WO2011156617A2 - Anti-egfr antibodies - Google Patents

Abstract

Monoclonal antibodies that bind and inhibit activation of epidermal growth factor receptor related member EGFR^L858R/T790M are disclosed. The antibodies can be used to treat cell proliferative diseases and disorders, including certain forms of cancer, associated with activation of EGFR^L858R/T790M, EGFRvIII or wild-type EGFR amplification.

Description

ANTI-EGFR ANTIBODIES

CROSS-REFERENCE TO RELATED APPLICATION

[0001] This application claims the benefit of and priority to U.S. Provisional Application Serial No. 61/353,118, filed June 9, 2010; the content of which is incorporated herein in its entirety.

FIELD OF THE INVENTION

[0002] The field of the invention is molecular biology, immunology and oncology. More particularly, the field is antibodies that bind human wild type EGFR and mutant

EGFR^L858R/T790M

BACKGROUND

[0003] Non- small cell lung cancers (NSCLC) driven by ligand- independent activating mutations in epidermal growth factor receptor (EGFR) often respond to treatment with the EGFR tyrosine kinase inhibitors (TKIs) gefitinib and erlotinib. These TKIs compete with ATP to bind (reversibly) the kinase domain of their targets. Approximately 90% of NSCLC- associated mutations occur as in-frame deletions in exon 19, or as a single nucleotide substitution at nucleotide 2573 in exon 21, that substitutes arginine for leucine at position 858 (L858R). Both of these mutations are associated with sensitivity to gefitinib and erlotinib. Only about 10% of tumors that express wild-type EGFR respond to gefitinib or erlotinib.

[0004] Resistance to EGFR-TKI therapy typically develops after about ten months of treatment. This acquired resistance occurs even in patients who have a strong initial response. About half of acquired resistance to EGFR-TKI therapy results from a secondary point mutation in the EGFR tyrosine kinase domain that substitutes methionine for threonine at amino acid position 790 (T790M), which is located in the ATP binding cleft. The T790M mutation increases the ATP affinity of EGFR L858R more than 10-fold. Cells containing the EGFR^T790M mutation exhibit tyrosine phosphorylation levels comparable to wild-type EGFR. The T790M/L858R double mutation results in a substantial increase in phosphorylation, compared with phosphorylation in cells that contain only the L858R mutation. Thus, the T790M mutation, when combined with activating EGFR kinase domain mutations (e.g., EGFR^L858R/T790M, EGFR ^9/T790M), leads to increased phosphorylation levels.

[0005] Murine models have been generated to express (inducibly) EGFR^T790M (alone or in combination with the L858R mutation) in type II pneumocytes that develop into lung adenocarcinomas. Mice expressing the T790M mutation alone develop tumors with longer latency than those expressing both the T790M and L858R mutations. This indicates that the T790M mutation is not only a cause of resistance to gefitinib and erlotinib, but also confers a growth advantage to cancer cells. Acquired resistance to PF00299804, a TKI that binds EGFR irreversibly, occurs when the EGFR^T790M allele is amplified. Amplified EGFR^T790M is a common resistance mechanism that operates against reversible inhibitors and irreversible inhibitors. Consequently, there is a need for more effective therapies against EGFR^T790M.

[0006] Monoclonal antibodies that inhibit ligand binding to wild-type EGFR, as well as inhibiting the effects of ligand-independent activated forms of EGFR, generally are

characterized by undesirable side effects, particularly skin disorders (rash and acne) and diarrhea, which can be severe. These target-associated toxicities limit the dosage, and thus potentially, the efficacy of current anti-EGFR therapeutic agents.

[0007] Although antibodies targeting one or more forms of EGFR have been developed, there remains a need for improved anti-EGFR therapeutics, including anti-EGFR antibodies characterized by increased efficacy and reduced side effects. Antibodies against EGFR are described publications including the following: Schlessinger et al, U.S. Pat. No. 6, 217,866; Bendig et al, U.S. Pat. No. 5,558,864; Van de Winkel et al, U.S. Pat. No. 7,247,301;

Jakobovitz et al, U.S. Pat. No. 6,235,883; Weber et al, U.S. Pat. No. 7,524,496; Van de Winkel et al, U.S. Pub. No. 2003/0194403; Jakobovitz U.S. Pub. No 2005/0100546; Schwab et al, U.S. Pub. No. 2004/0033543; Greene et al, U.S. Pub. No. U.S. 2006/0073140; Tang et al, U.S. Pub. No. 2005/0222059; Weber et al, U.S. Pat. Pub. No. 2005/0053608; and Wong et al, International Pub. No. WO 2008/091701.

[0008] Naturally occurring antibodies are multimeric proteins that contain four polypeptide chains (FIG. 1). Two of the polypeptide chains are called immunoglobulin heavy chains (H chains), and two of the polypeptide chains are called immunoglobulin light chains (L chains). The immunoglobulin heavy and light chains are connected by an interchain disulfide bond. The immunoglobulin heavy chains are connected by interchain disulfide bonds. A light chain consists of one variable region (VL in FIG. 1) and one constant region (CL in FIG. 1). The heavy chain consists of one variable region (VH in FIG. 1) and at least three constant regions (CHI, CH2 and CH3 in FIG. 1). The variable regions determine the specificity of the antibody. Each variable region contains three hypervariable regions known as complementarity determining regions (CDRs) flanked by four relatively conserved regions known as framework regions (FRs). The three CDRs, referred to as CDR_l5 CDR₂, and CDR₃, contribute to the antibody binding specificity. Naturally occurring antibodies have been used as starting material for engineered antibodies, such as chimeric antibodies and humanized antibodies.

