducted with high-fidelity Phusion polymerase (New England B ⁇ olabs).
  • the PCR amplified gene was digested with restriction enzymes EcoRl and Xho ⁇ , and the resulting product was linked on its 5 * - end to the seed-specific glycinin-1 promoter from soybean and on its 3'-end to the glycinin-1 3 " untranslated region in the binary vector p0308-DsRed to generate the plasmid "pEugELO ⁇
  • the glycinin-1 regulatory elements have been previously described by Nielsen, et aL ''Characterisation of the glyci ⁇ i ⁇ gene family ⁇ n soybean," Plant Cell ( 1989) Vol. 1 , p.
  • This vector also contains a Ds-Red transgene under control of the cassava mosaic virus promoter for selection of transformed seeds by fluorescence and a kanamycin resistance marker for bacterial selection.
  • the Isochrysis galbana ⁇ 9-elongase gene (SEQ ID NO: 2) was also cloned as an EcoRl/Xhol fragment under control of the glycinin-1 promoter in p0308-Ds-Red to generate the plasmid "pIsoD9 " .
  • pEugELO and pIsoD9 were introduced into Agrobacter ⁇ um (umefaciens strain C58 MP90 by electroporation. Kanamycin-rcsistant agrobacter ⁇ um was then used for transformation of Arabidopsis thaliana ecotype CoI-O by the floral dip method (Clough. et aL, "Floral dip: a simplified method for Agrobacterium- mediated transformation of Arabidopsis thaliana.” Plant J, (1998) Vol. 16. p. 735- 743). Following the agrobacterium floral dip, plants were maintained at 22°C with 16 hour day length until reaching maturity and dry down.
  • a facBlfae X mutant of Arabidopsis was used thai contains low levels of ⁇ -iinolenic acid and very-long chain fatty acids (>C20) but e ⁇ evated levels of Hnoie ⁇ c acid in its seed oii (Cahoon, et aL "Conjugated fatty acids accumulate to high levels in phospholipids of rnetabol ⁇ cally engineered soybean and Arabidopsis seeds. " Phytochen ⁇ siry (2006) Vol. 67, p. 1166-1 176). This genetic background approximates the fatty acid profile of seed oils from crops such as safflower and low Iinoienic acid soybean.
  • Transgenic seeds obtained from the agrobacterium-dipped Arabidopsis plants were identified by fluorescence of the DsRed marker protein using the methodology described by Pidkowich. et a I.. "Modulating seed beta-ketoacyl-acyl carrier protein synthase II level converts the composition of a temperate seed oil to that of a palm- ⁇ ke tropical oil," Proc Natl Acad Sci USA (2007) Vol. 104, p. 4742-4747. Single transgenic and non-transgenic control seeds were subjected to direct transesterification of the constituent lipids, including triacylglycerols.
  • TMSH tr ⁇ methylsulfonium hydroxide
  • Table 5 Shown in Table 5 are the fatty acid compositions of single Tl seeds from six independent transformation events from plants transformed with pEugELO construct. Also shown are the fatty acid compositions of single Tl seeds representing independent events from plants transformed with plsoD9 construct, the control ⁇ 9 elongase (see Table 6).
  • the major change in the fatty acid composition of transgenic seeds from the pEugELO transformation relative to iion-transfo ⁇ ned fadilfae 1 seeds was the presence of high levels of EDA (20:2n-6. ⁇ l L14). In these seeds, relative amounts of 20:2 ranged from 40% to 49% (w/w) of the totaJ fatty acids.
  • seeds engineered to express the Isochrysis galbana ⁇ 9-ELO accumulated 20:2 to amounts of 30 to 40% of the total fatty acids and 20:0 and 20:1 each to amounts of ⁇ 3% of the total fatty acids (see Table 6).
  • Table 5 a Fatty acid composition of single Tl transgenic ⁇ rahidopsis fmI3/fael seeds expressing Eug-MO7-ELO#10.
  • Each seed represents an independent transgenic event. Values shown are the wt% of the total fatty acids in the seed. Table 6 s : Fatty acid compositi ⁇ a of single Tj transgenic Arabidopsis ⁇ f ⁇ jfaei seeds expressing the Isochrysis galbana ELO.
  • Each seed represents an independent transgenic event. Values shown are the vvt% of the total fatty acids in the seed.
  • Example 6 Coexpression of the ⁇ 9-elongase * Eug-MO7-ELO#10 with a A8- desaturase

Abstract

The present disclosure relates to isolated polynucleotides encoding a delta 9-elongase, delta 9-elongases encoded by the isolated polynucleotides, expression vectors comprising the isolated polynucleotides, host cells comprising the expression vectors, and methods for producing delta 9-elongase and polyunsaturated fatty acids.

