WO2011146629A2 - Methods and compositions for sequence-specific purification and multiplex analysis of nucleic acids - Google Patents
Methods and compositions for sequence-specific purification and multiplex analysis of nucleic acids Download PDFInfo
- Publication number
- WO2011146629A2 WO2011146629A2 PCT/US2011/037012 US2011037012W WO2011146629A2 WO 2011146629 A2 WO2011146629 A2 WO 2011146629A2 US 2011037012 W US2011037012 W US 2011037012W WO 2011146629 A2 WO2011146629 A2 WO 2011146629A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleic acid
- detection
- probe
- probes
- hybrid
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Definitions
- the present disclosure relates to methods, compositions, and kits for purifying, detecting, and characterizing nucleic acids.
- nucleic acids from the sample are first separated from other macromolecules present in the sample by manipulating various physical properties.
- nucleic acids typically bear a net negative charge at neutral pH, owing to the phosphodiester backbone. This property can be manipulated to separate nucleic acids from other macromolecules using anion exchange resins.
- anion exchange resins As another example, differential solubility of nucleic acids compared to other macromolecules in certain solvents is used to extract nucleic acids from the sample. Numerous other such schemes exist.
- the amount of target nucleic acid relative to the total amount of nucleic acid purified typically is very low. Therefore, some type of amplification is necessary before the target nucleic acid can be detected. Either the amount of specific nucleotide sequence(s) is increased by target amplification methods such as polymerase chain reaction (PCR) or the specific nucleotide sequence(s) is/are reacted with a detectable label and the signal from the label is amplified to detectable levels.
- target amplification methods such as polymerase chain reaction (PCR)
- PCR polymerase chain reaction
- the specific nucleotide sequence(s) is/are reacted with a detectable label and the signal from the label is amplified to detectable levels.
- the present disclosure in aspects and embodiments addresses these various needs and problems by providing a method of detecting at least one target nucleic acid comprising: (1) sequence-specific isolation of a target nucleic acid from a sample; (2) amplifying the isolated target nucleic acid; and (3) detecting the target nucleic acid using a plurality of detectably labeled nucleic acid detection probes, wherein each (a) bears a different detectable label from the other detection probes, and/or (b) has a different melting temperature from probes bearing the same detectable label.
- the present disclosure also relates to kits for use in such a method.
- the method comprises: A. purifying the at least one target nucleic acid by a method comprising: Al . generating a double-stranded nucleic acid hybrid of the at least one target nucleic acid by hybridizing the at least one target nucleic acid to a hybrid probe set comprising at least a first nucleic acid probe specific for the at least one target nucleic acid; A2. separating the double-stranded nucleic acid hybrid from the sample to generate at least one purified nucleic acid; B. amplifying at least a portion of the at least one purified nucleic acid; and C. detecting the target nucleic acid by a method comprising: CI .
- each of the detection probes of the detection probe set bears a detectable label
- Cl(b) at least two of the detection probes of the detection probe set carry the same detectable label
- Cl(c) each of the probes carrying the same detectable label has a melting temperature (T m ) which differs from the other probes with the same label
- T m melting temperature
- the double-stranded nucleic acid hybrid is separated from the sample by a method comprising contacting the double stranded nucleic acid hybrid with a molecule that binds specifically to double-stranded nucleic acid hybrids, preferably an anti- DNA:R A hybrid antibody.
- the target is amplified by a method comprising an isothermal amplification, preferably whole genome amplification.
- the amplified nucleic acids are fragmented prior to the contacting them with the detection probe set.
- the target nucleic acid is specific for a pathogen selected from the group consisting of: Mycobacterium tuberculosis, Streptococcus, Pseudomonas, Shigella, Campylobacter, Salmonella, Respiratory Syncytial Virus A, Respiratory Syncytial Virus B; adenovirus, HSVl, HSV2, Influenza A/B, hMPV, Parainfluenzavirus 1-4, Coronavirus, Rhinovirus, Enterovirus, Bocavirus, cytomegalovirus (CMV), HIV, HlNl, chlamydia, Neisseria gonorrhoeae, Trichomonas vaginalis, Staphylococcus aureus, SARS-associated coronavirus, Escherichia coli, Bacillus anthracis, Ebolavirus, Marburgvirus, Yersinia pestis, Vibrio cholerae, F.
- a pathogen selected from the group
- kits for performing the methods disclosed herein, the kit comprising at least a hybrid probe set and a detection probe set.
- Fig. 1 demonstrates the principle behind TaqMeltTM probes, which may be used with the detection step of the present methods.
- the reactions performed with the probes in one row all share a common label. However, the melting temperature of the probes differs. It is thus possible to identify each probe by means of the differing melting temperatures.
- the probes in column 2 for example all have the same melting temperature but a different label. It is thus possible to identify each probe by means of the different label.
- This format lends itself to single nucleotide polymorphisms ("SNP”) detection by creating probes that detect these SNPs by melting at different temperature than the wild type sequence.
- SNP single nucleotide polymorphisms
- FIG. 2 demonstrates the utility of an exemplary detection probe set in a 12-plex
- FIG. 3 demonstrates how the presently-disclosed methods could be practiced in a closed tube format using the QIAsymphony® system (Qiagen GmbH, Hilden, Germany).
- Fig. 4 demonstrates the multiplex capability of the detection step that is presently disclosed.
- the present disclosure covers methods, compositions, reagents, and kits for determining the presence of at least one target nucleic acid in a sample.
- the methods, compositions, reagents, systems, and kits may be used for clinical diagnostic purposes, including but not limited to the detection and identification of pathogenic organisms and the detection of a genetic predisposition to a particular disease.
- the methods and compositions may be adapted for use in forensic or biodefense applications.
- probe is a nucleic acid which is able to bind another nucleic acid.
- tissue refers to any tissue or fluid in a human, animal or plant including, but not limited to breast, prostate, blood, serum, cerebrospinal fluid, liver, kidney, breast, head and neck, pharynx, thyroid, pancreas, stomach, colon, colorectal, uterus, cervix, bone, bone marrow, testes, brain, neural tissue, ovary, skin, and lung.
- probe set is a set of three or more agents that may interact with a nucleic acid molecule at a specific position, i.e. sequence.
- label is a moiety that is bound covalently or non-covalently to a probe where it can give rise to signal which may be detected by optical or other physical means.
- a method for detecting at least one target nucleic acid in a sample comprising: (1) sequence-specific isolation of the target nucleic acid from a sample; (2) amplifying at least a portion of the isolated target nucleic acid; and (3) detecting the target nucleic acid using a plurality of detectably labeled nucleic acid detection probes, wherein each detection probe: (a) bears a different detectable label from the other detection probes, and/or (b) has a different melting temperature from probes bearing the same detectable label.
- any sample in which nucleic acids may be present may be used as a starting point, including, without limitation: a specimen or culture (e.g., cellular, microbiological and viral cultures) including clinical and laboratory biological samples; environmental samples, such as water, dust, dirt, and air samples; food and agricultural samples; and forensic samples, including semen, hair, blood, skin, and saliva samples.
- Biological samples may be from an animal, including a human, fluid, solid (e.g., stool) or tissue, as well as liquid and solid food and feed products and ingredients such as dairy items, vegetables, meat and meat by-products, and waste.
- Environmental samples include environmental material such as surface matter, soil, water and industrial samples, as well as samples obtained from food and dairy processing instruments, apparatus, equipment, utensils, disposable and non-disposable items.
- the sample may comprise, consist, or consist essentially of nucleic acids that have been extracted from a biological sample.
- Numerous methods are known for extracting nucleic acids from a biological or environmental sample, including but not limited to: phenol/chloroform extraction; anion exchange chromatography; cesium chloride gradient ultracentrifugation; size exclusion chromatography; and silca/chaotropic salt extraction.
- Extracted nucleic acids may be further separated according to size by gel electrophoresis and extracted from the gel if samples comprising specific nucleic acid sizes are desired.
- the methods disclosed herein relate to the detection and/or genotyping of at least one target nucleic acid in a sample.
- the at least one target nucleic acid may be DNA or RNA or both DNA and RNA and can be single-stranded, double-stranded, or partially single-stranded.
- the at least one target nucleic acid can be contained within a larger nucleic acid. Detection of either the at least one target nucleic acid or the larger nucleic acid comprising the at least one target nucleic acid is contemplated by this disclosure.
- the nucleic acid may be naturally occurring or synthetic nucleic acid, including but not limited to: RNA, DNA, cDNA (complementary DNA), LNA (locked nucleic acid), mRNA (messenger RNA), mtRNA (mitochondrial), rRNA (ribosomal RNA), tRNA (transfer RNA), nRNA (nuclear RNA), siRNA (short interfering RNA), snRNA (small nuclear RNA), snoRNA (small nucleolar RNA)1 scaRNA (Small Cajal Body specific RNA), microRNA, dsRNA (doubled-stranded RNA), ribozyme, riboswitch, viral RNA, dsDNA (double-stranded DNA), ssDNA (single-stranded DNA), plasmid DNA, cosmid DNA, chromosomal DNA, viral DNA, mtDNA (mitochondrial DNA), nDNA (nucle
- the at least one target nucleic acids may include, without limitation, nucleic acids found in specimens or cultures (e.g., cellular, microbiological and viral cultures) including biological and environmental samples.
- the at least one target nucleic acids may be found in biological samples from an animal, including a human, fluid, solid (e.g., stool) or tissue, as well as liquid and solid food and feed products and ingredients such as dairy items, vegetables, meat and meat by-products, and waste.
- At least one target nucleic acids may be found in
- environmental samples and include environmental material such as surface matter, soil, water and industrial samples, as well as samples obtained from food and dairy processing instruments, apparatus, equipment, utensils, disposable and non-disposable items.
- the at least one target nucleic acids may be from other viral, bacteria,
- mycobacteria or plasmodia such as Mycobacterium tuberculosis, Streptococcus, Pseudomonas, Shigella, Campylobacter, Salmonella, Respiratory Syncytial Virus A, Respiratory Syncytial Virus B; adenovirus, HSVl, HSV2, Influenza A/B, hMPV Parainfiuenzavirus 1-4, Coronavirus, Rhinovirus, Enterovirus, Bocavirus, cytomegalovirus (CMV), HIV, HlNl, chlamydia, Neisseria gonorrhoeae, Trichomonas vaginalis, Staphylococcus aureus, SARS-associated coronavirus, Escherichia coli, Bacillus anthracis, Ebolavirus, Marburgvirus, Yersinia pestis, Vibrio cholerae, F.
- Mycobacterium tuberculosis such as Mycobacterium tub
- the at least one target nucleic acids are at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98%, at least 99%, or 100% identical to nucleic acids associated with any one of cervical samples (e.g., a sample obtained from a cervical swab) or cervical cell samples, adenoid cells, anal epithelial cells, blood, saliva, cerebral spinal fluid, pleural fluid, milk, lymph, sputum, urine and semen, other viral, bacteria, mycobacteria or plasmodia, for example Mycobacterium tuberculosis, Streptococcus, Pseudomonas, Shigella, Campylobacter, Salmonella, Respiratory Syncytial Virus A, Respiratory Syncytial Virus B; adenovirus, HSVl, HSV2, Influenza A/B, hMPV
- HIV HlNl
- chlamydia Neisseria gonorrhoeae
- Trichomonas vaginalis Staphylococcus aureus
- SARS-associated coronavirus Escherichia coli
- Bacillus anthracis Ebolavirus
- Marburgvirus Yersinia pestis, Vibrio cholerae, F. tularensis, Brucella, Coxiella burnetii, Machupo virus, Coccidioides immitis, Coccidioides posadasii., Burkholderia mallei, Burkholderia pseudomallei, Shigella ssp. bacterium, Rickettsia rickettsii, Rickettsia prowazekii, Chlamydophila psittaci, yellow fever virus, Japanese encephalitis virus, Rift Valley fever virus, Variola major, and Variola minor..
