WO2011064395A2 - Inhibitors and antagonists of calcium channels in the treatment of asthma - Google Patents

Abstract

The present invention relates to an inhibitor of CACNA1C and/or CACNA1D gene expression for the treatment and/or the prevention of inflammatory diseases, preferably allergic diseases, and most preferably respiratory allergic diseases. The present invention also relates to a specific antagonist of at least one of the Cav1.2 and Cav1.3 subunits of voltage- dependent L- type calcium channels for the prevention and/or treatment of such inflammatory diseases.

Description

Inhibitors and antagonists of calcium channels in the treatment of asthma

FIELD OF THE INVENTION

The invention relates to the use of specific antagonists of the Cavl .2 and/or Cavl .3 subunits of voltage-dependent L-type calcium (Cavl) channels, preferably expressed in Th2 lymphocytes, for use in preventing and/or treating inflammatory diseases in a subject in need thereof. The present invention also relates to an inhibitor of CACNA1C and/or CACNA1D gene expression for use in preventing and/or treating such inflammatory diseases.

Preferably, the inflammatory diseases are allergic diseases. More preferably, the inflammatory diseases are respiratory allergic diseases.

BACKGROUND OF THE INVENTION

Respiratory diseases such as allergic rhinitis and asthma are widespread conditions with complex and multifactorial etiologies. The severity of the conditions vary widely between individuals, and within individuals, dependent on factors such as genetics, environmental conditions, and cumulative respiratory pathology associated with duration and severity of disease. Both diseases are a result of immune system hyper-responsiveness to innocuous environmental antigens, with asthma typically including an atopic (allergic) component.

In asthma, the pathology manifests as inflammation, mucus overproduction, and reversible airway obstruction which may result in scarring and remodelling of the airways. Mild asthma is relatively well controlled with current therapeutic interventions including beta-agonists and low dose inhaled corticosteroids or cromolyn. However, moderate and severe asthma are less well controlled, and require daily treatment with more than one long-term control medication to achieve consistent control of asthma symptoms and normal lung function. With moderate asthma, doses of inhaled corticosteroids are increased relative to those given to mild asthmatics, and/or supplemented with long acting beta-agonists or leukotriene inhibitors. Although beta-agonists can decrease dependence on corticosteroids, they are not as effective for total asthma control as corticosteroids (e.g., reduction of episodes, emergency room visits). With severe asthma, doses of inhaled corticosteroids are increased, and supplemented with both beta-agonists and oral corticosteroids. Severe asthmatics often suffer from chronic symptoms, including night time symptoms; limitations on activities; and the need for emergency room visits. Additionally, chronic corticosteroid therapy at any level has a number of unwanted side effects. Allergic rhinitis is an inflammation of the nasal passages, and is typically associated with watery nasal discharge, sneezing, congestion and itching of the nose and eyes. It is frequently caused by exposure to irritants, particularly allergens. Subjects suffering from allergic rhinitis mostly suffer from seasonal symptoms due to exposure to allergens, such as pollen, that are produced during the natural plant growth season(s). A smaller proportion of sufferers have chronic allergies due to allergens that are produced throughout the year such as house dust mites or animal dander. Treatments are available for the treatment of allergic rhinitis including oral and nasal antihistamines, and decongestants. Antihistamines are utilized to block itching and sneezing and many of these drugs are associated with side effects such as sedation and performance impairment at high doses. Decongestants frequently cause insomnia, tremor, tachycardia, and hypertension. Nasal formulations, when taken improperly or terminated rapidly, can cause rebound congestion. Anticholinergics and leukotriene receptor antagonists have substantially fewer side effects, but they also have limited efficacy. Similarly, prescription medications are not free of side effects. Nasal corticosteroids can be used for prophylaxis or suppression of symptoms; however, compliance is variable due to side effects including poor taste and nasal irritation and bleeding. Allergen immunotherapy is expensive and time consuming and carries a low risk of anaphylaxis.

There is thus a need for identifying new therapies for treating said inflammatory diseases, and particularly respiratory allergic diseases such as asthma or allergic rhinitis.

Respiratory allergic diseases are currently considered as inflammatory disorders involving the conducting airways and characterized by infiltration of the airway wall with inflammatory cells driven mostly by Th2 lymphocytes, mast cells and eosinophils. Th2 lymphocytes, by producing inflammatory cytokines as IL-4, IL-5, IL-9 and IL-13, are thought to play a central role in both the initiation and maintenance of the disease.

Several therapies have been developed for treating said respiratory allergic diseases: for example therapies targeting cytokines such as IL-13, IL-4, IL-5, cytokine receptors such as IL-4R alpha, transcription factors such as STAT-6, GATA-3, or NFkB, and chemokines receptor such as CCR3.

The inventors observed that Th2 lymphocytes express voltage-dependent L-type calcium (Ca_vl) channels, said Ca_vl channels being essential for TCR-induced calcium signalling in Th2 lymphocytes and for production of IL-4, IL-5 and IL-13 cytokines.

Therefore, the inventors aim to provide a new therapy for treating inflammatory diseases, and particularly allergic diseases, preferably respiratory allergic diseases such as asthma, by targeting said Ca_vl channels in Th2 lymphocytes. SUMMARY OF THE INVENTION

The present invention relates to a specific antagonist of at least one of the Cavl.2 and Cavl.3 subunits of voltage-dependent L-type calcium (Ca_vl) channels, preferably expressed in Th2 lymphocytes, or to an inhibitor of CACNA1C and/or CACNAID gene expression for use as a medicament.

The present invention also relates to a specific antagonist of at least one of the Cavl.2 and Cavl.3 subunits of voltage-dependent L-type calcium (Ca_vl) channels, preferably expressed in Th2 lymphocytes, for use in preventing and/or treating inflammatory diseases, and particularly allergic diseases, preferably respiratory allergic diseases such as asthma and allergic rhinitis. The present invention also relates to an inhibitor of CACNA1C and/or CACNAID gene expression for use in preventing and/or treating inflammatory diseases, and particularly allergic diseases, preferably respiratory allergic diseases such as asthma and allergic rhinitis.

The present invention also relates to specific antisense oligonucleotides that inhibit CACNA1C and/or CACNAID gene expression.

DETAILED DESCRIPTION OF THE INVENTION

The inventors previously showed that murine Th2 cells, but not Thl cells, express dihydropyridine (DHP) receptors (DHPRs) that can be blocked by DHPR antagonists such as nicardipine (Savignac et al, 2004).

The inventors then tested the effect of nicardipine in a model of experimental allergic asthma in mice and observed that nicardipine altered TCR-driven calcium response in Th2 cells as well as the release of IL-4, IL-5 and IL-13 cytokines, which are implicated in the pathogenesis of asthma, thereby impeding the development of Th2 mediated airway inflammation and reducing the capacity of lymphocytes from lung-draining lymph nodes to secrete Th2 cytokines (20). These results suggested that nicardipine might be potentially useful in the treatment of asthma. However, the concentrations of nicardipine used for preventing or treating asthma in this model were 30 times higher than those used in the treatment of experimental cardiovascular pathologies for inhibiting calcium signalling in excitable cells. The inventors then investigated about the specific molecular target of DHP antagonists in T-cells.

DHP are known to target voltage-dependent L-type calcium (Ca_vl) channels. The Ca_v channels are hetero-oligomeric protein complexes comprising a main pore-forming CCi-subunit in association with auxiliary β, <¾_δ subunits and optionally γ-subunit. The <¾ subunit is composed of four membrane- spanning domains (TIV), and each domain consists of six transmembrane segments (S1-S6). Beside the cytoplasmic N- and C-termini, joining the domains are intracellular regions comprising the loops linking domain I-II, domain II-III and domain III- IV.

The human <¾ subunit is encoded by 10 genes, of which 4 genes CACNA1S, CACNA1C, CACNA1D and CACNA1F respectively encode the L-type calcium (Ca_vl) channels referred to as Cavl. l, Cav 1.2, Cav 1.3 and Cav 1.4 channels (Jurkat-Rott et al, The impact of splice isoforms on voltage-gated calcium channel CCi subunits, J Physiol 554.3, pp 609-619, 2003). The inventors investigated whether Ca_vl channels were expressed by Th2 cells and the potential role of Ca_vl channels in Th2 cell functions. They first observed that murine differentiated Th2 cells specifically express Cavl.2 and Cavl.3 transcripts, whereas Cavl. l transcript was faintly detectable and Cav 1.4 transcript was undetectable. Then, they observed that specific inhibition of Ca_v1.2 and Ca_v1.3 transcripts obtained by transfection of Th2-cells with specific antisense oligodeoxynucleotides (ODNs) resulted in the loss of capacity of Th2- cells to transfer passive asthma. In addition, the administration of specific Cavl antisense ODNs efficiently prevented airway inflammation in experimental models of active and passive asthma in mice as well as bronchial hyper-reactivity in the experimental model of active asthma.

Therefore, the inventors aim to provide a new therapy for preventing and/or treating inflammatory diseases, particularly respiratory allergic diseases such as asthma by using a specific antagonist of at least one of Ca_v1.2 and Ca_v1.3 subunits expressed in Th2 lymphocytes, or by using an inhibitor of CACNA1C and/or CACNA1D gene expression. Indeed, the CACNA1C and CACNA1D genes are expressed in the Th2 lymphocytes, thereby giving the Ca_v1.2 and Ca_v1.3 subunits.

Definitions

The term "Ca_vl" means voltage-dependent L-type calcium channels.

The terms "Cavl.2 subunit" and "Cav 1.3 subunit" have their general meanings in the art. The Cavl.2 and Cavl.3 subunits are respectively encoded by the CACNA1C and CACNA1D genes. These subunits may include naturally occurring Ca_v1.2 or Ca_v1.3 subunits and variants and modified forms thereof. They can be from any source, but typically are mammalian (e.g., human and non-human primate) Ca_v1.2 and Ca_v1.3 subunits, particularly human Cavl.2 and Cavl.3 subunits.

The terms "Cavl.2 subunit expressed in the Th2 lymphocytes" and "Cavl.3 subunit expressed in the Th2 lymphocytes" respectively refer to the isoforms of the Cavl.2 and Cavl.3 subunits which are expressed in the Th2 lymphocytes.

The terms "inflammatory diseases" refer to any diseases marked by the generation, activation and recruitment of inflammatory cells into the tissues. These cells may belong to the innate (eosinophils, mast cells, basophils) or adaptative (T-cells especially Th2-cells) immune system.

The terms "allergic diseases" (also referred to as atopic diseases) refer to any disorder of the immune system resulting from an inappropriate immune response towards normally harmless environmental compounds called allergens. Such a response depends on the nature of the allergen, environmental and genetic factors. For example, some genetic diseases such as the Netherton syndrome are constantly associated with allergic manifestations. Allergy is one form of hypersensitivity that is called type I (or immediate) hypersensitivity. It is characterized by excessive activation of innate immune cells, including eosinophils, mast cells and basophils, as well as by the production of IgE specific antibodies. Common allergic reactions include eczema, urticaria, allergic rhinitis (perennial and seasonal), asthma, food allergies, and reactions to the venom of stinging insects such as wasps and bees. Preferably, the terms "allergic diseases" refer to eczema, urticaria, allergic rhinitis, asthma, food allergies, and reactions to the venom of stinging insects.

The terms "respiratory allergic diseases" refer to any obstructive diseases of the airways including:

asthma. The term asthma includes bronchial, allergic, intrinsic, extrinsic, exercise- induced, drug-induced (including aspirin and NSAID-induced) and dust-induced asthma, both intermittent and persistent and of all severities, and other causes of airway hyper-responsiveness;

chronic obstructive pulmonary disease (COPD);

bronchitis, including eosinophilic bronchitis;

- emphysema;

bronchiectasis;

cystic fibrosis;

sarcoidosis;

farmer's lung and related diseases; hypersensitivity pneumonitis;

acute and chronic rhinitis including rhinitis medicamentosa, and vasomotor rhinitis; perennial and seasonal allergic rhinitis including rhinitis nervosa (hay fever);

and nasal polyposis.