Description

NOVEL Δ9-ELONGASE FOE PRODUCTION OF
POLYUNSATURATED FATTY ACID-ENRICHED
OILS
BACKGROUNB OFTHEDISCLOSURE
[0001 ] The present disclosure relates to isolated polynucleotides encoding a deha-9 elongase, deIta-9 elongases encoded by the isolated polynucleotides, expression vectors comprising the isolated polynucleotides, host ceils comprising the expression vectors, and methods for producing delta-9 elongases and polyunsaturated fatty acids.
[0002] Polyunsaturated fatty acids (PUFAs) play many roles in the proper functioning of life forms. For example, PUFAs are important components of the plasma membrane of a cell, where they are found in the form of phospholipids. They also serve as precursors to mammalian prostacyclins, eicosanoids, leukotrienes and prostaglandins. Additionally, PUFAs are necessary for the proper development of the developing infant brain as well as for tissue formation and repair. In view of the biological significance of PUFAs. attempts are being made to efficiently produce them, as well as intermediates leading to their production.
[0003] A number of enzymes, most notably desaturases and elongases, are involved in PUFA biosynthesis (see Figure 1). Desaturases catalyze the introduction of unsaturations (e.g., double bonds) between carbon atoms within the fatty acid alkyl chain of the substrate. Elongases catalyze the addition of a 2-carbon unit to a fatty acid substrate. For example, linoleϊc acid (LA. 18:2n-6) is produced from oleic acid (OA, 18:ln-9) by a A12-desaturase. Eicosadienoic acid (EDA, 20:2n-6) is produced from linolcic acid (LA, 18:2n-6) by a Δ9~εlongase. Dϊhomo-γ-liπolenic acid (DGLA. 20:3n-6) is produced from eicosadienoic acid (EDA. 20:2n-6) by a Δ8-<iesaturase. Arachidonic acid (ARA. 20:4n-6) is produced from dihomo-γ-Hnolenic acid (DGLA. 20:3n-6) by a Δ5-desaturase (see Figure 1). [0004] Eloπgases catalyze the conversion of v-ϊϊnofenic acid (GLA. 18:3n-6) to dihomo-γ-linofertic acid (DGLA. 20:3n-6) and the conversion of stearidonic acid (SDA- 18:4n-3) to etcosatetraenoic acid (ETA. 2G:4n-3). Elongasc also catalyzes the conversion of arachidonic acid (ARA. 20:4n-6) to adrenϊc acid (ADA, 22:4n-6) and the conversion of eicosapentaenoic acid (EPA. 2G:5n-3) to ω3-docosapentaenoϊc acid (22:5n-3). Δ9-elongase elongates polyunsaturated fatty acids containing unsaturation at the carbon 9 position. For example, Δ9-elongase catalyzes the conversion of linoleic acid (LA, 18:2n-6) to eicosadienoic acid (EDA. 20:2n-6). and the conversion of α-linoienic acid (ALA- lS:3n-3) to eicosatrienoic acid (ETrA. 20:3π-3). ω3-ETrA may then be converted to <n3-ETA by a Δ8-desaturase. ω3-ETA may then be utilized in the production of other polyunsaturated fatty acids, such as ω3-EPA. which may be added to pharmaceutical compositions, nutritional compositions, animal feeds, as well as other products such as cosmetics.
[0005] The elongases which have been identified in the past differ in terms of the substrates upon which they act. Furthermore, they are present in both animals and plants. Those found in mammals have the ability to act on saturated,
monounsatu rated and polyunsaturated fatty acids. In contrast those found in plants are specific for saturated or monounsaturated fatty acids. Thus, in order to generate polyunsaturated fatty acids in plants, there is a need for a PUFA-specific elongase.
[0006] In both plants and animals, the elongation process is believed to be the result of a four-step mechanism (Lassner et a!.. The Plant Cell 8:281-292 (1996)). CoA is the acyl carrier. Step one involves condensation of malonyl-CoA with a Jong- chain acyl-CoA to yield carbon dioxide and a β-ketoacyl-CoA in which the acyl moiety has been elongated by two carbon atoms. Subsequent reactions include reduction to β-hydroxyacyl-CoA, dehydration to an enoyl-CoA, and a second reduction to yield the elongated acyl-CoA. The initial condensation reaction is not only the substrate-specific step but also the rate-limiting step.
[0007] It should be noted that animals cannot desaturate beyond the Δ9 position, and therefore cannot convert oleic acid (OA, 18:1 n-9) into linoleic acid (LA. 18:2n-6). Likewise, α-iinolenic acid (ALΛ. ! 8:3n-3) cannot be synthesized by mammals, since they lack Δ15-desaturasc activity. However, α-Hnolenic acϊci can be converted to stearldoiiic acid (SDA. 18:4n-3) by a Δ6-desaturase (see WO 96/13591: see also U.S. Pat. No. 5,552.306), followed by elongation to eicosatetraenoϊc acid (ETΛ. 20:4n-3) in mammals and algae. This polyunsaturated fatty acid (i.e.. ETA. 20:4n-3) can then be converted to eicosapentaenoic acid (EPA. 20:5-3) by a Δ5- desaturase. Other eukaryotes, including fungi and plants, have enzymes which desaturate at carbons 12 (see WO 94/11516 and U.S. Pat. No. 5,443.974) and 15 (see WO 93/ 1 1245). The major polyunsaturated fatty acids of animals therefore are either derived from diet and/or from desaturation and elongation of linoleic acid or α- linolenic acid. In view of the inability of mammals to produce these essential long- chain fatty acids, it is of significant interest to isolate genes involved in PUFA biosynthesis from species that naturally produce these fatty acids and to express these genes in a microbial, plant or animal system which can be altered to provide production of commercial quantities of one or more PUFAs. Consequently, there is a definite need for elongase enzymes, the genes encoding the enzymes, as well as recombinant methods of producing the enzymes.
[0008] In view of the above discussion, a definite need also exists for oils containing levels of PUFAs beyond those naturally present as well as those enriched in novel PUFAs. Such oils can be made by isolation and expression of elongase genes.
[0009] One of the most important long-chain PUFAs is eicosapentaenoic acid (EPA). EPA is found in fungi and also in marine oils. Docosahexaenoic acid (DHA) is another important long-chain PUFA. DFLA is most often found in fish oil and can also be purified from mammalian brain tissue. Arachidonic acid (ARA) is a third important long-chain PUFA. ARA is found in filamentous fungi and can also be purified from mammalian tissues including the liver and the adrenal glands.
[0010] ARA. EPA and/or DHA. for example, can be produced via either the alternate Δ-8 desaturase/Δ9-elongase pathway or the conventional Δ6 pathway (see Figure i). Elongases, which are active on substrate tatty acids in the conventional Δ6 pathway for the production of long-chain PUFAs. particularly ARA, EPA and DHA. have previously been identified. The conventional Δ6 pathway for converting LA to DGLA and ALA Io ω3-ETA utilizes the Δ6-desaturase enzyme to convert LA to GLA, and ALA to stcaridonic acid (SDA). and lhe Δό-elongase enzyme to convert GLA to DGLA, and SDA to ω3-ETA. However, in certain instances, the alternate Δ8-desaturase/Δ9-e!ongase pathway may be preferred over the conventional A6 pathway. For example, if particular residual omega-6 or omega-3 fatty acid intermediates, such as GLA or SDA. are not desired during production of DGLA. ω3- ETA. ARA. EPA. α>3-docosapentaeπoϊc acid. ω6-docosapentaenoic acid. ADA and/or DHA. the alternate Δ8-desatυrase/Δ9-elongase pathway may be used as an alternative to the conventional Δ6 pathway, to bypass GLA and SDA formation.
[001 1] In the present disclsure. a new source of Δ9-eloπgase has been identified for the production of long-chain PUFAs. in particular DGLA, ETA. ARA. EPA. ω3-docosapentaenoic acid, ωό-docosapentaenoic acid. ADA and/or DHA. The Δ9-elongase enzyme of the present disclosure converts, for example. LA to ω6-EDA. and ALA to o3-ETrA. The production of DGLA from ω6-EDA, and ARA from DGLA, is then catalyzed by a Δ8-desaturase and a Δ5-desaturase. respectively.
SUMMARY QF THE DISCLOSURE
[0012] In one aspect, the present disclosure relates to an isolated nucleic acid molecule or fragment thereof comprising or complementary to an isolated nucleotide sequence encoding a polypeptide having elongase activity, wherein the amino acid sequence of the polypeptide has at least 68% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO: 18 and SEQ ID NO: 20.
[0013] In another aspect, the present disclosure relates to an isolated nucleotide sequence or fragment thereof comprising or complementary to at least 68% of a nucleotide sequence selected from the group consisting of SEQ ID NO: 17 and SEQ ID NO: 19. The isolated nucleotide sequence or fragment thereof encodes a furtclionaϋy active eiongase which utilizes a polyunsaturated fatty acid as a substrate, and in particular a functional fy active Δ9-eiongase.
[00Ϊ4J The nucleotide sequence may be from, for example, a Eiigknoid sp.. and may specifically be isolated from, for example. Euglena deses Ehr. CCMP 2916.
[0015] In another aspect, the present disclosure relates to a purified polypeptide encoded by the above-described isolated nucleotide sequence as well as a purified polypeptide which elongates polyunsaturated fatty acids containing unsaturalion at the carbon 9 position and has at least 68% amino acid identity Io an amino acid sequence selected from the group consisting of SEQ ID NO: 18 and SEQ ID NO: 20.
[0016] In still another aspect, the present disclosure relates to an expression vector. The expression vector comprises a nucleotide sequence operably finked to a regulatory sequence, wherein the nucleotide sequence comprises or si complementary to at least 68% of a nucleotide sequence selected from the group consisting of SEQ ID NO: 17 and SEQ ID NO: 19. The disclosure aiso relates to a host cell comprising this expression vector. The host cell may be, for example, a eukaryotic cell or a prokaryotic cell. Suitable eukaryotic cells and prokaryotic cells are set forth herein. The disclosure also relates to a transgenic seed comprising the expression vector.
[0017] In another aspect, the present disclosure relates to a plant cell, plant seed, plant or plant tissue comprising the above-described expression vector, wherein expression of the nucleotide sequence of the expression vector results in production of at least one polyunsaturated fatty acid by the plant cell, plant or plant tissue. The polyunsaturated fatty acid may be. for example, selected from the group consisting of (06-EDA and α>3-ETrA. and combinations thereof. The present disclosure also includes one or more plant oils or fatty acids expressed by the above plant cell, plant seed, plant or plant tissue.
[0018] Furthermore, the present disclosure relates to a method of producing a Δ9-elongase. The method comprises the steps of: a) isolating a nucleotide sequence comprising or complementary to at least 68% of a nucleotide sequence selected from the group consisting of SEQ ID NO: 17 and SEQ ID NO: 19; b) constructing an expression vector comprising: i) the isolated nucleotide sequence operably linked to ii) a regulatory sequence; and c) introducing the expression vector into a host cell for a time and under conditions sufficient for expression of the Δ9-elongase, as appropriate. The host cell may be. for example, a eukaryotϊc eel! or a prokaryotic cell. In particular, the eukaryotic cell may be. for example, a mammalian cell, an insect cell, a plant cell or a fungal cell. The plant cell may be from an oilseed plant selected from the group consisting of soybean. Brassica species, safflower. sunflower, maize, cotton, and flax.
[0019] Additionally, the present disclosure relates to a method for producing a polyunsaturated fatty acid comprising the steps of: a) isolating a nucleotide sequence comprising or complementary to at least 68% of a nucleotide sequence selected from the group consisting of SEQ ID NO: 17 and SEQ ID NO: 19; b) constructing an expression vector comprising the isolated nucleotide sequence operabϊy linked to a regulatory sequence; c) introducing the expression vector into a host cell under time and conditions sufficient for expression of Δ9-elongase; and d) exposing the expressed Δ9-elongase to a substrate polyunsaturated fatty acid in order to convert the substrate polyunsaturated fatty acid to a first product polyunsaturated fatty acid. The "substrate" polyunsaturated fatty acid is, for example, LA or ALA, and the "first product" polyunsaturated fatty acid is. for example, ω6-EDA or GJ3- ETrA, respectively. This method may further comprise the step of exposing the first product polyunsaturated fatty acid to at least one desaturase, at least one additional elongase, or combinations thereof, in order to convert the first product
polyunsaturated fatty acid to a second or subsequent polyunsaturated fatty acid. The second or subsequent product polyunsaturated fatty acid may be, for example. DGLA or ω3-ETA, ARAT EPA. DPA, DHA, or combinations thereof.
[0020] In another aspect, the present disclosure relates to a method for producing a polyunsaturated fatty acid in a host cell comprising the steps of: a) isolating a nucleotide sequence comprising or complementary to at least 68% of a nucleotide sequence selected from the group consisting of SEQ ϊD NO: 17 and SEQ ID NO: 19; b) constructing an expression vector comprising the isolated nucleotide sequence operabiy linked to a regulatory sequence; c) introducing ϊ) the expression vector and ii) at least one additional recombinant DNA construct comprising an isolated nucleotide sequence encoding a Δ8-desaturase and operabiy linked to at least one regulatory sequence, into a host cell for a time and under conditions sufficient for expression of a Δ9-elongase and the Δ8-desalurase; and d) exposing the expressed Δ9-elongase and the Δ8-desaturase to a substrate polyunsaturated fatty acid selected from the group consisting of LA, ALA. and combinations thereof in order to convert the substrate polyunsaturated fatty acid to a first product polyunsaturated fatty acid. The first product polyunsaturated fatty acid may be, for example, DGLA. ω3-ETA. or combinations thereof. This method may further comprise the step of exposing the first product polyunsaturated fatty acid to at least one desaturase, at least one additional elongase. or combinations thereof, in order to convert the first product polyunsaturated fatty acid to a second or subsequent polyunsaturated fatty acid. The second or subsequent product polyunsaturated fatty acid may be, for example. ARA, EPA, DPA, DHA. or combinations thereof. In one aspect, this method may further comprise introducing into the host cell a recombinant DNA construct comprising i) an isolated nucleotide sequence encoding a Δ5-desaturase operabiy linked to ii) a regulatory sequence. The host cell may be as described above.
[0021] In another aspect, the present disclosure relates to a method for producing a transgenic plant comprising transforming a plant cell with at least one isolated nucleotide sequence or fragment thereof comprising or complementary to at least 68% of a nucleotide sequence selected from the group consisting of SEQ ID NO: 17 and SEQ ID NO: 19. and regenerating a transgenic plant from the transformed plant cell. The plant cell may be from an oilseed plant selected from the group consisting of soybean. Brassica species, safflower. sunflower, maize, cotton, and flax. In another aspect, the present disclosure relates to a seed obtained from the transgenic plant produced by this method. [0022] It should also be noted that each nucleotide and amino acid sequence referred to herein has been assigned a particular sequence identification number. The Sequence Listing (which is attached hereto), incorporated herein by reference. lists each such sequence and its corresponding number.
BRIEF DESCRDPTION OF THE DRAWINGS
[0023] Figiire 1 shows the fatty acid biosynthelic pathway and the role of Δ9-elongase in this pathway.
[0024] Figures 2A and 2B show alignment of nucleotide sequences SEQ ID NO: 26 and SEQ ID NO: 27. which are nucleotide sequences of Eug-MO7-ELO# 10 and the Eug-MO7-ELO#14 variant, respectively, cloned into the Bam Hi/Hind III sites of vector pYX242. as discussed in Example 3. A box is drawn around variants.
[0025] Figures 3A and 3B show alignment of amino acid sequences of Δ9- elongase from Eugkna deses Ehr. CCMP 2916 (Eυg-MO7-ELO-10) (SEQ ID NO: 18) with known Δ9-elongases from Englena gracialis (SEQ IDNO: 4), Isochrysis galbana (SEQ ID NO: 2): Mouse ElovH elongase (Accession # AAG47667; SEQ ID NO: 21), human ELOVL2 elongase (Accession # NP 060240; SEQ ID NO: 22). and C. elegans elongase (Ascessϊon # AF244356: SEQ ID NO: 23). Invariant residues are shaded.
[0026] Figure 4A shows the Δ9-elongase amino acid sequence from Pavlova salm' a (Accession # AAY 15135; SEQ ID NO: 1 ).
[0027] Figure 4B shows the Δ9-elongase amino acid sequence from Isochrysis galbana (Accession #AF39O174; SEQ ID NO: 2).
[0028] Figure 4C shows the Δ9-elongase amino acid sequence from Eutreptiella sp. (SEQ ID NO: 3).
[0029] Figare 4D shows the Δ9-elongase amino acid sequence from Eiigkna gracialis (Accession # CAT 16687; SEQ ID NO: 4). [003Oj Figure 4E shows the A9-eioπgase amino add sequence from Euglena anahena (SEQ ID NO: 5).
[0031] Figure 5A shows the nucleotide sequence (SEQ ID NO: 6) of clone piate2 MO7. obtained as described in Example 1.
[0032] Figure SB shows the deduced amino acid sequence (SEQ ID NO: 7) of clone plate2_MO7, obtained as described in Example I.
[0033] Figare 6A shows the nucleotide sequence (SEQ ID NO: 13) of the pIate2_MO7 gene fragment putative 3"-end. obtained as described in Example 2.
[0034] Figare 6B shows the predicted amino acid sequence (SEQ ID NOs: 14 and 30-32) of the piate2_MO7 gene fragment putative 3*-end. obtained as described in Example 2. SEQ ID NOs: 14 and 30-32 are separated by an "*". which represents a stop codon.
[0035] Figπre 6C shows SEQ ID NO: 14.
[0036] Figure 6D shows SEQ ID NO: 30.
[0037] Figure 6E shows SEQ ID NO: 31.
[0038] Figure 6F shows SEQ ID NO: 32.
[0039] Figure 7A shows the nucleotide sequence (SEQ ID NO: 17) of the putative Δ9-elongase from Euglena deses Ehr. CCMP 2916 (Eug-MO7-ELO#10). obtained as described in Example 3.
[0040] Figare 7B shows the predicted amino acid sequence (SEQ ID NO: 18) encoded by the nucleotide sequence (SEQ ID NO: 17) of the putative Δ9-e!ongase from Euglena deses Ehr. CCMP 2916 (Eug-MO7-ELO# 10), obtained as described in Example 3. [0041 ] Figure 8A shows the nucleotide sequence (SEQ ID NO: 19) of a variant Δ9-elongase from Euglena deses Ehr. CCMP 2916 (Eug-MO7-ELO# 14), obtained as described in Example 3.
[0042] Figπre 8B shows the predicted amino acid sequence (SEQ ID NO: 20) encoded by nucleotide sequence (SEQ ID NO: 19) of the variant Δ9-elongase from Euglena deses Ehr. CCMP 2916 (Eug-MO7-ELO#14). obtained as described in Example 3.
[0043] Figare 9 A shows the amino acid sequence from Mouse ElovH elongase (Accession # AAG47667: SEQ ID NO: 21).
[0044] Figure 9B shows the amino acid sequence from human ELOVL2 elongase (Accession # NP 060240; SEQ ID NO: 22).
[0045] Figure 9C shows the amino acid sequence from C. elegans elongase (Accession # AF244356; SEQ ID NO: 23).
DETAILED DESCRIPTION OF THE DISCLOSURE
[0046] The present disclosure is directed to the nucleotide (e.g.. gene) and translated amino acid sequences of a Δ9-elongase gene from Euglenoid sp., for example. Euglena deses Ehr., specifically Euglena deses Ehr. CCMP 2916,
Furthermore, the present disclosure also includes uses of the gene and of the enzyme encoded by the gene. For example, the gene and corresponding enzyme may be used in the production of polyunsaturated fatty acids such as. for instance, ω6-EDA. ω3- EtrA. DGLA, ω3-ETA, ARA, EPA. ω3-docosapentaenoic acid. ω6-docosapentaenoic acid. ADA. DHA. or any combinations thereof, which may be added to
pharmaceutical compositions, nutritional compositions and to other valuable products.
Definitions
[0047] As used herein, the singular forms "a"* "an" and "the" include plural referents unless the context clearly dictates otherwise. For the recitation of numeric ranges herein, each intervening number there between with the same degree of precision is explicitly contemplated. For example, for the range 6-9. the numbers 7 and 8 are contemplated in addition to 6 and 9. and for the range 6.0-7.0. the numbers 6.0. 6.1. 6.2. 6.3. 6.4. 6.5. 6.6. 6.7, 6.8. 6.9 and 7.0 are explicitly contemplated.
[0048] Chimeric Construct: As used herein, the phrase "chimeric construct" refers to a combination of nucleic acid molecules that are not normally found together in nature. Accordingly, a chimeric construct may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that normally found in nature.
[0049] Coding Sequence: As used herein, the term "coding sequence" refers to a DNΛ sequence that codes for a specific amino acid sequence. "Regulatory sequences" refer to nucleotide sequences located upstream (5' non-coding sequences), within, or downstream (31 non-coding sequences) of a coding sequence, and which influence the transcription. RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences may include, but are not limited to. promoters, translation leader sequences, introns. and polyadenylation recognition sequences.
[0050] Complementarity: As used herein, the term '"complementarity" refers to the degree of relatedness between two DNA segments. H is determined by measuring the ability of the sense strand of one DNA segment to hybridize with the antisense strand of the other DNA segment, under appropriate conditions, to form a double helix. In the double helix, adenine appears in one strand, thymine appears in the other strand. Similarly, wherever guanine is found in one strand, cytosϊne is found in the other. The greater the relatedness between the nucleotide sequences of two DNA segments, the greater the ability to form hybrid duplexes between the strands of the two DNA segments.
[0051] Encoded by. Hybridization, and Stringent Conditions: As used herein, the phrase, "encoded by" refers to a nucleic acid sequence which codes for a polypeptide sequence, wherein the polypeptide sequence or a portion thereof contains an amino acid sequence of at least 3 consecutive amino acids, more preferably at least 8 consecutive amino acids, and even more preferably at least 15 consecutive amino acids from a polypeptide encoded by the nucleic acid sequence.
[0052] The present disclosure also encompasses an isolated nucleotide sequence which encodes for an enzyme having PUFA eϊongase activity and that is hybridizable. under moderately stringent conditions, to a nucleic acid having a nucleotide sequence comprising or complementary to a nucleotide sequence comprising SEQ ID NO: 17 or SEQ ID NO: 19 (shown in Figures 7 A and 8A.
respectively). A nucleic acid molecule is "hybridizable" to another nucleic acid molecule when a single-stranded form of the nucleic acid molecule can anneal to the other nucleic acid molecule under the appropriate conditions of temperature and ionic strength (See, Sambrook et a!.. Molecular Cloning: A Laboratory Manual, Second Edition (1989), Cold Spring Harbor Laboratory Press. Coid Spring Harbor, New York)). The conditions of temperature and ionic strength determine the "stringency" of the hybridization. "Hybridization" requires that two nucleic acids contain complementary sequences. However, depending on the stringency of the
hybridization, mismatches between bases may occur. The appropriate stringency for hybridizing nucleic acids depends on the length of the nucleic acids and the degree of complementation. Such variables are well known to those skilled in the art. More specifically, the greater the degree of similarity or homology between two nucleotide sequences, the greater the value of Tm for hybrids of nucleic acids having those sequences- For hybrids of greater than 100 nucleotides in length, equations for calculating Tm have been derived (See. Sambrook et ai., supra). For hybridization with shorter nucleic acids, the position of mismatches becomes more important, and the length of the oligonucleotide determines its specificity (See, Sambrook et al., supra).
[0053] Typically, stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion. typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 300C for short probes (e.g., IO to 50 nucleotides) and at least about 600C for !ong probes (e.g.. greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as fcrmamϊde. An example of low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, ϊ M NaCL 1% SDS (sodium dodecy! sulphate) at 37°C. and a wash in 1 X to 2 X SSC (20 X SSC=3.0 M NaCI/0.3 M trisodium citrate) at 50 to 55°C. An example of moderate stringency conditions include hybridization in 40 to 45% formamide, 1 M NaCl, 1% SDS at 37°C. and a wash in 0.5 X to 1 X SSC at 55 to 600C. An example of high stringency conditions include hybridization in 50% formamide. 1 M NaCl. 1% SDS at 37°C, and a wash in 0.1 X SSC at 60 to 65°C.