- the at least one target nucleic acid is an HPV nucleic acid.
- the HPV nucleic acid is HPV DNA of a HR-HPV type.
- the HPV nucleic acid is HPV RNA of a LR-HPV type.
- the at least one target nucleic acids are any one of HR-HPV types 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66,
- a plurality of target nucleic acid is targeted.
- the plurality of target nucleic acids consists of a set of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68,
- nucleic acids having distinct nucleotide sequences Any set of nucleic acids to be targeted can be used.
- the plurality of target nucleic acids is selected such that each is related to the others.
- the set of nucleic acids can be: structurally related to one another (for example, members of a gene family);
- nucleic acids encoding proinflammatory cytokines for example, nucleic acids encoding proinflammatory cytokines
- phylogenetically related to one another for example, nucleic acids specific for different members of a family of viruses, such as HPV-family viruses
- related by virtue of differential expression in a different cell or tissue type for example, macrophage-associated nucleic acids and prostate-associated nucleic acids
- disease states cervical cancer associated nucleic acids.
- the set of nucleic acids is unrelated.
- a set of target nucleic acids comprises, consists, or consists essentially of HR-HPV types 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, 68, and 82, or any subset thereof.
- a set of target nucleic acids comprises, consists, or consists essentially of LR-HPV types 2, 3, 6, 7, 10, 11, 13, 27, 28, 30, 32, 40, 42, 43, 53, 54, 55, 61, 62, 67, 69, 70, 71, 72, 74, 81, 83, 84, 85, 86, 87, 89, 90, and 91, or any subset thereof.
- a set of target nucleic acids comprises, consists, or consists essentially of HR-HPV types 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, 68, and 82, or any subset thereof; and LR- HPV types 2, 3, 6, 7, 10, 11, 13, 27, 28, 30, 32, 40, 42, 43, 53, 54, 55, 61, 62, 67, 69, 70, 71, 72, 74, 81, 83, 84, 85, 86, 87, 89, 90, and 91, or any subset thereof.
- the at least one target nucleic acid is at least 70%, at least 80%>, at least 85%>, at least 90%>, at least 95%>, at least 96%, at least 97%, at least 98%, at least 98%, at least 99%, or 100% identical to nucleic acids associated with any one of HPV, genetic variants of HPV, HPV DNA of a HR-HPV type, or HPV RNA of a HR-HPV type.
- the at least one target nucleic acids are at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%), at least 98%>, at least 99%>, or 100% identical to nucleic acids associated with any one of HR-HPV types 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, 68, and 82 or any one of LR-HPV types 2, 3, 6, 7, 10, 11, 13, 27, 28, 30, 32, 40, 42, 43, 53, 54, 55, 61, 62, 67, 69, 70, 71, 72, 74, 81, 83, 84, 85, 86, 87, 89, 90, and 91.
- a target nucleic acid is chosen that is: not more than from 35% to 65% GC AT rich; from 40% to 60% GC rich; from 45% to 55% GC rich; or from 50% to 65% GC rich.
- a target nucleic acid is selected that does not near neighbor, cross- reactive variants or species.
- the sample may be treated with a denaturation reagent to render the at least one target nucleic acid accessible to hybridization.
- a denaturation reagent to render the at least one target nucleic acid accessible to hybridization.
- the sample is denatured with an alkaline solution.
- suitable alkali include NaOH and KOH.
- Alkaline treatment of protein effectively homogenizes the specimen to ensure reproducibility of analysis results for a given sample. It can also reduce the viscosity of the sample to increase kinetics, homogenize the sample, and reduce background by destroying any endogenous single stranded RNA nucleic acids, DNA-RNA hybrids or RNA-RNA hybrids in the sample. It also helps inactivate enzymes such as RNases and DNases that may be present in the sample.
- RNA is the at least one target nucleic acid (as opposed to DNA)
- different reagents may be preferable including, but not limited to phenol extraction and TC A/acetone precipitation, and guanidinium thiocyanate-phenol- chloroform extraction.
- the sequence-specific purification step comprises: (1) generating a double-stranded nucleic acid hybrid of the target nucleic acid by hybridizing at least one nucleic acid probe to the target nucleic acid to specific for the at least one target nucleic acid and (2) separating the double-stranded nucleic acid hybrid from the sample to generate a purified target nucleic acid.
- the sample comprising the nucleic acid is prepared for hybridization, it is contacted with at least one polynucleotide hybrid capture probe under a condition sufficient for the hybrid capture probes to hybridize to its complement.
- the at least one polynucleotide hybrid probe can be full length, truncated, or synthetic DNA or full length, truncated, or synthetic RNA. If the at least one target nucleic acid is DNA, then the at least one polynucleotide hybrid probe may be RNA and if the at least one target nucleic acid is RNA, then the probe may be DNA.
- a single polynucleotide probe is used in the purification step.
- the single polynucleotide hybrid capture probe may be specific for only a single target nucleic acid or may be designed so as to hybridize to a plurality of target nucleic acids under stringent conditions.
- a polynucleotide probe may be designed against a highly conserved region of a genus of related nucleic acids, such that the
- polynucleotide probe would be expected to hybridize under stringent conditions to substantially all nucleic acids of that genus.
- a plurality of polynucleotide probes is used in the purification step.
- the plurality of polynucleotide probes may be specific for only a single target nucleic acid or may be specific for a plurality of target nucleic acids.
- a plurality of polynucleotide probes specific for a single target nucleic acid may be generated by fragmenting the target nucleic acid.
- at least one polynucleotide hybrid probe is provided for each target nucleic acid.
- at least two polynucleotide hybrid probes are provided for each target nucleic acid.
- the polynucleotide hybrid probe is capable of hybridizing or binding to nucleic acids at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98%, at least 99%, or 100% identical to nucleic acids associated with HPV, genetic variants of HPV, HPV DNA of a HR-HPV type, or HPV RNA of a HR-HPV type, or any one of one of HR-HPV types 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, 68, and 82 or any one of LR-HPV types 2, 3, 6, 7, 10, 11, 13, 27, 28, 30, 32, 40, 42, 43, 53, 54, 55, 61, 62, 67, 69, 70, 71, 72, 74, 81, 83, 84, 85, 86, 87, 89, 90, and 91.
- the probe is complementary to HPV, genetic variants of HPV, HPV DNA of a HR-HPV type, HPV RNA of a HR-HPV type, or any one of one of HR-HPV types 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, 68, and 82 or any one of LR-HPV types 2, 3, 6, 7, 10, 11, 13, 27, 28, 30, 32, 40, 42, 43, 53, 54, 55, 61, 62, 67, 69, 70, 71, 72, 74, 81, 83, 84, 85, 86, 87, 89, 90, and 91.
- a plurality of polynucleotide hybrid probes is provided, the plurality being selected to hybridize to and purify each of a set of target nucleic acids.
- the plurality of polynucleotide hybrid probes is capable of hybridizing to each nucleic acid of a set of target nucleic acids consisting of HR-HPV types 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, 68, and 82 nucleic acids, or any subset thereof.
- the plurality of polynucleotide hybrid probes is capable of hybridizing to each nucleic acid of a set of target nucleic acids consisting of LR-HPV types 2, 3, 6, 7, 10, 11, 13, 27, 28, 30, 32, 40, 42, 43, 53, 54, 55, 61, 62, 67, 69, 70, 71, 72, 74, 81, 83, 84, 85, 86, 87, 89, 90, and 91, or any subset thereof.
- the plurality of polynucleotide hybrid probes is capable of hybridizing to each nucleic acid of a set of target nucleic acids consisting of HR-HPV types 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, 68, and 82, or any subset thereof; and LR-HPV types 2, 3, 6, 7, 10, 11, 13, 27, 28, 30, 32, 40, 42, 43, 53, 54, 55, 61, 62, 67, 69, 70, 71, 72, 74, 81, 83, 84, 85, 86, 87, 89, 90, and 91, or any subset thereof.
- the one or more polynucleotide probes may be diluted in a probe diluent that also can act as a neutralizing hybridization buffer (to neutralize the basic denaturation reagent).
- the probe diluent used for DNA or RNA probes may differ due to the different requirements necessary for DNA versus RNA stability. For example, if the probes are RNA, it is preferable to neutralize the sample first and then add the probe or alternatively, add the RNA probe and neutralizing agent (probe diluent) to the sample at the same time as excessive alkalinity can destroy RNA.
- the probe diluent can be used to dissolve and dilute the probe and also help restore the sample to about a neutral pH, e.g., about pH 6 to about pH 9, to provide a more favorable environment for hybridization. Sufficient volume of probe diluent, preferably one-half volume of the sample, may be used to neutralize the base-treated sample.
- a heated alkaline solution may be added to the sample, then probe diluent may be added to the sample at room temperature, and then the sample may be reheated.
- probe diluent may be added to the sample at room temperature, and then the sample may be reheated.
- Such a process can inhibit secondary structure from forming.
- Antibodies tend to irreversibly bind to structures with secondary structure.
- heating the solutions or sample may not be necessary because secondary structures issues are not present.
- the sample is not heated when used with truncated or synthetic probes.
- an aliquot of neutralization buffer in an aspect the probe diluent described, in which the one or more probes are dissolved, can be added to the sample under appropriate conditions to allow hybridization or binding of the probe and the at least one target nucleic acid to occur.
- the neutralization buffer may contain a single buffering salt. In an aspect, the neutralization buffer does not contain more than a single buffering salt.
- the hybridization condition is sufficient to allow the one or more polynucleotide probes to anneal to a corresponding complementary nucleic acid sequence, if present, in the sample to form a double-stranded nucleic acid hybrid.
- Hybridization conditions suitable for the particular probes and diluents described herein are employed.
- the probes and sample nucleic acids can be incubated for a hybridization time, preferably at least about 5 to about 30 minutes, about 5 to about 20 minutes, or from about 7 to about 15 minutes, or about 10 minutes, as well as any number within the recited ranges sufficient to allow the one or more polynucleotide probes to anneal to a corresponding complementary nucleic acid sequence.
- the hybridization condition can include a hybridization temperature of at least about 65°C, about 68.5°C, and about 67°C to about 70°C, as well as any number within the recited ranges.
- hybridization conditions For a given at least one target nucleic acid and a given probe, one of ordinary skill in the art can readily determine desired hybridization conditions by routine experimentation. One of ordinary skill in the art will further appreciate that the time and temperature of hybridization must be optimized, one with respect to the other. Thus, higher hybridization temperatures may be carried out for shorter periods of time and vice versa. Without being limited, stringent hybridization conditions may be controlled by increasing the temperature, increasing the ionic conditions to above 0.5M (for example, NaCl), or reducing the concentration of PAA.
- 0.5M for example, NaCl
- stringent hybridization conditions may include performing a hybridization reaction at elevated temperatures, such as of at least about 65°C, at least about 68.5°C, between about 67°C to about 70°C , and between about 69°C to about 70°C.
- Stringent hybridization conditions may also include elevated temperatures, such as of at least about 65°C, at least about 68.5°C, and between about 67°C to about 70°C.
- the sample is suspended in collection medium, the at least one target nucleic acid is denatured with a denaturation reagent, and hybridized to nucleic acid probes suspended in a neutralizing buffer.
- the neutralizing buffer is the probe diluent.
- the probe diluent comprises 2.2 M BES (N,N-bis(2-hydroxyethyl)-2- aminoethanesulfonic acid), 2.6% polyacrylic acid, 0.7 N NaOH and 0.05% sodium azide.