The term "expression" when used in the context of expression of a gene or nucleic acid refers to the conversion of the information contained in a gene, into a gene product. A gene product can be the direct transcriptional product of a gene (e.g., mRNA), tRNA, rRNA, antisense RNA, ribozyme, structural RNA or any other type of RNA or a protein produced by translation of a mRNA. Gene products also include messenger RNAs which are modified, by processes such as capping, polyadenylation, methylation, and editing, and proteins (e.g., FXR) modified by, for example, methylation, acetylation, phosphorylation, ubiquitination, SUMOylation, ADP-ribosylation, myristilation, and glycosylation.

An "inhibitor of gene expression" refers to a natural or synthetic compound that has a biological effect to inhibit or significantly reduce the expression of a gene. Consequently an "inhibitor of CACNA1C and/or CACNA1D gene expression" refers to a natural or synthetic compound that has a biological effect to inhibit or significantly reduce the expression of the CACNA1C and/or CACNA1D genes. Said inhibitor of CACNA1C and/or CACNA1D gene expression may be identified as described in example 1 (particularly "Transfection experiment" and "Immunoblotting").

"Nucleic acids" are polymers of nucleotides, wherein a nucleotide comprises a base linked to a sugar which sugars are in turn linked one to another by an interceding at least bivalent molecule, such as phosphoric acid. In naturally occurring nucleic acids, the sugar is either 2'- deoxyribose (DNA) or ribose (RNA). An "oligonucleotide" generally refers to a nucleic acid molecule having less than 30 nucleotides. An "oligodeoxynucleotide" or "ODN" means a monocatenary DNA molecule having less than 30 nucleotides; thus an ODN corresponds to an oligonucleotide of which the sugar is deoxyribose. Antisense poly- or oligonucleotides refer to synthetic poly- or oligonucleotides that mimic the complementary nature of the naturally occurring nucleic acids after which they are designed. They may contain modified bases, sugars, or linking molecules; such modified structures can impart an increased stability to the antisense poly- or oligonucleotides. An example of an antisense oligonucleotide is an antisense molecule composition that has a phosphorothioate backbone. An example of an antisense ODN is an antisense DNA molecule which has a phosphorothioate or morpholino backbone. A "polypeptide" is a polymer of amino acid residues joined by peptide bonds, and a peptide generally refers to amino acid polymers of 12 or less residues. Peptide bonds can be produced naturally as directed by the nucleic acid template or synthetically by methods well known in the art. A "protein" is a macromolecule comprising one or more polypeptide chains. A protein may further comprise substituent groups attached to the side groups of the amino acids not involved in formation of the peptide bonds. Typically, proteins formed by eukaryotic cell expression also contain carbohydrates. Proteins are defined herein in terms of their amino acid sequence or backbone and substituents are not specified, whether known or not. By "receptor antagonist" is meant a natural or synthetic compound that has a biological effect opposite to that of a receptor agonist. The term is used indifferently to denote a "true" antagonist and an inverse agonist of a receptor. A "true" receptor antagonist is a compound which binds the receptor and blocks the biological activation of the receptor, and thereby the action of the receptor agonist, for example, by competing with the agonist for said receptor. An inverse agonist is a compound which binds to the same receptor as the agonist but exerts the opposite effect. Inverse agonists have the ability to decrease the constitutive level of receptor activation in the absence of an agonist.

The term "Cavl.2 or Cavl.3 subunit antagonist" includes any chemical entity that, upon administration to a patient, results in inhibition or down-regulation of a biological activity associated with activation of the Cavl.2 or Cavl.3 subunit in the patient. Said biological activity of Cavl.2 or Cavl.3 subunit is the capacity of allowing the entry of calcium in the cells expressing said Cavl.2 or Cavl.3 subunit. Preferably, said biological activity of Cavl.2 or Cavl.3 subunit expressed in Th2 lymphocytes is the capacity of allowing the entry of calcium in the Th2 lymphocytes. Such Cavl.2 or Cavl.3 subunit antagonists include any agent that can block the Cavl.2 or Cavl.3 subunit activation or any of the downstream biological effects of the Cavl.2 or Cavl.3 subunit activation in the Th2 lymphocytes.

In the context of the present invention, Cavl.2 or Cavl.3 subunit antagonists are specific (ie selective) for the Cavl.2 or Cavl.3 subunit, and preferably specific for the Cavl.2 or Cavl.3 subunit expressed in Th2 lymphocytes, as compared with the other Cavl subunits, such as the Cavl.l and Cavl.4 subunits.

By "specific" or "selective" it is meant that the affinity of the antagonist for the Cavl.2 or Cavl.3 subunit is at least 10-fold, preferably 25-fold, more preferably 100-fold, still preferably 500-fold higher than the affinity for the other Cavl subunits (Cavl.l and Cavl.4). The affinity of an antagonist for the Cavl.2 or Cavl.3 subunit may be quantified by measuring the activity of the Cavl.2 or Cavl.3 subunit in the presence a range of concentrations of said antagonist in order to establish a dose-response curve. From that dose response curve, an IC₅₀ value may be deduced which represents the concentration of antagonist necessary to inhibit 50% of the response to an agonist in defined concentration. The IC₅₀ value may be readily determined by the one skilled in the art by fitting the dose- response plots with a dose-response equation as described by De Lean et al. (1979). IC₅₀ values can be converted into affinity constant (Ki) using the assumptions of Cheng and Prusoff (Relationship between the inhibition constant (Ki) and the concentration of inhibitor which causes 50 per cent inhibition (150) of an enzymatic reaction, Biochem Pharmacol. 1973 Dec 1;22(23):3099-108).

Accordingly, a specific or selective Cavl.2 subunit antagonist is a compound for which at least one of the ratios (i) Ki Cavl. l : Kj Cavl.2, and (ii) IC₅₀ Cavl.l: IC₅₀ Cavl.2, and at least one of the ratios (i') Ki Cavl.4 : K_; Cavl.2 and (ϋ') IC₅₀ Cavl.4: IC₅₀ Cavl.2, are above 10: 1, preferably 25 : 1 , more preferably 100: 1, still preferably 1000: 1.

Accordingly, a specific or selective Cavl.3 subunit antagonist is a compound for which at least one of the ratios (i) Ki Cavl. l : Kj Cavl.3, and (ii) IC₅₀ Cavl.l: IC₅₀ Cavl.3, and at least one of the ratios (i') K_; Cavl.4 : K_; Cavl.3 and (ϋ') IC₅₀ Cavl.4: IC₅₀ Cavl.3, are above 10: 1, preferably 25: 1, more preferably 100: 1, still preferably 1000: 1.

The term "small organic molecule" refers to a molecule of a size comparable to those organic molecules generally used in pharmaceuticals. The term excludes biological macromolecules (e. g., proteins, nucleic acids, etc.). Preferred small organic molecules range in size up to about 5000 Da, more preferably up to 2000 Da, and most preferably up to about 1000 Da. The term "antibody" refers to a protein capable of specifically binding an antigen, typically and preferably by binding an epitope or antigenic determinant or said antigen. The term "antibody" also includes recombinant proteins comprising the binding domains, as well as variants and fragments of antibodies. Examples of fragments of antibodies include Fv, Fab, Fab', F(ab')2, dsFv, scFv, sc(Fv)2, diabodies and multispecific antibodies formed from antibody fragments.

The term "treating" a disorder or a condition refers to reversing, alleviating or inhibiting the process of one or more symptoms of such disorder or condition. The term "preventing" a disorder or condition refers to preventing one or more symptoms of such disorder or condition.

As used herein, the term "subject" denotes a mammal, such as a rodent, a feline, a canine, and a primate. Preferably a subject according to the invention is a human.

A "therapeutically effective amount" as used herein is intended for a minimal amount of active agent which is necessary to impart therapeutic benefit to a subject. For example, a "therapeutically effective amount of the active agent" to a subject is an amount of the active agent that induces, ameliorates or causes an improvement in the pathological symptoms, disease progression, or physical conditions associated with the disease affecting the subject.

The Invention

The present invention aims the use of an inhibitor of CACNAIC and/or CACNAID gene expression or the use of a specific antagonist of at least one of the Cavl.2 and Cavl.3 subunits of voltage-dependent L-type calcium (Cavl) channels as a medicament. The present invention also aims the use of an inhibitor of CACNAIC and/or CACNAID gene expression in preventing and/or treating inflammatory diseases, and particularly allergic diseases, preferably respiratory allergic diseases such as asthma and allergic rhinitis. Preferably, the inhibitor is an inhibitor of CACNAIC gene expression.

The present invention also aims the use of a specific antagonist of at least one of the Cavl.2 and Cavl.3 subunits of voltage-dependent L-type calcium (Cavl) channels in preventing and/or treating these inflammatory diseases. Preferably the antagonist is a specific antagonist of at least one of the Cavl.2 and Cavl.3 subunits of voltage-dependent L-type calcium (Cavl) channels expressed in Th2 lymphocytes.

These Ca_v1.2 and Ca_v1.3 subunits are indeed expressed in murine and human Th2 lymphocytes, thanks to their corresponding genes CACNAIC and CACNAID. Moreover, specific isoforms of both Cavl.2 and Cavl.3 subunits are expressed in murine and human Th2 lymphocytes.

The inhibitors of gene expression include, but are not limited to, antisense oligonucleotides, siRNAs, shRNAs, ribozymes and DNAzymes.

The antagonists include, but are not limited to, small organic molecules, antibodies and ap tamers. One aspect of the invention relates to the use of an inhibitor of CACNA1C and/or CACNA1D gene expression.

Inhibitors of CACNA1C and/or CACNA1D gene expression for use in the present invention may be based on antisense oligonucleotides constructs. Antisense oligonucleotides, including antisense RNA and antisense oligodeoxynucleotides molecules, the antisense RNA or DNA molecules being modified or not, would act to directly block the translation of Cavl.2 or Cavl.3 mRNA by binding thereto and thus preventing protein translation or increasing mRNA degradation, thus decreasing the level of Cavl.2 or Cavl.3 proteins, and thus activity, in a cell. For example, antisense oligonucleotides of at least about 15 bases and complementary to unique regions of the mRNA transcript sequence encoding Cavl.2 or Cavl.3 can be synthesized, e.g., by conventional phosphodiester techniques and administered by e.g., intravenous injection or infusion or inhalation. Methods for using antisense techniques for specifically inhibiting gene expression of genes whose sequence is known are well known in the art (e.g. see U.S. Pat. Nos. 6,566,135; 6,566,131).

Preferably, the inhibitors of CACNA1C and/or CACNA1D gene expression for use in the present invention are antisense oligodeoxynucleotides (ODNs). ODNs are synthetic polymers, whose monomers are deoxynucleotides like those in DNA, and wherein their sequence (3'→ 5') is antisense (ie complementary to the sequence of a molecule of mRNA). Antisense ODNs act by blocking the synthesis of the Cavl.2 or Cavl.3 protein. This is achieved by the binding of the ODN to the Cavl.2 or Cavl.3 mRNA, as described in Example 1.

These antisense ODNs are particularly useful as therapeutics for pulmonary inflammation, airway hyperresponsiveness, and/or respiratory allergic diseases like asthma. Lung provides an ideal tissue for aerosolized antisense ODNs for several reasons: the lung can be targeted non-invasively and specifically, it has a large absorption surface, and it is lined with surfactant that may facilitate distribution and uptake of antisense ODNs. Delivery of antisense ODNs to the lung by aerosol results in excellent distribution throughout the lung in both mice and primates. Moreover, antisense ODNs have relatively predictable toxicities and pharmacokinetics based on backbone and nucleotide chemistry. Pulmonary administration of antisense ODNs results in minimal systemic exposure, potentially increasing the safety of such compounds as compared to other classes of drugs.

The mRNA corresponding to CACNA1C gene expression product, present in human Th2 cells, has been partially sequenced. Three sequences, ie SEQ ID NO:6, SEQ ID NO:48 and SEQ ID NO:49, were obtained from PCR products obtained from human Th2-cells, as explained in Example 2. These sequences are identical to different parts of the sequence GenBank accession number NM-001129827, except that SEQ ID NO:49 does not comprise the exon 32 of the sequence NM-001129827.