[0009] In view of the foregoing, there is a need for improved EGFR antibodies that are useful as therapeutic agents against tumors expressing wild type EGFR and various mutant forms of EGFR.

SUMMARY OF THE INVENTION

[0010] The invention is based on the discovery of antibodies that bind wild-type human EGFR and various mutant forms of human EGFR, i.e., a "pan-EGFR antibody." When used as therapeutic agents, the antibodies are engineered, e.g., humanized, to reduce or eliminate an immune response when administered to a human patient.

[0011] Antibodies of the invention neutralize the biological activity of wild-type human EGFR and various mutant forms of human EGFR, including EGFR containing the T790M and/or L858R mutations. By virtue of such neutralization, the antibodies of the invention can be used to inhibit the proliferation of tumor cells in vitro or in vivo. When administered to a human cancer patient (or an animal model such as a mouse model), the antibodies inhibit or reduce tumor growth in the human patient (or animal model).

[0012] These and other aspects and advantages of the invention are illustrated by the following figures, detailed description and claims. As used herein, "including" means without limitation, and examples cited are non-limiting.

DESCRIPTION OF THE DRAWINGS

[0013] The invention can be more completely understood with reference to the following drawings.

[0014] FIG. 1 (prior art) is a schematic representation of a typical naturally-occurring antibody. [0015] FIG. 2 is an amino acid sequence alignment of the complete immunoglobulin heavy chain variable region of the two pan-EGFR antibodies designated 07D06 and 12D03. The amino acid sequences of these antibodies are aligned against one another, and Complementary Determining Region (CDR) sequences (Kabat definition), CDR_l5 CDR₂, and CDR₃ are identified in boxes. The unboxed sequences represent framework (FR) sequences.

[0016] FIG. 3 is an amino acid sequence alignment of the CDR_l5 CDR₂, and CDR₃ sequences (Kabat definition) for each of the immunoglobulin heavy chain variable region sequences in FIG. 2.

[0017] FIG. 4 is an amino acid sequence alignment of the complete immunoglobulin light chain variable region of antibodies 07D06 and 12D03. The amino acid sequences for each antibody are aligned against one another, and CDR_l5 CDR₂, and CDR₃ sequences (Kabat definition) are identified in boxes. The unboxed sequences represent framework (FR) sequences.

[0018] FIG. 5 is an amino acid sequence alignment of the CDR_l5 CDR₂, and CDR₃ sequences (Kabat definition) for each of the immunoglobulin light chain variable region sequences in FIG. 4.

[0019] FIG. 6 is graph summarizing results from an experiment to measure inhibition of rh-pro-EGF binding to rhEGFR by: negative control (murine IgG (Δ)), antibody 07D06 (■), antibody 12D03( A), cetuximab ( T), and panitumumab (♦).

[0020] FIG. 7 is a graph summarizing results from an experiment to measure anti- proliferation activity of: negative control IgG (murine IgG (Δ)), antibody 07D06 (■), antibodyl2D03 ( A), and cetuximab (·), in BaF3 cells expressing EGFR^{L858R T790M}.

[0021] FIG. 8 is a graph summarizing results from an experiment to measure anti- proliferation activity of: negative control human IgG, antibody 07D06, and antibody 12D03, cetuximab and panitumumab in human primary keratinocytes.

[0022] FIG. 9 is a graph summarizing results from an experiment to measure tumor growth inhibition by: antibody 07D06 (■), antibodyl2D03 (A ), cetuximab (·), panitumumab (♦), and a human IgG control (Δ) at a dose of 4 mg/kg (abbreviated as "mpk"), against lung chimeric EGFR^L858R/T790M tumor xenografts in NCr nude mice. [0023] FIG. 10 is a graph summarizing results from an experiment to measure tumor growth inhibition by antibody 07D06 ( A ), antibodyl2D03 (■), cetuximab (·), and a human IgG control (Δ), at a dose of 0.5 mg/kg (abbreviated as "mpk"), against lung H1975 tumor xenografts in NCr nude mice. [0024] FIG. 11 is a graph summarizing results from an experiment to measure tumor growth inhibition by antibody 07D06 (■), antibodyl2D03 ( A ), cetuximab (·), and a human IgG control(A) at a dose of 2.5 mg/kg (abbreviated as "mpk"), against A431 tumor xenografts in NCr nude mice.

[0025] FIG. 12 is a graph summarizing results from an experiment to measure tumor growth inhibition by antibody 07D06 (■), antibody 12D03 ( A ), cetuximab (·), panitumumab (♦) and a human IgG control (Δ), at a dose of 5 mg/kg (abbreviated as "mpk"), against lung chimeric EGFRvIII tumor xenografts in NCr nude mice.

DETAILED DESCRIPTION OF THE INVENTION

[0026] The antibodies of the invention are based on the antigen binding sites of monoclonal antibodies selected for neutralization of the biological activity of EGFR . The antibodies contain immunoglobulin variable region CDRs that define the EGFR binding site.

[0027] By virtue of the neutralizing activity of the antibodies of the invention, they are useful for inhibiting the growth and/or proliferation of certain cancer cells, and tumors. The antibodies can be engineered to minimize or eliminate an immune response when administered to a human patient. Various features and aspects of the invention are discussed in more detail below.

[0028] As used herein, unless otherwise indicated, the term "antibody" means an intact antibody (e.g., an intact monoclonal antibody) or antigen-binding fragment of an antibody (e.g., an antigen-binding fragment of a monoclonal antibody), including an intact antibody or antigen-binding fragment that has been modified, engineered or chemically conjugated.