[0054] Exon: As used hereinτ the term "exon" refers to a portion of the sequence of a gene that is transcribed and is found in the mature messenger RNA derived from the gene, but is not necessarily a part of the sequence that encodes the final gene product.
[0055] Expression, Antisense Inhibition, and Co-suppression: As used herein, the term "expression", refers to the production of a functional end-product. Expression of a gene involves transcription of the gene and translation of the mRNA into a precursor or mature protein.
[0056] As used herein, the phrase "antϊsense inhibition" refers to the production of antisense RNA transcripts capable of suppressing the expression of the target protein.
[0057] As used herein, the term "co suppression" refers to the production of sense RNA transcripts capable of suppressing the expression of identical or substantially similar foreign or endogenous genes (See. U.S. Patent No. 5.231,020).
[0058] Fragment or Subfragment that is Functionally Equivalent: The terms "fragment or subfragment that is functionally equivalent" and "functionally equivalent fragment or subfragment". used interchangeably herein, refer to a portion or subsequence of an isolated nucleic acid molecule in which the ability to alter gene expression or produce a certain phenotype is retained whether or not the fragment or subfragment encodes an active enzyme. For example, the fragment or subfragment can be used in the design of chimeric constructs to produce the desired phenotype in a transformed plant. Chimeric constructs can be designed for use in co-suppression or antisense inhibition by linking a nucleic acid fragment or subfragment thereof, whether or not it encodes an active enzyme, in the appropriate orientation relative to a plant promoter sequence.
[0059] Gene. Native Gene, Foreign Gene, and Transgene: As used herein, the term "gene" refers to a nucleic acid molecule that expresses a specific protein, including regulatory sequences preceding (51 non-coding sequences) and following (3' non-coding sequences) the coding sequence.
[0060] As used herein, the phrase "native gene" refers to a gene as found in nature with its own regulatory sequences.
[0061] A "foreign" gene refers to a gene not πormaily found in the host organism, but that is introduced into the host organism by gene transfer. Foreign genes can comprise native genes inserted into a non-native organism, or chimeric constructs.
[0062] As used herein, the term "transgene" refers to gene that has been introduced into the genome by a transformation procedure.
[0063] Gossvpium species: As used herein, the phrase "Gossypium species" refers to any plants of Gossypium arboreum, Gossypium barbadense, Gossypium herbaceum, Gossypium hirsutum. Gossypium hirsutum var hϊrsutum. Gossypium hirsutum var marie-galante. Gossypium lapideum. Gossypium sturtianum. Gossypium thuberi, Gossypium thurberi, Gossypium tomentosum or Gossypium tormenlosuin.
[0064] Homology: The terms "homology", "homologous", "substantially similar" and "corresponding substantially" are used interchangeably herein and refer to nucleic acid molecules wherein changes in one or more nucleotide bases does not affect the ability of the nucleic acid molecule to mediate gene expression or produce a certain phenotype. These terms also refer to modifications of the nucleic acid molecules of the instant disclosure such as a deletion or insertion of one or more nucleotides that do not substantially alter the functional properties of the resulting nucleic acid moiecule relative to the initial, unmodified molecuϊe. It is therefore understood, as those skilled in the art will appreciate, that the disclosure encompasses more than the specific exemplary sequences.
[0065] Host Cell: As used herein, the phrase "host cell" is meant a cell, which comprises an isolated nucleic acid sequence or fragment thereof of the present disclosure. Host cells may be prokaryotic cells (e.g. such as Escherichia colL cyanobacteria and Bacillus subtifis), or eukaryotic cells (e.g. such as fungal, insect, plant or mammalian cells).
[0066] Examples of fungal cells that can be used are Saccharomyces spp.. Candida spp., Lipomyces spp., Yarrowia spp., Kϊuyveromyces spp., Hansemda spp.. Aspergillus spp., Penicillium spp., Neurospora spp.. Trichodenna spp. and Pichia spp. A particularly preferred fungal cell is Saccharomyces cerevisiae.
[0067] Plant cells can be monocotyledonous or dicotyledonous plant cells. Particularly preferred plant cells are from oilseed plants such as Glycine max (e.g., soybean), a Brassica species, Carthamυs linctorius L. (e.g., safflower), Helianthus anntius (e.g., sunflower), Zea mays (e.g., maize), a Gossypium species (cotton) and Limtm usUatissimitm (e.g. flax).
[0068] Identity. Sequence Identity, and Percentage of Sequence Identity (% Identity): The terms "identity" or "sequence identity," used interchangeably herein, when used in the context of nucleotide or polypeptide sequences refer to the nucleic acid bases or amino acid residues in two sequences that are the same when aligned for maximum correspondence over a specified comparison window. Thus, identity is defined as the degree of sameness, correspondence or equivalence between the same strands (either sense or antisense) of two DNA or polypeptide segments. [0069] "Percentage of sequence identity" or "% identity" is calculated by comparing two optimally aligned sequences over a particular region, determining the number of positions at which the identical base occurs in both sequence in order to yield the number of matched positions, dividing the number of such positions by the total number of positions in the segment being compared and multiplying the result by 100. Optimal alignment of sequences may be conducted by the algorithm of Smith & Waterman. Appi Math. 2:482 (1981). by the algorithm of Needleman & Wunsch, j. MoL Biol. 48:443 (1970), by the method of Pearson & Lipman, Proc. Mat!. Acad. Sci. (USA) 85:2444 (1988) and by computer programs which implement the relevant algorithms (e.g., Higgins et aL CABlOS. 5Ll 51-153 (1989)), FASTDB
(Intelligenelics), BLAST (National Center for Biomedical Information; Altschul et aL Nucleic Acids Research 25:3389-3402 (1997)), PILEUP (Genetics Computer Group, Madison, WI) or GAP, BESTFIT. FASTA and TFASTA (Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, Madison, WI). (See, U.S. Patent No. 5,912,120). Useful examples of percent sequence identities include, but are not limited to, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%τ 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%. These identities can be determined using any of the programs described herein.
[0070] Indirectly or Directly: As used herein, the term "indirectly" when used in connection with the use of a gene and its corresponding enzyme in the production of polyunsaturated fatty acids, encompasses the situation where a first acid is converted to second acid (i.e., a pathway intermediate) by a first enzyme (e.g., LA to ω6-EDA, by, for example a Δ9-elongase) and then the second acid is converted to third acid by use of a second enzyme (e.g., ©6-EDA to DGLA by, for example, Δ8- desaturase).
[0071] As used herein, the term "directly" when used in connection with the use of a gene and its corresponding enzyme in the production of polyunsaturated fatly acids encompasses the situation where the enzyme directly converts a first acid to a second acid, wherein the second acid is then utilized in a composition (e.g.. the conversion of LA to ωό-EDA by. for example a Δ9-eIongase or ϋ>3-ETrA Io ω3~ETA by, for example a Δ8-desaturasae).
[0072] Intron: As used herein, the term "intron" refers to an intervening sequence in a gene that does not encode a portion of the protein sequence. Thus, such sequences are transcribed into RNA but are then excised and are not translated. The term is also used for the excised RNA sequences.
[0073] Isolated: As used herein, the term "isolated" refers to a nucleic acid moϊecule (DNA or RNA) or a protein or a biologically active portion thereof that is removed from its naturally occurring environment or source using routine techniques known in the art (e.g., from bacteria, algae, fungi, pJants, vertebrates, mammals, etc.). Isolated nucleic acid molecules or proteins are substantially or essentially free from components that normally accompany or interact with the nucleic acid molecules or proteins in their naturally occurring environment.
[0074] Isolated Nucleic Acid Fragment or Isolated Nucleic Acid Sequence: As used herein, the phrase 'Isolated nucleic acid fragment" or "isolated nucleic acid sequence" refers to a polymer of RNA or DNA that is single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases. An isolated nucleic acid fragment in the form of a polymer of DNA may be comprised of one or more segments of cDNA. genomic DNA or synthetic DNA. (A "fragment" of a specified polynucleotide refers to a polynucleotide sequence which comprises a contiguous sequence of approximately at least about 6 consecutive nucleotides, preferably at least about 8 consecutive nucleotides, more preferably at least about 10 consecutive nucleotides, at least about 15 consecutive nucleotides, at least about 20 consecutive nucleotides, at least about 25 consecutive nucleotides, etc., identical or complementary to a region of the specified nucleotide sequence.) Nucleotides (usually found in their 5' monophosphate form) are referred to by their single letter designation as follows: "A" for adenylate or deoxyadenylate (for RNA or DNA. respectively), "C" for cytϊdylate or deoxycytidylate. "G" for guanylate or deoxyguanylate, "U" for uridylate, "T* for deoxythymϊdylate, "R" for purines (A or G), *Υ" for pyrimidines (C or T). "K" for G or T. "H" for A or C or T- "ϊ" for tnosine. and "H" for any nucleotide.
[0075] Mature and Precursor: Λs used herein, the term, "mature" when used in connection with the term "protein" refers to a post-translationally processed polypeptide: i.e.. one from which any pre- or propeptides present in the primary translation product have been removed. As used herein, the term "precursor" when used in connection with the term "protein" refers to the primary product of translation of mRNA; i.e.. with pre- and propeptides still present. Pre- and propeptides may be, but are not limited to. intracellular localization signals.
[0076] 3' Non-Coding Sequences: As used herein, the phrase "3' non- coding sequences" refers to DNA sequences located downstream of a coding sequence and include polyadenyiation recognition sequences and other sequences encoding regulatory signals capable of affecting mRNA processing or gene expression. The polyadenyiation signal is usually characterized by affecting the addition of polyadenylic acid tracts to the 3' end of the mRNA precursor. The use of different 3' non-coding sequences is exemplified by lngelbrecht et al.. (1989) Plant Cell 1:671 6SO.
[0077] TNon-Naturally Occurring: As used herein, the phrase. *'non-naturally occurring" refers to something that is artificial, not consistent with what is normally found in nature.
[0078] Operably Linked: As used herein, the phrase "operably linked" refers to the association of nucleic acid sequences on a single nucleic acid molecule so that the function of one is regulated by the other. For example, a promoter is operably linked with a coding sequence when it is capable of regulating the expression of that coding sequence (i.e.. that the coding sequence is under the transcriptional control of the promoter). Coding sequences can be operably linked to regulatory sequences in a sense or antisense orientation. In another example, the complementary RNA regions of the disclosure can be operably linked- either directiy or indirectly. 51 to the target mRNA. or 3' to the target mRNA. or within the target mRNA. or a first
complementary region is 5' and its complement is 3' to the target mRNA.
[0079] Plant: As used herein, the term "plant" refers to whole plants, plant organs, plant tissues, seeds, plant cells, seeds and progeny of the same. Plant ceils include, without limitation, cells from seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen and microspores.
[0080] Polymerase Chain Reaction or PCR: As used herein, the phrase "Polymerase Chain Reaction" or "PCR" refers to a technique for the synthesis of large quantities of specific DNA segments, consists of a series of repetitive cycles (Perkin Elmer Cetus instruments, Norwalk, CT). Typically, the double stranded DNA is heat denatured, the two primers complementary to the 3' boundaries of the target segment are annealed at low temperature and then extended at an intermediate temperature. One set of these three consecutive steps is referred to as a cycle.
[0081] PCR is a powerful technique used to amplify DNA millions of fold, by repeated replication of a template, in a short period of time (Mullis et al. Cold Spring Harbor Symp. Quant. Biol. 51:263 273 (1986); Erlich et al, European Patent Application 50,424; European Patent Application 84,796; European Patent
Application 258,017, European Patent Application 237,362; Mullis. European Patent Application 201 , 184, Mullis et al U.S. Patent No. 4,683,202; Erlich, U.S. Patent No. 4,582,788; and Saiki etal, U.S. Patent No. 4T683,194). The process utilizes sets of specific in vitro synthesized oligonucleotides to prime DNA synthesis. The design of the primers is dependent upon the sequences of DNA that are desired to be analyzed. The technique is carried out through many cycles (usually 20 50) of melting the template at high temperature, allowing the primers to anneal to complementary sequences within the template and then replicating the template with DNA polymerase. The products of PCR reactions are analyzed by separation in agarose gels followed by ethidium bromide staining and visualization with UV
transillumination. Alternatively, radioactive dNTPs can be added to the PCR in order Io incorporate label into the products. In this case the products of PCR are visualized by exposure of the gel to x-ray film. The added advantage of radio label ing PCR products is that the leveϊs of individual amplification products can be quantitated.
[0082] Promoter and Enhancer: As used herein, the term "promoter * refers to a DNA sequence capable of controlling the expression of a coding sequence or functional RNA. The promoter sequence consists of proximaE and more distal upstream elements, the latter elements often referred to as enhancers.
[0083] As used herein, the term "enhancer" refers to a DNA sequence which can stimulate promoter activity and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue-specifictly of a promoter. Promoter sequences can also be located within the transcribed portions of genes, and/or downstream of the transcribed sequences. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental conditions. Promoters which cause a gene to be expressed in most cell types at most times are commonly referred to as "constitutive promoters." New promoters of various types useful in plant cells are constantly being discovered; numerous examples may be found in the compilation by Okamuro and Goldberg. (1989) Biochemistry of Plants 15:1 82. It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined. DNA molecules of some variation may have identical promoter activity.
[0084] Recombinant: As used herein, the term "recombinant" refers to an artificial combination of two otherwise separated segments of sequence, e.g., by chemical synthesis or by the manipulation of isolated segments of nucleic acids by genetic engineering techniques. [0085] Recombinant Construct Expression Construct, and Recombinant Expression Construct: The phrases "recombinant construct", "expression construct" and "recombinant expression construct" are used interchangeably herein and refer to a functional unit of genetic materia! lhat can be inserted into the genome of a ceil using standard methodology well known to one skilled in the art. Such construct may be itself or may be used in conjunction with a vector. If a vector is used then the choice of vector is dependent upon the method that will be used to transform host plants as is well known to those skilled in the art. For example, a plasmid vector can be used. The skilled artisan is well aware of the genetic elements that must be present on the vector in order to successfully transform, select and propagate host cells comprising any of the isolated nucleic acid molecules of the disclosure. The skilled artisan will also recognize that different independent transformation events will result in different levels and patterns of expression (Jones et aL (1985) EMBOJ. 4:241 1 2418; De Almeida et aL (1989) MoI. Gen. Genetics 218:78 86). and thus that multiple events must be screened in order to obtain lines displaying the desired expression level and pattern. Such screening may be accomplished by Southern analysis of DNA, Northern analysis of mRNA expression. Western analysis of protein expression, or phenotypic analysis.
[0086] RNA transcript. Messenger RTNA. cDNA. Functional RNA. and Endogenous RNA: As used herein, the phrase, "RNA transcript" refers to the product resulting from RNA polymerase-catalyzed transcription of a DNA sequence. When the RNA transcript is a perfect complementary copy of the DNA sequence, it is referred to as the primary transcript or it may be a RNA sequence derived from post- transcriptϊonal processing of the primary transcript and is referred to as the mature RNA.
[0087] As used herein, the phrase "messenger RNA (mRNA)" refers to the RNA that is without introns and that can be translated into protein by the cell.
[0088] As used herein, the term "cDNA" refers to a DNA that is complementary to and synthesized from a mRNA template using the enzyme reverse transcriptase. The cDNA can be single-stranded or converted into the double- stranded form using the Klenow molecule of DNA polymerase I. "Sense" RNA refers to RNA transcript that includes the mRNA and can be translated into protein within a cell or in vitro. "Antisense RNA" refers to an RNA transcript that is complementary to all or part of a target primary transcript or mRNA and that blocks the expression of a target gene (U.S. Patent No. 5,107.065). The complementarity of an antisense RNA may be with any part of the specific gene transcript, i.e., at the 5" non-coding sequence, 3* non-coding sequence, introns, or the coding sequence.
[0089] As used herein, the phrase, "functional RNA" refers to antisense RNA, ribozyme RNA. or other RNA that may not be translated but yet has an effect on cellular processes.
[0090] The terms "complement" and "reverse complement" are used interchangeably herein with respect to mRNA transcripts, and are meant to define the antisense RNA of the message.
[0091] As used herein, the phrase "endogenous RNA" refers to any RNA which is encoded by any nucleic acid sequence present in the genome of the host prior to transformation with the recombinant construct of the present disclosure, whether naturally-occurring or non-naturally occurring, i.e.. introduced by recombinant means, mutagenesis, etc.
[0092] Similarity: The term "similarity," when referring to the "similarity" between two amino acid sequences, proteins or polypeptides, refers to the presence of a series of identical as well as conserved amino acid residues in both sequences. The higher the degree of similarity between two amino acid sequences, the higher the correspondence, sameness or equivalence of the two sequences.
[0093] Stable Transformation. Transient Transformation, and
Transformation: As used herein, the phrase "stable transformation" refers to the transfer of a nucleic acid molecule into a genome of a host organism, including both nuclear and organellar genomes, resulting in genetically stable inheritance. [00941 'n contrast as used herein, the phrase "transient transformation" refers to the transfer of a nucleic acid molecule into the nucleus, or DTNA-containing organelle, of a host organism resulting in gene expression without integration or stable inheritance. Host organisms containing the transformed nucleic acid molecules are referred to as "transgenic" organisms. The preferred method of cell
transformation of rice, corn and other monocots is the use of particle-accelerated or "gene gun" transformation technology (Klein et al.. (1987) Nature (London) 327:70 73; U.S. Patent No. 4.945.050). or an Agrobacterium-medϊated method using an appropriate Ti pϊasmid containing the transgene (Ishida Y. et al.. (1996) Nature Biotech. 14:745 750).
[0095] As used herein, the term "transformation" refers to both stable transformation and transient transformation.
[0096] Translation Leader Sequence: As used herein, the phrase "translation leader sequence" refers to a DNA sequence located between the promoter sequence of a gene and the coding sequence. The translation leader sequence is present in the fully processed mRNA upstream of the translation start sequence. The translation leader sequence may affect processing of the primary transcript to mRNA. mRNA stability or translation efficiency. Examples of translation leader sequences have been described (Turner. R. and Foster, G. D. (1995) Molecular Biotechnology 3:225).
[0097] All patents, patent publications and priority documents cited herein are hereby incorporated by reference in their entirety.
The A9-Elongase Gene and Enzyme Encoded Thereby
[0098] The enzyme encoded by the Δ9-elongase gene of the present disclosure is essential in the production, via the alternate Δ8-desaturase/Δ9-elongase pathway, of long-chain polyunsaturated fatty acids (LC-PUFAs), having a length of 20 or greater carbons. The nucleotide sequence of the isolated Euglena deses Ehr. CCMP 291ό Δ9-eloπgase gene is shown in Figure 7A, and the predicted amino acid sequence of the corresponding protein is shown in Figure 7B. [0099] The conversion of LA to DGLA and ALA to o>3-ETA using a Δ9- elongase enzyme and a Δ8-desatorasc enzyme is referred to as the alternate Δ8- desaturase/Δ9-elongase pathway. The conventional Δ6 pathway for converting LA to DGLA and ALA to ω3-ETA utilizes a Δ6-desafurase enzyme to convert LA to GLA, and ALA to SDA. and a Δ6-eIongase to convert GLA to DGLA, and SDA to ω3- ETA. respectively. In either pathway, the production of ARA or EPA is then catalyzed by, for example, a Δ5-desaturase. DHA. for example, may be produced upon the conversion of EPA to ω3-docosapentaenoic acid (DPA). and ω3- docosapentaenoic acid to DHA, utilizing, for example, a Δ5-elongase and a Δ4- desaturase, respectively.
[00100] Although, for example. DGLA, ω3-ETA, ARA. EPA, ω3- docosapentaenoic acid, ω6-docosapentaenoic acid. ADA and/or DHA can be produced via either the alternate Δ8-desaturase/Δ9~eIongase pathway or the conventional A6 pathway, in certain instances, the alternate Δ8-desaturase/Δ9- elongase pathway may be preferred over the conventional Δ6 pathway. For example, if particular residual omega-6 or omega-3 fatty acid intermediates, such as GLA or SDA, are not desired during production of DGLA, ω3-ETA, ARA, EPA, ω3- docosapentaenoic acid. ω6-docosapentaenoic acid. ADA and/or DHA, the alternate Δ8-desaturase/Δ9-e!ongase pathway may be used as an alternative to the conventional Δό pathway, to bypass GLA and SDA formation.
[00101] As discussed above, Δ9-elongase is a necessary enzyme in the alternate Δ8-desaturase/Δ9-elongase pathway. EPA, for example, cannot be synthesized via the alternate Δ8-desaturase/Δ9-elongase pathway without the Δ9- elongase gene and enzyme encoded thereby. As shown in Figure L the isolated Δ9- elongase enzyme of the present disclosure converts, for example, ALA to α>3-ETrA and LA to ω6-EDA. The production of ω3-ETA from co3-ETrA, and EPA from ω3- ETA is then catalyzed by, for example, a Δ8-desaturase and a Δ5-desaturase, respectively. As a result of using the alternate Δ8-desaturase/Δ9-elongase pathway, the intermediate GLA and SDA fatty acids are bypassed. [00102] Il shoiitd be noted that the present disclosure also encompasses nucleotide sequences (and the corresponding encoded proteins) having sequences comprising, consisting of, or complementary to at least 68%. 69%. 70%, 71%. 72%. 73%. 74%, 75%. 76%. 77%. 78%. 79%, 80%. 81%, 82%. 83%, 84%. 85%. &6%. 87%. 88%. 89%. 90%, 91%. 92%. 93%. 94%. 95%. 96%. 97%. 98% or 99% of the nucleotides in sequence (i.e., having sequence identity to) SEQ ID NO: 17 (i.e.. the isolated nucleotide sequence of the Δ9-eiongase gene of Euglena deses Ehr. CCMP 2916) or SEQ ID NO: 19 (i.e.. a variant Δ9-elongase gene of Euglena deses Ehr. CCMP 2916). Such sequences may be from human sources as well as other non- human sources (e.g., C elegcms or mouse).