Some antisense ODNs of this mRNA have been synthesized and shown as particularly successful in the treatment of asthma on a mouse model, by significantly inhibiting CACNA1C gene expression (see examples 1 and 3).

Therefore, preferred inhibitors of CACNA1C gene expression according to the invention are the antisense oligonucleotides, preferably antisense ODNs, that comprise at least 15 nucleotides complementary to (i) at least one of the sequences SEQ ID NO : 6, SEQ ID NO:48 and SEQ ID NO:49, or to (ii) at least one sequence having at least 90% or 95% or more identity to the sequence SEQ ID NO:6 or SEQ ID NO:48 or SEQ ID NO:49. Most preferred inhibitors of CACNA1C gene expression are the antisense oligonucleotides, preferably antisense ODNs, that comprise at least 15 nucleotides complementary to (i) the exon lb of the sequence SEQ ID NO : 6, ie SEQ ID NO: 7, or to (ii) at least one sequence having at least 90% or 95% or more identity to the sequence SEQ ID NO : 7.

Most preferred inhibitors of CACNA1C gene expression are the antisense oligonucleotides, preferably the antisense ODNs, that have the following sequence:

5 cctcgtgttttcattgaccat^3' (SEQ ID NO : 1)

5'cctcgtattctcattgaccat3' (SEQ ID NO :2)

5'-tcc gtg ctg ttg ctg ggc tca-3' (SEQ ID NO:73)

5'-act ctg ggg cac act tct tg-3' (SEQ ID NO:74)

5'-tcc etc ttg tec tec tct g-3' (SEQ ID NO:75)

5'-tcc tct etc cca aac cca cct-3' (SEQ ID NO:76)

5'-cct tct cct ctt cct cct cct-3' (SEQ ID NO:77) and antisense ODNs of sequence having at least 90% or 95% or more identity to the sequence SEQ ID NO: l or SEQ ID NO:2 or SEQ ID NO: 73 or SEQ ID NO: 74 or SEQ ID NO: 75 or SEQ ID NO:76 or SEQ ID NO: 77,

as well as antisense oligonucleotides, preferably antisense ODNs, comprising at least one of the sequences SEQ ID NO: l, SEQ ID NO:2, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO:76 and SEQ ID NO: 77.

The term "identity" in the context of nucleic acid sequences refers to the residues in two sequences which are the same when aligned for maximum correspondence. The length of sequence identity comparison may be over a stretch of at least about 15 nucleotides, usually at least about 20 nucleotides. There are a number of different algorithms known in the art which can be used to measure nucleotide sequence identity. For instance, polynucleotide sequences can be compared using FASTA, Gap or Bestfit, which are programs in Wisconsin Package Version 10.0, Genetics Computer Group (GCG) , Madison, Wis. FASTA provides alignments and percent sequence identity of the regions of the best overlap between the query and search sequences (Pearson, Methods Enzymol. 183:63-98 (1990)). For instance, percent sequence identity between nucleic acid sequences can be determined using FASTA with its default parameters (a word size of 6 and the NOP AM factor for the scoring matrix) or using Gap with its default parameters as provided in GCG Version 6.1. Alternatively, sequences can be compared using the computer program, BLAST (Altschul et al., J. Mol. Biol. 215:403-410 (1990); Gish and States, Nature Genet. 3:266-272 (1993); Madden et al., Meth. Enzymol. 266: 131-141 (1996); Altschul et al., Nucleic Acids Res. 25:3389-3402 (1997); Zhang and Madden, Genome Res. 7:649-656 (1997)), especially blastp or tblastn (Altschul et al., Nucleic Acids Res. 25:3389-3402 (1997)).

On the other hand, the CACNA1D gene expression product, here mRNA, present in human Th2 cells, has been partially sequenced. This partial sequence corresponds to SEQ ID NO : 8. Therefore, preferred inhibitors of CACNA1D gene expression are the antisense oligonucleotides, preferably antisense ODNs, that comprise at least 15 nucleotides complementary to (i) the sequence SEQ ID NO : 8 or to (ii) at least one sequence having at least 90% or 95% or more identity to the sequence SEQ ID NO:8.

Most preferred inhibitors of CACNA1D gene expression are the antisense oligonucleotides, preferably antisense ODNs, that have the following sequence:

5 'C ATC ATC ATC ATC ATC ATC AT3 ' (SEQ ID NO :3)

5^,ttagccttctctctttcctttgagaattctccactaaggacacc^3' (SEQ ID NO :4)

5' gccttctctctttcctttgagaattctcc3' (SEQ ID NO :5)

and antisense ODNs of sequence having at least 90% or 95% or more identity to the sequence SEQ ID NO:3 or SEQ ID NO:4 or SEQ ID NO:5,

as well as antisense oligonucleotides, preferably antisense ODNs, comprising at least one of the sequences SEQ ID NO:3 to SEQ ID NO:5.

Thus, preferably, the present invention relates to an antisense oligonucleotide chosen from the group consisting of: antisense oligonucleotides that comprise at least 15 nucleotides complementary to at least one of the sequences SEQ ID NO : 6, SEQ ID NO: 48 and SEQ ID NO:49, or to at least one sequence having at least 90% or 95% or more identity to the sequence SEQ ID NO:6 or SEQ ID NO:48 or SEQ ID NO:49; and - antisense oligonucleotides that comprise at least 15 nucleotides complementary to the sequence SEQ ID NO : 8 or to at least one sequence having at least 90% or 95% or more identity to the sequence SEQ ID NO: 8.

Preferably, the antisense oligonucleotide is selected from antisense oligodeoxynucleotides of sequence chosen from SEQ ID NO: l to SEQ ID NO:5 or SEQ ID NO:73 to SEQ ID NO:77, antisense oligodeoxynucleotides comprising at least one of the sequences SEQ ID NO: l, SEQ ID NO:2, SEQ ID NO : 3, SEQ ID NO : 4, SEQ ID NO : 5, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76 and SEQ ID NO: 77, and antisense oligodeoxynucleotides of sequence having at least 90% or 95% or more identity to the sequence SEQ ID NO: l or SEQ ID NO:2 or SEQ ID NO:3 or SEQ ID NO:4 or SEQ ID NO:5 or SEQ ID NO: 73 or SEQ ID NO: 74 or SEQ ID NO: 75 or SEQ ID NO: 76 or SEQ ID NO: 77.

Small inhibitory RNAs (siRNAs) can also function as inhibitors of CACNA1C and/or CACNA1D gene expression for use in the present invention. CACNA1C and/or CACNA1D gene expression can be reduced by contacting a subject or cell with a small double stranded RNA (dsRNA), or a vector or construct causing the production of a small double stranded RNA, such that CACNA1C and/or CACNA1D gene expression is specifically inhibited (i.e. RNA interference or RNAi). Methods for selecting an appropriate dsRNA or dsRNA- encoding vector are well known in the art for genes whose sequence is known (e.g. see Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl T. Duplexes of 21- nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature. 2001 May 24;411(6836):494-8; Tuschl T, Zamore PD, Lehmann R, Bartel DP, Sharp PA. Targeted mRNA degradation by double-stranded RNA in vitro. Genes Dev. 1999 Dec 15;13(24):3191- 7).

Ribozymes and DNAzymes can also function as inhibitors of CACNA1C and/or CACNA1D gene expression for use in the present invention. Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. DNAzymes are enzymatic DNA molecules with catalytic action. The mechanism of ribozyme action involves sequence specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage. Engineered hairpin or hammerhead motif ribozyme molecules that specifically and efficiently catalyze endonucleolytic cleavage of Cavl.2 or Cavl.3 mRNA sequences are thereby useful within the scope of the present invention. Specific ribozyme cleavage sites within any potential RNA target are initially identified by scanning the target molecule for ribozyme cleavage sites, which typically include the following sequences, GUA, GUU, and GUC. Once identified, short RNA sequences of between about 15 and 20 ribonucleotides corresponding to the region of the target gene containing the cleavage site can be evaluated for predicted structural features, such as secondary structure, that can render the oligonucleotide sequence unsuitable. The suitability of candidate targets can also be evaluated by testing their accessibility to hybridization with complementary oligonucleotides, using, e.g., ribonuclease protection assays.

Both antisense oligonucleotides and ribozymes useful as inhibitors of CACNA1C and/or CACNA1D gene expression can be prepared by known methods. These include techniques for chemical synthesis such as, e.g., by solid phase phosphoramadite chemical synthesis. Alternatively, antisense RNA molecules can be generated by in vitro or in vivo transcription of DNA sequences encoding the RNA molecule. Such DNA sequences can be incorporated into a wide variety of vectors that incorporate suitable RNA polymerase promoters such as the T7 or SP6 polymerase promoters. Various modifications to the oligonucleotides of the invention can be introduced as a means of increasing intracellular stability and half-life. Possible modifications include but are not limited to the addition of flanking sequences of ribonucleotides or deoxyribonucleotides to the 5' and/or 3' ends of the molecule, or the use of phosphorothioate or 2'-0-methyl rather than phosphodiesterase linkages within the oligonucleotide backbone.

ODNs, siRNAs, shRNAs, ribozymes and DNAzymes of the invention may be delivered in vivo alone or in association with a vector. In its broadest sense, a "vector" is any vehicle capable of facilitating the transfer of the antisense ODN, siRNA, shRNA, ribozyme or DNAzyme nucleic acid to the cells and preferably cells expressing Cavl.2 or Cavl.3. Preferably, the vector transports the nucleic acid to cells with reduced degradation relative to the extent of degradation that would result in the absence of the vector. In general, the vectors useful in the invention include, but are not limited to, plasmids, phagemids, viruses, other vehicles derived from viral or bacterial sources that have been manipulated by the insertion or incorporation of the antisense ODNs, siRNAs, shRNAs, ribozymes and DNAzymes nucleic acid sequences. Viral vectors are a preferred type of vector and include, but are not limited to nucleic acid sequences from the following viruses: retrovirus, such as moloney murine leukemia virus, harvey murine sarcoma virus, murine mammary tumor virus, and rouse sarcoma virus; adenovirus, adeno-associated virus; SV40-type viruses; polyoma viruses; Epstein-Barr viruses; papilloma viruses; herpes virus; vaccinia virus; polio virus; and RNA virus. One can readily employ other vectors not named but known to the art. Preferred viral vectors are based on non-cytopathic eukaryotic viruses in which non-essential genes have been replaced with the gene of interest. Non-cytopathic viruses include retroviruses (e.g., lenti virus), the life cycle of which involves reverse transcription of genomic viral RNA into DNA with subsequent proviral integration into host cellular DNA. Retroviruses have been approved for human gene therapy trials. Most useful are those retroviruses that are replication-deficient (i.e., capable of directing synthesis of the desired proteins, but incapable of manufacturing an infectious particle). Such genetically altered retroviral expression vectors have general utility for the high-efficiency transduction of genes in vivo. Standard protocols for producing replication-deficient retroviruses (including the steps of incorporation of exogenous genetic material into a plasmid, transfection of a packaging cell lined with plasmid, production of recombinant retroviruses by the packaging cell line, collection of viral particles from tissue culture media, and infection of the target cells with viral particles) are provided in Kriegler, 1990 and in Murry, 1991 (Kriegler, A Laboratory Manual, W.H. Freeman CO., New York, 1990; Murry, Methods in Molecular Biology, vol.7, Humana Press, Inc., Cliffton, N.J., 1991).