Examples of antibodies that have been modified or engineered are chimeric antibodies, humanized antibodies, and multispecific antibodies (e.g., bispecific antibodies). Examples of antigen-binding fragments include Fab, Fab', F(ab')₂, Fv, single chain antibodies (e.g., scFv), minibodies, and diabodies. An antibody conjugated to a toxin moiety is an example of a chemically conjugated antibody. Antibodies that Bind Wild Type EGFR and EGFR^{L8S8K 1 yuM}

[0029] Antibodies of the invention comprise: (a) an immunoglobulin heavy chain variable region comprising the structure CDR_Hi-CDR_H2-CDR_H3 and (b) an immunoglobulin light chain variable region comprising the structure CDR_L1-CDR_L2-CDR_L3, wherein the heavy chain variable region and the light chain variable region together define a single binding site for binding wild- type and mutant forms of human EGFR.

[0030] In some embodiments, the antibody comprises (a) an immunoglobulin heavy chain variable region comprising the structure CDR_HI-CDR_H2-CDR_H3 and (b) an immunoglobulin light chain variable region, wherein the heavy chain variable region and the light chain variable region together define a single binding site for binding wild- type and mutant forms of human EGFR. A CDR_HI comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 5 (07D06), SEQ ID NO: 19 (07D06), SEQ ID NO: 15 (12D03) and SEQ ID NO: 21 (12D03); a CDR_H2 comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 6 (07D06), SEQ ID NO: 20 (07D06), SEQ ID NO: 16 (12D03) and SEQ ID NO: 22 (12D03); and a CDR_H3 comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 7 (07D06) and SEQ ID NO: 17 (12D03). Throughout the specification a particular SEQ ID NO. is followed in parentheses by the antibody that was the origin of that sequence. For example, "SEQ ID NO: 5 (07D06)" means that SEQ ID NO: 5 comes from antibody 07D06.

[0031] In some embodiments, the heavy chain variable region comprises a CDR_Hi comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 5

(07D06) and SEQ ID NO: 19 (07D06), a CDR_H2 comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 6 (07D06) and SEQ ID NO: 20 (07D06), and a CDR_H3 comprising the amino acid sequence of SEQ ID NO: 7 (07D06).

[0032] In one embodiment, the heavy chain variable region comprises a CDR_HI comprising the amino acid sequence of SEQ ID NO: 5 (07D06), a CDR_H2 comprising the amino acid sequence of SEQ ID NO: 6 (07D06), and a CDR_H3 comprising the amino acid sequence of SEQ ID NO: 7 (07D06).

[0033] In one embodiment, the heavy chain variable region comprises a CDR_HI comprising the amino acid sequence of SEQ ID NO: 5 (07D06), a CDR_H2 comprising the amino acid sequence of SEQ ID NO: 20 (07D06), and a CDR_H3 comprising the amino acid sequence of SEQ ID NO: 7 (07D06).

[0034] In some embodiments, the heavy chain variable region comprises a CDR_Hi comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 15 (12D03) and SEQ ID NO: 21 (12D03), a CDR_H2 comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 16 (12D03) and SEQ ID NO: 22 (12D03), and a CDR_H3 comprising the amino acid sequence of SEQ ID NO: 17 (12D03).

[0035] In one embodiment, the heavy chain variable region comprises a CDR_Hi comprising the amino acid sequence of SEQ ID NO: 15 (12D03), a CDR_H2 comprising the amino acid sequence of SEQ ID NO: 16 (12D03), and a CDR_H3 comprising the amino acid sequence of SEQ ID NO: 17 (12D03).

[0036] In one embodiment, the heavy chain variable region comprises a CDR_Hi comprising the amino acid sequence of SEQ ID NO: 15 (12D03), a CDR_H2 comprising the amino acid sequence of SEQ ID NO: 22 (12D03), and a CDR_H3 comprising the amino acid sequence of SEQ ID NO: 17 (12D03).

[0037] Preferably, the CDR_Hi, CDR_H2, and CDR_H3 sequences are interposed between human or humanized immunoglobulin FRs. The antibody can be an intact antibody or an antigen-binding antibody fragment.

[0038] In other embodiments, the antibody comprises (a) an immunoglobulin light chain variable region comprising the structure CDR_L1-CDR_L2-CDR_L3, and (b) an immunoglobulin heavy chain variable region, wherein the light chain variable region and the heavy chain variable region together define a single binding site for binding wild-type and mutant forms of human EGFR. A CDR_L1 comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 8 (07D06, 12D03) and SEQ ID NO: 29 (07D06, 12D03); a CDR_L2 comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 9 (07D06, 12D03) and KVS; and a CDR_L3 comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 10 (07D06) and SEQ ID NO: 18 (12D03).

[0039] In some embodiments, the antibody comprises an immunoglobulin light chain variable region comprising a CDR_LI an amino acid sequence selected from the group consisting of SEQ ID NO: 8 (07D06, 12D03) and SEQ ID NO: 29 (07D06, 12D03), a CDR_L2 comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 9 (07D06, 12D03) and KVS, and a CDR_L3 comprising the amino acid sequence of SEQ ID NO: 10 (07D06).

[0040] In one embodiment, the antibody comprises an immunoglobulin light chain variable region comprising a CDR_L1 comprising the amino acid sequence of SEQ ID NO: 8 (07D06, 12D03), a CDR_L2 comprising the amino acid sequence of SEQ ID NO: 9 (07D06, 12D03), and a CDR_L3 comprising the amino acid sequence of SEQ ID NO: 10 (07D06).