- hybrid capture refers to a method of isolating and analyzing nucleic acids the generation of DNA:RNA hybrids and isolation of the DNA:RNA hybrid through the use of a molecule that binds specifically to DNA:RNA hybrids.
- Various aspects of hybrid capture are described in: Nazarenko et ah, A novel method of HPV genotyping using Hybrid Capture® sample preparation method combined with GP5+/6+ PCR and multiplex detection on Luminex® XMAP®, Journal of Virological Methods 154 (2008) 76-81; and Nazarenko et al, U.S.
- Molecules specific for the double-stranded nucleic acid hybrids include, but are not limited to, monoclonal antibodies, polyclonal antibodies, proteins such as but not limited to RNAse H, nucleic acids including but not limited to aptamers, or sequence specific nucleic acids. Aptamers are short stretches of random sequences that are successively selected from a library of sequences by hybridizing to a target, amplifying the hybridized aptamers, and repeating the selection process.
- the molecule specific for the double-stranded nucleic acid hybrid is captured by an antibody, known as an anti-hybrid antibody.
- the anti-hybrid antibodies are immobilized onto a support before the double-stranded nucleic acid hybrid is captured.
- Methods of immobilizing antibodies to solid supports are well known in the art.
- the antibodies can be covalently linked to the solid support.
- the antibody can be adsorbed onto the support by, for example, protein- protein interactions, protein-G beads, biotin-streptavidin interaction, ED AC to link to a carboxyl or tosyl group, etc., or hybridization directly onto the solid support using, for example, sequence specific nucleic acids in an affinity column.
- the anti-hybrid antibodies may be complexed with the double- stranded nucleic acid hybrid before being immobilized on the solid support.
- the anti-hybrid antibody may be conjugated with a biotin label, while the support may be conjugated with a streptavidin moiety.
- Anti-hybrid antibody/double-stranded nucleic acid-hybrid complexes can then be allowed in the absence of the solid support.
- the anti-hybrid antibody/double-stranded nucleic acid-hybrid complexes will be immobilized to the solid support by virtue of the interaction between the biotin conjugate and the streptavidin moiety.
- Supports include but are not limited to beads; magnetic beads, including paramagnetic, diamagnetic, ferromagnetic beads, columns, plates, filter paper,
- PDMS polydimethylsiloxane
- dipsticks coated tubes, plates, and dishes; and resin columns.
- Any support can be used as long as it allows extraction of the liquid phase and provides the ability to separate out bound and unbound antibodies.
- Paramagnetic beads are particularly useful in that they can be left in the solution and the liquid phase can be extracted or decanted, if a magnetic field is applied to immobilize the beads.
- Other beads that employ charge switching or silica capture (as opposed to magnetic fields) may be used as well.
- the hybrids are incubated with the anti-hybrid antibody attached to the support for a sufficient amount of time to allow capture of the double-stranded nucleic acid hybrids by the immobilized anti-hybrid antibodies.
- the support is a bead.
- the anti-hybrid antibody may be monoclonal or polyclonal. In one aspect the antibody is monoclonal. In one aspect, the antibody is coupled to support by a l-ethyl-3-[3- dimethylaminopropyl] carbodiimide hydrochloride (ED AC) linker. In one aspect, the support is a polystyrene bead. In an aspect, the support or bead coupled to the antibody is diluted in a bead dilution buffer. The bead dilution buffer is helpful in minimizing protein denaturation on the bead. One example of a bead dilution buffer comprises 6% casein, 100 mM Tris-HCl, 300 mM NaCl, and 0.05% sodium azide.
- a bead dilution buffer comprises 6% casein, 100 mM Tris-HCl, 300 mM NaCl, and 0.05% sodium azide.
- the beads coated with the anti-hybrid antibody are incubated with the sample at about 67°C to about 70°C for about 30 minutes. In another aspect, the beads and sample are incubated at about 68°C to about 69°C for about 30 minutes. In yet another aspect, the beads and sample are incubated at about 68.5°C for 30 minutes.
- the incubation time can range from about 5 minutes to about 60 minutes, from about 15 minutes to about 45 minutes, from about 20 minutes to about 40 minutes, or any number within the recited ranges, and is generally inversely proportional to the temperature. It will be understood by those skilled in the art that the incubation time, temperature and/or shaking conditions can be varied to achieve alternative capture kinetics as desired.
- the captured hybrid may be separated from the rest of the sample by washing away of non-captured nucleic acids.
- the at least one target nucleic acid is purified, it is amplified. Amplification is performed at this time to increase the sensitivity of the method by increasing the amount of the at least one target nucleic acid.
- Various amplification methods may be applied, these are for example, rolling circle amplification (such as in Liu, et al., “Rolling circle DNA synthesis: Small circular oligonucleotides as efficient templates for DNA polymerases," J. Am, Chem. Soc. 118: 1587- 1594 (1996).), isothermal amplification (such as in Walker, et al., “Strand displacement amplification-an isothermal, in vitro DNA amplification technique", Nucleic Acids Res.
- Ligase chain reaction such as in Landegren, et al., 11A Ligase-Mediated Gene Detection Technique," Science 241 : 1077-1080, 1988, or, in Wiedmann, et ai., “Ligase Chain Reaction (LCR) ⁇ Overview and Applications,” PCR Methods and Applications (Cold Spring Harbor Laboratory Press, Cold Spring Harbor Laboratory, NY1 1994) pp. S51-S64.).
- Nucleic acid amplifications can be broadly separated into two categories:
- the temperature typically is raised above the melting point of the target nucleic acid to "melt" any double stranded portions, and then lowered to a point at which oligonucleotide primers anneal with a single stranded portion of the target nucleic acid, then raised again to a temperature at which the primers remain annealed and the polymerase is active.
- an agent is added to the reaction mixture to permit amplification without temperature cycling.
- an enzyme having helicase activity is added to the amplification mixture.
- helicase or “an enzyme with, or having, helicase activity” refers to any enzyme capable of unwinding a double stranded nucleic acid. The helicase functions to unwind double stranded nucleic acids, thus obviating the need for repeated melting cycles.
- Examplary helicases include E.
- Additional helicases that may be useful include RecQ helicase, thermostable UvrD helicases from T. tengcongensis and T. thermophilus, thermostable DnaB helicase from T. aquaticus, and MCM helicase from archaeal and eukaryotic organisms.
- nick-initiated amplification a nick-inducing agent is used to induce breaks in the phosphodiester bonds of the nucleic acid backbone.
- a polymerase having strand displacement activity can then initiate amplification at the site of the nick, using one strand of the nucleic acid as a primer and the other strand as a template.
- nick-inducing agent refers to any enzymatic or chemical reagent or physical treatment that introduces breaks in the phosphodiester bond between two adjacent nucleotides in one strand of a double-stranded nucleic acid. Examples of nick-inducing enzymes include BpulO I, BstNB I, Alw I, BbvC I, BbvC I, Bsm I, BsrD, and E. coli endonuclease I.
- the amplification in the disclosed methods can be either a temperature cycled amplification or an isothermic amplification.
- Exemplary methods of amplification include, but are not limited to: polymerase chain reaction (“PCR"), reverse transcriptase (“RT”) reaction, RT- PCR, HDA, RT-HDA, thermophilic helicase-dependent amplification (“tHDA”), RT-tHDA, whole genome amplification (“WGA”), RT-WGA, ligase chain reaction (“LCR”), RT-LCR, NIA, and RT-NIA.
- Amplification reactions can further be separated into sequence-dependent or sequence-independent amplifications.
- Sequence-dependent amplification refers to specific amplification of a target sequence relative to non-target sequences present in a sample with the use of target-specific primers.
- target-specific primer refers to a single stranded nucleic acid capable of binding to a pre-determined single stranded region on a target nucleic acid to facilitate polymerase dependent replication of the target nucleic acid to be selectively amplified.
- the amplification is a sequence-specific amplification.
- a pair of target-specific primers one hybridizing to the 5 '-flank of a target sequence within each target nucleic acid and the other hybridizing to the 3 '-flank of the target sequence, are used to achieve exponential amplification of the target sequence.
- all of the target nucleic acids comprise a variable region that is sought to be genotyped and where the variable region is flanked on both sides by conserved regions.
- multiple pairs of target-specific primers are utilized in a single reaction for amplifying multiple targets nucleic acids simultaneously.
- target-specific primer pairs are short synthetic
- oligonucleotides for example having a length of more than 10 nucleotides and less than 50 nucleotides.
- Target-specific, oligonucleotide primer design involves various parameters such as string-based alignment scores, melting temperature, primer length and GC content.
- string-based alignment scores such as string-based alignment scores, melting temperature, primer length and GC content.
- a target-specific primer one of the important factors is to choose a sequence within the target fragment that is specific to the nucleic acid molecule to be amplified.
- Another important factor is to calculate the melting temperature of a target-specific primer for the reaction.
- the melting temperature of a target-specific primer is determined by the length and GC content of that oligonucleotide. In one aspect, the melting temperature of the primer is about 10° to 30°C higher than the temperature at which primer hybridization and target amplification will take place.
- Primer hybridization refers to binding of an oligonucleotide primer to a region of the single-stranded nucleic acid template under the conditions in which the primer binds only specifically to its complementary sequence on one of the template strands, not other regions in the template.
- the specificity of hybridization may be influenced by the length of the oligonucleotide primer, the temperature in which the hybridization reaction is performed, the ionic strength, and the pH of the reaction mixture.
- Each target-specific primer hybridizes to each end of the target nucleic acid and may be extended in a 3' ⁇ 5' direction by a polymerase using the target nucleotide sequence as a template.
- a homologous or perfect match target-specific primer is preferred.
- target-specific primers may include sequences at the 5 ' end which are non-complementary to the target nucleotide sequence(s).
- target-specific primers may contain nucleotides or sequences throughout that are not exactly complementary to the target nucleic acid.
- the target-specific primers may include any of the deoxyribonucleotide bases A,
- T, G or C and/or one or more ribonucleotide bases A, C, U, G and/or one or more modified nucleotide (deoxyribonucleotide or ribonucleotide) wherein the modification does not prevent hybridization of the primer to the nucleic acid or elongation of the target-specific primer or denaturation of double stranded molecules.
- Target-specific primers may be modified with chemical groups such as phosphorothioates or methylphosphonates or with non nucleotide linkers to enhance their performance or to facilitate the characterization of amplification products.
- the temperature of denaturation suitable for permitting specificity of target-specific primer-template recognition and subsequent annealing may occur over a range of temperatures, for example 20°C to 75°C.
- a preferred denaturation temperature may be selected according to which helicase is selected for the melting process. Tests to determine optimum temperatures for amplification of a nucleic acid in the presence of a selected helicase can be determined by routine experimentation by varying the temperature of the reaction mixture and comparing amplification products using gel electrophoresis.
- amplification is a sequence-independent amplification.
- sequence-independent amplification refers to any amplification that does not amplify a specific sequence.
- random primer mixtures or nick-inducing agents may be used to initiate sequence-independent amplification.
- random primer mixture refers to mixtures of short randomly generated oligonucleotide sequences.
- nick-initiated polymerase activity refers to polymerase activity in the absence of exogenous primers, which is initiated by single-strand breaks in the template. Synthesis initiates at the single-strand break in the DNA, rather than at the terminus of an exogenous synthetic primer. With nick-initiated synthesis, removal of primers is unnecessary, reducing cost, handling time and potential for loss or degradation of the product. In addition, nick-initiated synthesis reduces false amplification signals caused by self-extension of primers. The nicks may be introduced at defined locations, by using enzymes that nick at a recognition sequence, or may be introduced randomly in a target polynucleotide.