Other vectors include plasmid vectors. Plasmid vectors have been extensively described in the art and are well known to those of skill in the art (see e.g. Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, 1989). In the last few years, plasmid vectors have been used as DNA vaccines for delivering antigen-encoding genes to cells in vivo. They are particularly advantageous for this because they do not have the same safety concerns as with many of the viral vectors. These plasmids, however, having a promoter compatible with the host cell, can express a peptide from a gene operatively encoded within the plasmid. Some commonly used plasmids include pBR322, pUC18, pUC19, pRC/CMV, SV40, and pBlueScript. Other plasmids are well known to those of ordinary skill in the art. Additionally, plasmids may be custom designed using restriction enzymes and ligation reactions to remove and add specific fragments of DNA. Plasmids may be delivered by a variety of parenteral, mucosal and topical routes. For example, the DNA plasmid can be injected by intramuscular, intradermal, subcutaneous, or other routes. It may also be administered by intranasal sprays or drops, rectal suppository and orally. It may also be administered into the epidermis or a mucosal surface using a gene-gun. The plasmids may be given in an aqueous solution, dried onto gold particles or in association with another DNA delivery system including but not limited to liposomes, dendrimers, cochleate and microencapsulation. Examples of vectors according to the invention are viral vectors, like lentivirus vectors. Such lentivirus may be pLentiLox 3.7 as described in Karnabi et al, 2009 (Silencing of Cavl.2 gene in neonatal cardiomyocytes by lentiviral delivered shRNA, Biochemical and Biophysical Research Communications 384 (2009) 409-414). The inhibitors of CACNA1C and/or CACNA1D gene expression according to the invention can be identified according to different screening methods.

To test the activity of antisense oligonucleotides or siRNA, the method can consist in introducing the antisense oligonucleotide or siRNA into the cells by transfection with chemicals (as lipofectin or Hpofectamin) or by electroporation.

shRNA products can be encoded by adequate vectors allowing the generation of retroviral particles. In that case, cells to be tested would be transduced with retrovirus or lentiviral vectors (see Karnabi et al above).

The loss of expression of the gene targeted, and the impact on the function considered should then be assessed. One example of screening method is illustrated in example I.

According to an embodiment of the invention, the specific antagonist of at least one of the Cavl.2 and Cavl.3 subunits is a small organic molecule. DHP are not considered as specific antagonists according to the present invention, because they bind to all the Cavl.l, Cavl.2, Cavl.3 and Cavl.4 subunits. In another embodiment the specific antagonist of the Cavl.2 or Cavl.3 subunit may consist in an antibody (the term including antibody fragment) that can block the Cavl.2 or Cavl.3 subunit activation.

Antibodies directed against of the Cavl.2 or Cavl.3 subunit can be raised according to known methods by administering the appropriate antigen or epitope to a host animal selected, e.g., from pigs, cows, horses, rabbits, goats, sheep, and mice, among others. Various adjuvants known in the art can be used to enhance antibody production. Although antibodies useful in practicing the invention can be polyclonal, monoclonal antibodies are preferred. Monoclonal antibodies against the Cavl.2 or Cavl.3 subunit can be prepared and isolated using any technique that provides for the production of antibody molecules by continuous cell lines in culture. Techniques for production and isolation include but are not limited to the hybridoma technique originally described by Kohler and Milstein (Continuous cultures of fused cells secreting antibody of predefined specificity. Nature. 1975 Aug 7;256(5517):495-7); the human B-cell hybridoma technique (Cote RJ, Morrissey DM, Houghton AN, Beattie EJ Jr, Oettgen HF, Old LJ. Generation of human monoclonal antibodies reactive with cellular antigens. Proc Natl Acad Sci U S A. 1983 Apr;80(7):2026-30); and the EBV-hybridoma technique (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., 1985, pp. 77-96). Alternatively, techniques described for the production of single chain antibodies (see, e.g., U.S. Pat. No. 4,946,778) can be adapted to produce anti-Cavl.2 or anti-Cavl.3 single chain antibodies. Cavl.2 or Cavl.3 subunit antagonists useful in practicing the present invention also include anti-Cavl.2 or anti-Cavl.3 antibody fragments including but not limited to F(ab')₂ fragments, which can be generated by pepsin digestion of an intact antibody molecule, and Fab fragments, which can be generated by reducing the disulfide bridges of the F(ab')₂ fragments. Alternatively, Fab and/or scFv expression libraries can be constructed to allow rapid identification of fragments having the desired specificity to Cavl.2 or Cavl.3.

Humanized anti-Cavl.2 or anti-Cavl.3 antibodies and antibody fragments therefrom can also be prepared according to known techniques. "Humanized antibodies" are forms of non-human (e.g., rodent) chimeric antibodies that contain minimal sequence derived from non-human immunoglobulin. For the most part, humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a hypervariable region (CDRs) of the recipient are replaced by residues from a hypervariable region of a non-human species (donor antibody) such as mouse, rat, rabbit or nonhuman primate having the desired specificity, affinity and capacity. In some instances, framework region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues. Furthermore, humanized antibodies may comprise residues that are not found in the recipient antibody or in the donor antibody. These modifications are made to further refine antibody performance. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the hypervariable loops correspond to those of a non-human immunoglobulin and all or substantially all of the FRs are those of a human immunoglobulin sequence. The humanized antibody optionally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. Methods for making humanized antibodies are described, for example, by Winter (U.S. Pat. No. 5,225,539) and Boss (Celltech, U.S. Pat. No. 4,816,397).

Then after raising antibodies directed against the Cavl.2 or Cavl.3 subunit as above described, the skilled man in the art can easily select those blocking Cavl.2 or Cavl.3 subunit activation.

In another embodiment the Cavl.2 or Cavl.3 subunit antagonist is an aptamer. Aptamers are a class of molecule that represents an alternative to antibodies in term of molecular recognition. Aptamers are oligonucleotide or oligopeptide sequences with the capacity to recognize virtually any class of target molecules with high affinity and specificity. Such ligands may be isolated through Systematic Evolution of Ligands by Exponential enrichment (SELEX) of a random sequence library, as described in Tuerk C. and Gold L., 1990 (Tuerk C. and Gold L. (1990) Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science. 3;249(4968):505-10). The random sequence library is obtainable by combinatorial chemical synthesis of DNA. In this library, each member is a linear oligomer, eventually chemically modified, of a unique sequence. Possible modifications, uses and advantages of this class of molecules have been reviewed in Jayasena S.D., 1999. Peptide aptamers consists of a conformationally constrained antibody variable region displayed by a platform protein, such as E. coli Thioredoxin A that are selected from combinatorial libraries by two hybrid methods (Colas P, Cohen B, lessen T, Grishina I, McCoy J, Brent R. (1996) Genetic selection of peptide aptamers that recognize and inhibit cyclin-dependent kinase 2. Nature, 380, 548-50). Then after raising aptamers directed against the Cavl.2 or Cavl.3 subunit as above described, the skilled man in the art can easily select those blocking Cavl.2 or Cavl.3 subunit activation.

Pharmaceutical compositions: Another object of the invention relates to a method for treating and/or preventing an inflammatory disease, particularly an allergic disease, and preferably a respiratory allergic disease comprising administering to a subject in need thereof an inhibitor of CACNAIC and/or CACNAID gene expression or a specific antagonist of at least one of Cavl.2 and Cavl.3 subunits, preferably expressed in Th2 lymphocytes.

Another object of the invention relates to a pharmaceutical composition comprising an inhibitor of CACNAIC and/or CACNAID gene expression or a specific antagonist of at least one of Cavl.2 and Cavl.3 subunits, preferably expressed in Th2 lymphocytes, in a physiologically acceptable vehicle.

Cavl.2 or Cavl.3 subunits antagonists or inhibitors of CACNAIC or CACNAID gene expression may be administered in the form of a pharmaceutical composition which comprises a physiologically acceptable vehicle, as defined below.

By « physiologically acceptable vehicle », it is meant an inert vehicle, ie compatible with the envisaged application.

Preferably, said antagonist or inhibitor is administered in a therapeutically effective amount. It will be understood that the total daily usage of the compounds and compositions of the present invention will be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level for any particular patient will depend upon a variety of factors including the disorder being treated and the severity of the disorder; activity of the specific compound employed; the specific composition employed, the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination; and like factors well known in the medical arts. For example, it is well within the skill of the art to start doses of the compound at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. However, the daily dosage of the products may be varied over a wide range from 0.01 to 1,000 mg per adult per day. The compositions may contain 0.01, 0.05, 0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100, 250 and 500 mg of the active ingredient for the symptomatic adjustment of the dosage to the patient to be treated. Cavl.2 or Cavl.3 subunits antagonists or inhibitors of CACNA1C or CACNA1D gene expression may be combined with pharmaceutically acceptable excipients, and optionally sustained-release matrices, such as biodegradable polymers, to form therapeutic compositions. In the pharmaceutical compositions of the present invention, the active principle, alone or in combination with another active principle, can be administered in a unit administration form, as a mixture with conventional pharmaceutical supports, to animals and human beings. Suitable unit administration forms comprise oral-route forms such as tablets, gel capsules, powders, granules and oral suspensions or solutions, sublingual and buccal administration forms, aerosols, implants, subcutaneous, transdermal, topical, intraperitoneal, intramuscular, intravenous, subdermal, transdermal, intrathecal and intranasal administration forms and rectal administration forms.

Preferably, Cavl.2 or Cavl.3 subunits antagonists or inhibitors of CACNA1C or CACNA1D gene expression are adapted for intranasal administration ; thus preferably, the pharmaceutical compositions contain vehicles which are pharmaceutically acceptable for an intranasal administration. Compositions and devices for delivery to the lung and nose are well known. In particular, the inhibitors and antagonists according to the invention can be soluble in aqueous solution and may be delivered using standard nebulizer devices. They can also be delivered using other devices such as dry powder inhalers or metered dose inhalers which can provide improved patient convenience as compared to nebulizer devices, resulting in greater patient compliance.

The invention will further be illustrated in view of the following figures and examples. FIGURES:

Figure 1: Ca_v1.2 and Ca_v1.3 are up regulated in Th2- but not in Thl-cells. A) cDNAs from OVA- specific D011.10 Thl and Th2-cells collected after 3 rounds of stimulation were tested for the expression of Ca_vl isoforms (Ca_vl.l to Ca_v1.4) and β actin (left panel). cDNAs from Th2-, Thl-cells and brain used as a positive control were tested for expression of auxiliary Ca_vl beta subunits and β actin (right panel). One representative experiment out of the ten performed. B and C) We analyzed the expression of GATA-3 (the Th2-lineage specific transcription factor, dark grey bars), T-bet (the Thl -lineage specific transcription factor, light grey bars), (left panels) Ca_v1.2 (white bars), Ca_v1.3 (black bars), (right panels) by real-time PCR in CD4⁺ T-cells, Th2- (B) and Thl-cells (C) collected 3 and 7 days (d) after the first stimulation (stl) and thereafter 3 days after the second (st2), third (st3) and fourth stimulation (st4). Data were normalized to levels of the housekeeping gene HPRT. They represent the mean + ISD from seven experiments; * p< 0.01 as compared to CD4⁺ T cells, nd = not detectable.

Figure 2: Ca_v1.2 and Ca_v1.3 expression is reduced by transfection with specific antisense oligodeoxynucleotides. A) Real time PCR were carried out to quantify the expression of Ca_v1.2 (n=7), Ca_v1.3 (n=7), stiml (n=5), Orail (n=5), K_v1.3 (n=3) and Kca3.1 (n=3), in Th2-cells transfected with a mixture of Ca_v1.2 and Ca_v1.3 antisense (black bars) or sense (white bars) ODNs. The numbers in brackets represent the number of experiments performed. Data were normalized to levels of the housekeeping gene HPRT. * p <0.01 as compared to controls. B) Th2-cells treated with lipofectin (lipo), or transfected with Ca_v1.2 (1.2), Ca_v1.3 (1.3) sense (S) or antisense (AS) were analyzed 48 h after transfection by western blotting with anti-Ca_v1.2 or Ca_v1.3 monoclonal antibodies. Actin was used as a loading control. The intensity of bands was quantified and normalized to the level of actin. The histograms in (C) represent the mean + ISD from six experiments where lyzates from cells treated as in (B) were immuno-blotted with anti-Ca_v1.2 (white bars) or anti-Ca_v1.3 (black bars) antibodies; * p< 0.02 when compared to Th2-cells transfected with control ONs. Figure 3: Ca_vlAS reduce the TCR-dependent Ca²⁺ response and cytokine production by

Th2- but not by Thl-cells. A) Th2-cells transfected with Ca_v1.2 sense (S), Ca_v1.2 antisense (AS) or a mixture of Ca_v1.2 and Ca_v1.3 AS ODNs were loaded with Fura-2/AM. Intracellular Ca²⁺ levels were recorded for 2 min before stimulation with anti-TCR mAb (arrow) and for 7- 8 min after stimulation. At least 45 cells were recorded and [Ca²⁺]; calculated for each cell were averaged at each time-point. Standard errors are not indicated, but they were less than 10% of the mean. One representative experiment out of 6 is shown. B and C) The mean peak values of [Ca²⁺]i and cytokine production elicited by TCR stimulation were measured in Th2 (B) and in Thl (C) cells treated with lipofectin or transfected with Ca_v1.2 and/or Ca_v1.3 S or AS ODNs. The relative Ca²⁺ response represents the percentage of the peak [Ca²⁺]; value relative to the data obtained from T cells treated with lipofectin alone; they represent the mean + ISD of six experiments.