[0041] In one embodiment, the antibody comprises an immunoglobulin light chain variable region comprising a CDR_L1 comprising the amino acid sequence of SEQ ID NO: 29 (07D06, 12D03), a CDR_L2 comprising the amino acid sequence of KVS, and a CDR_L3 comprising the amino acid sequence of SEQ ID NO: 10 (07D06).

[0042] In some embodiments, the antibody comprises an immunoglobulin light chain variable region comprising a CDR_L1 an amino acid sequence selected from the group consisting of SEQ ID NO: 8 (07D06, 12D03) and SEQ ID NO: 29 (07D06, 12D03), a CDR_L2 comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 9 (07D06, 12D03) and KVS, and a CDR_L3 comprising the amino acid sequence of SEQ ID NO: 18 (12D03).

[0043] In one embodiment, the antibody comprises an immunoglobulin light chain variable region comprising a CDR_LI comprising the amino acid sequence of SEQ ID NO: 8 (07D06, 12D03), a CDR_L2 comprising the amino acid sequence of SEQ ID NO: 9 (07D06, 12D03), and a CDR_L3 comprising the amino acid sequence of SEQ ID NO: 18 (12D03).

[0044] In one embodiment, the antibody comprises an immunoglobulin light chain variable region comprising a CDR_LI comprising the amino acid sequence of SEQ ID NO: 29 (07D06, 12D03), a CDR_L2 comprising the amino acid sequence of KVS, and a CDR_L3 comprising the amino acid sequence of SEQ ID NO: 18 (12D03).

[0045] Preferably, the CDR_Li, CDR_L2, and CDR_L3 sequences are interposed between human or humanized immunoglobulin FRs. The antibody can be an intact antibody or an antigen-binding antibody fragment.

[0046] In some embodiments, the antibody comprises: (a) an immunoglobulin heavy chain variable region comprising the structure CDR_Hi-CDR_H2-CDR_H3 and (b) an immunoglobulin light chain variable region comprising the structure CDR_LI -CDR_L2-CDR_L3, wherein the heavy chain variable region and the light chain variable region together define a single binding site for binding wild-type and mutant forms of human EGFR. The CDR_HI comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 5 (07D06), SEQ ID NO: 19

(07D06), SEQ ID NO: 15 (12D03) and SEQ ID NO: 21 (12D03); the CDR_H2 comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 6 (07D06), SEQ ID NO: 20 (07D06), SEQ ID NO: 16 (12D03) and SEQ ID NO: 22 (12D03); and the CDR_H3 comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 7

(07D06) and SEQ ID NO: 17 (12D03). The CDR_L1 comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 8 (07D06, 12D03) and SEQ ID NO: 29 (07D06, 12D03); the CDR_L2 comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 9 (07D06, 12D03) and KVS; and the CDR_L3 comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 10 (07D06) and SEQ ID NO: 18 (12D03).

[0047] In some embodiments, the antibody comprises (i) an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 2 (07D06), and (ii) an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO: 4 (07D06).

[0048] In some embodiments, the antibody comprises (i) an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 12 (12D03), and (ii) an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO: 14 (12D03).

[0049] In some embodiments, the antibody comprises (i) an immunoglobulin heavy chain comprising the amino acid sequence of SEQ ID NO: 39 (07D06), and (ii) an immunoglobulin light chain comprising the amino acid sequence of SEQ ID NO: 41 (07D06).

[0050] In some embodiments, the antibody comprises (i) an immunoglobulin heavy chain comprising the amino acid sequence of SEQ ID NO: 43 (12D03), and (ii) an immunoglobulin light chain comprising the amino acid sequence of SEQ ID NO: 45 (12D03).

[0051] In other embodiments, an isolated antibody that binds wild-type and mutant forms of human EGFR comprises an immunoglobulin heavy chain variable region comprising an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identical to the entire variable region or the framework region sequence of SEQ ID NO: 2 (07D06) or SEQ ID NO: 12 (12D03). [0052] In other embodiments, an isolated antibody that binds wild-type and mutant forms of human EGFR comprises an immunoglobulin light chain variable region comprising an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identical to the entire variable region or the framework region sequence of SEQ ID NO: 4 (07D06) or SEQ ID NO: 14 (12D03).