- nick- inducing agent refers to any enzymatic or chemical reagent or physical treatment that introduces breaks in the phosphodiester bond between two adjacent nucleotides in one strand of a double- stranded nucleic acid.
- nick-inducing enzymes include BpulO I, BstNB I, Alw I, BbvC I, BbvC I, Bsm I, BsrD, and E. coli endonuclease I.
- at least one nick- inducing enzyme is included as a replacement for a helicase in a reaction mixture.
- at least one nick-inducing enzyme is added to a reaction mixture in addition to at least one helicase.
- the amplification is an isothermic amplification.
- the isothermic amplification is a Whole Genome Amplification ("WGA").
- WGA is an isothermal process that uses non-specific primers to generate amplicons using the target nucleic acid sequence as a template. As multiple random primers are used, substantially the entire molecule comprising the target nucleic acid can be amplified using WGA.
- Phi 29 DNA polymerase can be used in combination with non-specific primers to amplify target nucleic acid sequences. The polymerase can move along the target nucleic acid sequence displacing the complementary strand.
- the WGA reaction is nodified to include at least one helicase, at least one nick-inducing agent, or both.
- WGA is described in, Nazarenko et al., US 7,601,497, which is hereby incorporated by reference in its entirety.
- the target nucleic acid is detected from the pool of amplified nucleic acids by (1) contacting it with at least one detection probe set comprising a plurality of polynucleotide detection probes under a condition sufficient for each of the detection probes to hybridize to its complement; (2) detecting hybridization of at least one of the polynucleotide detection probes; and (3) determining the melting temperature of (T m ) of the polynucleotide detection probe hybridized to the target nucleic acid.
- the polynucleotide detection probes of the detection probe set can be full length, truncated, or synthetic DNA or full length, truncated, or synthetic RNA.
- the at least one capture probe may be DNA, RNA, synRNA, or PNA, regardless of the identity of the at least one target nucleic acid.
- the polynucleotide detection probes should be detectably labeled or adapted so that they may accept a detectable label. Additionally, the detection probe set should be constituted so that: (1) at least two of the plurality of detection probes bear the same detectable label; (2) at least two of the plurality of detection probes bear different detectable labels; and (3) any of the plurality of detection probes bearing the same detectable label have different melting temperatures (T m ).
- Hybridization conditions suitable for the particular probes and diluents described herein are employed.
- the probes and sample nucleic acids can be incubated for a hybridization time, preferably at least about 5 to about 30 minutes, about 5 to about 20 minutes, or from about 7 to about 15 minutes, or about 10 minutes, as well as any number within the recited ranges sufficient to allow the one or more polynucleotide probes to anneal to a corresponding complementary nucleic acid sequence.
- the hybridization condition can include a hybridization temperature of at least about 65°C, about 68.5°C, and about 67°C to about 70°C, as well as any number within the recited ranges.
- hybridization conditions For a given at least one target nucleic acid and a given probe, one of ordinary skill in the art can readily determine desired hybridization conditions by routine experimentation. One of ordinary skill in the art will further appreciate that the time and temperature of hybridization must be optimized, one with respect to the other. Thus, higher hybridization temperatures may be carried out for shorter periods of time and vice versa. Without being limited, stringent hybridization conditions may be controlled by increasing the temperature, increasing the ionic conditions to above 0.5M (for example, NaCl), or reducing the concentration of PAA.
- 0.5M for example, NaCl
- stringent hybridization conditions may include performing a hybridization reaction at elevated temperatures, such as of at least about 65°C, at least about 68.5°C, between about 67°C to about 70°C , and between about 69°C to about 70°C.
- Stringent hybridization conditions may also include elevated temperatures, such as of at least about 65°C, at least about 68.5°C, and between about 67°C to about 70°C.
- All probes used herein may be short synthetic R A probes that specifically bind only to the at least one target nucleic acid. Examples are described in U.S. Pat. Appl. No. 12/426,076, filed on April 17, 2009, the contents of which are incorporated herein by reference in its entirety.
- the detection step comprises: (1) contacting the amplified nucleic acids with a detection probe set comprising at least four detection probes, wherein (a) each of the detection probes is specific for a nucleic acid sequence; (b) at least two of the detection probes carry the same label; and (c) each of the probes that carry the same label has a melting temperature (T m ) which differs by at least 2°C from the other probes with the same label when they are dissociated from their target nucleic acid sequence by heating; (2) detecting the target nucleic acid by determining whether a labeled probe has bound its nucleic acid sequence; and (3) detecting the temperature at which each given labeled probe dissociates from the nucleic acid sequence to which it has bound.
- T m melting temperature
- the detection probe set comprises at least four detection probes, wherein at least two detection probes carry the same label.
- the detection probe set comprises at least four detection probes, wherein at least three detection probes carry the same label. [0082] In another embodiment, the detection probe set comprises at least five detection probes, wherein at least two detection probes carry the same label.
- the detection probe set comprises at least five detection probes, wherein at least three detection probes carry the same label.
- the detection probe set comprises at least five detection probes, wherein at least four detection probes carry the same label.
- the detection probe set comprises at least six detection probes, wherein at least two detection probes carry the same label.
- the detection probe set comprises at least six detection probes, wherein at least three detection probes carry the same label.
- the detection probe set comprises at least six detection probes, wherein at least four detection probes carry the same label.
- the detection probe set comprises at least seven detection probes, wherein at least two detection probes carry the same label.
- the detection probe set comprises at least seven detection probes, wherein at least three detection probes carry the same label.
- the detection probe set comprises at least seven detection probes, wherein at least four detection probes carry the same label.
- the detection probe set comprises at least eight detection probes, wherein at least two detection probes carry the same label.
- the detection probe set comprises at least eight detection probes, wherein at least three detection probes carry the same label.
- the detection probe set comprises at least eight detection probes, wherein at least four detection probes carry the same label.
- the labels of the detection probes may be fluorescent labels. Where fluorescent labels are used, two or more labels shall be deemed "the same label" when they have maximum emission wavelengths that differ by 0°C to about 10°C.
- detection probes with the same label have melting temperatures that differ by at least about 2°C, at least about 5°C, from about 5° to about 10°C, from about 5°C to about 8°C, from about 5°C to about 7°C, from about 5° to about 6°C.
- melting temperatures that differ by at least about 2°C, at least about 5°C, from about 5° to about 10°C, from about 5°C to about 8°C, from about 5°C to about 7°C, from about 5° to about 6°C.
- the term "about” is to be understood as to include deviations of up to +/- 10 % of the temperature value.
- the detection step comprises: (1) contacting the amplified nucleic acids with at least two detection probe sets, wherein (a) each detection probe set consists of at least three detection probes, (b) each of the detection probes is specific for a nucleic acid sequence, (c) each of the detection probes in a given detection probe set carries a different label, and (d) all of the detection probes in a given detection probe set have a similar or identical melting temperature (T m ) when they are dissociated from their target nucleic acid sequence by heating; (2) detecting the amplified nucleic acids by determining whether the labeled detection probe has bound its nucleic acid sequence; and (3) detecting the temperature at which each given labeled detection probe dissociates from the nucleic acid sequence to which it has bound.
- T m melting temperature
- the method comprises at least three detection probe sets, wherein each detection probe set consists of at least three detection probes.
- a detection probe set comprises at least 3 detection probes.
- a detection probe set may be seen as all those detection probes that share a common label but also as all those detection probes that share a common melting temperature (Tm).
- Tm melting temperature
- the detection probes in a detection probe set that have the same label or labels that are not distinguishable from one another have different melting temperatures.
- the detection probes in a detection probe set that have identical or very similar melting temperatures should have different labels.
- multiplex detection of 20 different target nucleic acids may be performed in a single reaction.
- 5 different labels are used and all the detection probes that share a common label have a slightly varying melting temperature. All the detection probes that share a common melting temperature on the other hand have a different label.
- this "detecting the amplified nucleic acids by determining whether the labeled probe has bound its nucleic acid sequence", and “detecting the temperature at which each given labeled probe dissociates from the nucleic acid sequence to which it has bound” may be done at the end of given reaction or during the reaction.
- the labels of the detection probes in the first and second or further detection probe sets are fluorescent labels and have an emission wavelength that is very similar. Ideally, that means they may be detected without altering the wavelength adjustment that may be detected by the detection device. It is preferred that the labels of the probes in the first, second and third or further detection probe set are identical.
- the labels are fluorescent labels selected from the group of FAM (5-or 6-carboxyfiuorescein), VIC, NED, Fluorescein, FITCl 1RD-700/800, CY3, CY5, CY3.5, CY5.5, HEX, TET, TAMRA1 JOE, ROX, BODIPY TMR, Oregon Green, Rhodamine Green, Rhodamine Red, Texas Red, Yakima Yellow, Alexa Fluor PET, Biosearch BlueTM, Marina Blue®, Bothell Blue®, Alexa Fluor® 350 FAMTM, SYBR® Green 1 , Fluorescein, EvaGreenTM, Alexa Fluor® 488 JOETM, VICTM, HEXTM, TETTM, CAL Fluor® Gold 540, Yakima Yellow®, ROXTM, CAL Fluor® * Red 610, Cy3.5TM, Texas Red®, Alexa Fluor® 568 Cy5TM, QuasarTM 670, LightCycler Red640®, Alexa
- the probes carrying the same label differ in melting
- T m melting temperature in a way that they are distinguishable by melting point on a given instrument, typically harboring a difference in melting temperature of more than 0.1 °C, 0.2°C, 0.3°C1 0.4°C, 0.5°C, 1°C, 1.5°C, 2°C, 2.5°C, 3°C, 4°C, 5°C, 6°C, 7°C, 8°C, 9°C, or 10°C. More than 1°C, 1.5°C, 2°C, 2.5°C, 3°C, 4°C, 5°C is preferred.
- the melting transitions of the double stranded segments can be determined by monitoring fluorescence intensity of double stranded nucleic acid- specific (dsNAS) dyes.
- the double stranded nucleic acid-specific dye is selected from the group consisting of SYBR® Green I, SYBR® Gold, ethidium bromide, propidium bomide, Pico Green, Hoechst 33258, YO-PRO-I and YO-YO-I, SYTO®9, LC Green®, LC Green® Plus+, EvaGreenTM.
- These saturation dyes are capable of existing at sufficiently saturating conditions with respect to the DNA during or after amplification, while minimizing the inhibition of PCR.
- the dsDNA binding dye has a percent saturation of at least 50%. In other embodiments, the percent saturation is at least 80%.
- the percent saturation is at least 99%. It is understood that the percent saturation is the percent fluorescence compared to fluorescence of the same dye at saturating concentrations. Saturating concentration is the concentration that provides the highest fluorescence intensity possible in the presence of a predetermined amount of dsDNA. Because these dyes can be present at significantly higher concentrations without significantly interfering with certain nucleic acid reactions, these dyes may be particularly useful for monitoring the conformation of single- stranded nucleic acids and dsDNA.
- Detection probes may be specific for various targets, such as disease markers, pathogens, forensic markers or any other target that may be addressed by means of amplification.
- the method disclosed herein is particularly suited for the analysis of pathogens.
- the primers and probes are specific for one or more pathogenic bacteria or viruses.
- Pathogenic bacteria contribute to other globally important diseases, such as pneumonia, which can be caused by bacteria such as Streptococcus and Pseudomonas, and foodborne illnesses, which can be caused by bacteria such as Shigella, Campylobacter and Salmonella. [00108] Pathogenic bacteria also cause infections such as tetanus, typhoid fever, diphtheria, syphilis and leprosy.
- One of the primary pathways by which food or water become contaminated is from the release of untreated sewage into a drinking water supply or onto cropland, with the result that people who eat or drink contaminated sources become infected. In developing countries most sewage is discharged into the environment or on cropland. This is the typical mode of transmission for the infectious agents of cholera, hepatitis A, polio and rotavirus.