Figure 4: Th2-cells transfected with Ca_vlAS lose their ability to induce asthma. A) OVA specific Th2-cells transfected or not with Ca_v1.2 and Ca_v1.3 sense (Th2S) or antisense (Th2AS) oligonucleotides were transferred into BALB/c mice that were exposed to intranasal OVA for 7 days. (A) The number of inflammatory cells was reduced in the BALF of mice transferred 7 days before with Th2AS (black bars) compared to mice injected with Th2 (grey bars) or Th2S (white bars) (* p<0.01). Data represent the mean + ISD from 5 mice and are representative of 4 experiments with 5 mice per group. Tot= total, eos= eosinophils, mono= monocytes/ macrophages, ly= lymphocytes, neutro= neutrophils. C) IL-4 concentration was reduced in the BALF of mice transferred with Th2AS (black bars) compared to mice injected with Th2 or Th2S (white bars). Data represent the mean + ISD from 5 mice and are representative of 5 experiments. The number of cells in the lung-draining lymph nodes of mice injected with Th2AS (D) and the capacity of CD4⁺ T-cells isolated from these lymph nodes to produce cytokines after in vitro stimulation with APCs and OVA (E) was reduced compared to controls (* p <0.01, n=5 independent experiments).

Figure 5: Ca_vlAS impair the development of asthma. A and B) BALB/c mice immunized with OVA in alum were exposed 15 days later to daily doses of intranasal OVA for 5 days. CD4⁺ T-cells were purified from the lungs. An intracellular staining with the monoclonal anti- Ca_v1.2 antibody was performed (A). In parallel, cDNAs were prepared and analyzed for the expression of Ca_v1.2 (white bars) and Ca_v1.3 (grey bars) by real time PCR (B). Data were normalized to levels of the housekeeping gene HPRT and represent the mean + SD from three independent experiments. Results obtained with cDNAs from Th2-cells obtained after three rounds of stimulation were shown for comparison. C to F) BALB/c mice were immunized with OVA and were exposed 15 days later to daily doses of intranasal OVA mixed with Ca_v1.2 plus Ca_v1.3 sense (Ca_vlS), (white bars) or antisense (Ca_vlAS) (black bars) for 5 days. C) Ca_vlAS reduced the number of inflammatory cells in the BALF when compared to controls (* p< 0.01, 5 mice per group). One representative experiment out of four is shown. IL-4 concentration (E) was reduced in the BALF of mice given Ca_vlAS (black bars) compared to controls (white bars) as well as the capacity of CD4⁺ T-cells isolated from the lymph nodes of mice given Ca_vlAS (F) to produce IL-4 after in vitro stimulation with APCs and OVA compared to controls (* p <0.01, n=5 independent experiments).

Figure 6. Ca_vlAS suppress airway hyper-reactivity in an experimental model of active asthma. BALB/c mice were immunized with OVA in alum and were exposed 15 days later to daily doses of intranasal OVA mixed with Ca_v1.2 plus Ca_v1.3 sense (Ca_vlS) or antisense (Ca_vlAS) ODNs for 5 days. Mice treated with Ca_vlAS (black circles) displayed no or only mild airway hyper-reactivity upon exposure to increasing concentrations of intranasal methacholine, unlike mice exposed to either OVA alone (Ct, open squares) or mice treated with Ca_vlS (open circles); * p< 0.01, 5 mice per group. One representative experiment out of three is shown. The dashed line represents the results obtained with mice primed with OVA in alum and given intranasal PBS.

Figure 7. Th2- but not Thl-cells express Ca_v1.2 and anti-Ca_v1.3 proteins. Lyzates from differentiated Thl and Th2-cells were resolved by SDS-PAGE and then immunoblotted (50 μg protein/lane) with anti-Ca_v1.2 or anti-Ca_v1.3 polyclonal antibodies. The anti-Ca_v1.2 and anti-Ca_v1.3 antibodies were pre-incubated (Th2-pep) or not with the antigenic peptide before use. The figure shows one representative experiment out of five performed.

Figure 8. Ca_vlAS reduce dihydropyridine receptor expression in Th2-cells. Th2-cells collected after three rounds of stimulation were treated with lipofectin alone, or were transfected with Ca_v1.2 (1.2) or Ca_v1.3 (1.3) sense (S) or antisense (AS). Cells were stained 24 h later with ST-BODIPY-labelled DHP. The fluorescence intensity was quantified by using the Image J software and the intensity/per cell was averaged. Results represent the mean of fluorescence intensity/per cell obtained from five independent experiments. * p < 0.01, as compared to Th2-cells transfected with Ca_vlS. The staining was completely abolished by pre- incubation with an excess of unlabelled DHP (not shown).

Figure 9. Ca_vlAS do not alter the proliferation of Th2-cells A) Th2-cells were transfected with a mixture of Ca_v1.2 and Ca_v1.3 antisense (Th2AS) or sense (Th2S). The cells were stained 48h later with carboxyfluorescein succinimidyl ester (CFSE) and stimulated on plates coated with anti-TCR mAb in the presence of anti-CD28 mAb. The fluorescence was then analyzed by FACS 48h later and showed that Th2AS and Th2S proliferated equally well. The histogram shows the percentage of dividing cells in Th2, Th2S and Th2AS. Results are expressed as mean + SD of 4 cultures. Figure 10. Ca_vlAS modify neither the calcium response nor IL-4 production induced by stimulation with thapsigargin or PMA/ionomycin. A) Th2-cells were either treated with lipofectin only (lipo) or transfected with Ca_v1.2 (1.2) or Ca_v1.3 (1.3) sense (S) or antisense (AS) ODNs and were loaded with Fura2-AM. The [Ca²⁺]; was recorded before stimulation (Unst.) and after stimulation with thapsigargin (Thapsi). [Ca²⁺]; was recorded in 60-70 cells for each condition. The peak value for [Ca ]i was determined for each cell and the mean value calculated for each sample. The histograms represent the mean + 1SD of the mean peak values of [Ca²⁺]; from six independent experiments. B) Production of IL-4 by Th2-cells transfected with Ca_vlAS after stimulation with PMA/ionomycin (PMA/iono), thapsigargin (Thapsi), or anti-TCR antibody (a-TCR). Data were expressed relative to the production of Th2-cells transfected with control ODNs and represented the mean + 1SD of five experiments. The ranges of IL-4 production induced by stimulation through the TCR, by PMA/iono or thapsigargin were around 11.5, 7.5 and 6 ng/ml respectively.

Figure 11. Th2-cells transfected with Ca_vlAS can localize into the lungs of BALB/c mice upon adoptive transfer. 24 h after transfection of Th2-cells with a mixture of Ca_v1.2 and Ca_v1.3 sense (Th2S) or antisense (Th2AS), cells were injected intravenously in BALB/c mice that were given intranasal OVA for 7 days. The lungs were collected, digested and CD4⁺ T- cells were purified and labelled with anti-clonotypic KJ1.26 antibodies. The same numbers of KJ1.26⁺ cells were recovered from mice injected with Th2, Th2S or Th2AS. One representative experiment out of the three performed is shown.

Figure 12. Ca_v1.2 transcripts are expressed in CD4+CRTH2+ cells. cDNA from CRTh2+ cells were amplified with the primers listed in Example 2 : 94°C for 1 min. then 40 cycles (90°C for 45 sec, 55°C for 40 sec, 72°C for 1 min.). In some experiments neuroblastoma was used as a positive control.

a) indicates the location of primers used in PCR 1 to 5 relative to the numbers of exons and to the expected structure of the channel (Tiwari et al. PNAS 2006). The rectangle area schematizes the cell membrane.

b) and c) and e) show examples of PCRs performed, d) shows that the sequence obtained thanks to PCR3 predicts splicing of exons 32 and 34a.

Figure 13. Ca_v1.2 channels are preferentially expressed in Th2 cells as compared to Thl cells. cDNAs were prepared from 5 samples of CRTH2+ (Th2) and CRTH2- cells differentiated along the Thl pathway. Real time PCR was developed to measure the amount of transcripts encoding Ca_v12 and the housekeeping gene GAPDH in Th2 and Thl cells. Results were normalized relative to the expression of GAPDH which is stable in the two cell subsets. * p< 0.01 compared to Thl cells. Figure 14. Nicardipine inhibits the entry of Ca ⁺ and the production of IL-4 in Th2 cells upon TCR stimulation. Nicardipine (ΙΟμΜ) reduced the production of IL-4 by CRTH2+ cells upon stimulation through the TCR as assessed by ELISA 24h after stimulation with plate-bound anti-CD3 and soluble anti-CD28mAb, with or without the drug.* p< 0.02 when compared to cells without the drug.

Figure 15. Effect of Ca_vlAS on Ca_v1.2 expression in transfected CRTH2+ cells. CRTH2+ cells were transfected with putative Ca_v1.2 specific antisense oligodeoxynucleotides (AS, AS1 to AS5 cf table 2) or control oligonucleotides and tested 48h later for Ca_v1.2 expression by staining with anti-Ca_v1.2 mAb. Fluorescence was then quantified. Results are expressed as the mean + 1SD of 10 to 20 cells. AS5 induced the most important inhibtion of Ca_v1.2 expression. The numbers in brackets represent the percentages of inhibition.

Figurel6. Ca_vlAS reduce the production of IL-5 and IL-13 by CRTH2⁺ cells. CRTH2+ cells were transfected with Ca_vlAS or control oligonucleotides and stimulated 48h later with plate-bound anti-CD3 and soluble anti-CD28niAb for 24h. Cytokine concentrations were measured by ELISA. The numbers in brackets represent the percentages of inhibition.

EXAMPLES

Example 1: Knocking-down Cayl calcium channels implicated in Th2-cell activation prevents experimental asthma METHODS

Mice. 7-10 week old female BALB/c mice (Janvier Ets, Le Genest St.Isle, France) and DO11.10 BALB/c mice, which express a transgenic T-cell receptor (TCR) specific for the 323-339 ovalbumin (OVA) peptide, were cared for in our animal facility. Our institutional review board for animal experimentation approved all aspects of animal care.

In vitro T-cell activation and differentiation. CD4+ T cells were isolated from spleens of DO11.10 BALB/c mice by negative selection with the Dynal® Mouse CD4 Negative Isolation Kit (Invitrogen Carlsbad, CA). CD4+ T cells were cultured in RPMI 1640 supplemented with 10% foetal calf serum (ATGC, Noisy Le Grand, France), 1% pyruvate, 1% non-essential amino acids, 2 mM glutamine, 100 U/ml penicillin, 100 μg/ml streptomycin, and 50 μΜ beta-mercaptoethanol. CD4+ T-cells (10⁶/ well) were differentiated along the Th2 pathway by weekly stimulation with 2.5 x 10⁶ irradiated BALB/c spleen cells/well, 0.3 μΜ OVA 323-339 peptide (Neosystem, Strasbourg, France), 10 ng/ml IL-4 and 10 μg/ml anti- IFNgamma (XMG1.2) antibody (both purchased from BD Pharmingen, San Diego, CA). Thl- cell differentiation was achieved by weekly stimulation of 10⁶ CD4+ T cells with APCs (5 x 10⁶/well), 5 ng/ml IL-12 (BD Pharmingen) and 10 μg/ml anti-IL-4 antibody (11B.11, BD Pharmingen). Cytokine concentration was measured by ELISA (Savignac et al, 2001) in the supernatants of T cells (2.5xl0⁴ cells/well) stimulated with plate-bound anti-TCR mAb (H57- 597, BD Pharmingen, 1 μg/ml) for 24 h.