[00103] Furthermore, the present disclosure also encompasses fragments and derivatives comprising or consisting of the nucleotide sequence of SEQ ID NO: 17 (shown in Figure 7A) or SEQ ID NO: 19 (shown in Figure 8A)). as well as of the sequences from other sources, and having the above-described complementarity or correspondence. Functional equivalents of the above-sequences (i.e.. sequences having Δ9-elongase activity) are also encompassed by the present disclosure.
[00104] Fragments derived from SEQ ID NO: 17 or SEQ ID NO: 19 can have a length comprising or consisting of 10 to about 780 nucleotides. 10 to about 700 nucleotides. 10 to about 650 nucleotides. 10 to about 500 nucleotides. 10 to about 250 nucleotides. 10 to about 100 nucleotides, 10 to about 50 nucleotides, or 15 to 40 nucleotides. In one aspect, the fragments of SEQ ID TNO: 17 and SEQ ID NO: 19 encode a polypeptide having Λ9-elongase activity. In another aspect, fragments of the SEQ ID NO: 17 and SEQ ID NO: 19 can be used as primers and probes. Methods of making primers and probes are well known to those skilled in the art. Such primers and probes can have a length of 10 to 50 nucleotides, preferably from 15 to 40 nucleotides.
[00105] Variants of the nucleotide sequence of SEQ ID NO: 17 or SEQ ID NO: 19 are also contemplated herein. Such variants may contain one or more base pair additions, substitutions, or deletions. Non-limiting examples of nucleotide variants of SEQ ID NO: 17 encompassed by the present disclosure are shown in Tabic A below. One specific example of a variant of SEQ ID NO: 17 is SEQ ΪD NO: 19 (see Figure 8A).
Table A
Sequence Substitution (SEQ ID NO: 17
SEQ ΪD NO: 19)
GCT24 => GCC24
GC85C => GT83C
G232TA => A2J2TA
Figure imgf000028_0001
C310TC =? A3J0TC
ACA6i0 => ACT630
AAA7JO ==> AAG750
[00106] The present disclosure also encompasses nucleotide sequences from other sources, and having the above-described complementarity or correspondence to SEQ ID NO: 17 or SEQ ID NO: 19. Functional equivalents of SEQ ID NO: 17 or SEQ ID NO: 19 (i.e., sequences having A9-elongase activity) are also encompassed by the present disclosure.
[00107] The present disclosure also encompasses nucleotide sequences or fragments thereof encoding a polypeptide having Δ9-elongase activity, wherein the amino acid sequence of said polypeptide has at least 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%. 79%. 80%, 81%. 82%, 83%, 84%. 85%, 86%. 87%. 88%, 89%, 90%, 91%, 92%, 93%. 94%, 95%, 96%, 97%, 98% or 99% sequence identity to an amino acid sequence comprising SEQ ID NO: 18 or SEQ ID NO: 20. Such sequences may be from human sources as well as other non-human sources (e.g., C. elegans or mouse). [00108] The disclosure a!so includes an isolated and/or purified polypeptide which eiongales polyunsaturated fatty acids containing unsaturation at the carbon 9 position (i.e.. has Δ9-e!ongase activity) and has at least 68%, 69%. 70%, 7i%. 72%. 73%. 74%. 75%. 76%, 77%, 78%. 79%. 80%. 81%. 82%. 83%. 84%, 85%, 86%. 87%. 88%, 89%. 90%, 91%. 92%. 93%. 94%.95%. 96%. 97%.98% or 99% similarity or identity to the amino acid sequence (i.e.. SEQ ID NO: 18 (shown in Figure 7B) or SEQ ID NO: 20 (shown in Figure 8B)). Specifically, the present disclosure includes a purified polypeptide having an amino acid sequence of SEQ ID NO: 18 or SEQ ID NO: 20.
[00109] Fragments of the polypeptide having the sequence of SEQ ID TNO: 18 or SEQ ID NO: 20 are also contemplated herein. Such fragments can have a length comprising or consisting of 10 to about 260 consecutive amino acids. 10 to about 200 consecutive amino acids. 10 to about 100 consecutive amino acids. 10 to about 50 consecutive amino acids. 10 to about 40 consecutive amino acids. 10 to about 30 consecutive amino acids, or 10 to about 20 consecutive amino acids.
[001 10] Variants of the polypeptide having the sequence of SEQ ID NO: 18 or SEQ ID NO: 20 are also contemplated herein. Such variants may contain one or more amino acid additions, substitutions, or deletions. Non-limiting examples of amino acid variants of SEQ ID NO: 18 encompassed by the present disclosure are shown in Table B below. One specific example of a variant of SEQ ID NO: 18 is SEQ ID NO: 20 (see Figure 8B).
Amino Acid Substitution
(SEQ H> NO: 18→SEQ ID
NO: 20)
A28 => V28
Figure imgf000029_0001
Production of the Δ9-elongase enzyme
[001 11] Once the nucleic acid (e.g.. gene) encoding the Δ9-eIongase enzyme has been isolated and/or purified, it ma> then be introduced into cither a prokaryotϊc or eukaryotic host cell through the use of a vector or construct. The vector, for example, a bacteriophage, cosmid. or plasmid. may comprise the nucleotide sequence encoding the Δ9-elongase enzyme, as well as any regulatory sequence {e.g.. promoter) which is functional in the host cell and is able to elicit expression of the Δ9-eIongase encoded by the nucleotide sequence. The regulatory sequence is in operable association with or operabJy linked to the nucleotide sequence. (As noted above, regulatory is said to be "operably linked" with a coding sequence if the regulatory sequence affects transcription or expression of the coding sequence.) Suitable promoters include, for example, those from genes encoding alcohol dehydrogenase, glyceraldehyde-3 -phosphate dehydrogenase, phosphoglucoisomerase,
phosphoglycerate kinase, acid phosphatase, T7. TPl. lactase, metallothionein, cytomegalovirus immediate early, whey acidic protein, glucoamylase. and promoters activated in the presence of galactose, for example. GALl and GALIO. Additionally, nucleotide sequences which encode other proteins, oligosaccharides, lipids, etc. may also be included within the vector as well as other regulatory sequences such as a polyadenylation signal (e.g.. the poly-A signal of SV-40T-anligen. ovalalbumin or bovine growth hormone). The choice of sequences present in the construct is dependent upon the desired expression products as well as the nature of the host cell.
[001 12] As noted above, once the vector has been constructed, it may then be introduced into the host cell of choice by methods known to those of ordinary skill in the art including, for example, transfcctϊon. transformation and electroporation (see Molecular Cloning: A Laboratory? Manual. 2nd ed.. Vol. 1-3. ed. Sambrook et al.. Cold Spring Harbor Laboratory Press (1989)). The host cell is then cultured under suitable conditions permitting expression of the genes leading to the production of the desired PUFA. which is then recovered and purified using routine techniques known in the art.
[00113] Examples of suitable prokarjotic host ceils include, but are not limited to. bacteria such as Escherichia coli. Bacillus sυbtilis as well as c>anobacteria such as Spirtdina spp. (i.e.. blue-green algae). The eukaryotic cell may be. for example, a mammalian cell, an insect cell, a plant cell or a fungal cell. The fungal ceil may be. for example, Saccharomyces spp., Candida spp., Lψomyces spp., Yarrowia spp.. Aspergillus spp.. Peniciilium spp.. Neurospora spp., Khtyveromyces spp.. Hansemila spp.. Trichoderma spp.. or Pichia spp. In particular, the fungal cell may be a yeast cell such as. for example. Saccharomyces spp.. Candida spp..
Hansemila spp. and Pichia spp. The yeast cell may also be Saccharomyces cerevisiae. The plant cell includes, but is not limited to. plant ceils from oilseed plants such as Glycine max (e.g., soybean), a Brassica species, Carthamus tinctorius L. (e.g., safflower). Helianthus anmts (e.g., sunflower), Zea mays (e.g.. maize), a Gossypium species (e.g., cotton), and Linum usitatissimiim (e.g.. flax).
[001 14] Expression in a host cell can be accomplished in a transient or stable fashion. Transient expression can occur from introduced constructs which contain expression signals functional in the host cell, but which constructs do not replicate and rarely integrate in the host cell, or where the host cell is not proliferating.
Transient expression also can be accomplished by inducing the activity of a regulatable promoter operably linked to the gene of interest, although such inducible systems frequently exhibit a low basal level of expression. Stable expression can be achieved by introduction of a construct that can integrate into the host genome or that autonomously replicates in the host cell. Stable expression of the gene of interest can be selected for through the use of a selectable marker located on or transfected with the expression construct followed by selection for cells expressing the marker. When stable expression results from integration, the site of the construct s integration can occur randomly within the host genome or can be targeted through the use of constructs containing regions of homology with the host genome sufficient to target recombination with the host locus. Where constructs are targeted to an endogenous locus, ail or some of the transcriptional and transϊationa! regulatory regions can be provided by the endogenous locus.
[001 15] A transgenic mammal may also be used in order to express the Δ9- elongase enzyme and ultimately the PUFA(s) of interest. More specifically, once the above-described construct is created, it may be inserted into the pronucleus of an embryo. The embryo may then be implanted into a recipient female. Alternatively, a nuclear transfer method could also be utilized (Schnieke, et al.. Science 278:2130- 2133 (1997)). Gestation and birth are then permitted (see, e.g.. U.S. Patent No.
5,750,176 and U.S. Patent No. 5,700,671). Milk, tissue or other fluid samples from the offspring should then contain altered levels of PUFAs, as compared to the levels normally found in the non-transgenic animal. Subsequent generations may be monitored for production of the altered or enhanced levels of PLJFAs and thus incorporation of the gene encoding the desired desaturase enzyme into their genomes. The mammal utilized as the host may be selected from the group consisting of. for example, a mouse, a rat, a rabbit, a pig. a goat a sheep, a horse and a cow. However, any mammal may be used provided it has the ability? to incorporate DNA encoding the enzyme of interest into its genome.
[001 16] For expression of a Δ9-eIongase polypeptide, functional transcriptional and translational initiation and termination regions are operably linked to the DNA encoding the elongase polypeptide. Transcriptional and translational initiation and termination regions are derived from a variety of nonexclusive sources, including the DNA to be expressed, genes known or suspected to be capable of expression in the desired system, expression vectors, chemical synthesis, or from an endogenous locus in a host cell. Expression in a plant tissue and/or plant part presents certain efficiencies, particularly where the tissue or part is one which is harvested early, such as seed, leaves, fruits, flowers, roots, etc. Expression can be targeted to that location with the plant by utilizing specific regulatory sequence such as those of U.S. Patent Nos. 5,463,174, 4.943.674, 5,106,739, 5.175.095, 5.420,034, 5,188.958, and 5.589.379. [001 17] Alternatively, the expressed protein can be an enz) me which produces a product which may be incorporated, either directly or upon further modifications, into a fluid fraction from the host plant. Expression of a Δ9-elongase gene, or antisense Δ9-elongase transcripts, can alter the levels of specific PUFAs. or derivatives thereof, found in plant parts and/or plant tissues.
[00118j The Δ9-eIongase polj peptide coding region may be expressed either b> itself or with other genes (e.g.. a gene encoding a Δ8-desaturase, a gene encoding a Δ5-desaturase, a gene encoding a Δ 17-desaturase, a gene encoding a Δ5-elongase. and/or a gene encoding a Δ4-desaturase). in order to produce tissues and/or plant parts containing higher proportions of desired PUFAs or in which the PLJFA composition more closely resembles that of human breast milk (see WO 95/24494). The termination region may be derived from the 3" region of the gene from which the initiation region was obtained or from a different gene. A large number of termination regions are known to and have been found to be satisfactory in a variety of hosts from the same and different genera and species. The termination region usually is selected as a matter of convenience rather than because of any particular property.
[001 19] As noted above, a plant (e.g.. Glycine max (soybean) or Brassica napus (canola)) or plant tissue may also be utilized as a host or host cell, respectively, for expression of the Δ9-eiongase enzyme which may, in turn, be utilized in the production of polyunsaturated fatty acids. More specifically, desired PLJFAS can be expressed in seed. Methods of isolating seed oils are known in the art. Thus, in addition to providing a source for PUFAs. seed oil components may be manipulated through the expression of the Δ9-elongase gene, as wrell as perhaps desaturase genes (e.g.. Δ8-desaturase. Δ17-desaturasc. Δ5-desaturases, Δ4-desaturase. etc.) and other elongase genes (e.g.. Δ5-eioπgase. etc.). in order to provide seed oils that can be added to nutritional compositions, pharmaceutical compositions, animal feeds and cosmetics. Once again, a vector which comprises a DNA sequence encoding the Δ9- elongase operably linked to a promoter, will be introduced into the plant tissue or plant for a time and under conditions sufficient for expression of the Δ9-elongase gene. The vector ma}" also comprise one or more genes that encode other enzymes. for example. Δ4-desatυrase, Δ5-desaturase. Δ6-desafurase. ΔlO-desaturase. ΔI2- desaturase, Δ15-desaturase. ΔI7-desaturase. Δϊ9-desatorase. Δ6-elongase, and/or Δ5- elongase. The plant tissue or plant may produce the relevant substrate upon which the enzymes act or a vector encoding enzymes which produce such substrates may be introduced into the plant tissue, plant cell or plant. In addition, substrate may be sprayed on plant tissues expressing the appropriate enzymes. Using these various techniques, one may produce PUFAs by use of a plant cell, plant tissue or plant. It should also be noted that the disclosure also encompasses a transgenic plant comprising the above-described vector, wherein expression of the nucleotide sequence of the vector results in production of a polyunsaturated fatty acid in. for example, the seeds of the transgenic plant.
[00120] The regeneration, development, and cultivation of plants from single plant protoplast transformants or from various transformed explants is well known in the art (Weissbach and Weissbach. In: Methods for Plant Molecular Biology. (Eds.)τ Academic Press. Inc. San Diego. CA. (1988)). This regeneration and growth process typically includes the steps of selection of transformed cells, culturing those individualized cells through the usual stages of embryonic development through the rooted plantlet stage. Transgenic embryos and seeds are similarly regenerated. The resulting transgenic rooted shoots are thereafter planted in an appropriate plant growth medium such as soil.
[00121] The development or regeneration of plants containing the foreign, exogenous gene that encodes a protein of interest is well known in the art. Preferably, the regenerated plants are self-pollinated to provide homozygous transgenic plants. Otherwise, pollen obtained from the regenerated plants is crossed to seed-grown plants of agronomically important lines. Conversely, pollen from plants of these important lines is used to pollinate regenerated plants. A transgenic plant of the present disclosure containing a desired polypeptide is cultivated using methods well known to one skilled in the art. [00122] There are a variety of methods for the regeneration of plants from plant tissue. The particular method of regeneration wiJl depend on the starting plant tissue and the particular plant species to be regenerated.
[00123] Methods for transforming dϊcots, primarϊiy by use of 'Agrobacterium tumefaciens, and obtaining transgenic plants have been published for cotton (U.S. Patent No. 5.004,863. U.S. Patent No. 5.159.135. U.S. Patent No. 5.518. 908);
soybean (U.S. Patent No. 5.569,834, U.S. Patent No. 5,416,0i l, McCabe et. aL. BiolTechnology 6:923 (1988). Christou et aL, Plant Physiol 87:671 674 (1988)); Brassica (U.S. Patent No. 5,463.174); peanut (Cheng et ah. Plant Cell Rep. 15:653 657 (1996), McKently. et aL, Plant Cell Rep. 14:699 703 (1995)): papaya; and pea (Grant et aL, Plant Cell Rep. 15:254258, ( 1995)).
[00124J Transformation of monocotyledons using electroporation, particle bombardment, and Agrobacterium have also been reported. Transformation and plant regeneration have been achieved in asparagus (Bytebier et aL, Proc. Natl. Acad Sd. (USA) 84:5354, (1987)); barley (Wan and Lemaux, Plant Plψsiol 104:37 (1994)); lea mays (Rhodes et aL, Science 240:204 (1988), Gordon-Kamm et aL, Plant Cell 2:603 618 (1990), Fromm et aL, BiolTecJmolog}' 8:833 (1990), Koziel et aL,
BiolTechnalogy 1 1: 194, (1993), Armstrong et aL, Crop Science 35:550 557 (1995)); oat (Somers et aL, BiolTeclmology 10: 15 89 (1992)); orchard grass (Horn et aL, Plant Cell Rep. 7:469 (1988)); rice (Toriyama et aL, TheorAppl. Genet. 205:34, (1986); Part et aL, Plant MoI. Biol. 32: 1 135 1148, (1996); Abedinia et aL, Aust. J. Plant Physiol. 24:133 141 (1997); Zhang and Wu, Tlwor. Appl. Genet. 76:835 (1988); Zhang et al. Plant Cell Rep. 7:379, (1988); Battraw and \\&\l Plant Sci. 86:191 202 (1992);
Christou et aL, Bio/Technology 9:957 (1991)); rye (De Ia Pena et aL, Nature 325:274 (1987)); sugarcane (Bower and Birch, Plant J. 2:409 (1992)); tall fescue (Wanget aL, BiolTechnology 10:691 (1992)). and wheat (Vasil et aL, Bio/Technology 10:667 (1992): U.S. Patent No. 5,631,152).
[00125] Assays for gene expression based on the transient expression of cloned nucleic acid constructs have been developed by introducing the nucleic acid molecules into plant celis by polyethylene glycol treatment, elcctroporation. or particle bombardment (Marcotte et aL Nature 335:454457 (1988): Marcotte ct a!.. Plant Cell 1 :523 532 (1989): McCarty et aL. Cell 66:895 905 (1991): Hattori et al.. Genes Dev. 6:609 618 (1992): Goff et al., EMBOJ. 9:2517 2522 (1990)).
[00126] Transient expression systems may be used to functionally dissect gene constructs (see generally. MaI iga et al.. Methods in Plant Molecular Biology. Cold Spring Harbor Press (1995)). It is understood that any of the nucleic acid molecules of the present disclosure can be introduced into a plant cell in a permanent or transient manner ϊn combination with other genetic elements such as vectors, promoters, enhancers etc.
[00127] In addition to the above discussed procedures, practitioners are familiar with the standard resource materials which describe specific conditions and procedures for the construction, manipulation and isolation of macromolecules (e.g., DNA molecules, plasmids, etc.), generation of recombinant organisms and the screening and isolating of clones, (see for example, Sambrook et aL_ Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Press (1989); Maliga et al.. Methods in Plant Molecular Biology, Cold Spring Harbor Press (1995); Birren et a!.. Genome Analysis: Detecting Genes. 1. Cold Spring Harbor. New York (1998): Birren et al., Genome Analysis: Analyzing DNA. 2. Cold Spring Harbor. New York (1998); Plant Molecular Biology: A Laboratory Manual, eds. Clark. Springer. New York (1997)).
[00128] The substrates which may be produced by the host cell either naturally or transgenically. as well as the enzymes which may be encoded by DNA sequences present in the vector which is subsequently introduced into the host cell, are shown in Figure 1.
[00129] In view of the above, the present disclosure encompasses a method of producing the Δ9-elongase enzyme comprising the steps of: I) isolating a nucleotide sequence comprising or complementary to at least 68% of the nucleotide sequence encoding the Δ9-eIongase enzyme (e.g.. a nucleotide sequence selected from the group consisting of SEQ ID NO: 17 and SEQ ID NO: 19): 2) constructing an expression vector comprising the nucleotide sequence operably linked to a regulatory sequence: and 3) introducing the vector into a host cell under time and conditions sufficient for the production of the Δ9-ebngase enzyme.
[00130] The present disclosure also encompasses a method of producing polyunsaturated fatly acids, ϊn one aspect, the method involves: I) isolating a nucleotide sequence comprising or complementary to at least 68% of the nucleotide sequence encoding the Δ9-elongase enzyme (e.g., a nucleotide sequence selected from the group consisting of SEQ ID NO: 17 and SEQ ID NO: 19); 2) constructing an expression vector comprising the nucleotide sequence operabiy linked to a regulatory sequence; 3) introducing the expression vector into a host cell under time and conditions sufficient for the production of a Δ9-eIongase enzyme; and 4) exposing the expressed Δ9-elongase to a substrate polyunsaturated fatty acid in order to convert the substrate polyunsaturated fatty acid to a first product polyunsaturated fatty acid.
Examples of substrate PUFAs include LA. ALA. and combinations thereof.
Examples of first product polyunsaturated fatty acid that can be produced by this method are ω6-EDA, ω3-ETrA, or both ©6-EDA and ©3-ETrA. For example, when LA is exposed to a Δ9-elongase enzyme, it is converted to ω6-EDA. In another example, when ALA is exposed to a Δ9-elongase enzyme, it is converted to α>3-ETrA.
[00131 ] The method can further involve the step(s) of exposing the first product polyunsaturated fatty acid to at least one desaturase, at least one additional elongase, or combinations thereof, and optionally repeating this step (i.e.. exposing the second or subsequent product polyunsaturated fatty acid to a desaturase or elongase (which can be the same or different from any previously used desaturase or elongase) to convert the first product polyunsaturated fatty acid to a second or subsequent (e.g.. third, fourth, fifth, sixth, etc.) product polyunsaturated fatty acid). This step can be repeated as many times as necessary until the desired product polyunsaturated fatty acid is obtained. For example, if the first product
polyunsaturated fatty acid is e>6-EDA. the method can further comprise exposing ωό- EDA to. for example. Δ8-desaturase which converts the ω6-EDA to DGLA (a second product polyunsaturated fatty acid). The EKJLA then may optionally be converted to ARA (a third product polyunsaturated fatty acid) by exposing the DGLA to. for example, Δ5-desaturase. The ARA can then be exposed to a Δ 17-desaturase to produce EPA (a fourth product polyunsaturated fatty acid). Still further, optionally the EPA can be exposed to a Δ5~efongase to produce DPA (a fifth product polyun saturated fatty acid). The DPA can then optionally be exposed to a Δ4- desaturase to produce DHA (a sixth product polyunsaturated fatty acid). In another example, if the first product polyunsaturated fatty acid is ω3-ETrA, the method can further comprise exposing the oo3-ETrA to, for example. Δ8-desaturase which converts the ω3-ETrA to ETA (a second product polyunsaturated fatty acid). The ETA may then be converted to EPA (a third product polyunsaturated fatty acid) by- exposing the ETA to, for example. Δ5-desaturase. The EPA may be further converted to other polyunsaturated fatty acids as described above.
[00132] In another aspect, the method involves: 1) isolating a nucleotide sequence comprising or complementary to at least 68% of a nucleotide sequence encoding the Δ9-elongase enzyme (e.g., a nucleotide sequence selected from the group consisting of SEQ ID NO: 17 and SEQ ID NO: 19); 2) constructing an expression vector comprising the isolated nucleotide sequence operabiy linked to a regulatory sequence; 3) introducing the expression vector and at least one additional recombinant DNA construct comprising an isolated nucleotide sequence encoding a Δ8-desaturase and operabiy linked to at least one regulator}' sequence into a host cell for a time and under conditions sufficient for expression of a Δ9-elongase and the Δ8- desaturase; and 4) exposing the expressed Δ9-elongase and the Δ8-desaturase to a substrate polyunsaturated fatty acid selected from the group consisting of LA, ALA. and combinations thereof, in order to convert the substrate polyunsaturated fatty acid to a first product polyunsaturated fatty* acid. Examples of the first product polyunsaturated fatty acid include DGLA, ω3-ETA, and combinations thereof.