- Pvhinovirus Parainfluenza Viruses (PIV1-3), Influenza A and Influenza B, Adenovirus B as well as Respiratory Syncytial Virus A and B.
- Marburgvirus Marburgvirus, Yersinia pestis, Vibrio cholerae, F. tularensis, Brucella, Coxiella burnetii, Machupo virus, Coccidioides immitis, Coccidioides posadasii. , Burkholderia mallei,
- Burkholderia pseudomallei Shigella ssp. bacterium, Rickettsia rickettsii, Rickettsia prowazekii, Chlamydophila psittaci, yellow fever virus, Japanese encephalitis virus, Rift Valley fever virus, Variola major, and Variola minor.
- the target nucleic acid is at least one genomic or plasmid marker specific for pathogens that may be useful as bioweapons.
- the target nucleic acid is at least one marker specific for B. anthracis (BA), Y. pestis (YP), or F. tularensis (FT).
- the target nucleic acid is at least one ciprofloxacin resistance target. Exemplary targets are set forth in table 1.
- a detection probe set comprising, consisting, or consisting essentially of: (1) at least one detection probes specific for a ciprofloxacin resistance target selected from the group consisting of gyrA, gyrB-1, gyrB-2, parC, and parE; and (2) at least one detection probes specific for a genomic or plasmid target selected from the group consisting of capB2, capB4, pXOl, pX02, PLA, PIM, CAF1, tul4, and fopA.
- a detection probe set comprising, consisting essentially of, or consisting of at least one detection probes specific for each of gyrA, gyrB-1, gyrB-2, parC, parE, capB2, capB4, pXOl, pX02, PLA, PIM, CAF1, tul4, and fopA.
- the amplification step may comprise whole genome
- amplification which typically results in amplicons greater than 10 kilobases in length.
- probe-based detection requires a much shorter amplicon, typically from 100 to 250 bases in length.
- amplicons typically from 100 to 250 bases in length.
- many methods of doing so are known in the art including, without limitation: use of enzymatic methods of fragmenting DNA such as the use of DNase I with Mn 2+ cofactor (Anderson, S., Nucleic Acids Research, 1981, Vol. 9, No. 13 3015-3027, which is hereby incorporated by reference) and partial digestion using various restriction enzymes (Sambrook, J., Fritsch, E.F., and Maniatis, T., 1989, Molecular Cloning: A laboratory manual, 2 nd Ed., p. 5.2-5.95, 9.32, Cold Spring Harbor Laboratory Press, New York, which is hereby incorporated by reference); incorporation of random ribonucleoside
- the amplified nucleic acids are fragmented before detection.
- Uracil DNA glycosylase uracil-N-glycosylase
- Uracil DNA glycosylase is the product of the Escherichia coli ung- gene, and has been cloned, sequenced and expressed in E. coli.
- Uracil DNA glycosylase UDG removes these uracil residues from DNA (single- and double- stranded) without destroying the DNA sugar-phosphodiester backbone, thus preventing its use as a hybridization target or as a template for DNA polymerases.
- the resulting abasic sites are susceptible to hydrolytic cleavage at elevated temperatures.
- removal of uracil bases is usually accompanied by fragmentation of the DNA.
- the person skilled in the art knows how to use the Uracil DNA glycosylase in order to avoid contamination.
- Real-time PCR requires an instrumentation platform that consists of a thermal cycler, a computer, optics for fluorescence excitation and emission collection, and data acquisition and analysis software.
- instrumentation platform that consists of a thermal cycler, a computer, optics for fluorescence excitation and emission collection, and data acquisition and analysis software.
- These machines available from several manufacturers, differ in sample capacity (some are 96-well or 384-well standard plate format, others process fewer samples or require specialized glass capillary tubes, some have block format, others a carousel), method of excitation (some use lasers, others broad spectrum light sources with tunable filters or one or more diodes), detection (some use a camera, others a photo multiplier tube, or types of light detection system) and overall sensitivity.
- method of excitation some use lasers, others broad spectrum light sources with tunable filters or one or more diodes
- detection some use a camera, others a photo multiplier tube, or types of light detection system
- overall sensitivity There are also platform
- a kit comprising: (1) at least one hybrid capture component selected from the group consisting of: at least one hybrid capture probe; an anti-DNA-RNA hybrid antibody; and a solid support; and (2) a detection probe set comprising at least four, at least five, or at least six detection probes.
- the kit comprises at least four detection probes, wherein at least two detection probes carry the same label.
- the kit comprises at least four detection probes, wherein at least three detection probes carry the same label.
- the kit comprises at least five detection probes, wherein at least two detection probes carry the same label.
- the kit comprises at least five detection probes, wherein at least three detection probes carry the same label.
- the kit comprises at least five detection probes, wherein at least four detection probes carry the same label.
- the kit comprises at least six detection probes, wherein at least two detection probes carry the same label.
- the kit comprises at least six detection probes, wherein at least three detection probes carry the same label.
- the kit comprises at least six detection probes, wherein at least four detection probes carry the same label.
- the kit comprises at least seven detection probes, wherein at least two detection probes carry the same label.
- the kit comprises at least seven detection probes, wherein at least three detection probes carry the same label. [00129] In another embodiment the kit comprises at least seven detection probes, wherein at ieast four detection probes carry the same label.
- the kit comprises at least eight detection probes, wherein at least two detection probes carry the same label
- the kit comprises at least eight detection probes, wherein at least three detection probes carry the same label.
- the kit comprises at least eight probes, wherein at least four probes carry the same label.
- a kit comprising at least 6 probes which are able to hybridize, under stringent conditions, to one or more nucleic acid molecules, wherein a) a first group of at least three probes carries a first label and all the probes in this group differ with respect to their melting temperature and b) a second group of at least three probes carries a second label and all the probes in this group differ with respect to their melting temperature.
- a kit comprising at least 9 probes which are able to hybridize, under stringent conditions, to one or more nucleic acid molecules, wherein (a) a first group of at least two probes carries a first label and all the probes in this group differ with respect to their melting temperature, (b) a second group of at least two probes carries a second label and (c) a third group of at least two probes carries a third label, and all the probes in this group differ with respect to their melting temperature and at least a third group of at least two probes carries a third label and all the probes in this group differ with respect to their melting temperature.
- the probes that differ with respect to their melting temperature (Tm) differ by at least 0.5°C, 1 °C, 1.5°C, 2°C, 2.5°C, 3°C, 4°C, 5°C, 6°C, 7°C, 8°C, 9°C, or 10°C. More than 1°C, 1.5°C, 2°C, 2.5°C, 3°C, 4°C, 5°C is preferred, ideally the probes differ by about 5°C.
- the phrase "about” includes all temperatures roundable to the indicated temperature.
- the probes that have the same label have fixed intervals of difference in melting temperature (Tm), selected in a way that they are reliably distinguishable by melting analysis, for example such as 5°C.
- T m melting temperature
- the probes that are, for example, fluorescein labeled would have a melting temperature (T m ) of, e.g. 40°C, 45°C, 50°C and 55°C.
- the kit additionally comprises a buffer, nucleotides and one or enzymes, such as a polymerase.
- the kit may be adapted as a premix, wherein the user only needs to add the probe.
- the kit may used for human or veterinary diagnosis, for testing food or water, for forensic applications, for biodefense applications, or for scientific purposes.
- kits for the detection of at least one target nucleic acid in a sample comprising, consisting of, or consisting essentially of:
- a paramagnetic bead adapted so as to bind the anti-hybrid antibody
- a reagent for fragmenting amplified nucleic acids optionally, a reagent for fragmenting amplified nucleic acids.
- a plurality of hybrid capture probes and a plurality of detection probe sets are provided with the kit.
- the kit may also include instructions for describing procedures associated with the disclosed methods and assays.
- the kit may also include a means for transcribing patient information.
- the means includes paper, a computer, or a device capable of transmitting patient information.
- the kit can include all the necessary components to complete the methods at the same location where the patient sample is taken.
- the kit may include color coded reagents associated with the detection assay.
- the reagent vials are color coded for ease of use and can be included in a kit.
- the reagent bottles may also be identified by symbols, letters, or other known identifiers.
- kits As the individual components of the kit come together in an easy to use platform, one advantage of the kit described herein is that it provides for immediate testing of samples. This allows for rapid determination of patient results.
- methods of the disclosure can include the collection, processing, and performing the purifying step on patient samples in the field.
- some of the method steps are conducted at the same location where the patient samples are collected.
- the location may be a village, clinic, laboratory, or communal area where individuals receive medical checkups and evaluations.
- the location may be permanent or temporary.
- the nucleic acid is detected at a location, such as a laboratory or clinic, which is different from where the samples are taken.
- the kit is designed for use in a developing country or geographical areas where access to medical care is not readily available.