Sequencing of cDNAs encoding the Cavl.2 and Cavl.3 subunits in Th2-cells. The primers listed in Table El enabled us to determine the full-length sequences of the Cavl.2 and Cavl.3 subunits. The PCR amplification products were cloned and sequenced using an ABI PRISM® 3100 Genetic Analyzer with BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosytems). At least ten clones were sequenced for each product.

Table El: Primers used to determine the sequences of Th2-cell Cavl.2 and Cavl.3 cDNAs:

*Refer to the murine sequences L01776.1 (Cavl.2) and NM-001083616 (Cavl.3).

Detection of Cavl PCR products. Total RNA was isolated from 107 cells by using the SV Total RNA Isolation System (Promega, Madison, WI) and reverse transcribed with poly(dT) and Moloney murine leukemia virus reverse transcriptase (Invitrogen). Specific primers were used as follows:

for Cavl. l: 5'-tgtggtatgtcgtcacttcctcc-3' (SEQ ID NO: 9) and 5'-cgtcaatgatgctgccgatg-3' (SEQ ID NO: 10); for Cavl.2: 5'-caagccctcacaaaggaatgc-3' (SEQ ID NO: 11) and 5'-aaagttgcccctgctgtcactc-3' (SEQ ID NO: 12);

for Cavl.3: 5'-cttcacagccatctttacggttg-3' (SEQ ID NO: 13) and 5'-agaggccgcaagaccctca-3' (SEQ ID NO: 14);

for Cavl.4: 5'-tccacacactccaccagcag-3' (SEQ ID NO: 15) and 5'-atggtcaacgtgttgagg-3' (SEQ ID NO: 16);

for betal subunit: 5'-agcatgccagtgtgcacgagtac-3' (SEQ ID NO: 17) and 5'- agccctccagctcattcttattgc-3' (SEQ ID NO: 18);

for beta2: 5'-ataaccacagagagggagccaca-3' (SEQ ID NO: 19) and 5'-tatacatccctgttccactcgcca-3' (SEQ ID NO: 20);

for beta3: 5'-tccctggacttcagaaccagcag-3' (SEQ ID NO: 21) and 5'-ttgtggtcatgctccgagtcctg-3' (SEQ ID NO: 22);

for beta4: 5'-tgagacacagcaaccattctacagaga-3' (SEQ ID NO: 23) and 5'- atgtcgggagtcatggctgcatc-3' (SEQ ID NO: 24);

for beta actin: 5'-tggaatcctgtggcatccatgaaac-3' (SEQ ID NO: 25) and 5'- taaaacgcagctcagtaacagtccg-3' (SEQ ID NO: 26).

PCR conditions were 94°C for 45 sec, followed by 55°C (Cavl and β subunits) or 60°C (β- actin) for 45 sec, and 72°C for 1 min over 21 cycles (beta-actin) or 40 cycles (Cavl and β subunits).

Real-time quantitative PCR. Cavl.2, Cavl.3, GATA-3, T-bet, Orail, Stiml, Kvl.3, KCa3.1 and HPRT (hypoxanthine-guanine phosphoribosyltransferase) transcripts were measured by real-time quantitative PCR using an ABI Prism 7000 Sequence Detection System. PCR was performed with the PCR SYBR Green Sequence Detection System (Perkin Elmer). We used the following primers to quantify mRNA encoding

Cavl.2: 5'agacgcgggtggttttttta-3' (SEQ ID NO: 27) and 5'-gaagacgctgttccggttacc-3' (SEQ ID NO: 28);

Cavl.3: 5'-tgaggccaaaagtaaccccgagg-3' (SEQ ID NO: 29) and 5'-cgccatcatagccgaaaggacaat-3' (SEQ ID NO: 30);

GATA-3: 5'-gccatgggttagagaggcag-3' (SEQ ID NO: 31) and 5'- ttggagactcctcacgcatgt-3' (SEQ ID NO: 32);

T-bet: 5'-cggtaccagagcggcaagt-3' (SEQ ID NO: 33) and 5'- cagctgacccaagaggaatca-3' (SEQ ID NO: 34); Orail: 5'-gcttcgccatggtagcgat-3' (SEQ ID NO: 35); and 5'-gctgatcatgagggcaaac-3' (SEQ ID NO: 36);

Stiml: 5'-gccacagcttggcctgg-3' (SEQ ID NO: 37) and 5'-gctccatcaggctgtgg-3' (SEQ ID NO: 38);

Kvl.3: 5'-ccagcacctctcctcttcag-3' (SEQ ID NO: 39) and 5'- agggcatacacagaccaagg-3' (SEQ ID NO: 40);

KCa3.1: 5'-tgccatttgcgtactgagag-3' (SEQ ID NO: 41) and 5'-gacaaaggaggaaggcagtg-3' (SEQ ID NO: 42);

HPRT: 5'-ctggtgaaaaggacctctcg-3' (SEQ ID NO: 43) and 5'- tgaagtactcattatagtcaagggca-3' (SEQ ID NO: 44).

Quantification of target gene expression was calculated by normalising the values relative to the expression of HPRT.

Transfection experiments. Thl or Th2-cells specific for the OVA 323-339 peptide were transfected with Cavl.2 or Cavl.3 sense, mismatched or antisense ODNs by using Lipofectin® (Invitrogen). The sequences of the ODNs are given in Table E2. FACS analysis showed that transfection with FITC-conjugated control or antisense ODNs labelled 60-70% of cells (data not shown). Table E2: Oligodeoxynucleotides used in transfection experiments :

L01776 and AJ4377291.1 refer to the murine Cavl.2 and Cavl.3a sequences respectively.

Immunoblotting. 10⁷ cells Th2 or Thl cells were lyzed for 15 min in lyzis buffer containing 4 mM EDTA, 1% Triton, 150 mM NaCl, 20 mM Tris HC1 pH 8, protease inhibitor cocktail (1 tablet / 6 ml buffer, Roche Diagnostics, Mannheim, Germany). Lyzates were centrifuged at 13,000 rpm to remove insoluble material. The protein content of the supernatant was measured by using a detergent-compatible protein assay (Bio-Rad, Hercules, CA). Samples (50 μg/lane for Th2 and Thl samples except when otherwise mentioned) were subjected to 7.5% SDS-PAGE and transferred onto nitrocellulose membranes (Bio-Rad). Membranes were saturated with TBS/Tween containing 1% milk and 1% BSA and incubated overnight with anti-Cavl.2 and anti-Cavl.3 polyclonal (Alomone Labs, Jerusalem, Israel) or monoclonal antibodies (UC Davis NINDS/NIMH NeuroMab facility, Davis CA). Blots were developed with the appropriate HRP-conjugated secondary antibody and Amersham Biosciences Enhanced Chemiluminescence system (GE Healthcare, Little Chalfont, UK). Membranes were then washed and incubated in stripping buffer (62.5 mM Tris-HCl (pH 6.8), 2% SDS, 0.1 M 2-Mecaptoethanol) at 60°C for 30 min to be reprobed with anti-actin antibodies as a loading control.

Confocal microscopy. Cells were stained with monoclonal anti-Cavl.2 antibody, and with Alexa-fluor-555-labeled anti-IgG2b mouse immunoglobulin (Invitrogen).

Single cell intracellular Ca²⁺ measurements were done as previously described (20, 23) in cells loaded with 5 μΜ Fura2-AM before being stimulated with anti-TCR plus anti-CD28 antibodies, thapsigargin or ionomycin. Thl and Th2 transfer experiments. Thl and Th2-cells transfected as described above were injected intravenously into BALB/c recipient mice (5 x 10⁶ cells per mouse) and the mice were then given intranasal OVA protein (50 μg in PBS) once per day for 7 days. Broncho- alveolar lavage fluid (BALF) was collected 24 hours after the final OVA administration. In vivo administration of Cavl-specific antisense ODN. BALB/c mice primed intraperitoneally with 100 μg OVA protein in 2 mg alum (Sigma) were challenged 15 days later with a mixture of intranasal OVA (50 μg in PBS) and control or Cavl.2 and Cavl.3 antisense ODN (200 μg corresponding to 15 nmoles/ day) in PBS for 5 days. 24h after the final OVA administration, the mice were anaesthetized and BALF was collected by cannulation of the trachea and lavage with PBS.

Airway inflammation and stimulation assays. BALF was centrifuged at 300 g. Cell pellets were suspended in PBS and the number of cells was determined by trypan blue exclusion. Cells were then centrifuged onto slides and stained with May-Grunwald Giemsa to identify inflammatory cells. Lung samples were fixed in formalin overnight, stored in 70% ethanol, and 5 μιη-thick sections were stained with hematoxylin and eosin. CD4+ T cells (25 x 10⁴/ well) were purified from peribronchial lymph nodes and stimulated for 24 h with OVA (100 μg/ml) and irradiated BALB/c spleen cells as a source of APCs (2 x 10⁶/ well).

Airway hyper-responsiveness. It was assessed 24 h after the final OVA inhalation by using a whole body plethysmograph (EMKA Technologies, France). Baseline-enhanced pause (Penh) values were recorded for 3 min before the mice were exposed to intranasal methacholine as previously described (Gomes et al, 2007). The Penh values measured during 20 min sequence were averaged and expressed as the fold increase over baseline values.

Statistical analysis. Data are presented as means + SD. Data were analyzed by using the Mann-Whitney test or the Kruskal-Wallis test when more than one group was compared. A p value below 0.05 was considered significant.

RESULTS

Th2- but not Thl-cells express Ca_v1.2 and Ca_v1.3 channels.

Four genes encode Ca_vl channels (Ca_vl. l-Ca_v1.4) that make up the Ca²⁺ pore. The analysis of their expression showed Ca_v1.2, Ca_v1.3 and barely detectable Ca_vl.l transcripts in well-differentiated Th2-cells whereas Ca_vl transcripts were undetectable in Thl-cells (Figure 1A). Ca_v1.4 transcripts were detected in no T-cell subset while they were easily evidenced in retina (not shown). The cDNAs encoding the four beta subunits that may associate with the Ca_vl channels were also present in Th2-cells but not in Thl-cells (Figure 1A). We then used real-time PCR to quantify Ca_v1.2 and Ca_v1.3 expression during T-cell differentiation. Low levels of Ca_vl products were measured in CD4⁺ T cells and expression of both Ca_v1.2 and Ca_v1.3 increased progressively during Th2-cell differentiation from the end of the first stimulation (Figure IB, right panel), after expression of GATA-3, the Th2 lineage- specific transcription factor was already enhanced (Figure IB, left panel). This suggests that commitment to the Th2-lineage is required for induction of Ca_vl gene expression in T- lymphocytes. Conversely Ca_vl products became undetectable in differentiating Thl-cells (Figure 1C, right panel) that express T-bet, the transcription factor characteristic of Thl-cells (Figure 1C, left panel). In order to determine whether differentiated Th2-cells express classical Ca_vl channels (for which numerous splice variants have been described), we carried out RT-PCR that amplify two overlapping products, each of more than 3 kbp, encompassing the entire cDNA sequences encoding Ca_v1.2 and Ca_v1.3. The sequence coding Ca_v1.3 was identical to the neuronal Ca_v1.3a (Genbank accession AJ4377291.1). Multiple splice variants may encode Ca_v1.2 channels with some exons that characterize the cardiac form such as the exon la instead of the exon lb, and the use of exons 34a, 41a and 45 that were excluded in other forms (25). We found that the sequences of Ca_v1.2 cloned from Th2-cells did not express cardiac specific exons and differed from the Genbank accession L01776 sequence (cloned from the BALB/c brain) only by the use of the exon 8 instead of the exon 8a (exons that are known to be exclusive) (25) and by the absence of exon 33. However the sequences described as encoding the four voltage sensors in classical Ca_vl channels (26) were also evidenced in Th2-cell sequences.