Furthermore- the method can further involve the step(s) of exposing the first product polyunsaturated fatty acid to at least one additional desaturase or at least one additional elongase and. optionally, repeating this step {namely, exposing the second or subsequent product polyunsaturated fatty acid to a desaturase or eiongase (which can be the same or different from any desaturase or eiongase used previously)) to convert the first product polyunsaturated fatty acid (e.g.. DGLA and/or OJ3-ETA) to a second or subsequent (e.g.. third, fourth, fifth, sixth, etc.) product polyunsaturated fatty acid. This step can be repeated as many times as necessary until the desired product polyunsaturated fatly acid is obtained. In one aspect, the method further includes introducing into the host cell a recombinant DNA construct comprising an isolated nucleotide sequence encoding a Δ5-desaturase operably linked to a regulatory sequence.
[00133 j Thus. Δ9-eIongase may be used in the production of
polyunsaturated fatty acids which may be used, in turn, for particular beneficial purposes, or may be used in the production of other PUFAs.
Uses of the A9-Elongase Gene
[00134] As noted above, the Δ9-isolated eiongase gene and the Δ9-eIongase enzyme encoded thereby have many uses. For example, the gene and corresponding enzyme may be used indirectly or directly in the production of polyunsaturated fatty acids, for example. Δ9-elongase may be used in the production of ω6-EDA. ω3-ETrA. DGLA- ω3-ETA. ARA, EPA, ω3-docosapentaenotc acid. ω6-docosapentaenoic acid. ADA and/or DHA. "Directly" is meant to encompass the situation where the enzyme directly converts the acid to another acid, the latter of which is utilized in a composition (e.g.. the conversion of LA to ω6-EDA). "Indirectly" is meant to encompass the situation where an acid is converted to another acid (i.e., a pathway intermediate) by the enzyme (e.g., LA to ω6-EDA) and then the latter acid is converted to another acid by use of a non-elongase enzyme (e.g.. ω6-EDA to DGLA by. for example. Δ8-desaturase. These polyunsaturated fatty acids (i.e.. those produced either directiy or indirectly by activity of the Δ9-elongase enzyme) may be added to. for example, nutritional compositions, pharmaceutical compositions, cosmetics, and animal feeds, all of which are encompassed by the present disclosure. These uses are described, in detail, below. Nutritional Compositions
[00135] The present disclosure includes nutritional compositions. Such compositions, for purposes of the present disclosure, include any food or preparation for human consumption including for enteral or parenteral consumption, which when taken into the body (a) serve to nourish or build up tissues or supply energy and/or (b) maintain, restore or support adequate nutritional status or metabolic function.
[00136] The nutritional composition of the present disclosure comprises at least one oil or acid produced directly or indirectly by use of the Δ9-elongase gene, as described herein, and may either be in a solid or liquid form. Additionally, the composition may include edible macronutrients. vitamins and minerals in amounts desired for a particular use. The amount of such ingredients will vary depending on whether the composition is intended for use with normal, healthy infants, children or adults having specialized needs such as those which accompany certain metabolic conditions (e.g.. metabolic disorders).
[00137] Examples of macronutrients which may be added to the composition include but are not limited to edible fats, carbohydrates and proteins. Examples of such edible fats include but are not limited to coconut oil, soy oil, and mono- and diglycerides. Examples of such carbohydrates include but are not limited to glucose, edible lactose and hydrolyzed search. Additionally, examples of proteins which may be utilized in the nutritional composition of the disclosure include but are not limited to soy proteins, electrodialysed whey, electrodialysed skim milk, milk whey, or the hydrolysates of these proteins.
[00138] With respect to vitamins and minerals, the following may be added to the nutritional compositions of the present disclosure: calcium, phosphorus, potassium, sodium, chloride, magnesium, manganese, iron, copper, zinc, selenium, iodine, and Vitamins A, E. D. C. and the B complex. Other such vitamins and minerals may also be added. [00139] The components utilized in the nutritional compositions of the present disclosure will be of semi-purified or purified origin. By semi-purified or purified is meant a material which has been prepared by purification of a natural material or by synthesis.
[00140] Examples of nutritional compositions of the present disclosure include but are not limited to infant formulas, dietary supplements, dietary substitutes, and rehydration compositions. Nutritional compositions of particular interest include but are not limited to those utilized for enteral and parenteral supplementation for infants, specialty infant formulas, supplements for the elderly, and supplements for those with gastrointestinal difficulties and/or malabsorption.
[00141] The nutritional composition of the present disclosure may also be added to food even when supplementation of the diet is not required. For example, the composition may be added to food of any type including but not limited to margarines, modified butters, cheeses, milk, yogurt, chocolate, candy, snacks, salad oils, cooking oils, cooking fats, meats, fish and beverages.
[00142] In a preferred embodiment of the present disclosure, the nutritional composition is an enteral nutritional product more preferably, an adult or pediatric enteral nutritional product. Tills composition may be administered to adults or children experiencing stress or having specialized needs due to chronic or acute disease states. The composition may comprise, in addition to polyunsaturated fatty acids produced in accordance with the present disclosure, macronutrients, vitamins and minerals as described above. The macronutrients may be present in amounts equivalent to those present in human milk or on an energy basis, i.e., on a per calorie basis.
[00143] Methods for formulating liquid or solid enteral and parenteral nutritional formulas are well known in the art.
[00144] The enteral formula, for example, may be sterilized and
subsequently utilized on a ready-to-feed (RTF) basis or stored in a concentrated liquid or powder. The powder can be prepared by spray drying the formula prepared as indicated above, and reconstituting it by rehydrating the concentrate. Adult and pediatric nutritional formulas arc well known ϊn the art and are commercially available (e.g.. Similac®. Ensure®. Jevϊty® and Alimentum® from Ross Products Division, Abbott Laboratories, Columbus. Ohio). An oil or acid produced in accordance with the present disclosure may be added Io any of these formulas.
[00145] The energy density of the nutritional compositions of the present disclosure, when in liquid form, may range from about 0.6 Kcal to about 3 Kcal per ml. When in solid or powdered form, the nutritional supplements may contain from about 1.2 to more than 9 Kcais per gram, preferably about 3 to 7 Kcals per gm. In general, the osmolality of a liquid product should be less than 700 mOsm and. more preferably, less than 660 mOsm.
[00146] The nutritional formula may include macronutrients, vitamins, and minerals, as noted above, in addition to the PUFAs produced in accordance with the present disclosure. The presence of these additional components helps the individual ingest the minimum daily requirements of these elements. In addition to the provision of PUFAs? it may also be desirable to add zinc, copper, folic acid and antioxidants to the composition. It is believed that these substance boost a stressed immune system and will therefore provide further benefits to the individual receiving the composition. A pharmaceutical composition may also be supplemented with these elements.
[00147] In a more preferred embodiment, the nutritional composition comprises, in addition to antioxidants and at least one PUFA, a source of
carbohydrate wherein at least 5 weight percent of the carbohydrate is indigestible oligosaccharide. In a more preferred embodiment, the nutritional composition additionally comprises protein, taurine, and carnitine.
[00!48] As noted above, the PUFAs produced in accordance with the present disclosure, or derivatives thereof, may be added to a dietary substitute or supplement, particularly an infant formula, for patients undergoing intravenous feeding or for preventing or treating malnutrition or other conditions or disease states. As background, it should be noted that human breast milk has a fatty acid profile comprising from about 0.15% Io about 0.36% as DHA. from about 0.03% to about 0.13% as EPA. from about 030% to about 0.88% as ΛRA, from about 0.22% to about 0.67% as DGLA. and from about 0.27% to about 1.04% as GLA. Thus, fatty acids such as ARA. EPA and/or DHA, produced in accordance with the present disclosure, can be used to alter, for example, the composition of infant formulas in order to better repiicate the PUFA content of human breast milk or to alter the presence of PUFAs noπnaily found in a non-human mammal's milk. In particular, a composition for use in a pharmacologic or food supplement particularly a breast milk substitute or supplement, will preferably comprise one or more of ARA, EPA. DGLA. and DHA. More preferably, the oil will comprise from about 0.3 to 30% ARA. and from about 0.2 to 30% DGLA.
[00149] Parenteral nutritional compositions comprising from about 2 to about 30 weight percent fatty acids calculated as triglycerides are encompassed by the present disclosure. Other vitamins, particularly fat-soluble vitamins such as vitamin A- D, E and L-carnitϊne can optionally be included. When desired, a preservative such as alpha-tocopherol may be added in an amount of about 0.1% by weight.
[00150] In addition, the ratios of ARA and DGLA can be adapted for a particular given end use. When formulated as a breast milk supplement or substitute, a composition which comprises one or more of ARA, DGLA and GLA will be provided in a ratio of about 1:19:30 to about 6:1:0.2, respectively. For example, the breast milk of animals can vary in ratios of ARA:DGLA:GLA ranging from 1 : 19:30 to 6: 1 :0.2, which includes intermediate ratios which are preferably about 1:1: 1. 1 :2:1. 1 : 1 :4. When produced together in a host cell, adjusting the rate and percent of conversion of a precursor substrate such as EDA and DGLA to ARA can be used to precisely control the PUFA ratios. For example, a 5% to 10% conversion rate of DGLA to ARA can be used to produce an ARA to DGLA ratio of about 1 : 19.
whereas a conversion rate of about 75% to 80% can be used to produce an ARA to DGLA ratio of about 6:1. Therefore, whether in a cell culture system or in a host animal, regulating the timing, extent and specificity of elongase expression, as well as the expression of desaturases (such as but nol limited to Δ8-desaturases) and other elongases. can be used to modulate PUFA levels and ratios. The PUFAs/acids produced in accordance with the present disclosure (e.g.. ARA and EPA) may then be combined with other PUFAs/acids (e.g.. DGLA) in the desired concentrations and ratϊos.
[00151] Additionally, PUFA produced in accordance with the present disclosure or host cells containing them may also be used as animal food supplements to alter an anϊmaFs tissue or milk fatty acid composition to one more desirable for human or animal consumption.
[00152] Examples of some of the nutritional supplements, infant formulations, nutritional substitutes and other nutritional solutions that employ the polyunsaturated fatty acids produced pursuant to the present disclosure are described below.
[00153] Infant Formulations: Examples of infant formulations include, but are not limited to, ϊsomii® Soy Formula with Iron. Isomil® DF Soy Formula For Diarrhea, Isomil® Advance® Soy Formula with Iron. Isomil® Advance® 20 Soy Formula With Iron Ready To Feed. Similac® Infant Formula, Similac® Advance® Infant Formula with Iron, Similac® NeoSure® Advance® Infant Formula With iron. Similac Natural Care Advance Low-Iron Human Milk Fortifier Ready To Use. all commercially available from Abbott Nutrition (Columbus, OH). The various PUFAs of the present disclosure can be substituted and/or added to the infant formulae described herein and to other infant formulae known to those in the art.
[00! 54] Nutritional Formulations: Examples of nutritional formulations include, but are not limited to. ENSURE®. ENSURE® HIGH PROTEIN. ENSURE PLUS®. ENSURE® POWDER, ENSURE® PUDDING- ENSURE® WITH FIBER. Oxepa™ Nutritional Product, all commercially available from Abbott Nutrition (Columbus. OH), The various nutritional supplements described above and known to others of skill in the art can be substituted and/or supplemented with the PUFAs produced in accordance with the present disclosure. Pharmaceutical Compositions
[001551 The present disclosure also encompasses a pharmaceutical composition comprising one or more of the acids and/or resulting oils produced using the Δ9-elongase genes described herein, in accordance with the methods described herein. More specifically, such a pharmaceutical composition may comprise one or more of the acids and/or oiϊs as weli as a standard, well-known, non-toxic pharmaceutically acceptabϊe carrier, adjuvant or vehicle such as. for example, phosphate buffered saline, water, ethanol. polyols. vegetable oils, a wetting agent or an emuϊsion such as a water/oil emulsion. The composition may be in either a liquid or solid form. For example, the composition may be in the form of a tablet capsule, ingestible liquid or powder, injectible. or topical ointment or cream. Proper fluidity can be maintained, for example, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants. It may also be desirable to include isotonic agents, for example, sugars, sodium chloride and the like. Besides such inert diluents, the composition can also include adjuvants, such as wetting agents, emulsifying and suspending agents, sweetening agents, flavoring agents and perfuming agents.
[00156] Suspensions, in addition to the active compounds, may comprise suspending agents such as. for example, ethoxylated isostearyl alcohols,
polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide. bentonite, agar-agar and tragacanth or mixtures of these substances.
[00 ! 57] Solid dosage forms such as tablets and capsules can be prepared using techniques weli known in the art. For example. PUFAs produced in accordance with the present disclosure can be tableted with conventional tablet bases such as lactose, sucrose, and cornstarch in combination with binders such as acacia, cornstarch or gelatin, disintegrating agents such as potato starch or alginic acid, and a lubricant such as stearic acid or magnesium stearate. Capsules can be prepared by incorporating these excipϊents into a gelatin capsule along with antioxidants and the
^3- relevant PUFA(s). The antioxidant and PUFA components should fit Ή, ϊlhin the guidelines presented above.
[00 ϊ 58] For intravenous administration, the PUFAs produced in accordance w ith the present disclosure or derivatives thereof may be incorporated into commercial formulations such as Intralipids™. The typical normal adult plasma fatty acid profile comprises 6.64 to 9.46% ARA. 1.45 to 3. N % of DGLA. and 0.02 to 0.08% of GLA. These PUFAs or their metabolic precursors can be administered alone or in combination with other PUFAs in order to achieve a normal fatty acid profile in a patient Where desired, the individual components of the formulations may be provided individually, in kit foπn. for single or multiple use. A typical dosage of a particular fatty acid is from 0.1 mg to 20 g (up to 100 g) daily and is preferably from 10 mg to 1. 2. 5 or 10 g daily.
[00159] Possible routes of administration of the pharmaceutical
compositions of the present disclosure include, for example, enteral (e.g., oral and rectal) and parenteral. For example, a liquid preparation may be administered, for example, orally or rectally. Additionally, a homogenous mixture can be completely dispersed in water, admixed under sterile conditions with physiologically acceptable diluents, preservatives, buffers or prope Hants in order to form a spray or inhalant.
[00160] The route of administration will, of course, depend upon the desired effect. For example, if the composition is being utilized to treat rough, dry. or aging skin, to treat injured or burned skin, or to treat skin or hair affected by a disease or condition, it may perhaps be applied topically.
[00161 j The dosage of the composition to be administered to the patient may be determined by one of ordinary skill in the art and depends upon various factors such as weight of the patient age of the patient immune status of the patient, etc.
[00162] With respect to form, the composition may be. for example, a solution, a dispersion, a suspension, an emulsion or a sterile powder which is then reconstituted. [00 i 63] The present disclosure also includes the treatment of various disorders by use of the pharmaceutical and/or nutritional compositions described herein. In particular, the compositions of the present disclosure may be used to treat restenosis after angioplasty. Furthermore, symptoms of inflammation, rheumatoid arthritis, asthma and psoriasis may also be treated with the compositions of the disclosure. Evidence also indicates that PUFAs may be involved in calcium metabolism; thus, the compositions of the present disclosure may. perhaps, be utilized in the treatment or prevention of osteoporosis and of kidney or urinary tract stones.
[00164] Additionally, the compositions of the present disclosure may also be used in the treatment of cancer. Malignant cells have been shown to have altered fatty acid compositions. Addition of fatty acids has been shown to slow their growth, cause eel! death and increase their susceptibility to chemotherapeutic agents.
Moreover, the compositions of the present disclosure may also be useful for treating cachexia associated with cancer.
[00165] The compositions of the present disclosure may also be used to treat diabetes (see U.S. Patent No. 4.826.877 and Horrobin et aL Am. J. Clin. Nutr. 1993) Vol. 57 (Suppi.) 732S-737S). Altered fatty acid metabolism and composition have been demonstrated in diabetic animals.
[00166] Furthermore, the compositions of the present disclosure, comprising PUFAs produced either directly or indirectly through the use of the Δ9-elongase enzyme, may also be used in the treatment of eczema, in the reduction of blood pressure- and in the improvement of mathematics examination scores. Additionally, the compositions of the present disclosure may be used in inhibition of platelet aggregation, induction of vasodilation, reduction in cholesterol levels, inhibition of proliferation of vessel wall smooth muscle and fibrous tissue (Brenner et ah. Adv. Exp. Med. Biol. (1976) Vol. 83. p.85-101). reduction or prevention of gastrointestinal bleeding and other side effects of non-steroidal anti-inflammatory drugs (see U.S. Patent No. 4.666.701), prevention or treatment of endometriosis and premenstrual syndrome (see U.S. Patent No. 4.758.592). and treatment of myalgic encephalomyelitis and chronic fatigue after viral infections (see U.S. Patent No. 5.1 16.871).
[00167] Further uses of the compositions of the present disclosure include use in the treatment of AIDS, multiple sclerosis, and inflammatory skin disorders, as well as for maintenance of general health.
[00168] Additionally, the composition of the present disclosure may be utilized for cosmetic purposes. It may be added to pre-existing cosmetic
compositions such that a mixture is formed or may be used as a sole composition.
Veterinary Applications
[00 f 69] It should be noted that the above-described pharmaceutical and nutritional compositions may be utilized in connection with animals (i.e.. domestic or non-domestic), as well as humans, as animals experience many of the same needs and conditions as humans. For example, the oil or acids of the present disclosure may be utilized in animal or aquaculture feed supplements, animal feed substitutes, animal vitamins or in animal topical ointments.
[00170] The present disclosure may be illustrated using the following non- limiting examples.
Example 1 : cDN A Library Construction from Eugϊena deses Ehr. CCMP 2916 and
Sequence Analysis to isolate Putative Δ9 Elongase Candidates
[00171] Analysis of the fatty acid composition of some marine algae revealed the presence of a considerable amount of docosahexaenoic acid (DHA. 22:6 n-3) (15% by weight of total lipids) in Eugiena deses Ehr. CCMP 2916 (see Table 1). In addition, this organism displayed intermediates of the alternate Δ8-desaturase/Δ9- elongase pathway (see Figure 1). indicating that this pathway is active in this organism. Thus, it is predicted that this organism would contain an active Δ9- elongase capable of converting linofcic acid (LA. 18:2 n-6) to ω6-Eicosadienoic acid (ω6-EDA. 20:2 n-6), or α-linolenϊc acid (ALA. 18:3. n-3) to ω3-Eicosatrienoic acid (ω3-ETrA. 20:3n-3), as weii as an active Δ8-desaturase that
Figure imgf000049_0001
convert ωό- Eicosadienoic acid (ω6-EDA. 20:2 n-6) to Dihomo-y-lmolent'c acid (DGLA. 20:3 n- 6), or (Oj-Eicosatrϊeiioic acid (ω3-EtrA. 20:3n-3) to ω3-Eicosatetraenoic acid (ω3- ETA. 20:4n-3) {see Figure 1).
Table 1: Fatty acid profile of Euglena deses Ehr. CCMP 2916
Figure imgf000049_0002
[00172] The goal of this study was to isolate the full-length Δ9-elongase gene from Euglena deses Ehr. CCMP 2916 and to characterize its enzymatic activity by expression in a heterologous host, Saccharomyces cerevisiae.
[00173] To isolate full-length genes from Euglena deses Ehr. CCMP 2916. a micro-cDNA library was constructed using total RNA isolated from the organism. For this, cell pellets of the Euglena deses Ehr. CCMP 2916 were obtained from
Provasoli-Guillard-National Center for Marine Phytoplankton (CCMP-Bϊgelow Laboratories. West Boothbay. Maine), and total RNA was isolated from it using the Qϊagen RNeasy Maxi kit (Qiagen, Valencia. CA) as per manufacturer's protocol. Briefly, frozen cell pellets were crushed in liquid nitrogen using a mortar and pestle, suspended in RLT buffer (Qiagen RNeasy Plant Mini kit), and passed through a QiaShredder. The RNA was purified using RNeasy maxi columns as per
manufacturer's protocol. f00 i 74] The micro-cDNA ϊibrary was constructed by Agencourt Biosciences (Waltham, MA), using 50 μg of RNA from Euglena deses Ehr. CCMP 2916 by proprietary technology. Agencourt uses several unique and proprietary steps during first strand that ultimately yields a 25 to 30% increased efficiency over commonly used techniques. During the proprietary process, the R]NA is reverse transcribed into ssDNA using conditions designed to reduce or eliminate internal priming events. The combination of this and a specialized cycling program increases the number of full- length clones. Following second strand synthesis, the cDNA clones are then size selected at greater than 1.2kb to decrease preferential cloning of small, truncated cDNAs. For the large insert library, the insert size selected is >4kb to enhance for the larger insert clones. Following size selection, cDNA ends are polished and the cDNAs are digested using the rare cutting enzyme. A "rare-cutter" restriction enzyme, the site for which is introduced into the clones during the cDNA priming step, is then used to prepare the clones for directional cloning into the pAGEN vector. The "rare-cutter" restriction enzyme is 20 times less likely to cut within the cDNA clones, thus yielding many more full-length clones versus other cDNA library construction processes, which utilize more common restriction enzymes that cut at random intervals along the clone. The result is an insert with a 5* blunt end and a 3" overhang created from the rare cutting restriction enzyme. Because of this process, no additional adapter ligation is required to ensure directional cloning. This improves the overall efficiency of the cloning process. The vector is specially engineered for directional cloning without the use of 5* adaptors, further enhancing the
transformation efficiency due to a reduced number of manipulations of the cDNA during cloning. After the primary cDNA library is complete, it is tested for the
^8- number of independent eϊones. the percentage of recombinant clones and the average insert size.