[0053] Homology or identity may be determined in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. BLAST (Basic Local Alignment Search Tool) analysis using the algorithm employed by the programs blastp, blastn, blastx, tblastn and tblastx (Karlin et al, (1990) PROC. NATL. ACAD. SCI. USA 87, 2264-2268; Altschul, (1993) J. MOL. EVOL. 36, 290-300; Altschul et al, (1997) NUCLEIC ACIDS RES. 25, 3389-3402, incorporated by reference) are tailored for sequence similarity searching. The approach used by the BLAST program is to first consider similar segments between a query sequence and a database sequence, then to evaluate the statistical significance of all matches that are identified and finally to summarize only those matches which satisfy a preselected threshold of significance. For a discussion of basic issues in similarity searching of sequence databases see Altschul et al, (1994) NATURE GENETICS 6, 119-129 which is fully incorporated by reference. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. The search parameters for histogram, descriptions, alignments, expect (i.e., the statistical significance threshold for reporting matches against database sequences), cutoff, matrix and filter are at the default settings. The default scoring matrix used by blastp, blastx, tblastn, and tblastx is the BLOSUM62 matrix (Henikoff et al, (1992) PROC. NATL. ACAD. SCI. USA 89, 10915-10919, fully incorporated by reference). Four blastn parameters may be adjusted as follows: Q=10 (gap creation penalty); R=10 (gap extension penalty); wink=l (generates word hits at every wink.sup.th position along the query); and gapw=16 (sets the window width within which gapped alignments are generated). The equivalent Blastp parameter settings may be Q=9; R=2; wink=l; and gapw=32. Searches may also be conducted using the NCBI (National Center for Biotechnology Information) BLAST Advanced Option parameter (e.g.: -G, Cost to open gap [Integer]: default = 5 for nucleotides/ 11 for proteins; -E, Cost to extend gap [Integer]: default = 2 for nucleotides/ 1 for proteins; -q, Penalty for nucleotide mismatch [Integer]: default = -3; -r, reward for nucleotide match [Integer]: default = 1; -e, expect value [Real]: default = 10; -W, wordsize [Integer]: default = 11 for nucleotides/ 28 for megablast/ 3 for proteins; -y, Dropoff (X) for blast extensions in bits: default = 20 for blastn/ 7 for others; -X, X dropoff value for gapped alignment (in bits): default = 15 for all programs, not applicable to blastn; and -Z, final X dropoff value for gapped alignment (in bits): 50 for blastn, 25 for others). ClustalW for pairwise protein alignments may also be used (default parameters may include, e.g., Blosum62 matrix and Gap Opening Penalty = 10 and Gape Extension Penalty = 0.1). A Bestfit comparison between sequences, available in the GCG package version 10.0, uses DNA parameters GAP=50 (gap creation penalty) and LEN=3 (gap extension penalty) and the equivalent settings in protein comparisons are GAP=8 and LEN=2.

[0054] In each of the foregoing embodiments, it is contemplated herein that

immunoglobulin heavy chain variable region sequences and/or light chain variable region sequences that together bind wild-type and mutant forms of human EGFR may contain amino acid alterations (e.g., at least 1, 2, 3, 4, 5, or 10 amino acid substitutions, deletions, or additions) in the framework regions of the heavy and/or light chain variable regions.

[0055] In some embodiments of the invention, the antibody binds hEGFR with a K_D of 10 nM, 7.5 nM, 5 nM, 2.5 nM, 500 pM, 400 pM, 250 pM, 100 pM or lower. Unless otherwise specified, K_D values are determined by surface plasmon resonance methods under the conditions described in Example 5.

[0056] In some embodiments, the antibodies inhibit hEGFR binding to rh-pro-EGF. For example, the antibodies can have an IC₅₀ (concentration at 50% of maximum inhibition) of about 5 nM, 2 nM, 1 nM or lower, when assayed using the protocol described in Example 6.

Production of Antibodies

[0057] Methods for producing antibodies of the invention are known in the art. For example, DNA molecules encoding light chain variable regions and heavy chain variable regions can be chemically synthesized using the sequence information provided herein.

Synthetic DNA molecules can be ligated to other appropriate nucleotide sequences, including, e.g., constant region coding sequences, and expression control sequences, to produce conventional gene expression constructs encoding the desired antibodies. Production of defined gene constructs is within routine skill in the art. Alternatively, the sequences provided herein can be cloned out of hybridomas by conventional hybridization techniques or polymerase chain reaction (PCR) techniques, using synthetic nucleic acid probes whose sequences are based on sequence information provided herein, or prior art sequence

information regarding genes encoding the heavy and light chains of murine antibodies in hybridoma cells. [0058] Nucleic acids encoding desired antibodies can be incorporated (ligated) into expression vectors, which can be introduced into host cells through conventional transfection or transformation techniques. Exemplary host cells are E. coli cells, Chinese hamster ovary (CHO) cells, HeLa cells, baby hamster kidney (BHK) cells, monkey kidney cells (COS), human hepatocellular carcinoma cells (e.g., Hep G2), and myeloma cells that do not otherwise produce IgG protein. Transformed host cells can be grown under conditions that permit the host cells to express the genes that encode the immunoglobulin light or heavy chain variable regions.

[0059] Specific expression and purification conditions will vary depending upon the expression system employed. For example, if a gene is to be expressed in E. coli, it is first cloned into an expression vector by positioning the engineered gene downstream from a suitable bacterial promoter, e.g., Trp or Tac, and a prokaryotic signal sequence. The expressed secreted protein accumulates in refractile or inclusion bodies, and can be harvested after disruption of the cells by French press or sonication. The refractile bodies then are solubilized, and the proteins refolded and cleaved by methods known in the art. [0060] If the engineered gene is to be expressed in eukayotic host cells, e.g., CHO cells, it is first inserted into an expression vector containing a suitable eukaryotic promoter, a secretion signal, IgG enhancers, and various introns. This expression vector optionally contains sequences encoding all or part of a constant region, enabling an entire, or a part of, a heavy or light chain to be expressed. The gene construct can be introduced into eukaryotic host cells using convention techniques. The host cells express VL or VH fragments, VL-VH heterodimers, VH-VL or VL-VH single chain polypeptides, complete heavy or light immunoglobulin chains, or portions thereof, each of which may be attached to a moiety having another function (e.g. , cytotoxicity). In some embodiments, a host cell is transfected with a single vector expressing a polypeptide expressing an entire, or part of, a heavy chain (e.g., a heavy chain variable region) or a light chain (e.g., a light chain variable region). In other embodiments, a host cell is transfected with a single vector encoding (a) a polypeptide comprising a heavy chain variable region and a polypeptide comprising a light chain variable region, or (b) an entire immunoglobulin heavy chain and an entire immunoglobulin light chain. In still other embodiments, a host cell is co-transfected with more than one expression vector (e.g., one expression vector encoding a polypeptide comprising an entire, or part of, a heavy chain or heavy chain variable region, and another expression vector encoding a polypeptide comprising an entire, or part of, a light chain or light chain variable region).