As shown on the Figure 7, Western blots of Th2-cell extracts probed with anti-Ca_v1.2 and anti-Ca_v1.3 polyclonal antibodies revealed polypeptides of around 210 and 240 kDa, respectively. These bands corresponded to the expected sizes for classical Ca_vl channels found in the brain (not shown). Pre-incubating anti-Ca_v1.2 or anti-Ca_v1.3 antibody with the antigenic peptides markedly decreased the band intensity as expected. By contrast, none of these channels were detected in cell lyzates from differentiated Thl -cells (Figure 7).

Ca_vlAS alter TCR-dependent calcium signaling and IL-4 production by Th2-cells with no impact on Thl-cell functions.

To investigate the function of Ca_vl channels in Th2-cells, we used Ca_vl specific antisense oligodeoxynucleotides (Ca_vlAS) to reduce translation of the mRNAs. As shown on Figure 2A, transfection of Th2-cells with a mixture of Ca_v1.2 plus Ca_v1.3AS reduced Ca_v1.2 and Ca_v1.3 gene expression with no effect on stiml, Orail, or the potassium channels K_v1.3 and KCa3.1 described as required for Ca²⁺ entry in memory and activated naive T-cells respectively (27). Ca_v1.2 and Ca_v1.3 AS also reduced the amounts of proteins as shown by Western blotting (Figure 2B and 2C). Transfection with Ca_vlAS significantly reduced the binding of the Ca_vl ligand DHP to Th2-cells, as shown by staining cells with the fluorescent dye BODIPY-DHP (Figure 8). Thus, Ca_vlAS reduce expression of the channels and so reduce the amount of DHP binding to Th2-cells showing the molecular identity of dihydropyridine receptors in Th2-cells. The [Ca ]i increase (Figure 3A) and IL-4 synthesis (Figure 3B) that is exquisitely Ca²⁺-dependent (28, 29) were lower upon TCR activation in Th2-cells transfected with Ca_v1.2 or Ca_v1.3 AS and especially in Th2-cells transfected with both AS, when compared to Th2- cells transfected with control oligonucleotides. The analysis of Th2-cells transfected with Ca_v1.2 and Ca_v1.3 AS showed that the [Ca²⁺]i rise was reduced in around 80% of cells compared to controls (data not shown). Among these cells, an oscillatory pattern without plateau was observed in 15% of cells and 10% of cells did not respond at all. This reduction in Ca²⁺ signaling was not due to global alterations in Th2-cell functions since Th2-cells transfected with Ca_vlAS proliferated as well as control Th2-cells (Figure 9). Transfection of Thl -cells with Ca_vlAS modified neither the Ca²⁺ response nor IFNy synthesis upon TCR stimulation (Figure 3C). Ca_vlAS did not affect SOC channels in Th2-cells as indicated by the absence of effect on the Ca²⁺ response induced by thapsigargin, an inhibitor of the intracellular Ca²⁺ pump, SERCA which activates SOC channels through the depletion of ER Ca²⁺ stores (Figure 10A). Accordingly, transfection with Ca_vlAS, which inhibited TCR-triggered IL-4 secretion in Th2-cells, had no effect on IL-4 production induced by PMA plus ionomycin or thapsigargin (Figure 10B). Thus Ca_vlAS impede the increase in [Ca²⁺]i and cytokine production induced by stimulation of the TCR specifically in Th2-cells.

Th2-cells transfected with Ca_vlAS lose their ability to induce asthma.

To investigate whether Ca_vl is involved in the pro-inflammatory functions of Th2-cells in vivo, OVA-specific transgenic Th2-cells were transfected with Ca_vl AS (Th2AS) or Ca_vlS (Th2S) and injected into BALB/c mice that were given intranasal OVA to induce airway inflammation. Similar numbers of transgenic T-cells, identified by the staining with anti- KJ1.26 antibodies were found in the lungs of mice after the transfer of either Th2AS or Th2S (see Figure 11) suggesting that Ca_vlAS do not prevent Th2-cells to localize into the lungs. However, the number of inflammatory cells, in particular eosinophils, was dramatically reduced in the bronchoalveolar lavage fluid (BALF) of mice injected with Th2AS when compared to the controls (Figure 4A). This was consistent with the absence or minor lung inflammation in these animals when compared to the controls (data not shown). The lack of lung inflammation in mice injected with Th2AS was accompanied by a decrease in the IL-4 concentration in the BALF (Figure 4C) and a reduction in the number of lymphocytes in the lung-draining lymph nodes (Figure 4D) when compared to controls. Moreover, CD4⁺ T cells from the draining lymph nodes produced less IL-4, IL-5 and IL-13 when stimulated with antigen-presenting cells (APCs) and OVA as compared to controls (Figure 4E). Thus knocking-down Ca_vl channels in Th2-cells strongly inhibits their ability to induce allergic asthma and airway inflammation upon adoptive transfer.

Intranasal delivery of Ca_vlAS prevents experimental active asthma.

We showed that around 30-50% of CD4⁺ T-cells that infiltrated the lungs of asthmatic mice were stained with anti-Ca_v1.2 mAb (Figure 5A), which is in agreement with the expression of Ca_v1.2 and Ca_v1.3 in these cells as assessed by RT-PCR (Figure 5B) and with the detection of dihydropyridine receptors on these cells (20). To assess whether inhaled Ca_vlAS might be beneficial directly in experimental asthma, we immunized BALB/c mice with OVA and then challenged them with a mixture of intranasal OVA and Ca_vlAS. The number of inflammatory cells (mainly eosinophils; Figure 5C) was reduced in the BALF of mice treated with Ca_vlAS and these mice developed only mild lung inflammation (data not shown). The concentration of IL-4 in the BALF of mice given Ca_vl AS was reduced (Figure 5E) and CD4⁺ T-cells isolated from their lung-draining lymph nodes produced less IL-4 upon stimulation in vitro with APCs and OVA than did similar cells isolated from control mice (Figure 5F). Mice treated with Ca_vlAS showed little or no hyper-responsiveness to the acetylcholine analogue methacholine unlike the controls (Figure 6). Thus, intranasal administration of Ca_vlAS prevents eosinophilic inflammation of the lungs and airway hyperreactivity, demonstrating their in vivo efficacy to prevent asthma.

Example 2: Human Th2-cells express Ca_yl channels

In order to demonstrate that human Th2-cells express Ca_vl channels as murine Th2-cells do, we prepared peripheral blood mononuclear cells from healthy donor buffy coats. CD4+ T- cells were then purified by negative selection by incubation with a cocktail of antibodies (anti-CD8, CD14, CD16, CD19, CD36, CD56, CDdwl23, CD235a) and magnetic beads coated with anti-mouse IgG (kit M-450 Dynabeads). CD4+ (around 90% pure) contained from 1 to 5% of CRTH2+cells. CRTH2 is a receptor for prostaglandin D2 shown to be mainly expressed by memory Th2-cells. CRTH2+ cells were collected by positive selection by using the human CD294 (CRTH2) MicroBead kit (Miltenyi). They were around 70% pure and intracellular staining with anti-interleukin (IL)-4 and anti-interferon gamma (IFNg) showed that around 50-60% of these cells produced IL-4 upon stimulation with PMA (and ionomycin) versus around 3-5% in CD4+ or CRTH2- CD4+ T-cells. We have stimulated CRTH2+ by weekly stimulation with beads coated with anti-CD3 and anti-CD28 antibodies (Dynal expander, Invitrogen) (lbead for 4 cells), IL-4 (5 ng/ml), IL-2 (5 ng/ml) and anti-IFNg antibody (5μg/ml) for two to three weeks. In these conditions Th2-cells retained their ability to produce IL-4 and their number was 5-10 fold increased. ARNs were prepared using Trizol, reverse transcribed in cDNAs. The following primers specific for human CACNAIC were used to detect Ca_vl .2 products:

fw = forward ; rev= reverse

* the nu mbers correspond to the position i n N M001129827.1, the va ria nt 2 of huma n CACNAIC tra nscri pts

The products of PCR were purified and cloned. Five clones were sequenced for each experiment and showed identity with exons lb, 2, 3, 28 to 37 (the exons 32 and 34a were spliced); and 48 to 50 of CACNAIC, as shown in Figure 12.

We have also shown that the addition of nicardipine (10 μg/ml), an antagonist of Ca_vl channels to CRTh2⁺ cells stimulated with plate-bound anti-CD3 (3 g/ml) and soluble anti- CD28 antibody (2 g/ml) for 24h decreased IL-4 production by around 50%. These data show that Ca_v1.2 products are evidenced in human CRTh2+ cells and suggest that they may be functional. Example 3: Expression of Ca_v1.2 channels in human Th2 cells and ODN effects a) Human Th2 cells express a neuronal isoform of Ca_v1.2 channels

CD4⁺ T cells were purified from healthy blood donors by negative selection and stained with anti-CRTH2-PE (phycoerythrin) antibodies. CRTH2, the receptor for prostaglandin D2 is considered as a cell surface marker for human memory Th2⁺ cells. This population represents 0.5 to 2% of CD4⁺ T cells. These cells were then purified on magnetic beads coated with anti- PE antibodies. CRTH2⁺ cells were around 80 to 85% pure. These cells were then cultured in the presence of beads coated with anti-CD3 and anti-CD28 mAbs plus IL-4, IL-2 and anti- IFNy antibodies for 14 to 28 days. At the end of the culture, intracellular cytokine staining reveals that around 50% of cells produced IL-4 and less than 5% of cells produced IFNy (data not shown).

CRTH2- cells were differentiated along the Thl pathway by setting them in the presence of beads coated with anti-CD3 and anti-CD28 mAbs plus IL-12, IL-2 and anti-IL-4 antibodies for 14 to 28 days. Intracellular cytokine staining reveals that more than 70% of cells produced IFNy and less than 3-5% synthetized IL-4 (not shown). mRNAs were extracted from CRTH2+ and CRTH2- (Thl) CD4+ T cells, reverse-transcribed, and PCR were performed with primers specific for Ca_v1.2 encoding gene (table 1) and the housekeeping gene.

Table 1: Sequences of primers used for sequencing human Ca_v1.2 channel mRNA in CRTH2⁺ cells

Primer Position relative to

NM-001129839

fw: tcaatgagaatacgagga 318-335

(SEQ ID NO:60)

rev: attggtggcgttggaatc 781-764

(SEQ ID NO:61)

fw: gtactggaactccttgagcaacct 2209-2232

(SEQ ID NO:62)

rev: tctgaaacacagtgaggagggact 2417-2394

(SEQ ID NO:63)

fw: atggatgacctccagcccaatgaa 2780-2803

(SEQ ID NO:64)

rev: cactggaggcgaaacctgttgtta 2991-2968

(SEQ ID NO:65)

fw: atcgggatgcaggtgtttgggaaa 4403-4426

(SEQ ID NO:66)

rev: tgatgatcaggaagggacagagca 4679-4656

(SEQ ID NO:67)

fw: aaacaccctgtggtagcagctttg 4605-4628

(SEQ ID NO:68) rev: aggtgtttgatacgacccttggct 4818-4795

(SEQ ID NO:69)

fw: tgaggtcaccgttggcaagttcta 5164-5187

(SEQ ID NO:70)

rev: tgaggtcaccgttggcaagttcta 6030-6053

(SEQ ID N0:71)

NM-001129839 used as a reference is reported as the variant 13 of human Ca_v1.2 in databases

Ca_v1.2 mRNA was detected in CRTH2⁺ cells (data not shown). The PCR fragments were sequenced and although the sequence did not cover the complete Ca_v1.2 sequence, they enabled to show that the organization of the mRNA was very similar to the sequence of the channels in murine Th2 cells. The organization of the channel and the exons encoding the different parts of the channel were designed (data not shown). Consistent with this nomenclature, Exons 1 (and not la), 8 (and not 8a) are used for encoding the channel. Exons 9a, 31, 34a, 41a and 45 are spliced.

Therefore a classical neuronal isoform of Ca_v1.2 is expressed by CRTH2+ cells.