[00 i 75] The clones are then transformed into DH i OB E. coli (Tl phage resistant bacterial ceils). The titer of the resulting library was 3.2 x I O6 cfu/mt with 3.52 x i O7 number of independent colonies with an average insert size of 1.3 kb.
[00176] 4224 clones from this cDN A library were sequenced. and vector- trimmed sequences were analyzed using BLAST to identify sequences with homology to known Δ9-elongase sequences. BLAST analysis revealed five putative hits from the Euglena deses Ehr. CCMP 2916 cDNA library with homology to known A9- elongase sequences from Pavlova sal ina (Accession # AAYI5I35; SEQ ID NO: 1: Figure 4A)- Isochrysis galbana (Accession #AF390174; SEQ ID NO: 2: Figure 4B). EuirβptieUa sp. (see WO 2007/061845 A2: SEQ ΪD NO: 3; Figure 4C)T Euglena gracialis (Accession # CAT16687; SEQ ID NO: 4; Figure 4D), and Euglena anabena (see WO 2008/0194685 Al: SEQ ID NO: 5; Figure 4E).
[00177] One EST clone designated pIate2_MO7' (SEQ ID NO: 6; Figure 5A), obtained from sequencing clones from the Euglena deses Ehr. CCMP 2916 cDNA library, showed high sequence homology to previously identified Δ9- etongases. This DNA fragment was 744 bp in length, and its deduced amino acid sequence (SEQ ID NO: 7: Figure 5B) displayed highest sequence identity (66% amino acid sequence identity) with the Δ9-elongase from Euglena gracialis (SEQ ID NO: 4). The plate2 MO7 gene fragment appeared to contain the 'ATG" start site of the gene based upon alignment with other Δ9-elongases. but did not contain the 3*- end of the putative Euglena deses Ehr. CCMP 2916 Δ9-elongase.
Example 2: isolation of the 3 '-end of the plate2 MO7 elongase from Euslena deses
£ftr. CCMP 2916
[00178] The plate2_MO7 clone sequence from Example 1 was used as a template to isolate its 3"- end. 100 f 79] First strand cDNΛ was synthesized using the SMART™ RACE kit (BD Blosciences) according to the manufacturer's instructions. For synthesis of 3" RACE-ready cDN'A. 1.5 μg totaϊ RNA from Euglena deses Ehr. CCMP 2916 and 1 μl of 3" CDS primer (5"-AAGCAGTGGTATCAACGCAGAGTAC(T)3OVNO". wherein N = A- C. G. or T; and V = A- G. or C (SEQ ΪD NO: 8)) (12 μM) were mixed in a total volume of 5 μl in a nuclease-free PCR tube, incubated at 700C for 2 minutes, and snap-chilled on ice. After brief centrifugation. 2 μl of 5X first strand buffer [250 rnM Tris-HCl (pH-8.3). 375 mM KCl and 30 mm MgCl2]. i μl of 0.1 M DTT and 1 μl of IO mM dNTP mix was added to the tubes. After incubation at 42°C for 2 minutes. I μl of reverse transcriptase (PowerScript™ RT. BD Biosciences) was added to the tube and incubated at 42°C for 90 minutes. The first strand cDNA was diluted in 100 μl of Tricine-EDTA buffer [10 mM Tricine-KOH (pH 8.5). 1.0 mM EDTA] and enzymes heat inactivated at 72°C for 7 minutes.
[00180] To isolate the 3'- end of the Euglenoid sp. elongase gene fragment (i.e., the plate2_MO7 clone sequence), primers were designed based on the sequence information from the partial gene sequence of p!ate2 MO7. Primary PCR
amplification was carried out using the 3"- RACE ready cDNA as a template and the following primers: Eug EIo MO-7 FPl (gene specific primer) (5"-AGG CGC TGT GGA TCT TCG TCT TCC -3 ) (SEQ ID NO: 9). in combination with RACE primer Universal Primer Mix A (UPM. BD Biosciences):
[00181 ] Long primer (0.4 μM): 5 "- CTA ATA CGA CTC ACT ATA GCA AGC AGT GGT ATC AAC GCA GAG T-3" (SEQ ID NO: 10); and
[00182] Short primer (2 μM): 5'- CTA ATA CGA CTC ACT ATA GGG C - 3' (SEQ ID NO: 1 1).
[00183] Amplification was carried out using 0.25 μl ( 100 mM) of the gene specific primer. 0.25 μl (100 mM) ofthe UPM primer. 2.5 μl of cDNA template, 2.5 μl of 2.5 mM dNTP. 5 μl of 5X PCR Buffer (Advantage® GC II polymerase buffer (Clontcch). 200 mM Tricine-KOH (pH 9.2), 75 mM potassium acetate. 17.5 mM magnesium acetate. 25% DMSO. 18.75 μg/ml BSA. 0.005 % Tween 20. 0.005% Nomdet-P40). 2.5 μl GC Melt Reagent (Ciontech), 0.5 μi of 50X Advantage® GC i polymerase (Ciontech). and ! 1.5 μL Milii-Q® water (Mϊliϊpore). in a final reaction volume of 25 μL Samples were denatured initially at 94°C for 3 minutes, followed by 2 cycles of 94°C for 30 seconds. 64°C for 30 seconds, and 68°C for 3.3 minutes: 3 cycles of 94°C for 30 seconds, 62°C for 30 seconds, and 68°C for 1.30 minutes: 4 cycles of 94°C for 30 seconds, 600C for 30 seconds, and 68°C for 1.30 minutes: and 26 cycles of 94°C tor 30 seconds, 58°C for 30 seconds, and 68°C for 1.30 minutes. A final extension cycle at 68°C for 10 minutes was carried out before the reaction was terminated at 4°C.
[00184] Analysis of the PCR products revealed very faint bands, which were likely due to low levels of the elongase gene transcripts in the cell. Hence, a nested PCR reaction was carried out using 1 μl of the product from the above-described primary PCR reaction as a template. Primers used for the nested PCR were Eug EIo MO-7 FP2 (a gene-specific primer): 5 - TCC CCG TGC CGA AGT CGT TCA TCA CC -3" (SEQ ID NO: 12), and the Universal Primer Mix A (UPM) primers (SEQ ID NOs: 10 and 1 1). PCR reaction conditions and cycling parameters were same as used for the primary PCR reaction.
[00185] A 548 bp amplicon (SEQ ID NO: 13; Figure 6A). obtained by nested PCR. was gel purified using the Qiagen GeI Purification kit (Qiagen). and was cloned into pTZ57R/T vector (T/A cloning vector. MBI Fermentas) and sequenced. Sequencing revealed that this fragment (SEQ ID NO: 13) was contained the complete 3*- end of the pIate2_MO7 elongase fragment along with the 'TAG* stop codon and downstream region containing the polyA tail. The predicted amino acid sequence of this fragment (SEQ ID NOs: 14 and 30-32) is shown in Figure 6B. The first asterisk denotes the stop site of the plate 2 MO7 encoded protein.
Example 3: Isolation of the FuH-Length plate2 M07 Eiongase Gene from Eug/ena deses Ehr. CCMP 2916
[00186] The fiαli-length gene sequence of piate2_MO7 elongase was isolated by PCR amplification using the Euglena deses Ehr. cDNA library as the template, and primers that were designed Io contain the 5*- and 3"- ends of the piate2JVfG7 gene based upon sequence information obtained in Example I and Exainpϊe 2. In addition. BamW/HindlH sites were incorporated into the primers (underlined) to facilitate cloning of the gene into the BamHVHindlll sites of the yeast expression vector, pYX242. The follow ing primer sequences were used:
[00 { 87] M07-E1O forward primer: 5 '- CAC CAT GGA TCC ATG GΛC GTC GCG ACT ACG CTG G -3" (SEQ ID NO: 15). and
[00188] M07-EΪO reverse primer: 5 "- ACG CGT AAG CTT CTA GTC CAC TTT CTT CTC ATC Crr C-3- <SEQ ID NO: 16).
[00189] Amplification was carried out using 0.5 μl ( 100 μM) of each primer. 1 μl (— I IOng) of the Eυglena deses Ehr. cDNA library plasmid pool as the template. 5 μl of 2.5 mM dNTP. 10 μl of 5X Phusion GC Buffer (Finnzymes). 5 μL of DMSO. 0.5 μL (1 U) of Phusion polymerase (Finnzymes). and 27.5 μL of MilH-Q® water (Millipore). Samples were denatured initially at 98°C for 3 minutes, followed by 2 cycles of 98°C for 8 seconds, 600C for 12 seconds, and 72°C for 45 seconds; and 28 cycles of 98°C for 8 seconds. 58°C for 12 seconds, and 72°C for 45 seconds. A final extension cycle at 72°C for 3 minutes was carried out before the reaction was terminated at 4°C.
[00190] PCR resulted in an -789 bp product which was cloned into the Bam Hi/Hind Ul sites of pYX242 vector and transformed into E.coli DH5α (Invitrogen). Plasmid DNA thus obtained was sequenced to obtain the full-length gene sequence of the 789 bp gene, designated Εug-MO7-ELO#10' (SEQ ID NO: 17: Figure 7A). SEQ ID NO: 17 was deposited with the American Type Culture Collection. 10801
University Boulevard, Manassas. VA 20110-2209. on July 10. 2009. under the terms of the Budapest Treaty, and was accorded deposit number ATCC . This gene was thought to encode the putative Δ9-eiongase from Euglena deses Ehr. CCMP 2916. with a predicted length of 262 amino acids (SEQ ID NO: 18; Figure 7B). This gene was used for expression studies to characterize its enzymatic activity. [00191] In addition to the Eug-MQ7~ELG#1G clone, additional variant clones were identified during sequencing that displayed some sequence variations in certain regions across the Full-length gene. These sequence variations probably arose during the process of PCR amplification. Sequence anal) sis of one such variant. Eug- MO7-ELG #14 revealed a number of nucleotide and corresponding amino acid changes when compared to the original Eug-MO7-ELO#10 clone (see Table 2 and Figures 2A and 2B). The nucleotide (SEQ ID NO: 19) and predicted amino acid sequence (SEQ ID NO: 20) of Eug-MO7-ELO #14 are shown in Figures 8A and 8B. respective!}5. Both the original Eug-MQ7-£LO#i0 clone arid the variant Eug-MO7- ELO #14 were used for expression analysis.
Table 2: Nucleotide and amino acid changes in the variant clone Eag-MO7- ELG#14 in comparison to the original clone Eog-MO7-ELO#10
Figure imgf000055_0001
[00192] Blast searches, using Eug-MO7-ELO # 10 as query, for similarity to sequences contained in the BLAST "nr* database revealed that the predicted amino acid sequence encoded by Eug-MO7-ELG# 10 (SEQ ID NO: 18) displayed highest amino acid sequence identity (36% sequence identity) with the Isochrysis galbcma Δ9-elongase (SEQ ID NO: 2). Pair wise alignment of SEQ ID NO: 18 to the known Δ9-eIongase from Eυglena gracϊalis (Accession # CAT ( 6687: SEQ ID NO: 4) revealed a much higher amino acid sequence identity (66% identity). Here the default parameters of Vector NTI@AlignX program were used for pair wise alignment. Pair wise alignment with the Pavlova salinu Δ9-eIongase (SEQ ID NO: 1) revealed only -15% sequence identity .
[00 i 931 Unlike desaturases. the elongase enzymes display very few highly conserved motifs. These enzymes are highly hydrophobic proteins containing four to five hydrophobic stretches that are predicted to be membrane-spanning region. In addition a highly conserved histidine box (HXXHH) (SEQ ID NO: 28) is found embedded in the fourth membrane spanning region and is essential for enzymatic activity (see Leonard, et al.. "Elongation of long-chain fatty acids." Prog Lipid Res. (2004) Vof.43. p. 36-54). In some eiongases. the first histidine residue of the
-HXXHH* motif (SEQ ID NO: 28) is replaced with a Glutamϊne (Q) resulting in -QXXHH" (SEQ ID NO: 29) as the conserved motif. This QXXHH (SEQ ID NO: 29) motif is found in most of the Δ9-eSongases including Eug-MO7-ELO#10. In additϊon. the Eug-MO7-ELO# 10 elongase contains other invariant residues that are present in most eiongases to date, as described by Leonard, et a!.. "Elongation of long-chain fatty acids," Prog Lipid Res. (2004) Vol. 43. p. 36-54.
[00194] Figures 3A and 3B depict an alignment of the amino acid sequence from Eug-MO7-ELO#10 elongase with other known eiongases that have varying substrate specificity. These include the Mouse ElovI4 elongase (Accession #
AAG47667: SEQ ID NO: 21 ; Figure 9A). human ELOVL2 elongase (Acession # NPJ)60240; SEQ ID NO: 22: Figure 9B), and C. elegans eiongase (Accession # AF244356; SEQ ID NO: 23). in addition to the Δ9-elongases from Euglena gracialis (SEQ ID NO: 4) and Isochrysis galbcma (SEQ ID NO: 2). Invariant amino acids in the alignment are shaded. It is assumed that these invariant residues are important determinants for functionality of these elongating enzymes due to high degree of conservation across species. Alignment was carried out using Vector NTI software that uses a modified ClustalW algorithm. Exampie 4: Characterization of the enzvmatic activity of the putative AQ-eiongase encoded by the gene Eug-MQ7-ELO#IO
[00195] The Eug-MO7~ELG#1G and Eug-MO7-ELG#14 variant encoding a putative Δ9-elongase were cloned into BamHHHimlIII sites of the yeast expression vector. pYX242 (Novagen), respectively. These constructs were transformed into competent Saccharamyces cerevisiae strain SC334 cells. Yeast transformation was carried out using the Aikalϊ-€atϊon Yeast Transformation Kit (QBioGene) according to conditions specified by the manufacturer. Transforrnants were selected for leucine auxotrophy on media lacking leucine (DOB [-Leu]).
[00 J 96] To characterize the elongase activity of the enzymes encoded by Eug-MO7-ELG#10 and Eug-MO7-ELO# 14. transformants were grown in the presence of 50 μM specific fatty acid substrates (listed below) and conversion to specific product was used to determine substrate specificity:
[00197] For Δ9-elongase activity:
[00198] Linoleic acid (18:2 n-6) => Eicosadienoic acid (EDA, 20:2 n-6)
[00199] Alpha-linolenic acid (18:3 n-3) => Eϊcosatrienoic acid (ETrA, 20:3 n-3)
[00200] For Cis-elongase activity-
[00201] Gamma-liπolenic acid (GLA. 18:3 n-6) => Dihomo-γ-lϊnolenic acid (DGLA, 20:3 n-6)
[00202] Stearidonic acid (SDA. 18:4 n-3) => ω3-Eicoastetraenoic acid (ω3- ETA. 20:4 n-3)
[00203] For C^-elongase activity:
[00204] Arachidonic acid (ARA, 20:4 n-6) ^> Adrenic acid (ω6-ADA. 22:4 n-6) [00205] Eicosapenlaenoic acid (EPA, 20:5 n-3) => ωS-Docosapenlaeπoic acid (e>3-DPA. 22:5 n-3)
[00206] The negative control strain consisted of ρYX242 vector expressed in S. cerevisiae 334.
[00207] The transformed colonies isolated from selective DOB [-Leu] media were grown overnight in 10 ml of YPD liquid broth at 300C, with vigorous agitation. 5 ml of this overnight culture was then added to 45 ml of selective media (DOB [-Leu]) containing 50 μM (final concentration) of various fatty acid substrates (as specified), and these were vigorously agitated (250 rpm) for 48 to 72 hours (as indicated) at 24°C.
[00208] For total lipid extraction, yeast cells were spun down at 2000 rpm for 15 minutes and 0.5 ml water was added, samples vortexed, followed by addition of 10 ml methanol with gentle swirling. 20 ml chloroform w?as then added, samples were vortexed for 1 minute at high speed and allowed to stand for 2 hours at room temperature. 6 mϊ saline was then added to the sample followed by centrifugation at 2200 rpm for 10 minutes. The upper chloroform layer was removed to a clean/dry 30 ml vial and chloroform evaporated to dryness at 400C under a stream of nitrogen. Once the solvents had completely evaporated, 2 ml chloroform was added to each vial and samples were derivatized.
[00209] For derivitization of lipids to Fatty acid methyl esters (FAME), each tube was spiked with 100 μl internal standard (17.216 μg/100 μl) Triheptadecanoin. Chloroform was evaporated to dryness under nitrogen at 400C, 2 ml Boron Trifluoride in 14% Methanol was added, followed by addition of 2 drops (-50 μl) Toluene. Each vial was flushed with nitrogen, and heated for 15 minutes at 95°C. After vials had cooled. 2 ml saline was added and lipids extracted with 4 ml hexane by vigorously vortexing for 1 minute. The hexane extract was then transferred into a 20 ml clean/dry screw-cap tube, 5 mi dϊ-H2O was added and sample vortexed, and centrifiiged at 1500 rpm for 4 minutes. The washed hexane was then transferred into a 20 ml reagent tube. Hexane was evaporated to dryness and each sample reconstituted with 0.5 nil fresh iiexane. The reconstituted final hexane was vortexed to disperse the lipids. The entire sampϊe was then loaded into the GC auto sampler vials and 4 μl was injected for analysis. The GC was calibrated with the NuChek Std. 461.
[00210] The percent conversion of substrate to product was calculated using the formula: fproduct] x 100
[product] + [substrate]
[0021 1 ] Table 3 represents the enzyme activity of the Eug-MO7-ELO# ϊ 0- and Eug-MO7-ELO#14 encoded proteins based on the percent conversion of substrate added. Eug-MO7-ELO# i 0 encoded protein converted 10.5% of LA (18:2n-6) to EDA (20:2 n-6), and 23.2% of ALA (18:3n-3) to ETrA (20:3n-3). This indicated that the Eug-MO7-ELO#10 gene encodes a Δ9-elongase that can recognize both n-6 and n-3 fatty acid substrates. The variant clone, Eug-M07-ELO#14 encoded protein also displayed Δ9 elongase activity, converting converted 7.84% of LA (18:2n-6) to EDA (20:2 n-6), and 11.15% of ALA (1 S:3π-3) to ETrA (20:3n-3). However this activity was lower that that of the original Eug-MO7-ELO#10 encoded protein. This indicates that the residues that differ between Eug-MO7-ELO#l4 and Eug-MO7-ELO#10 are important determinants of Δ9-elongating activity of this enzyme.
[00212] Very low background (non-specific conversion of substrate) activity was detected with the vector-only control (see Table 3). Both Eug-MO7-ELO#l 0 & Eug-MO7-ELO#14 encoded enzymes did not have activity on any of the other PTJFA substrates tested (see Table 4), indicating that this enzyme is specific for substrates involved in the alternate Δ8-desaturase/Δ9-elongase pathway (see Figure 1).
TaMe 3: Δ9-elongase activity of Eug-MO7-ELO#10 and Eπg-MO7-ELO#14 encoded proteins expressed in Saccharomyces cerevisiae strain SC334
Figure imgf000059_0001
Figure imgf000060_0001
a Cultures grown in presence of 50 μM substrate at 24°C for 48 hours. Numbers represent an average of 2 different experiments.
b Amount of product formed
c % Conversion = ([product] / { [product] + [substrate]}) x 100
Table 4: Specificity of Eϊongasc Activity of Eug-MO7-ELO#10 & Eug-MO7- ELO#14 encoded proteins expressed in Saccharomyces cerevisiae strain SC334
Figure imgf000060_0002
a Cultures grown in presence of 50 μM substrate at 24°C for 48 hours. Numbers represent an average of 2 different experiments.
Amount of product foπned
c o %. Conversion = {[product] / { [product] + [substrate]}) x !00 Example 5: Expression of the A9-elongase "Eug-MQ7-ELO#10* in plant seeds
[00213] The coding sequence of the Eug-MO7-ELO#l 0 eiongase was amplified by PCR from a plasmid containing the corresponding gene with the following sense and antisense oligonucleotide primers (added restriction enzyme sites are underlined):
[002141 5 - TATAGAATTCAAATGGACGTCGCGACTACGCTG^'
(SEQ ID HO: 24). and
[00215] 5 "- TATTCTCGAGTTCTAGTCCACTTTCrrCTCATCCTTC-3 * (SEQ ID NO: 25).
[00216] The PCR reaction was conducted with high-fidelity Phusion polymerase (New England Bϊolabs). The PCR amplified gene was digested with restriction enzymes EcoRl and Xho\, and the resulting product was linked on its 5*- end to the seed-specific glycinin-1 promoter from soybean and on its 3'-end to the glycinin-1 3" untranslated region in the binary vector p0308-DsRed to generate the plasmid "pEugELO\ The glycinin-1 regulatory elements have been previously described by Nielsen, et aL ''Characterisation of the glyciπiπ gene family ϊn soybean," Plant Cell ( 1989) Vol. 1 , p. 313-328. This vector also contains a Ds-Red transgene under control of the cassava mosaic virus promoter for selection of transformed seeds by fluorescence and a kanamycin resistance marker for bacterial selection. As a control for these experiments, the Isochrysis galbana Δ9-elongase gene (SEQ ID NO: 2) was also cloned as an EcoRl/Xhol fragment under control of the glycinin-1 promoter in p0308-Ds-Red to generate the plasmid "pIsoD9".
[00217] pEugELO and pIsoD9 were introduced into Agrobacterϊum (umefaciens strain C58 MP90 by electroporation. Kanamycin-rcsistant agrobacterϊum was then used for transformation of Arabidopsis thaliana ecotype CoI-O by the floral dip method (Clough. et aL, "Floral dip: a simplified method for Agrobacterium- mediated transformation of Arabidopsis thaliana." Plant J, (1998) Vol. 16. p. 735- 743). Following the agrobacterium floral dip, plants were maintained at 22°C with 16 hour day length until reaching maturity and dry down. For these experiments, a facBlfae X mutant of Arabidopsis was used thai contains low levels of α-iinolenic acid and very-long chain fatty acids (>C20) but eϊevated levels of Hnoieϊc acid in its seed oii (Cahoon, et aL "Conjugated fatty acids accumulate to high levels in phospholipids of rnetabolϊcally engineered soybean and Arabidopsis seeds." Phytochenήsiry (2006) Vol. 67, p. 1166-1 176). This genetic background approximates the fatty acid profile of seed oils from crops such as safflower and low Iinoienic acid soybean. Transgenic seeds obtained from the agrobacterium-dipped Arabidopsis plants were identified by fluorescence of the DsRed marker protein using the methodology described by Pidkowich. et a I.. "Modulating seed beta-ketoacyl-acyl carrier protein synthase II level converts the composition of a temperate seed oil to that of a palm-ϊϊke tropical oil," Proc Natl Acad Sci USA (2007) Vol. 104, p. 4742-4747. Single transgenic and non-transgenic control seeds were subjected to direct transesterification of the constituent lipids, including triacylglycerols. by use of trϊmethylsulfonium hydroxide (TMSH) reagent as described by Cahoon and Shanklin. "Substrate-dependent mutant complementation to select fatty acid desaturase variants for metabolic engineering of plant seed oils," Proc Natl Acad Sci USA (2000) Vol. 97, p. 12350-12355. Fatty acid methyl esters obtained from the single seeds were analyzed by gas
chromatography with flame ionization detection by use of an Agilent 6890 gas chromatograph fitted with an INNOWax column (30 m length x 0.25 mm inner diameter) and oven temperature programming from 185°C (1 minute hold) to 2300C (2 minute hold) at 7°C/minute. Component fatty acid methyl esters were identified based on their retention times relative to fatty acid methyl esters of known identity from seeds of wild-type Arabidopsis thaϊiana CoI-O and by comparison of retention times with those of standard fatty acid methyl esters.
[00218] Shown in Table 5 are the fatty acid compositions of single Tl seeds from six independent transformation events from plants transformed with pEugELO construct. Also shown are the fatty acid compositions of single Tl seeds representing independent events from plants transformed with plsoD9 construct, the control Δ9 elongase (see Table 6). The major change in the fatty acid composition of transgenic seeds from the pEugELO transformation relative to iion-transfoπned fadilfae 1 seeds (see Table 7) was the presence of high levels of EDA (20:2n-6. Δl L14). In these seeds, relative amounts of 20:2 ranged from 40% to 49% (w/w) of the totaJ fatty acids. By comparison 20:2 accounted for >0.5% of the total fatty acids of non- transgeπϊc fadiffae 1 seeds (see Table 7). This was accompanied by concomitant decreases in relative amounts of LA (18:2n-6. Δ9, 12) from approximately 50% in non-transgenicy<κβ//»el seeds (see Table 7) to as low as 14% in the pEugELO. This is consistent with 18:2 serving as the primary substrate for 20:2 synthesis conferred by the Eug-MO7-ELO#10 elongase. Amounts of Eicoseπoic acid (2O:ΪΔ1 f ) and Eicosanoic acid (20:0) were also elevated in the pEugELO-transformed seeds relative to non-transgenϊcy*«β//α£l seeds, but each of these fatty acids composed <3% of the total fatty acids in the transgenic seeds. These findings indicate that Eug-MO7- ELO#10 elongase has substrate preference in plants for Cis PUFΛs such as LA (18:2n-6) and is an effective enzyme for the production of 20:2 in seeds that are enriched in LA (18:2n-6). For comparison, seeds engineered to express the Isochrysis galbana Δ9-ELO (pIsoD9) accumulated 20:2 to amounts of 30 to 40% of the total fatty acids and 20:0 and 20:1 each to amounts of <3% of the total fatty acids (see Table 6).
Table 5a: Fatty acid composition of single Tl transgenic \rahidopsis fmI3/fael seeds expressing Eug-MO7-ELO#10.
Figure imgf000063_0001
a Each seed represents an independent transgenic event. Values shown are the wt% of the total fatty acids in the seed. Table 6s: Fatty acid compositiøa of single Tj transgenic Arabidopsis^føjfaei seeds expressing the Isochrysis galbana ELO.
Figure imgf000064_0001
a Each seed represents an independent transgenic event. Values shown are the vvt% of the total fatty acids in the seed.
Table Ti Fatty acid composition of single Ai λhidopsisf ad3/fael control seeds.
Figure imgf000064_0002
a Values shown are the wt% of the total fatty acids in the seed.
Example 6: Coexpression of the Δ9-elongase *Eug-MO7-ELO#10 with a A8- desaturase
[00219] It is possible to co-express Eug-MO7-ELO# 10 along with a Δ8- desaturase to reconstruct the alternate Δ8-desaturase/Δ9-elongase pathway leading to ARA production. In addition it will be possible to coexpress three genes, the Δ9- elongase Εug-MO7-ELO#I0* along with a Δ8-desaturase and a Δ5-desaturase in a heterologous host such as oilseed plants or oleaginous yeast to reconstruct the ARA biosynthesis pathway with will result in ARA production in these heterologous hosts. [00220] In view of the above, ii will be seen that the several objects of the disclosure are achieved and other advantageous results attained.
[00221] As various changes could be made in the above matter without departing from the scope of the disclosure, it is intended that all matter contained in the above description shall be interpreted as illustrative and not in a limiting sense.