- ALB Short(18bp) MK (SEQ ID NO. 9) AAG TGA CAG AGT CAC CAA
- PEc-myc-for (SEQ ID NO. 10) TCA AGA GGT GCC ACG TCT CC
- PEc-myc-rev (SEQ ID NO. 11) TCT TGG CAG CAG GAT AGT CCT T
- PEc-mycPro MK (SEQ ID NO. 12) CAG CAC AAC TAC GCA GCG CCT CC
- TBP HE rev (SEQ ID NO. 17) TGA TCT CCT TGC CAA TGG TGT A
- TBP MK (SEQ ID NO. 18) AGATGCTGCCAATAACTATGCCCGAGG
- PCR product was generated using cDNA from human leucocytes and the respective for and rev primers for each target shown in Table 7, PCR product was purified using QiaQuick (Qiagen) PCR purification Kit and used at 1 : 1000 dilution. Templates were added to the individual reactions as given in Table 8:
Abstract
Description
Claims
Priority Applications (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU2011255638A AU2011255638B2 (en) | 2010-05-19 | 2011-05-18 | Methods and compositions for sequence-specific purification and multiplex analysis of nucleic acids |
JP2013511335A JP2013528049A (en) | 2010-05-19 | 2011-05-18 | Methods and compositions for sequence-specific purification and multiplex analysis of nucleic acids |
EP11723212A EP2572001A2 (en) | 2010-05-19 | 2011-05-18 | Methods and compositions for sequence-specific purification and multiplex analysis of nucleic acids |
CA2799200A CA2799200A1 (en) | 2010-05-19 | 2011-05-18 | Methods and compositions for sequence-specific purification and multiplex analysis of nucleic acids |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US34621810P | 2010-05-19 | 2010-05-19 | |
US61/346,218 | 2010-05-19 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2011146629A2 true WO2011146629A2 (en) | 2011-11-24 |
WO2011146629A3 WO2011146629A3 (en) | 2012-05-31 |
Family
ID=44626680
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2011/037012 WO2011146629A2 (en) | 2010-05-19 | 2011-05-18 | Methods and compositions for sequence-specific purification and multiplex analysis of nucleic acids |
Country Status (6)
Country | Link |
---|---|
US (1) | US9422593B2 (en) |
EP (1) | EP2572001A2 (en) |
JP (2) | JP2013528049A (en) |
AU (1) | AU2011255638B2 (en) |
CA (1) | CA2799200A1 (en) |
WO (1) | WO2011146629A2 (en) |
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JP2015507931A (en) * | 2012-02-14 | 2015-03-16 | グレート ベイスン サイエンティフィック | Isothermal amplification using block primers |
RU2551208C1 (en) * | 2014-04-22 | 2015-05-20 | Федеральное казенное учреждение здравоохранения Волгоградский научно-исследовательский противочумный институт Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека | SET OF OLIGONUCLEOTIDE PRIMERS AND FLUORESCENTLY LABELLED PROBE FOR IDENTIFICATION OF Burkholderia mallei AND ITS DIFFERENTIATION FROM Burkholderia pseudomallei |
US9732080B2 (en) | 2006-11-03 | 2017-08-15 | Vertex Pharmaceuticals Incorporated | Azaindole derivatives as CFTR modulators |
WO2022087209A1 (en) * | 2020-10-22 | 2022-04-28 | Neogen Corporation | Methods of detecting listeria from an environmental sample |
EP3957755A4 (en) * | 2020-03-20 | 2023-01-25 | Anbio (Xiamen) Biotechnology Co., Ltd. | Novel coronavirus nucleic acid rapid hybridization capture immunofluorescence detection kit, and preparation method and detection method |
Families Citing this family (14)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US8288520B2 (en) | 2008-10-27 | 2012-10-16 | Qiagen Gaithersburg, Inc. | Fast results hybrid capture assay and system |
US9689047B2 (en) * | 2010-01-29 | 2017-06-27 | Qiagen Gaithersburg Inc. | Methods and compositions for sequence-specific purification and multiplex analysis of nucleic acids |
US9476095B2 (en) | 2011-04-15 | 2016-10-25 | The Johns Hopkins University | Safe sequencing system |
CN107326085B (en) | 2012-02-03 | 2022-05-03 | 加州理工学院 | Encoding and decoding of signals in multiplexed biochemical assays |
US9791372B2 (en) | 2012-08-03 | 2017-10-17 | California Institute Of Technology | Multiplexing and quantification in PCR with reduced hardware and requirements |
EP2912468B1 (en) | 2012-10-29 | 2018-09-12 | The Johns Hopkins University | Papanicolaou test for ovarian and endometrial cancers |
US20140273181A1 (en) | 2013-03-15 | 2014-09-18 | Biofire Diagnostics, Inc. | Compact optical system for substantially simultaneous monitoring of samples in a sample array |
US11286531B2 (en) | 2015-08-11 | 2022-03-29 | The Johns Hopkins University | Assaying ovarian cyst fluid |
KR101752152B1 (en) | 2015-09-21 | 2017-06-30 | 대한민국 | PNA probe for detecting Bacillus anthracis having resistance against ciprofloxacin antibiotic and the uses thereof |
CN109601008B (en) | 2016-04-01 | 2023-02-28 | 克罗玛科德公司 | Competitive probes for engineered signal generation |
WO2017218777A1 (en) | 2016-06-17 | 2017-12-21 | California Institute Of Technology | Nucleic acid reactions and related methods and compositions |
BR112020002555A2 (en) | 2017-08-07 | 2020-08-11 | The Johns Hopkins University | methods and materials to assess and treat cancer |
CN110628927B (en) * | 2019-11-13 | 2024-01-30 | 上海市食品药品检验研究院 | Burkholderia detection method based on gyrB gene sequence |
CN112280901B (en) * | 2020-11-11 | 2021-05-14 | 浙江恒驭生物科技有限公司 | Application of improved nucleic acid detection technology in preparation of virus detection kit |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7601497B2 (en) | 2000-06-15 | 2009-10-13 | Qiagen Gaithersburg, Inc. | Detection of nucleic acids by target-specific hybrid capture method |
WO2009135832A1 (en) | 2008-05-06 | 2009-11-12 | Qiagen Gmbh | Simultaneous detection of multiple nucleic acid sequences in a reaction |
Family Cites Families (153)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4732847A (en) | 1981-06-09 | 1988-03-22 | University Of Hawaii | Monoclonal antibodies for DNA-RNA hybrid complexes and their uses |
FI63596C (en) | 1981-10-16 | 1983-07-11 | Orion Yhtymae Oy | MICROBIA DIAGNOSIS FOERFARANDE SOM GRUNDAR SIG PAO SKIKTSHYBRIDISERING AV NUCLEINSYROR OCH VID FOERFARANDET ANVAENDA KOMBINATIONER AV REAGENSER |
US4486536A (en) | 1982-05-28 | 1984-12-04 | Smithkline Diagnostics, Inc. | Specimen slide for occult blood testing |
US4865980A (en) | 1982-12-29 | 1989-09-12 | University Of Hawaii | Monoclonal antibodies for DNA-RNA hybrid complexes and their uses |
WO1984002721A1 (en) | 1983-01-10 | 1984-07-19 | Gen Probe Inc | Method for detecting, identifying, and quantitating organisms and viruses |
US5288611A (en) | 1983-01-10 | 1994-02-22 | Gen-Probe Incorporated | Method for detecting, identifying, and quantitating organisms and viruses |
US5200313A (en) | 1983-08-05 | 1993-04-06 | Miles Inc. | Nucleic acid hybridization assay employing detectable anti-hybrid antibodies |
EP0144914A3 (en) | 1983-12-12 | 1986-08-13 | Miles Inc. | Hybridization assay employing labeled pairs of hybrid binding reagents |
US4743535A (en) | 1984-11-07 | 1988-05-10 | Miles Inc. | Hybridization assay employing labeled probe and anti-hybrid |
AU3844485A (en) | 1984-02-09 | 1985-08-15 | Enzo Biochem Inc. | Heterologous detection of cabeled dna |
FI71768C (en) | 1984-02-17 | 1987-02-09 | Orion Yhtymae Oy | Enhanced nucleic acid reagents and process for their preparation. |
US6221581B1 (en) | 1984-04-27 | 2001-04-24 | Enzo Diagnostics, Inc. | Processes for detecting polynucleotides, determining genetic mutations or defects in genetic material, separating or isolating nucleic acid of interest from samples, and useful compositions of matter and multihybrid complex compositions |
CA1260372A (en) | 1984-04-27 | 1989-09-26 | Elazar Rabbani | Hybridization method for the detection of genetic materials |
ZA853756B (en) | 1984-06-01 | 1986-01-29 | Miles Lab | Nucleic acid hybridization assay employing immobilized rna probes |
CA1253777A (en) | 1984-06-01 | 1989-05-09 | Robert J. Carrico | Nucleic acid hybridization assay employing immobilized rna probes |
IL75648A0 (en) | 1984-07-05 | 1985-10-31 | Gen Probe Inc | Accelerated nucleic acid reassociation method |
US4563417A (en) | 1984-08-31 | 1986-01-07 | Miles Laboratories, Inc. | Nucleic acid hybridization assay employing antibodies to intercalation complexes |
US4775619A (en) | 1984-10-16 | 1988-10-04 | Chiron Corporation | Polynucleotide determination with selectable cleavage sites |
US4689294A (en) | 1984-11-19 | 1987-08-25 | Miles Laboratories, Inc. | Enhancement of hybridization of nucleic acids by anionic polymers |
ES8707343A1 (en) | 1985-06-13 | 1987-07-16 | Amgen | Method for performing nucleic acid hybridization assays. |
US4751177A (en) | 1985-06-13 | 1988-06-14 | Amgen | Methods and kits for performing nucleic acid hybridization assays |
US5641630A (en) | 1985-06-13 | 1997-06-24 | Amgen Inc. | Method and kit for performing nucleic acid hybridization assays |
US4868105A (en) | 1985-12-11 | 1989-09-19 | Chiron Corporation | Solution phase nucleic acid sandwich assay |
US5750338A (en) | 1986-10-23 | 1998-05-12 | Amoco Corporation | Target and background capture methods with amplification for affinity assays |
WO1988003957A1 (en) | 1986-11-24 | 1988-06-02 | Gen-Probe Incorporated | Nucleic acid probes for detection and/or quantitation of non-viral organisms |
AU601021B2 (en) | 1987-03-11 | 1990-08-30 | Molecular Diagnostics, Inc. | Assay for necleic acid sequences in a sample |
IL85551A0 (en) | 1987-04-01 | 1988-08-31 | Miles Inc | Rapid hybridization assay and reagent system used therein |
US5359100A (en) | 1987-10-15 | 1994-10-25 | Chiron Corporation | Bifunctional blocked phosphoramidites useful in making nucleic acid mutimers |
US5656731A (en) | 1987-10-15 | 1997-08-12 | Chiron Corporation | Nucleic acid-amplified immunoassay probes |
US5082830A (en) | 1988-02-26 | 1992-01-21 | Enzo Biochem, Inc. | End labeled nucleotide probe |
DE68916671T2 (en) | 1988-03-18 | 1995-03-02 | Baylor College Medicine | Mutation detection by competitive oligonucleotide priming. |
US6326136B1 (en) | 1988-04-01 | 2001-12-04 | Digene Corporation | Macromolecular conjugate made using unsaturated aldehydes |
US5374524A (en) | 1988-05-10 | 1994-12-20 | E. I. Du Pont De Nemours And Company | Solution sandwich hybridization, capture and detection of amplified nucleic acids |
NO165894C (en) | 1988-05-24 | 1991-04-24 | Gunnar Paulsen | METHOD OF ANALYSIS OF GENES. |
ATE133714T1 (en) | 1988-09-29 | 1996-02-15 | Chiron Corp | POLYNUCLEOTIDE DETERMINATION WITH SELECTABLE CLEAVAGE SITES |
GB8823869D0 (en) | 1988-10-12 | 1988-11-16 | Medical Res Council | Production of antibodies |
JP3046837B2 (en) | 1989-03-10 | 2000-05-29 | バイシス・インコーポレーテツド | Immobilized oligonucleotide probes and their use |
US5106727A (en) | 1989-04-27 | 1992-04-21 | Life Technologies, Inc. | Amplification of nucleic acid sequences using oligonucleotides of random sequences as primers |
EP0405913B1 (en) | 1989-06-30 | 1998-12-23 | Chiron Corporation | Hydrophobic nucleic acid probe |
US5116734A (en) | 1989-09-01 | 1992-05-26 | Digene Diagnostics, Inc. | Highly sensitive method for detecting peroxidase |