[0061] A polypeptide comprising an immunoglobulin heavy chain variable region or light chain variable region can be produced by growing a host cell transfected with an expression vector encoding such variable region, under conditions that permit expression of the polypeptide. Following expression, the polypeptide can be harvested and purified using techniques well known in the art, e.g., affinity tags such as glutathione-S-transferase (GST) and histidine tags.

[0062] A monoclonal antibody that binds human EGFR, or an antigen-binding fragment of the antibody, can be produced by growing a host cell transfected with: (a) an expression vector that encodes a complete or partial immunoglobulin heavy chain, and a separate expression vector that encodes a complete or partial immunoglobulin light chain; or (b) a single expression vector that encodes both chains (e.g., complete or partial heavy and light chains), under conditions that permit expression of both chains. The intact antibody (or antigen-binding fragment of the antibody) can be harvested and purified using techniques well known in the art, e.g., Protein A, Protein G, affinity tags such as glutathione-S-transferase (GST) and histidine tags. It is within ordinary skill in the art to express the heavy chain and the light chain from a single expression vector or from two separate expression vectors.

Antibody Modifications

[0063] Methods for reducing or eliminating the antigenicity of antibodies and antibody fragments are known in the art. When the antibodies are to be administered to a human, the antibodies preferably are "humanized" to reduce or eliminate antigenicity in humans.

Preferably, the humanized antibodies have the same or substantially the same affinity for the antigen as the non-humanized mouse antibody from which it was derived.

[0064] In one humanization approach, chimeric proteins are created in which mouse immunoglobulin constant regions are replaced with human immunoglobulin constant regions. See, e.g., Morrison et al, 1984, PROC. NAT. ACAD. SCI. 81:6851-6855, Neuberger et al, 1984, NATU E 312:604-608; U.S. Patent Nos. 6,893,625 (Robinson); 5,500,362 (Robinson); and 4,816,567 (Cabilly).

[0065] In an approach known as CDR grafting, the CDRs of the light and heavy chain variable regions are grafted into frameworks from another species. For example, murine CDRs can be grafted into human FRs. In some embodiments of the invention, the CDRs of the light and heavy chain variable regions of an anti-EGFR antibody are grafted into human FRs or consensus human FRs. To create consensus human FRs, FRs from several human heavy chain or light chain amino acid sequences are aligned to identify a consensus amino acid sequence. CDR grafting is described in U.S. Patent Nos. 7,022,500 (Queen); 6,982,321 (Winter);

6, 180,370 (Queen); 6,054,297 (Carter); 5,693,762 (Queen); 5,859,205 (Adair); 5,693,761

(Queen); 5,565,332 (Hoogenboom); 5,585,089 (Queen); 5,530, 101 (Queen); Jones et al. ( 1986) NATURE 321 : 522-525; Riechmann et al. ( 1988) NATURE 332: 323-327; Verhoeyen et al.

(1988) SCIENCE 239: 1534- 1536; and Winter ( 1998) FEBS LETT 430: 92-94.

[0066] In an approach called "SUPERHUMANIZATION™," human CDR sequences are chosen from human germline genes, based on the structural similarity of the human CDRs to those of the mouse antibody to be humanized. See, e.g., U.S. Patent No. 6,881 ,557 (Foote); and Tan et al, 2002, J. IMMUNOL. 169: 1 1 19- 1 125.

[0067] Other methods to reduce immunogenicity include "reshaping,"

"hyperchimerization," and "veneering/resurfacing." See, e.g., Vaswami et al., 1998, ANNALS OF ALLERGY, ASTHMA, & IMMUNOL. 81 : 105; Roguska et al. , 1996, PROT. ENGINEER 9:895-904; and U.S. Patent No. 6,072,035 (Hardman). In the veneering/resurfacing approach, the surface accessible amino acid residues in the murine antibody are replaced by amino acid residues more frequently found at the same positions in a human antibody. This type of antibody resurfacing is described, e.g., in U.S. Patent No. 5,639,641 (Pedersen).

[0068] Another approach for converting a mouse antibody into a form suitable for medical use in humans is known as ACTIVMAB™ technology (Vaccinex, Inc., Rochester, NY), which involves a vaccinia virus-based vector to express antibodies in mammalian cells. High levels of combinatorial diversity of IgG heavy and light chains are said to be produced. See, e.g., U.S. Patent Nos. 6,706,477 (Zauderer); 6,800,442 (Zauderer); and 6,872,518 (Zauderer).

[0069] Another approach for converting a mouse antibody into a form suitable for use in humans is technology practiced commercially by KaloBios Pharmaceuticals, Inc. (Palo Alto, CA). This technology involves the use of a proprietary human "acceptor" library to produce an "epitope focused" library for antibody selection.

[0070] Another approach for modifying a mouse antibody into a form suitable for medical use in humans is HUMAN ENGINEERING™ technology, which is practiced commercially by XOMA (US) LLC. See, e.g. , PCT Publication No. WO 93/11794 and U.S. Patent Nos.

5,766,886; 5,770,196; 5,821,123; and 5,869,619.

[0071] Any suitable approach, including any of the above approaches, can be used to reduce or eliminate human immunogenicity of an antibody of the invention.

[0072] If the antibody is for use as a therapeutic, it can be conjugated to an effector agent such as a small molecule toxin or a radionuclide using standard in vitro conjugation chemistries. If the effector agent is a polypeptide, the antibody can be chemically conjugated to the effector or joined to the effector as a fusion protein. Construction of fusion proteins is within ordinary skill in the art.