Claims

WHAT IS CLAIMED IS:
1. An isolated nucleic acid or fragment thereof comprising or complementary to an isolated nucleotide sequence encoding a polypeptide having cloπgase activity, wherein the amino acid sequence of the polypeptide has at least 68% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO: 18 and SEQ ID NO: 20.
2. An isolated nucleotide sequence or fragment thereof comprising or complementary to at least 68% of a nucleotide sequence selected from the group consisting of SEQ ID NO: 17 and SEQ ID NO: 19.
3. The isolated nucleotide sequence of claim 1 or 2 wherein the isolated nucleotide sequence encodes a functionally active elongase which utilizes a polyunsaturated fatty acid as a substrate.
4. The isolated nucleotide sequence of claim 1 or 2 wherein the isolated nucleotide sequence is from a Euglenoid sp.
5. The isolated nucleotide sequence of claim 4 wherein the isolated nucleotide sequence is from Eiiglena deses Ehr. CCMP 2916.
6. A purified polypeptide encoded by the isolated nucleotide sequence of claim 1 or 2.
7. A purified polypeptide which elongates polyunsaturated fatty acids containing unsaturation at the carbon 9 position and has at least 68% amino acid identity to an amino acid sequence selected from the group consisting of SEQ ID NO: 18 and SEQ ID NO: 20.
8. An expression vector comprising a nucleotide sequence operably linked to a regulatory sequence, wherein the nucleotide sequence comprises or is complementary to at least 68% of a nucleotide sequence selected from the group consisting of SEQ JD NO: 17 and SEQ ID NO: 19.
9. A host cell comprising the expression vector of claim 8.
10. The host cell of claim 9 wherein the host cell is selected from the group consisting of a eukaryotϊc cell and a prokaryotic cell.
1 1. The host cell of claim 10 wherein the cukaryotic cell is selected from the group consisting of: a mammal ian eel!, an insect cell, a plant cell, and a fungal cell.
12. The host cell of claim 11 wherein the plant cell is from an oilseed plant selected from the group consisting of: soybean, Brassica species, safflower, sunflower, maize, cotton, and flax.
13. A plant cell, plant seed, plant, or plant tissue comprising the expression vector of claim 8, wherein expression of the nucleotide sequence of the expression vector results in production of at least one polyunsaturated fatty acid by the plant cell, plant seed, plant, or plant tissue.
14. The plant ceil, plant seed, plant or plant tissue of claim 13 wherein the polyunsaturated fatty acid is selected from the group consisting of ω6-eicosadienoic acid (ω6-EDA), ω3-eϊcosatrienoic acid (ω3-ETrA), and combinations thereof.
15. A method of producing a Δ9-elongase, the method comprising the steps of: a) isolating a nucleotide sequence comprising or complementary to at least 68% of a nucleotide sequence selected from the group consisting of: SEQ ID NO: 17 and SEQ ID NO: 19; b) constructing an expression vector comprising i) the isolated nucleotide sequence operably linked to ii) a regulatory sequence; and c) introducing the expression vector into a host cell for a time and under conditions sufficient for production of the Δ9-elongase.
16. The method of claim 15 wherein the host cell is selected from the group consisting of a eukaryotic cell and a prokaryotic cell.
S 7. The method of claim 16 wherein the eukaryotic ceil is selected from the group consisting of a mammalian cell, an insect cell, a plant cell, and a fiingai eel!. i 8. The method of claim ϊ 7 wherein the plant cell is from an oilseed plant selected from the group consisting of soybean. Brassica species, safflower, sunflower, maize, cotton, and flax.
19. A method for producing a polyunsaturated fatty acid comprising the steps of: a) isolating a nucleotide sequence comprising or complementary to at least 68% of a nucleotide sequence selected from the group consisting of SEQ ID NO: 17 and SEQ ID NO: 19; b) constructing an expression vector comprising i) the isolated nucleotide sequence operably linked to ii) a regulatory sequence; c) introducing the expression vector into a host cell for a time and under conditions sufficient for expression of a Δ9-eIongase; and d) exposing the expressed Δ9-elongase to a substrate polyunsaturated fatty acid in order to convert the substrate polyunsaturated fatty acid to a first product polyunsaturated fatty acid.
20. The method of claim 19 wherein the substrate polyunsaturated fatty acid is linoleic acid (LA) and the first product polyunsaturated fatty acid is ω6- eicosadienoic acid (α>6-EDA).
21. The method of claim 19 wherein the substrate polyunsaturated fatty acid is α-linolenic acid (ALA) and the first product polyunsaturated fatty acid is α>3- eicosatrienoic acid (α>3-ETrA).
22. The method of claim 19 further comprising the step of exposing the first product polyunsaturated fatty acid to at (east one desaturase. at least one additional eϊongase. or combinations thereof, in order to convert the first product polyunsaturated fatty acid to a second or subsequent product polyunsaturated fatty acid.
23. The method of claim 22 wherein the second or subsequent product polyunsaturated fatty acid ϊs selected from the group consisting of dihomo-γ-lϊnoienic acid (DGLA). ω3-eicosatetraeπoic acid (e>3-ETA). arachidonic acid (ARA), eicosapentaenoic acid (EPA), docosapentaenoic acid (DPA). docosahexaenoic acid (DHA). and combinations thereof.
24. A method for producing a polyunsaturated fatty acid in a host cell comprising the steps of: a) isolating a nucleotide sequence comprising or complementary to at least 68% of a nucleotide sequence selected from the group consisting of SEQ ID NO: 17 and SEQ ID NO: 19; b) constructing an expression vector comprising i) the isolated nucleotide sequence operably linked to ii) a regulatory sequence: c) introducing i) the expression vector and ii) at least one additional recombinant DNA construct comprising an isolated nucleotide sequence encoding a Δ8-desaturase and operably linked to at least one regulatory sequence, into a host cell for a time and under conditions sufficient for expression of a Δ9-elongase and the Δ8- desaturase; and d) exposing the expressed Δ9-elongase and the Δ8-desaturase to a substrate polyunsaturated fatty acid selected from the group consisting of linoleic acid (LA). α- linolenic acid (ALA), and combinations thereof, in order to convert the substrate polyunsaturated fatty acid to a first product polyunsaturated fatty acid.
25. The method of ciaim 24 wherein the first product polyunsaturated fatty actd is selected from the group consisting of dihomo-γ-Iinolensc acid (DGLA)- ω3- eicosatetraenoic acid (ω3-ETA). and combinations thereof.
26. The method of claim 24 further comprising the step of exposing the first product polyunsaturated fatty acid to at least one additional desaturase or to at least one additional elongase in order to convert the first product polyunsaturated fatty acid to a second or subsequent polyunsaturated fatly acid.
27. The method of claim 26 wherein the second or subsequent
polyunsaturated fatty acid is selected from the group consisting of arachidonic acid (ARA). eicosapentaenoic acid (EPA). docosapentaenoic acid (DPA). docosahexaenoic acid (DHA). and combinations thereof.
28. The method of claim 24 wherein the host cell is selected from the group consisting of a prokaryotic cell and a eukaryotic cell.
29. The method of claim 28 wherein the eukaryotic cell is selected from the group consisting of a mammalian cell, an insect cell, a plant cell, and a fungal cell.
30. The method of claim 29 wherein the plant cell is from an oilseed plant selected from the group consisting of soybean, Brassica species, safflower. sunflower, maize, cotton, and flax.
31. The method of claim 24 further comprising introducing into the host cell a recombinant DNA construct comprising i) an isolated nucleotide sequence encoding a Δ5-desaturase operably linked to ii) a regulatory sequence.
32. A method for producing a transgenic piant comprising transforming a plant cell with at least one isolated nucleotide sequence or fragment thereof of ciaim 2 and regenerating a transgenic plant from the transformed plant cell.
33. The method of claim 32 wherein the plant ceil is from an oilseed pianl selected from the group consisting of soybean. Brassica species, safflower, sunflower, maize, cotton, and flax.
34. A transgenic seed obtained from the transgenic plant made by the method of claim 32.
35. A transgenic seed comprising the expression vector of claim 8.
PCT/US2010/041893 2009-07-17 2010-07-14 Novel δ9-elongase for production of polyunsaturated fatty acid-enriched oils WO2011008803A2 (en)

Priority Applications (11)

Application Number Priority Date Filing Date Title
JP2012520732A JP2012533303A (en) 2009-07-17 2010-07-14 Novel Δ9-elongase for producing oils rich in polyunsaturated fatty acids
CN201080041384.1A CN102782124B (en) 2009-07-17 2010-07-14 Novel delta9-elongase for production of polyunsaturated fatty acid-enriched oils
NZ597679A NZ597679A (en) 2009-07-17 2010-07-14 Novel delta 9-elongase for production of polyunsaturated fatty acid-enriched oils
AU2010273508A AU2010273508B2 (en) 2009-07-17 2010-07-14 Novel delta9-elongase for production of polyunsaturated fatty acid-enriched oils
IN469DEN2012 IN2012DN00469A (en) 2009-07-17 2010-07-14
MX2012000825A MX2012000825A (en) 2009-07-17 2010-07-14 Novel î 9-elongase for production of polyunsaturated fatty acid-enriched oils.
BRBR112012001125-1A BR112012001125A2 (en) 2009-07-17 2010-07-14 New a9 elongase for the production of polyunsaturated fatty acid enriched oils.
CA2768318A CA2768318A1 (en) 2009-07-17 2010-07-14 Novel .delta.9-elongase for production of polyunsaturated fatty acid-enriched oils
RU2012103248/10A RU2558302C2 (en) 2009-07-17 2010-07-14 Novel delta-9-elongase for producing polyunsaturated fatty acid-enriched oils
UAA201201733A UA107468C2 (en) 2009-07-17 2010-07-14 A new delta-9-elongase for rich in polyunsaturated fatty acids oils obtaining
EP10737154A EP2454365A2 (en) 2009-07-17 2010-07-17 Novel 9-elongase for production of polyunsaturated fatty acid-enriched oils

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US12/505,293 2009-07-17
US12/505,293 US8188335B2 (en) 2009-07-17 2009-07-17 Δ9-elongase for production of polyunsaturated fatty acid-enriched oils

Publications (2)

Publication Number Publication Date
WO2011008803A2 true WO2011008803A2 (en) 2011-01-20
WO2011008803A3 WO2011008803A3 (en) 2011-04-07

Family

ID=42651221

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2010/041893 WO2011008803A2 (en) 2009-07-17 2010-07-14 Novel δ9-elongase for production of polyunsaturated fatty acid-enriched oils

Country Status (15)

Country Link
US (1) US8188335B2 (en)
EP (1) EP2454365A2 (en)
JP (1) JP2012533303A (en)
CN (1) CN102782124B (en)
AR (1) AR077763A1 (en)
AU (1) AU2010273508B2 (en)
BR (1) BR112012001125A2 (en)
CA (1) CA2768318A1 (en)
IN (1) IN2012DN00469A (en)
MX (1) MX2012000825A (en)
MY (1) MY160166A (en)
NZ (1) NZ597679A (en)
RU (1) RU2558302C2 (en)
UA (1) UA107468C2 (en)
WO (1) WO2011008803A2 (en)

Families Citing this family (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2363492A3 (en) 2004-04-22 2012-03-14 Commonwealth Scientific and Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cells.
CN103451246B (en) 2004-04-22 2018-02-16 联邦科学技术研究组织 With recombinant cell synthesis of long-chain polyunsaturated fatty acids
US8816106B2 (en) 2006-08-29 2014-08-26 Commonwealth Scientific And Industrial Research Organisation Synthesis of fatty acids
AR074364A1 (en) 2008-11-18 2011-01-12 Commw Scient Ind Res Org ENZYMES AND METHOD TO PRODUCE OMEGA FATTY ACIDS -3
GB0907413D0 (en) 2009-04-29 2009-06-10 Equateq Ltd Novel methods
US8293790B2 (en) 2011-10-19 2012-10-23 Dignity Sciences Limited Pharmaceutical compositions comprising DGLA and benzoyl peroxide and methods of use thereof
WO2013082265A1 (en) * 2011-11-29 2013-06-06 Dignity Sciences Limited Compositions comprising 20-carbon fatty acids and methods of making and using same
EP3266316A1 (en) 2012-06-15 2018-01-10 Commonwealth Scientific and Industrial Research Organisation Production of long chain polyunsaturated fatty acids in plant cells
WO2015089587A1 (en) 2013-12-18 2015-06-25 Commonwealth Scientific And Industrial Research Organisation Lipid comprising long chain polyunsaturated fatty acids
CN105219789B (en) 2014-06-27 2023-04-07 联邦科学技术研究组织 Extracted plant lipids comprising docosapentaenoic acid
CN107405368A (en) * 2015-04-08 2017-11-28 悠绿那股份有限公司 Rheumatoid arthritis inhibitor, rheumatoid arthritis prophylactic, rheumatoid arthritis treatment agent and rheumatoid arthritis suppression food
WO2017208173A1 (en) 2016-06-01 2017-12-07 National Research Council Of Canada Winter aconite fatty acid elongase and uses thereof in the production of fatty acids