JPH05501650A (en) | 1989-12-01 | 1993-04-02 | バイシス・インコーポレーテツド | Detection of HPV transcripts |
US5629153A (en) | 1990-01-10 | 1997-05-13 | Chiron Corporation | Use of DNA-dependent RNA polymerase transcripts as reporter molecules for signal amplification in nucleic acid hybridization assays |
US5792606A (en) | 1990-02-26 | 1998-08-11 | Boehringer Mannheim Gmbh | Nucleic acid hybridization based assay for determining a substance of interest |
CA2039517C (en) | 1990-04-03 | 2006-11-07 | David Segev | Dna probe signal amplification |
US5695926A (en) | 1990-06-11 | 1997-12-09 | Bio Merieux | Sandwich hybridization assays using very short capture probes noncovalently bound to a hydrophobic support |
US5545806A (en) | 1990-08-29 | 1996-08-13 | Genpharm International, Inc. | Ransgenic non-human animals for producing heterologous antibodies |
US5484699A (en) | 1990-09-28 | 1996-01-16 | Abbott Laboratories | Nucleotide sequences useful as type specific probes, PCR primers and LCR probes for the amplification and detection of human papilloma virus, and related kits and methods |
EP0557456A4 (en) | 1990-11-14 | 1995-11-15 | Siska Diagnostics Inc | Non-isotopic detection of nucleic acids using a polystyrene support-based sandwich hybridization assay and compositions useful therefor |
US5556748A (en) | 1991-07-30 | 1996-09-17 | Xenopore Corporation | Methods of sandwich hybridization for the quantitative analysis of oligonucleotides |
AU673813B2 (en) | 1991-11-14 | 1996-11-28 | Qiagen Gaithersburg, Inc. | Non-radioactive hybridization assay and kit |
US5981179A (en) | 1991-11-14 | 1999-11-09 | Digene Diagnostics, Inc. | Continuous amplification reaction |
JPH07502653A (en) | 1991-12-23 | 1995-03-23 | カイロン コーポレイション | HBV amplification probe for use in solution phase sandwich hybridization assays |
US5747244A (en) | 1991-12-23 | 1998-05-05 | Chiron Corporation | Nucleic acid probes immobilized on polystyrene surfaces |
US5424413A (en) | 1992-01-22 | 1995-06-13 | Gen-Probe Incorporated | Branched nucleic acid probes |
JP3373516B2 (en) | 1992-09-15 | 2003-02-04 | ザ・ダウ・ケミカル・カンパニー | Impact modification of thermoplastics |
WO1994010335A2 (en) | 1992-10-09 | 1994-05-11 | Amoco Corporation | Assay methods |
AU6031094A (en) | 1993-01-15 | 1994-08-15 | Public Health Research Institute Of The City Of New York, Inc., The | Sensitive nucleic acid sandwich hybridization assays and kits |
WO1994028156A1 (en) | 1993-05-20 | 1994-12-08 | Dana-Farber Cancer Institute | Compositions and methods for treatment of herpesvirus infections |
CA2167838C (en) | 1993-07-23 | 1999-11-23 | Thomas B. Ryder | Methods for enhancing nucleic acid amplification |
DE4331012A1 (en) | 1993-09-13 | 1995-03-16 | Bayer Ag | Nucleic acid-binding oligomers with N-branching for therapy and diagnostics |
US5681697A (en) | 1993-12-08 | 1997-10-28 | Chiron Corporation | Solution phase nucleic acid sandwich assays having reduced background noise and kits therefor |
DK145493D0 (en) | 1993-12-23 | 1993-12-23 | Dako As | ANTIBODY |
JPH10500281A (en) | 1994-02-14 | 1998-01-13 | ザ マクファーレーン バーネット センター フォー メディカル リサーチ リミテッド | Nonpathogenic HIV-1 species |
CA2186465A1 (en) | 1994-04-04 | 1995-10-12 | Richard A. Martinelli | Hybridization-ligation assays for the detection of specific nucleic acid sequences |
CA2126952C (en) | 1994-06-28 | 2010-12-14 | Sithian Pandian | Probe, kit, and method of amplification for increasing the sensitivity of nucleic acid hybridization assays |
US5681702A (en) | 1994-08-30 | 1997-10-28 | Chiron Corporation | Reduction of nonspecific hybridization by using novel base-pairing schemes |
JP3093116B2 (en) | 1994-09-30 | 2000-10-03 | 株式会社豊田中央研究所 | Nucleic acid detection method |
US6057099A (en) | 1994-12-02 | 2000-05-02 | Intelligene Ltd. | Detection of nucleic acid sequences |
US5747248A (en) | 1994-12-05 | 1998-05-05 | Chiron Corporation | Discontinuous probe design using hybritope mapping |
US20030104361A1 (en) | 1997-09-29 | 2003-06-05 | Susan Weininger | Method of detection of nucleic acids with a specific sequence composition |
CA2139070C (en) | 1994-12-23 | 2010-03-30 | Burton W. Blais | Method for enhancing detection ability of nucleic acid assays employing polymerase chain reaction |
US5731153A (en) | 1996-08-26 | 1998-03-24 | The Regents Of The University Of California | Identification of random nucleic acid sequence aberrations using dual capture probes which hybridize to different chromosome regions |
US5888724A (en) | 1995-02-17 | 1999-03-30 | The Trustees Of Columbia University In The City Of New York | Detection of high oncogenic-risk papilloma virus in high grade cervical lesions and cancers by a PCR/ELISA assay |
JPH11506605A (en) | 1995-06-07 | 1999-06-15 | アボツト・ラボラトリーズ | Method of masking probes to reduce background in amplification reactions |
US6083925A (en) | 1995-06-07 | 2000-07-04 | Connaught Laboratories Limited | Nucleic acid respiratory syncytial virus vaccines |
FR2737502B1 (en) | 1995-07-31 | 1997-10-24 | Genset Sa | NUCLEIC ACID DETECTION METHOD USING NUCLEOTIDE PROBES ALLOWING BOTH SPECIFIC CAPTURE AND DETECTION |
AU726047B2 (en) | 1995-11-15 | 2000-10-26 | Gen-Probe Incorporated | Nucleic acid probes complementary to human papillomavirus nucleic acid and related methods and kits |
EP2332958B1 (en) | 1996-02-09 | 2016-04-20 | Cornell Research Foundation, Inc. | Detection of nucleic and sequence differences using the ligase detection reaction with addressable arrays |
US5853993A (en) | 1996-10-21 | 1998-12-29 | Hewlett-Packard Company | Signal enhancement method and kit |
US6117631A (en) | 1996-10-29 | 2000-09-12 | Polyprobe, Inc. | Detection of antigens via oligonucleotide antibody conjugates |
GB9624165D0 (en) | 1996-11-19 | 1997-01-08 | Amdex A S | Use of nucleic acids bound to carrier macromolecules |
US6110676A (en) | 1996-12-04 | 2000-08-29 | Boston Probes, Inc. | Methods for suppressing the binding of detectable probes to non-target sequences in hybridization assays |
US20020034737A1 (en) | 1997-03-04 | 2002-03-21 | Hyseq, Inc. | Methods and compositions for detection or quantification of nucleic acid species |
US6043038A (en) | 1998-03-31 | 2000-03-28 | Tularik, Inc. | High-throughput screening assays for modulators of primase activity |
AU7986398A (en) | 1997-06-25 | 1999-01-04 | Tularik Inc. | High-throughput screening assays for modulators of primase activity |
US5843995A (en) | 1997-07-07 | 1998-12-01 | University Of Medicine And Dentistry Of New Jersey | Inhibition of HIV-1 replication using oligocarbamate derivatives |
JP2002505071A (en) | 1997-11-04 | 2002-02-19 | ロシュ ダイアグノスティックス ゲーエムベーハー | Specific and sensitive nucleic acid detection method |
US6969585B2 (en) | 1997-12-12 | 2005-11-29 | Digene Corporation | Universal collection medium |
US6225053B1 (en) | 1997-12-12 | 2001-05-01 | Digene Corporation | Detection of hepatitis B virus |
US20030096232A1 (en) | 1997-12-19 | 2003-05-22 | Kris Richard M. | High throughput assay system |
JP4325114B2 (en) | 1997-12-22 | 2009-09-02 | 日立化成工業株式会社 | Direct RT-PCR on oligonucleotide-immobilized PCR microplates |
EP1047794A2 (en) | 1998-01-13 | 2000-11-02 | BioChip Technologies GmbH | Method for the detection or nucleic acid of nucleic acid sequences |
JP2002501760A (en) | 1998-02-02 | 2002-01-22 | アマーシャム・ファルマシア・バイオテック・アクチボラグ | Nucleic acid analysis method |
US5994079A (en) | 1998-02-06 | 1999-11-30 | Digene Corporation | Direct detection of RNA mediated by reverse transcriptase lacking RNAse H function |
US7399589B2 (en) | 1998-02-06 | 2008-07-15 | Digene Corporation | Immunological detection of RNA:DNA hybrids on microarrays |
US6686151B1 (en) | 1998-02-06 | 2004-02-03 | Digene Corporation | Immunological detection of RNA:DNA hybrids on microarrays |
EP0945627B1 (en) | 1998-03-23 | 2004-01-02 | SPAL S.r.l. | Axial flow fan |
US6183956B1 (en) | 1998-03-31 | 2001-02-06 | Tularik, Incorporated | High throughput in vitro screening assays for transcription modulators |
US20010055766A1 (en) | 1999-04-02 | 2001-12-27 | Alexander Aristarkhov | Immunosorbant assay using branched bis-biotin/avidin/multiple label complex as a detection reagent |
WO2000060116A1 (en) | 1999-04-02 | 2000-10-12 | Tropix, Inc. | High throughput and high sensitivity detection assays |
US7019822B1 (en) | 1999-04-29 | 2006-03-28 | Mss, Inc. | Multi-grade object sorting system and method |
US6544732B1 (en) | 1999-05-20 | 2003-04-08 | Illumina, Inc. | Encoding and decoding of array sensors utilizing nanocrystals |
US20020086289A1 (en) * | 1999-06-15 | 2002-07-04 | Don Straus | Genomic profiling: a rapid method for testing a complex biological sample for the presence of many types of organisms |
US6200746B1 (en) | 1999-08-25 | 2001-03-13 | Pharmacia & Upjohn Company | Methods of identifying anti-viral agents |
US6893819B1 (en) | 2000-11-21 | 2005-05-17 | Stratagene California | Methods for detection of a nucleic acid by sequential amplification |
JP2001157598A (en) | 1999-12-01 | 2001-06-12 | Matsushita Electric Ind Co Ltd | Gene detection method and detection apparatus using the method |
US6436662B1 (en) | 2000-04-04 | 2002-08-20 | Digene Corporation | Device and method for cytology slide preparation |
US6521190B1 (en) | 2000-05-19 | 2003-02-18 | Digene Corporation | Cell collection apparatus |
AU2001274869A1 (en) | 2000-05-20 | 2001-12-03 | The Regents Of The University Of Michigan | Method of producing a dna library using positional amplification |
US7439016B1 (en) * | 2000-06-15 | 2008-10-21 | Digene Corporation | Detection of nucleic acids by type-specific hybrid capture method |
ATE466930T1 (en) | 2000-06-21 | 2010-05-15 | Qiagen Gaithersburg Inc | UNIVERSAL COLLECTION MEDIA |
US20030165843A1 (en) | 2000-07-28 | 2003-09-04 | Avi Shoshan | Oligonucleotide library for detecting RNA transcripts and splice variants that populate a transcriptome |
AU2001296762B2 (en) | 2001-02-16 | 2007-03-15 | Promega Corporation | Magnetic isolation and purification of nucleic acids |
EP1806410A3 (en) | 2001-08-23 | 2007-10-24 | Merck & Co., Inc. | Fluorescent multiplex HPV PCR assays using multiple fluorophores |
US20050032105A1 (en) | 2001-10-12 | 2005-02-10 | Bair Robert Jackson | Compositions and methods for using a solid support to purify DNA |
US6977148B2 (en) | 2001-10-15 | 2005-12-20 | Qiagen Gmbh | Multiple displacement amplification |
DK1463839T3 (en) | 2002-01-07 | 2007-07-02 | Norchip As | Method for detecting human papillomavirus mRNA |
FI113549B (en) | 2002-11-19 | 2004-05-14 | Mobidiag Oy | Diagnostic method for identifying and identifying bacteria causing respiratory tract infections and primer composition useful in the process |
CA2525482C (en) | 2003-04-04 | 2015-02-17 | F. Hoffmann-La Roche Ag | Improved system for multicolor real-time pcr comprising 3 to 6 pairs of forester resonance energy transfer (fret) probes |
US7129260B2 (en) | 2003-06-02 | 2006-10-31 | Abbott Laboratories | Isoindolinone kinase inhibitors |