Use of Antibodies

[0073] Antibodies of the invention can be used to treat various forms of cancer, e.g., non- small cell lung cancer, breast, ovarian, prostate, cervical, colorectal, lung, brain, pancreatic, gastric, and head and neck cancers. The cancer cells are exposed to a therapeutically effective amount of the antibody so as to inhibit or reduce proliferation of the cancer cell. In some embodiments, the antibodies inhibit cancer cell proliferation by at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or 100%.

[0074] In some embodiments, the antibody inhibits or reduces proliferation of a tumor cell by inhibiting binding of human EGFR to an EGFR ligand, e.g., EGF, TGF-a, HB-EGF, betacellulin, epiregulin, amphiregulin, epigen, etc. The antibody can be used in a method to inhibit tumor growth in a human patient. The method comprises administering to the patient a therapeutically effective amount of the antibody.

[0075] Cancers associated with activation and/or overexpression of EGFR^L858R/T790M or wild type EGFR include non-small cell lung cancer, breast cancer, ovarian cancer, prostate cancer, cervical cancer , lung cancer, brain cancers (e.g., glioblastoma, astrocytoma, neuroblastoma), melanomas, gastrointestinal cancers (e.g., colorectal, pancreatic, and gastric), and head and neck cancer. [0076] As used herein, "treat, "treating" and "treatment" mean the treatment of a disease in a mammal, e.g., in a human. This includes: (a) inhibiting the disease, i.e., arresting its development; and (b) relieving the disease, i.e., causing regression of the disease state; and (d) curing the disease.

[0077] Generally, a therapeutically effective amount of active component is in the range of 0.1 mg/kg to 100 mg/kg, e.g., 1 mg/kg to 100 mg/kg, 1 mg/kg to 10 mg/kg. The amount administered will depend on variables such as the type and extent of disease or indication to be treated, the overall health of the patient, the in vivo potency of the antibody, the pharmaceutical formulation, and the route of administration. The initial dosage can be increased beyond the upper level in order to rapidly achieve the desired blood-level or tissue level. Alternatively, the initial dosage can be smaller than the optimum, and the daily dosage may be progressively increased during the course of treatment. Human dosage can be optimized, e.g., in a conventional Phase I dose escalation study designed to run from 0.5 mg/kg to 20 mg/kg.

Dosing frequency can vary, depending on factors such as route of administration, dosage amount and the disease being treated. Exemplary dosing frequencies are once per day, once per week and once every two weeks. A preferred route of administration is parenteral, e.g., intravenous infusion. Formulation of monoclonal antibody-based drugs is within ordinary skill in the art. In some embodiments of the invention, the antibody is lyophilized and reconstituted in buffered saline at the time of administration.

[0078] For therapeutic use, an antibody of the invention preferably is combined with a pharmaceutically acceptable carrier. As used herein, "pharmaceutically acceptable carrier" means buffers, carriers, and excipients suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio. The carrier(s) should be "acceptable" in the sense of being compatible with the other ingredients of the formulations and not deleterious to the recipient. Pharmaceutically acceptable carriers include buffers, solvents, dispersion media, coatings, isotonic and absorption delaying agents, and the like, that are compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is known in the art.

[0079] Pharmaceutical compositions containing antibodies of the invention can be presented in a dosage unit form and can be prepared by any suitable method. A pharmaceutical composition should be formulated to be compatible with its intended route of administration. Examples of routes of administration are intravenous (IV), intradermal, inhalation, transdermal, topical, transmucosal, and rectal administration. A preferred route of administration for monoclonal antibodies is IV infusion. Useful formulations can be prepared by methods well known in the pharmaceutical art. For example, see Remington's Pharmaceutical Sciences, 18th ed. (Mack Publishing Company, 1990). Formulation components suitable for parenteral administration include a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl paraben; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as EDTA; buffers such as acetates, citrates or phosphates; and agents for the adjustment of tonicity such as sodium chloride or dextrose.

[0080] For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor ELTM (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). The carrier should be stable under the conditions of manufacture and storage, and should be preserved against microorganisms. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol), and suitable mixtures thereof.

[0081] Pharmaceutical formulations preferably are sterile. Sterilization can be

accomplished, for example, by filtration through sterile filtration membranes. Where the composition is lyophilized, filter sterilization can be conducted prior to or following

lyophilization and reconstitution.

EXAMPLES

[0082] The following Examples are merely illustrative and are not intended to limit the scope or content of the invention in any way.

Example 1: Cell Lines

[0083] BaF3 cells were infected by lentiviruses engineered to express human EGFR^L858R, EGFRvIII, EGFR ⁹ or EGFR^L858R/T790M. Infected cells were selected with blasticidin (50 μg/ml). Individual colonies were isolated and tested for expression of both receptors. Mutant EGFR-expressing clones were maintained in culture under blasticidin selection with 90% RPMI Medium 1640 (GIBCO, Cat. No. 11875-093), and 10% fetal bovine serum.

Example 2: EGFR Dimerization

[0084] BaF3/EGFR^L858R, BaF3/EGFR^L858R/T790M and NSCLC H1975 cells (ATCC, Cat. No. CRL-5908), which express _EGFR^L858R/T790M _{5 wer}e maintained as recommended by ATCC. Cells were serum starved overnight and next day stimulated with EGF (R&D Systems, Cat. No. 236-EG) (50 ng/ml) stimulation for 15 minutes. Cell surface proteins were cross-linked using BS3 (Bis [sulfosuccinimidyl] suberate) (Pierce, Cat. No. 21585) according to the vendor's protocol. Dimerization of EGFR was measured by Western blot.