Citations (35)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0050424A1 (en) 1980-09-24 1982-04-28 Cetus Corporation Method for producing an analytical antibody probe, an analytical antibody probe, and a method for analysing a sample for certain antibodies
EP0084796A2 (en) 1982-01-22 1983-08-03 Cetus Corporation HLA typing method and cDNA probes used therein
US4582788A (en) 1982-01-22 1986-04-15 Cetus Corporation HLA typing method and cDNA probes used therein
EP0201184A2 (en) 1985-03-28 1986-11-12 F. Hoffmann-La Roche Ag Process for amplifying nucleic acid sequences
US4666701A (en) 1985-03-19 1987-05-19 Efamol Limited Pharmaceutical and dietary compositions
US4683194A (en) 1984-05-29 1987-07-28 Cetus Corporation Method for detection of polymorphic restriction sites and nucleic acid sequences
EP0237362A1 (en) 1986-03-13 1987-09-16 F. Hoffmann-La Roche Ag Process for detecting specific nucleotide variations and genetic polymorphisms present in nucleic acids and kits therefor
EP0258017A2 (en) 1986-08-22 1988-03-02 F. Hoffmann-La Roche Ag Purified thermostable enzyme and process for amplifying, detecting, and/or cloning nucleic acid sequences using said enzyme
US4758592A (en) 1985-10-02 1988-07-19 Efamol Limited Method of treating or preventing endometriosis
US4826877A (en) 1985-10-02 1989-05-02 Efamol Limited Pharmaceutical and dietary composition
US4943674A (en) 1987-05-26 1990-07-24 Calgene, Inc. Fruit specific transcriptional factors
US4945050A (en) 1984-11-13 1990-07-31 Cornell Research Foundation, Inc. Method for transporting substances into living cells and tissues and apparatus therefor
US5004863A (en) 1986-12-03 1991-04-02 Agracetus Genetic engineering of cotton plants and lines
US5107065A (en) 1986-03-28 1992-04-21 Calgene, Inc. Anti-sense regulation of gene expression in plant cells
US5106739A (en) 1989-04-18 1992-04-21 Calgene, Inc. CaMv 355 enhanced mannopine synthase promoter and method for using same
US5116871A (en) 1988-09-13 1992-05-26 Efamol Holdings Plc Fatty acid therapy and compositions for the treatment of myalgic encephalomyelitis
US5175095A (en) 1989-07-19 1992-12-29 Calgene, Inc. Ovary-tissue transcriptional factors
US5188958A (en) 1986-05-29 1993-02-23 Calgene, Inc. Transformation and foreign gene expression in brassica species
WO1993011247A1 (en) 1991-12-06 1993-06-10 Genentech, Inc. Prohormone convertase transformed cells
US5231020A (en) 1989-03-30 1993-07-27 Dna Plant Technology Corporation Genetic engineering of novel plant phenotypes
WO1994011516A1 (en) 1992-11-17 1994-05-26 E.I. Du Pont De Nemours And Company Genes for microsomal delta-12 fatty acid desaturases and related enzymes from plants
US5416011A (en) 1988-07-22 1995-05-16 Monsanto Company Method for soybean transformation and regeneration
US5420034A (en) 1986-07-31 1995-05-30 Calgene, Inc. Seed-specific transcriptional regulation
US5443974A (en) 1990-05-25 1995-08-22 E. I. Du Pont De Nemours And Company Nucleotide sequence of soybean stearoyl-ACP desaturase gene
WO1995024494A1 (en) 1994-03-09 1995-09-14 Abbott Laboratories Humanized milk
WO1996013591A2 (en) 1994-10-26 1996-05-09 Michigan State University Methods and compositions relating to plant δ6 palmitoyl-acyl carrier protein desaturase
US5518908A (en) 1991-09-23 1996-05-21 Monsanto Company Method of controlling insects
US5552306A (en) 1991-10-10 1996-09-03 Rhone-Poulenc Agrochimie Production of γ-linolenic acid by a Δ6-desaturase
US5589379A (en) 1993-02-26 1996-12-31 Calgene, Inc. Geminivirus-based gene expression system
US5631152A (en) 1994-10-26 1997-05-20 Monsanto Company Rapid and efficient regeneration of transgenic plants
US5700671A (en) 1994-03-09 1997-12-23 Abbott Laboratories Methods of making transgenic animals producing oligosaccharides and glycoproteins
US5750176A (en) 1994-03-09 1998-05-12 Abbott Laboratories Transgenic non-human mammal milk comprising 2'-fucosyl-lactose
US5912120A (en) 1992-04-09 1999-06-15 The United States Of America As Represented By The Department Of Health And Human Services, Cloning, expression and diagnosis of human cytochrome P450 2C19: the principal determinant of s-mephenytoin metabolism
WO2007061845A2 (en) 2005-11-23 2007-05-31 E. I. Du Pont De Nemours And Company Delta-9 elongases and their use in making polyunsaturated fatty acids
US20080194685A1 (en) 2007-02-12 2008-08-14 Howard Glenn Damude Production of arachidonic acid in oilseed plants

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0616644B1 (en) 1991-12-04 2003-07-02 E.I. Du Pont De Nemours And Company Fatty acid desaturase genes from plants
US7678560B2 (en) * 2006-05-17 2010-03-16 E.I. Du Pont De Nemours And Company Δ 5 desaturase and its use in making polyunsaturated fatty acids
HUE028692T2 (en) 2007-04-03 2016-12-28 Du Pont Multizymes and their use in making polyunsaturated fatty acids
US7794701B2 (en) 2007-04-16 2010-09-14 E.I. Du Pont De Nemours And Company Δ-9 elongases and their use in making polyunsaturated fatty acids
MX2011003700A (en) 2008-10-06 2011-11-29 Abbott Lab Delta-8 desaturase genes, enzymes encoded thereby and uses thereof.

Patent Citations (43)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0050424A1 (en) 1980-09-24 1982-04-28 Cetus Corporation Method for producing an analytical antibody probe, an analytical antibody probe, and a method for analysing a sample for certain antibodies
EP0084796A2 (en) 1982-01-22 1983-08-03 Cetus Corporation HLA typing method and cDNA probes used therein
US4582788A (en) 1982-01-22 1986-04-15 Cetus Corporation HLA typing method and cDNA probes used therein
US4683194A (en) 1984-05-29 1987-07-28 Cetus Corporation Method for detection of polymorphic restriction sites and nucleic acid sequences
US4945050A (en) 1984-11-13 1990-07-31 Cornell Research Foundation, Inc. Method for transporting substances into living cells and tissues and apparatus therefor
US4666701A (en) 1985-03-19 1987-05-19 Efamol Limited Pharmaceutical and dietary compositions
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4683202B1 (en) 1985-03-28 1990-11-27 Cetus Corp
EP0201184A2 (en) 1985-03-28 1986-11-12 F. Hoffmann-La Roche Ag Process for amplifying nucleic acid sequences
US4758592A (en) 1985-10-02 1988-07-19 Efamol Limited Method of treating or preventing endometriosis
US4826877A (en) 1985-10-02 1989-05-02 Efamol Limited Pharmaceutical and dietary composition
EP0237362A1 (en) 1986-03-13 1987-09-16 F. Hoffmann-La Roche Ag Process for detecting specific nucleotide variations and genetic polymorphisms present in nucleic acids and kits therefor
US5107065A (en) 1986-03-28 1992-04-21 Calgene, Inc. Anti-sense regulation of gene expression in plant cells
US5188958A (en) 1986-05-29 1993-02-23 Calgene, Inc. Transformation and foreign gene expression in brassica species
US5463174A (en) 1986-05-29 1995-10-31 Calgene Inc. Transformation and foreign gene expression in Brassica species
US5420034A (en) 1986-07-31 1995-05-30 Calgene, Inc. Seed-specific transcriptional regulation
EP0258017A2 (en) 1986-08-22 1988-03-02 F. Hoffmann-La Roche Ag Purified thermostable enzyme and process for amplifying, detecting, and/or cloning nucleic acid sequences using said enzyme
US5004863A (en) 1986-12-03 1991-04-02 Agracetus Genetic engineering of cotton plants and lines
US5159135A (en) 1986-12-03 1992-10-27 Agracetus Genetic engineering of cotton plants and lines
US5004863B1 (en) 1986-12-03 1992-12-08 Agracetus
US5159135B1 (en) 1986-12-03 2000-10-24 Agracetus Genetic engineering of cotton plants and lines
US5004863B2 (en) 1986-12-03 2000-10-17 Agracetus Genetic engineering of cotton plants and lines
US4943674A (en) 1987-05-26 1990-07-24 Calgene, Inc. Fruit specific transcriptional factors
US5416011A (en) 1988-07-22 1995-05-16 Monsanto Company Method for soybean transformation and regeneration
US5569834A (en) 1988-07-22 1996-10-29 Monsanto Company Method for soybean transformation and regeneration
US5116871A (en) 1988-09-13 1992-05-26 Efamol Holdings Plc Fatty acid therapy and compositions for the treatment of myalgic encephalomyelitis
US5231020A (en) 1989-03-30 1993-07-27 Dna Plant Technology Corporation Genetic engineering of novel plant phenotypes
US5106739A (en) 1989-04-18 1992-04-21 Calgene, Inc. CaMv 355 enhanced mannopine synthase promoter and method for using same
US5175095A (en) 1989-07-19 1992-12-29 Calgene, Inc. Ovary-tissue transcriptional factors
US5443974A (en) 1990-05-25 1995-08-22 E. I. Du Pont De Nemours And Company Nucleotide sequence of soybean stearoyl-ACP desaturase gene
US5518908A (en) 1991-09-23 1996-05-21 Monsanto Company Method of controlling insects
US5552306A (en) 1991-10-10 1996-09-03 Rhone-Poulenc Agrochimie Production of γ-linolenic acid by a Δ6-desaturase
WO1993011247A1 (en) 1991-12-06 1993-06-10 Genentech, Inc. Prohormone convertase transformed cells
US5912120A (en) 1992-04-09 1999-06-15 The United States Of America As Represented By The Department Of Health And Human Services, Cloning, expression and diagnosis of human cytochrome P450 2C19: the principal determinant of s-mephenytoin metabolism
WO1994011516A1 (en) 1992-11-17 1994-05-26 E.I. Du Pont De Nemours And Company Genes for microsomal delta-12 fatty acid desaturases and related enzymes from plants
US5589379A (en) 1993-02-26 1996-12-31 Calgene, Inc. Geminivirus-based gene expression system
US5700671A (en) 1994-03-09 1997-12-23 Abbott Laboratories Methods of making transgenic animals producing oligosaccharides and glycoproteins
US5750176A (en) 1994-03-09 1998-05-12 Abbott Laboratories Transgenic non-human mammal milk comprising 2'-fucosyl-lactose
WO1995024494A1 (en) 1994-03-09 1995-09-14 Abbott Laboratories Humanized milk
US5631152A (en) 1994-10-26 1997-05-20 Monsanto Company Rapid and efficient regeneration of transgenic plants
WO1996013591A2 (en) 1994-10-26 1996-05-09 Michigan State University Methods and compositions relating to plant δ6 palmitoyl-acyl carrier protein desaturase
WO2007061845A2 (en) 2005-11-23 2007-05-31 E. I. Du Pont De Nemours And Company Delta-9 elongases and their use in making polyunsaturated fatty acids
US20080194685A1 (en) 2007-02-12 2008-08-14 Howard Glenn Damude Production of arachidonic acid in oilseed plants

Non-Patent Citations (53)

* Cited by examiner, † Cited by third party
Title
ABEDINIA ET AL., AUST. J. PLANT PHYSIOL., vol. 24, 1997, pages 133 141
ALTSCHUL ET AL., NUCLEIC ACIDS RESEARCH, vol. 25, 1997, pages 3389 - 3402
ARMSTRONG ET AL., CROP SCIENCE, vol. 35, 1995, pages 550 557
BATTRAW; HALL, PLANT SCI., vol. 86, 1992, pages 191202
BIO/TECHNOLOGY, vol. 10, 1992, pages 667
BOWER; BIRCH, PLANT J., vol. 2, 1992, pages 409
BRENNER ET AL., ADV: EXP. MED BIOL., vol. 83, 1976, pages 85 - 101
BYTEBIER ET AL., PROC. NATI. ACAD. SCI. (USA), vol. 84, 1987, pages 5354
CAHOON ET AL.: "Conjugated fatty acids accumulate to high levels in phospholipids of metabolically engineered soybean and Arabidopsis seeds", PHYTOCHEMISTRY, vol. 67, 2006, pages 1166 - 1176, XP028059914, DOI: doi:10.1016/j.phytochem.2006.04.013
CAHOON; SHANKLIN: "Substrate-dependent mutant complementation to select fatty acid desaturase variants for metabolic engineering of plant seed oils", PROC NATL ACAD SCI USA, vol. 97, 2000, pages 12350 - 12355
CHENG ET AL., PLANT CELL REP., vol. 15, 1996, pages 653 - 657
CHRISTOU ET AL., BIOL/TECHNOLOGY, vol. 9, 1991, pages 957
CHRISTOU ET AL., PLANT PHYSIOL., vol. 87, 1988, pages 671674
CLOUGH ET AL.: "Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana", PLANT J, vol. 16, 1998, pages 735 - 743, XP002132452, DOI: doi:10.1046/j.1365-313x.1998.00343.x
DE ALMEIDA ET AL., MOL. GEN. GENETICS, vol. 218, 1989, pages 78 86
DE LA PENA ET AL., NATURE, vol. 325, 1987, pages 274
FROMM ET AL., BIOLTECHNOLOGY, vol. 8, 1990, pages 833
GOFF ET AL., EMBO J., vol. 9, 1990, pages 2517 - 2522
GORDON-KAMM ET AL., PLANT CELL, vol. 2, 1990, pages 603 618
GRANT ET AL., PLANT CELL REP., vol. 15, 1995, pages 254 258
HATTORI ET AL., GENES DEV., vol. 6, 1992, pages 609 618
HIGGINS ET AL., CABIOS, vol. 5, 1989, pages 151 - 153
HORN ET AL., PLANT CELL REP., vol. 7, 1988, pages 469
HORROBIN ET AL., AM. J. CLIN. NUTR., vol. 57, 1993, pages 732S - 7375
ISHIDA Y. ET AL., NATURE BIOTECH., vol. 14, 1996, pages 745 750
JONES ET AL., EMBO J., vol. 4, 1985, pages 24112418
KLEIN ET AL., NATURE, vol. 327, 1987, pages 70 - 73
KOZIEL ET AL., BIOLTECHNOLOGY, vol. 11, 1993, pages 194
LASSNER ET AL., THE PLANT CELL, vol. 8, 1996, pages 281 - 292
LEONARD ET AL.: "Elongation of long-chain fatty acids", PROG LIPID RES., vol. 43, 2004, pages 36 - 54
LNGELBRECHT ET AL., PLANT CELL, vol. 1, 1989, pages 671 680
MARCOTTE ET AL., NATURE, vol. 335, 1988, pages 454 457
MARCOTTE ET AL., PLANT CELL, vol. 1, 1989, pages 523 532
MCCABE, BIOLTECHNOLOGY, vol. 6, 1988, pages 923
MCCARTY ET AL., CELL, vol. 66, 1991, pages 895 905
MCKENTLY ET AL., PLANT CELL REP., vol. 14, 1995, pages 699 703
MULLIS ET AL., COLD SPRING HARBOR SYMP. QUANT. BIOL, vol. 51, 1986, pages 263 273
NEEDLEMAN; WUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443
NIELSEN ET AL.: "Characterization of the glycinin gene family in soybean", PLANT CELL, vol. 1, 1989, pages 313 - 328
OKAMURO; GOLDBERG, BIOCHEMISTRY OFPLANIS, vol. 15, 1989, pages 1 82
PART ET AL., PLANT MOL. BIOL., vol. 32, 1996, pages 1135 - 1148
PEARSON; LIPMAN, PROC. NATL. ACAD SCI. (USA), vol. 85, 1988, pages 2444
PIDKOWICH ET AL.: "Modulating seed beta-ketoacyl-acyl carrier protein synthase II level converts the composition of a temperate seed oil to that of a palm-like tropical oil", PROC NATL ACAD SCI USA, vol. 104, 2007, pages 4742 - 4747, XP002595602, DOI: doi:10.1073/PNAS.0611141104
RHODES ET AL., SCIENCE, vol. 240, 1988, pages 204
SCHNIEKE ET AL., SCIENCE, vol. 278, 1997, pages 2130 - 2133
SMITH; WATERMAN, APPL. MAIH., vol. 2, 1981, pages 482
SOMERS ET AL., BIOLTECHNOLOGY, vol. 10, 1992, pages 15 89
TORIYAMA ET AL., THEORAPPL. GENET., vol. 205, 1986, pages 34
TURNER, R.; FOSTER, G. D., AFOLECULAR BIOTECHNOLOGY, vol. 3, 1995, pages 225
WAN; LEMAUX, PLANT PHYSIOL, vol. 104, 1994, pages 37
WANG ET AL., BIOLTECHNOLOGY, vol. 10, 1992, pages 691
ZHANG ET AL., PLANT CELL REP., vol. 7, 1988, pages 379
ZHANG; WU, THEOR. APPL. GENET., vol. 76, 1988, pages 835

Also Published As

Publication number Publication date
AR077763A1 (en) 2011-09-21
RU2012103248A (en) 2013-08-27
CA2768318A1 (en) 2011-01-20
IN2012DN00469A (en) 2015-06-05
NZ597679A (en) 2013-06-28
EP2454365A2 (en) 2012-05-23
CN102782124A (en) 2012-11-14
US20110016585A1 (en) 2011-01-20
AU2010273508B2 (en) 2015-02-05
UA107468C2 (en) 2015-01-12
JP2012533303A (en) 2012-12-27
RU2558302C2 (en) 2015-07-27
MY160166A (en) 2017-02-28
AU2010273508A1 (en) 2012-02-09
BR112012001125A2 (en) 2015-09-01
MX2012000825A (en) 2012-04-19
US8188335B2 (en) 2012-05-29
CN102782124B (en) 2015-04-22
WO2011008803A3 (en) 2011-04-07

Similar Documents

Publication Publication Date Title
US8188335B2 (en) Δ9-elongase for production of polyunsaturated fatty acid-enriched oils
JP4916886B2 (en) Δ15 desaturase suitable for altering polyunsaturated fatty acid levels in oily plants and yeast
EP1656449B1 (en) Fatty acid desaturases from primula
US7368552B2 (en) Genes involved in polyketide synthase pathways and uses thereof
US20040172682A1 (en) Production of very long chain polyunsaturated fatty acids in oilseed plants
MX2014001020A (en) Production of dha and other lc-pufas in plants.
US8916361B2 (en) Elongase gene and uses thereof
WO2003102138A2 (en) Elongase genes and uses thereof
WO2008064096A2 (en) Elongase gene and uses thereof
US8247653B2 (en) Delta-8 desaturase genes, enzymes encoded thereby and uses thereof
US20090325264A1 (en) Engineered Delta-15-Fatty Acid Desaturases

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 201080041384.1

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10737154

Country of ref document: EP

Kind code of ref document: A2

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2012520732

Country of ref document: JP

Ref document number: 2768318

Country of ref document: CA

Ref document number: 12012500107

Country of ref document: PH

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 469/DELNP/2012

Country of ref document: IN

Ref document number: MX/A/2012/000825

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 2010273508

Country of ref document: AU

ENP Entry into the national phase

Ref document number: 2010273508

Country of ref document: AU

Date of ref document: 20100714

Kind code of ref document: A

REEP Request for entry into the european phase

Ref document number: 2010737154

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2012103248

Country of ref document: RU

Ref document number: A201201733

Country of ref document: UA

Ref document number: 2010737154

Country of ref document: EP

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112012001125

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112012001125

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20120117