Confocal microscopy shows that Ca_v1.2 channels are also expressed at the protein level as assessed by intracellular staining with anti-Ca_v1.2 mAb (data not shown). The staining was specific because it was no longer detected in CRTH2+ cells transduced with a retrovirus encoding an shRNA specific for Ca_v1.2 and GFP. b) Ca_v1.2 channels are differentially expressed between Th2 and Thl cells

We developed real-time quantitative PCR specific for Ca_v1.2 expression by using the following primers fw 5'atcaccgagaacgcagagga3' and rev 5'tagggcagggcctggaagga3' (amplifying exons 32, 33 and 34). The level of Ca_v1.2 expression was significantly higher in CRTH2⁺ cells compared to CRTH2^" cells differentiated along the Thl pathway (Fig.13) or undifferentiated CD4+ T cells (not shown). c) Nicardipine and Ca_v1.2AS reduced Th2 cytokine production induced by TCR stimulation

Nicardipine (5 or 10 μΜ), a dihydropyridine antagonist of dihydropyridine receptors alias Ca_vl channels reduced the production of Th2 cytokines upon stimulation of human Th2 cells with coated anti-CD3niAb and soluble anti-CD28 mAb (Fig.14).

CRTH2⁺ cells were also transfected with different Ca_vlAS (Table 2). These antisense were chosen from litterature and predictive databases.

Table 2. Sequences of oligodeoxynucleotides used in transfection experiments. AS = Ca_v1.2 specific antisense oligodeoxynucleotides oligonucleotide sequence NM Exon

001129839* targeted

Control 5'-gtt ctt cac agg ggg tct ca-3' (SEQ ID NO:72)

AS1 5'-tcc gtg ctg ttg ctg ggc tca-3' 4599-4581 37

(SEQ ID NO:73)

AS2 5'-act ctg ggg cac act tct tg-3' 4648-4577 37

(SEQ ID NO:74)

AS3 5'-tcc etc ttg tec tec tct g-3' 5964-5946 46

(SEQ ID NO:75)

AS4 5'-tcc tct etc cca aac cca cct-3' 7891-7871 50 (3' not

(SEQ ID NO:76) translated)

AS5 5'-cct tct cct ctt cct cct cct-3' 2633-2613 16

(SEQ ID NO:77)

AS6 5'-cct cgt att etc att gac cat 334-314 1

(SEQ ID NO:2)

*Position relative to N1V [ 001129839

The Ca_vlAS reduced the expression from 10 to 70% depending upon the AS (Fig. 15). AS6 (the AS analogous to the Ca_vlAS used for inhibiting mouse Ca_v1.2) also decreased expression of Ca_v1.2 by 80% (not shown). Preliminary results (only two experiments have been done yet) suggested that Ca_vl AS, and especially AS5 and AS6 decreased the production of IL-5 and IL- 13 (Fig.l6). d) Eosinophils also express these Ca_v1.2 channels

We obtained evidence that murine eosinophils express Ca_v1.2 channels at the mRNA and protein levels. We purified eosinophils from the blood of healthy donors by using the eosinophil isolation kit (Myltenyi). They were 80 to 95% pure as shown by staining with anti- CRTH2 antibodies. They expressed Ca_v1.2 mRNA (not shown). In addition, the protein is detected as assessed by staining with anti-Ca_v1.2 mAb (data not shown). CRTH2+ and eosinophils appear to express the same form of Ca_v1.2. At that time, we are developing functional assays to determine which functions are Ca²⁺ dependent.

Conclusion

Human Th2 cells overexpress Ca_v1.2 and likely Ca_v1.3 channels.

The sequences of Ca_v1.2 channels are similar to neuronal isoforms of the channels. The protein is detected in these Th2 cells.

Th2 cells express approximately 10 times more Ca_v1.2 channels than Thl cells.

Nicardipine reduces Th2 cytokine production by CRTH2+. Preliminary results suggest that CavlAS and especially Cavl.5 and Cavl.6 AS decreased Cavl.2 expression and Th2 cytokine production. These latter results are recent and should be confirmed.

Eosinophils clearly express Ca_v1.2 channels but we have look for their role in eosinophil functions. REFERENCES

Throughout this application, various references describe the state of the art to which this invention pertains. The disclosures of these references are hereby incorporated by reference into the present disclosure.

Savignac M, Badou A, Moreau M, Leclerc C, Guery JC, Paulet P, Druet P, Ragab-Thomas J, Pelletier L. Protein kinase C-mediated calcium entry dependent upon dihydropyridine sensitive channels: a T cell receptor-coupled signaling pathway involved in IL-4 synthesis. asefc / 2001;15: 1577-1579.

Savignac M, Gomes B, Gallard A, Narbonnet S, Moreau M, Leclerc C, Paulet P, Mariame B, Druet P, Saoudi A, Fournie GJ, Guery JC, Pelletier L. Dihydropyridine receptors are selective markers of Th2 cells and can be targeted to prevent Th2-dependent immunopathological disorders. J Immunol 2004;172:5206-5212.

20. Gomes B, Cabral MD, Gallard A, Savignac M, Paulet P, Druet P, Mariame B, Moreau M, Leclerc C, Guery JC, Pelletier L. Calcium Channel Blocker Prevents T Helper Type 2 Cell- mediated Airway Inflammation. Am J Respir Crit Care Med 2007;175: 1117-1124. 23. Faroudi M, Zaru R, Paulet P, Muller S, Valitutti S. Cutting edge: T lymphocyte activation by repeated immunological synapse formation and intermittent signaling. / Immunol 2003;171: 1128-1132.

25. Tiwari S, hang Y, Heller J, Abernethy DR, Soldatov NM. Atherosclerosis-related molecular alteration of the human CaV1.2 calcium channel alphalC subunit. Proc Natl Acad Sci U S A 2006;103: 17024-17029. 26. Varadi G, Mori Y, Mikala G, Schwartz A. Molecular determinants of Ca²⁺ channel function and drug action. Trends Pharmacol. Sci. 1995;16:43-49.

27. Cahalan MD, Wulff H, Chandy KG. Molecular properties and physiological roles of ion channels in the immune system. / Clin Immunol 2001;21:235-252. 28. Kubo M, Kincaid RL, Webb DR, Ransom JT. The Ca2+/calmodulin-activated, phosphoprotein phosphatase calcineurin is sufficient for positive transcriptional regulation of the mouse IL-4 gene. Int Immunol 1994;6: 179-188.

29. Guo L, Urban JF, Zhu J, Paul WE. Elevating calcium in Th2 cells activates multiple pathways to induce IL-4 transcription and mRNA stabilization. / Immunol 2008;181:3984-

Claims

1. An inhibitor of CACNAIC and/or CACNAID gene expression or a specific antagonist of at least one of the Cavl.2 and Cavl.3 subunits of voltage-dependent L- type calcium channels for use as a medicament.

2. The inhibitor of CACNAIC and/or CACNAID gene expression for use in the treatment and/or the prevention of inflammatory diseases, preferably allergic diseases, and most preferably respiratory allergic diseases.

3. The inhibitor of CACNAIC and/or CACNAID gene expression according to claim 1 or 2 wherein said inhibitor of CACNAIC and/or CACNAID gene expression is selected from the group consisting of antisense oligonucleotides, small inhibitory RNAs, shRNA, DNAzymes and ribozymes.

4. The inhibitor of CACNAIC and/or CACNAID gene expression according to any one of claims 1 to 3 wherein said inhibitor of CACNAIC and/or CACNAID gene expression is selected from: antisense oligonucleotides that comprise at least 15 nucleotides complementary to at least one of the sequences SEQ ID NO : 6, SEQ ID NO: 48 and SEQ ID NO:49, or to at least one sequence having at least 90% or 95% or more identity to the sequence SEQ ID NO:6 or SEQ ID NO:48 or SEQ ID NO:49; and antisense oligonucleotides that comprise at least 15 nucleotides complementary to the sequence SEQ ID NO : 8 or to at least one sequence having at least 90% or 95% or more identity to the sequence SEQ ID NO: 8.

5. The inhibitor of CACNAIC and/or CACNAID gene expression according to any one of claims 1 to 4 wherein said inhibitor of CACNAIC and/or CACNAID gene expression is selected from: antisense oligodeoxynucleotides that comprise at least 15 nucleotides complementary to the sequence SEQ ID NO: 7, or to at least one sequence having at least 90% or 95% or more identity to the sequence SEQ ID NO : 7; and antisense oligodeoxynucleotides that comprise at least 15 nucleotides complementary to the sequence SEQ ID NO : 8 or to at least one sequence having at least 90% or 95% or more identity to the sequence SEQ ID NO : 8.

6. The inhibitor of CACNA1C and/or CACNA1D gene expression according to any one of claims 1 to 5 wherein said inhibitor of CACNA1C and/or CACNA1D gene expression is selected from: antisense oligodeoxynucleotides of sequence chosen from SEQ ID NO: l to SEQ ID NO:5 or SEQ ID NO: 73 to SEQ ID NO: 77, antisense oligodeoxynucleotides comprising at least one of the sequences SEQ ID NO: l, SEQ ID NO:2, SEQ ID NO : 3, SEQ ID NO : 4, SEQ ID NO : 5, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76 and SEQ ID NO: 77, and antisense oligodeoxynucleotides of sequence having at least 90% or 95% or more identity to the sequence SEQ ID NO: l or SEQ ID NO:2 or SEQ ID NO:3 or SEQ ID NO:4 or SEQ ID NO:5 or SEQ ID NO: 73 or SEQ ID NO: 74 or SEQ ID NO: 75 or SEQ ID NO:76 or SEQ ID NO: 77.

7. The inhibitor of CACNA1C and/or CACNA1D gene expression according to any one of claims 1 to 6 wherein it is an inhibitor of CACNA1C gene expression.

8. The specific antagonist of at least one of the Cavl .2 and Cavl.3 subunits of voltage- dependent L-type calcium channels for use in the prevention and/or treatment of inflammatory diseases, preferably allergic diseases, and most preferably respiratory allergic diseases.

9. The specific antagonist of at least one of the Cavl .2 and Cavl.3 subunits according to claim 1 or 8, wherein said specific antagonist is selected from the group consisting of small organic molecules, antibodies and aptamers.

10. The specific antagonist of at least one of the Cavl .2 and Cavl.3 subunits or the inhibitor of CACNA1C or CACNA1D gene expression according to any one of claims 1 to 9, wherein said respiratory allergic disease is chosen from asthma and allergic rhinitis.

11. The specific antagonist of at least one of the Cavl .2 and Cavl.3 subunits or the inhibitor of CACNA1C or CACNA1D gene expression according to any of claims 1 to 10 for intranasal administration.

12. A pharmaceutical composition comprising a specific antagonist of at least one of the Cavl.2 and Cavl.3 subunits or an inhibitor of CACNA1C or CACNA1D gene expression according to any of claims 1 to 9 in a physiologically acceptable vehicle.

13. An antisense oligonucleotide chosen from the group consisting of: antisense oligonucleotides that comprise at least 15 nucleotides complementary to at least one of the sequences SEQ ID NO : 6, SEQ ID NO: 48 and SEQ ID NO:49, or to at least one sequence having at least 90% or 95% or more identity to the sequence SEQ ID NO:6 or SEQ ID NO:48 or SEQ ID NO:49; and antisense oligonucleotides that comprise at least 15 nucleotides complementary to the sequence SEQ ID NO : 8 or to at least one sequence having at least 90% or 95% or more identity to the sequence SEQ ID NO: 8.

14. An antisense oligonucleotide according to claim 13 wherein it is selected from antisense oligodeoxynucleotides of sequence chosen from SEQ ID NO: l to SEQ ID NO:5 or SEQ ID NO: 73 to SEQ ID NO: 77, antisense oligodeoxynucleotides comprising at least one of the sequences SEQ ID NO: l, SEQ ID NO:2, SEQ ID NO : 3, SEQ ID NO : 4, SEQ ID NO : 5, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76 and SEQ ID NO: 77„ and antisense oligodeoxynucleotides of sequence having at least 90% or 95% or more identity to the sequence SEQ ID NO: l or SEQ ID NO:2 or SEQ ID NO:3 or SEQ ID NO:4 or SEQ ID NO:5 or SEQ ID NO: 73 or SEQ ID NO: 74 or SEQ ID NO: 75 or SEQ ID NO:76 or SEQ ID NO: 77.