EP2918595B1 (en) | 2003-07-05 | 2019-12-11 | The Johns-Hopkins University | Method and compositions for detection and enumeration of genetic variations |
EP1644516A4 (en) * | 2003-07-14 | 2007-03-21 | Capitalbio Corp | Methods and compositions for detecting sars virus and other infectious agents |
DE60300339T2 (en) | 2003-08-25 | 2006-04-13 | Mtm Laboratories Ag | Method for the detection of carcinomas in solubilized cervical body samples |
EP1687437A4 (en) * | 2003-10-13 | 2008-01-02 | Genaco Biomedial Products Inc | Method and kit for primer based amplification of nucleic acids |
US8012944B2 (en) | 2003-10-30 | 2011-09-06 | Pharmascience Inc. | Method for treating cancer using IAP antisense oligomer and chemotherapeutic agent |
JP2005243132A (en) | 2004-02-26 | 2005-09-08 | Renesas Technology Corp | Semiconductor device |
US20060040300A1 (en) | 2004-08-09 | 2006-02-23 | Generation Biotech, Llc | Method for nucleic acid isolation and amplification |
ES2668911T3 (en) | 2004-09-30 | 2018-05-23 | Epigenomics Ag | Method for providing DNA fragments derived from an archived sample |
CN101151379A (en) | 2005-01-14 | 2008-03-26 | 密执安州立大学董事会 | Systems, methods, and compositions for detection of human papilloma virus in biological samples |
US20060240449A1 (en) | 2005-01-19 | 2006-10-26 | Mcglennen Ronald C | Methods and compositions for preparation of biological samples |
CA2602185A1 (en) * | 2005-04-06 | 2006-10-06 | Verenium Corporation | Enzymes and formulations for broad-specificity decontamination of chemical and biological warfare agents |
US7803541B2 (en) | 2005-05-12 | 2010-09-28 | Panomics, Inc. | Multiplex branched-chain DNA assays |
US7972776B2 (en) | 2005-11-15 | 2011-07-05 | Oncohealth Corporation | Protein chips for HPV detection |
US20080003565A1 (en) | 2006-05-02 | 2008-01-03 | Government Of The Us, As Represented By The Secretary, Department Of Health And Human Services | Viral nucleic acid microarray and method of use |
US8962262B2 (en) | 2006-05-11 | 2015-02-24 | Arbor Vita Corporation | Method of protein extraction from cells |
JP2006320334A (en) * | 2006-07-18 | 2006-11-30 | Marine Biotechnol Inst Co Ltd | Method for detecting and identifying legionella pneumophila using nucleic acid fragment |
DK2114990T5 (en) | 2007-02-27 | 2012-05-07 | Nuclea Biomarkers Llc | Method for predicting NSCLC patients' response to treatment with an EGFR-TK inhibitor |
US8357538B2 (en) | 2007-04-06 | 2013-01-22 | Qiagen Gaithersburg, Inc. | Automated assay and system |
US7985375B2 (en) | 2007-04-06 | 2011-07-26 | Qiagen Gaithersburg, Inc. | Sample preparation system and method for processing clinical specimens |
US8703492B2 (en) | 2007-04-06 | 2014-04-22 | Qiagen Gaithersburg, Inc. | Open platform hybrid manual-automated sample processing system |
WO2008139938A1 (en) | 2007-05-02 | 2008-11-20 | National University Corporation Tokyo Medical And Dental University | Double-stranded nucleic acid molecule targeting for human papilloma virus type-16 gene, and pharmaceutical agent comprising the molecule |
PL2479289T3 (en) | 2007-06-08 | 2016-10-31 | Method for methylation analysis | |
JP2009106220A (en) * | 2007-10-31 | 2009-05-21 | Genodive Pharma Kk | Method for catching and detecting target base sequence by isothermal amplification reaction on substrate |
WO2009057993A1 (en) | 2007-11-01 | 2009-05-07 | Vereniging Voor Christelijk Hoger Onderwijs, Wetenschappelijk Onderzoek En Patiëntenzorg | NEW DETECTION METHOD FOR CERVICAL HPVs |
JP4580996B2 (en) * | 2008-02-27 | 2010-11-17 | 株式会社東芝 | Target nucleic acid detection method and target nucleic acid detection substrate |
WO2009123996A2 (en) * | 2008-03-31 | 2009-10-08 | The Ohio State University Research Foundation | Hybridization quantitation method for modified micro-rna and -dna based oligonucleotides |
EP2262911B1 (en) | 2008-04-17 | 2016-10-12 | QIAGEN Gaithersburg, Inc. | Compositions, methods, and kits using synthetic probes for determining the presence of a target nucleic acid |
WO2010004251A1 (en) | 2008-06-16 | 2010-01-14 | Oncomethylome Sciences Sa | Dna methylomes |
WO2010028382A2 (en) | 2008-09-05 | 2010-03-11 | Mayo Foundation For Medical Education And Research | Collecting and processing complex macromolecular mixtures |
US9090948B2 (en) | 2008-09-30 | 2015-07-28 | Abbott Molecular Inc. | Primers and probes for detecting human papillomavirus and human beta globin sequences in test samples |
US8288520B2 (en) | 2008-10-27 | 2012-10-16 | Qiagen Gaithersburg, Inc. | Fast results hybrid capture assay and system |
EP2184368A1 (en) | 2008-11-07 | 2010-05-12 | DKFZ Deutsches Krebsforschungszentrum | Diagnostic transcript and splice patterns of HPV16 in different cervical lesions |
JP5738278B2 (en) | 2009-05-01 | 2015-06-24 | キアジェン ゲイサーズバーグ インコーポレイテッド | Non-target amplification method for detecting RNA splicing morphology in a sample |
-
2011
- 2011-05-18 WO PCT/US2011/037012 patent/WO2011146629A2/en active Application Filing
- 2011-05-18 US US13/110,660 patent/US9422593B2/en not_active Expired - Fee Related
- 2011-05-18 JP JP2013511335A patent/JP2013528049A/en active Pending
- 2011-05-18 CA CA2799200A patent/CA2799200A1/en not_active Abandoned
- 2011-05-18 AU AU2011255638A patent/AU2011255638B2/en not_active Ceased
- 2011-05-18 EP EP11723212A patent/EP2572001A2/en not_active Withdrawn
-
2017
- 2017-06-16 JP JP2017118416A patent/JP2017200483A/en not_active Withdrawn
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7601497B2 (en) | 2000-06-15 | 2009-10-13 | Qiagen Gaithersburg, Inc. | Detection of nucleic acids by target-specific hybrid capture method |
WO2009135832A1 (en) | 2008-05-06 | 2009-11-12 | Qiagen Gmbh | Simultaneous detection of multiple nucleic acid sequences in a reaction |
Non-Patent Citations (8)
Title |
---|
ANDERSON, S., NUCLEIC ACIDS RESEARCH, vol. 9, no. 13, 1981, pages 3015 - 3027 |
LANDEGREN ET AL.: "11A Ligase-Mediated Gene Detection Technique", SCIENCE, vol. 241, 1988, pages 1077 - 1080, XP000676556, DOI: doi:10.1126/science.3413476 |
LIU ET AL.: "Rolling circle DNA synthesis: Small circular oligonucleotides as efficient templates for DNA polymerases", J. AM, CHEM. SOC., vol. 118, 1996, pages 1587 - 1594, XP001108842, DOI: doi:10.1021/ja952786k |
NAZARENKO ET AL.: "A novel method of HPV genotyping using Hybrid Capture@ sample preparation method combined with GP5+/6+ PCR and multiplex detection on Luminex® XMAP@", JOURNAL OF VIROLOGICAL METHODS, vol. 154, 2008, pages 76 - 81 |
SAMBROOK, J., FRITSCH, E.F., MANIATIS, T.: "Molecular Cloning: A laboratory manual", 1989, COLD SPRING HARBOR LABORATORY PRESS, pages: 5.2 - 5.95,9.3 |
See also references of EP2572001A2 |
WALKER ET AL.: "Strand displacement amplification-an isothermal, in vitro DNA amplification technique", NUCLEIC ACIDS RES., vol. 20, no. 7, 1992, pages 1691 - 6 |
WIEDMANN: "PCR Methods and Applications", vol. 1, 1994, COLD SPRING HARBOR LABORATORY PRESS, article "Ligase Chain Reaction (LCR)-- Overview and Applications", pages: S51 - S64 |
Cited By (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US9732080B2 (en) | 2006-11-03 | 2017-08-15 | Vertex Pharmaceuticals Incorporated | Azaindole derivatives as CFTR modulators |
JP2015507931A (en) * | 2012-02-14 | 2015-03-16 | グレート ベイスン サイエンティフィック | Isothermal amplification using block primers |
US9896723B2 (en) | 2012-02-14 | 2018-02-20 | Great Basin Scientific, Inc. | Methods of isothermal amplification using blocked primers |
RU2551208C1 (en) * | 2014-04-22 | 2015-05-20 | Федеральное казенное учреждение здравоохранения Волгоградский научно-исследовательский противочумный институт Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека | SET OF OLIGONUCLEOTIDE PRIMERS AND FLUORESCENTLY LABELLED PROBE FOR IDENTIFICATION OF Burkholderia mallei AND ITS DIFFERENTIATION FROM Burkholderia pseudomallei |
EP3957755A4 (en) * | 2020-03-20 | 2023-01-25 | Anbio (Xiamen) Biotechnology Co., Ltd. | Novel coronavirus nucleic acid rapid hybridization capture immunofluorescence detection kit, and preparation method and detection method |
WO2022087209A1 (en) * | 2020-10-22 | 2022-04-28 | Neogen Corporation | Methods of detecting listeria from an environmental sample |
Also Published As
Publication number | Publication date |
---|---|
AU2011255638B2 (en) | 2016-08-25 |
US9422593B2 (en) | 2016-08-23 |
WO2011146629A3 (en) | 2012-05-31 |
JP2013528049A (en) | 2013-07-08 |
JP2017200483A (en) | 2017-11-09 |
US20120045756A1 (en) | 2012-02-23 |
CA2799200A1 (en) | 2011-11-24 |
AU2011255638A1 (en) | 2013-01-10 |
EP2572001A2 (en) | 2013-03-27 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US9422593B2 (en) | Methods and compositions for sequence-specific purification and multiplex analysis of nucleic acids | |
US11851720B2 (en) | Direct amplification and detection of viral and bacterial pathogens | |
JP2023080282A (en) | Use of cas protein, method for detecting target nucleic acid molecule, and kit | |
JP5385973B2 (en) | Simultaneous detection of multiple nucleic acid sequences in a reaction | |
US9689047B2 (en) | Methods and compositions for sequence-specific purification and multiplex analysis of nucleic acids | |
JP2012529266A (en) | Detection of multiple nucleic acid sequences in reaction cartridges | |
US20210254139A1 (en) | Probe detection of loop-mediated amplification products | |
US20190284617A1 (en) | Polynucleotides for the amplification and detection of chlamydia trachomatis | |
US20190284618A1 (en) | Polynucleotides for the amplification and detection of neisseria gonorrhoeae | |
US20160348189A1 (en) | Molecular detection of rna | |
JP2022542361A (en) | Polynucleotides for amplification and detection of Neisseria gonorrhoeae | |
CA2925070C (en) | Detecting single nucleotide polymorphism using overlapped primer and melting probe | |
JP5980332B2 (en) | Molecular detection assay | |
JP2023518217A (en) | Loop primer and loop de loop method for detecting target nucleic acid | |
US20230332216A1 (en) | Methods and reagents for rapid detection of pathogens in biological samples | |
CA3170460A1 (en) | Nucleic acid fluorescence detection | |
Raghavan | Evolving CRISPR-Cas-Based Diagnostics and Its Reliability | |
WO2023205648A1 (en) | Use of exonuclease iii and probe for sensitive and specific lateral-flow-assay detection of amplification amplicons |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 11723212 Country of ref document: EP Kind code of ref document: A2 |
|
ENP | Entry into the national phase |
Ref document number: 2799200 Country of ref document: CA |
|
ENP | Entry into the national phase |
Ref document number: 2013511335 Country of ref document: JP Kind code of ref document: A |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2011723212 Country of ref document: EP |
|
ENP | Entry into the national phase |
Ref document number: 2011255638 Country of ref document: AU Date of ref document: 20110518 Kind code of ref document: A |