[0085] This experiment demonstrated that EGFR^L858R formed homodimers spontaneously, and addition of EGF increased the fraction of homodimers. EGFR did not form dimers in either BaF3/EGFR^L858R/T790M or H1975 with or without EGF stimulation. This data suggests that EGFR does not require dimerization to be activated.

Example 3: Production of Pan-EGFR Monoclonal Antibodies

[0086] Four A J mice and two Balb/c mice were immunized with recombinant human EGFR/Fc (R&D Systems, Cat. No. 344ER). Two sets of immunization were performed.

Cohort 1 mice (2 A J mice), were immunized with rhEGFR cleaved from the Fc moiety

(cleaved rhEGFR) (Immunization A). Cohort 2 mice (2 AJ mice and 2 Balb/c mice), were initially immunized with cleaved rhEGFR (as in cohort 1), then boosted with

BaF3/EGFR^L858R/T790M cells (10⁶ cells/mouse).

[0087] Sera displaying high anti-EGFR activity, as measured by Enzyme Linked

Immunosorbent Assay (ELISA), were chosen for subsequent fusion. Spleens and lymph nodes from the selected mice were harvested. B -cells then were collected and fused with a myeloma line. Fusion products were serially diluted onto forty 96-well plates to near clonality. A total of 7,040 supematants from the resulting fusions were screened for binding to recombinant rhEGFR/Fc using ELISA. The same supematants were also screened for binding to CHO cells, BaF3 cells, or 293T cells expressing human £QPR^L858R/T790M (Mesoscale electrochemi- luminescence assay). A total of 560 supematants identified as containing anti-EGFR antibodies were further characterized by in vitro biochemical assays and cell-based assays, as discussed below. A panel of hybridomas was selected, subcloned and expanded. Hybridoma cell lines were transferred to BioXCell (West Lebanon, NH) for antibody expression and purification by affinity chromatography on Protein G resin. The immunizations, fusions, and primary screens were conducted at Maine Biotechnology Services (Portland, ME), following the Repetitive Immunization Multiple Sites (RIMMS) protocol.

Example 4: Sequence Analysis

[0088] The light-chain isotype and heavy chain isotype of the monoclonal antibodies were determined using the IsoStrip™ Mouse Monoclonal Antibody Isotyping Kit according to the kit vendor's instructions (Roche Applied Science, Indianapolis, IN). The antibodies were found to be Kappa light chain and IgGl heavy chain.

[0089] The heavy and light chain variable regions of the mouse monoclonal antibodies were sequenced using 5' RACE (Rapid Amplification of cDNA Ends). Total RNA was extracted from each monoclonal hybridoma cell line using the RNeasy Miniprep kit according to the vendor's instructions (Qiagen, Valencia, CA). Full-length first strand cDNA containing 5' ends was generated using the SMARTer™ RACE cDNA Amplification Kit (Clontech, Mountain View, CA) according to the kit vendor's instructions, using random primers for 5' RACE.

[0090] The variable regions of the Kappa and Heavy IgG chains were amplified by PCR, using KOD Hot Start Polymerase (EMD Chemicals, Gibbstown, NJ) according to the kit vendor's instructions. For amplification of 5' cDNA, the Universal Primer Mix A primer (Clontech), a mix of

5 ' CTAATACGACTC ACTATAGGGCAAGC AGTGGTATCAACGCAGAGT 3' (SEQ ID NO: 46) and 5' CTAATACGACTCACTATAGGGC 3' (SEQ ID NO: 47), was used as a 5' primer. Heavy chain variable regions were amplified using the above 5' primers and a 3' IgGl Constant Region specific primer: 5' TATGCAAGGCTTACAACCACA 3' (SEQ ID NO: 48). Kappa chain variable regions were amplified with the above 5' primers and a 3' Kappa Constant Region specific primer: 5' CTCATTCCTGTTGAAGCTCTTGACAAT 3' (SEQ ID NO: 49).

[0091] Individual PCR products were isolated by agarose gel electrophoresis and purified using the Qiaquick® Gel Purification kit according to the kit vendor's instructions (Qiagen). The PCR products were subsequently cloned into the pCR®4Blunt plasmid using the Zero Blunt® TOPO® PCR Cloning Kit according to the kit vendor's instructions (Invitrogen, Carlsbad, CA) and transformed into DH5-a-TlR bacteria (Invitrogen) through standard molecular biology techniques. Plasmid DNA isolated from transformed bacterial clones was sequenced using M13 Forward (5' GTAAAACGACGGCCAGT 3') (SEQ ID NO: 50) and M13 Reverse primers (5' CAGGAAACAGCTATGACC 3') (SEQ ID NO: 51) by Beckman Coulter Genomics (Danver, MA), using standard dideoxy DNA sequencing methods to identify the sequence of the variable region sequences. The sequences were analyzed using Vector NTI software (Invitrogen) and the IMGT/V-Quest software (http://imgt.cines.fr) to identify and confirm variable region sequences.

[0092] The nucleic acid sequences encoding and the protein sequences defining variable regions of the murine monoclonal antibodies are summarized below (amino terminal signal peptide sequences are not shown). CDR sequences (Kabat definition) are shown in

bold/underlined in the amino acid sequences.

[0093] Nucleic Acid Sequence Encoding the Heavy Chain Variable Region of the 07D06 Antibody (SEQ ID NO: 1)

1 cagatccagt tggtgcagtc tggacctgag ctgaagaagc ctggagagac agtcaagatc 61 tcctgcaagg cctctgggta taccttcaca gaatatccaa tacactgggt gaagcaggct 121 ccaggaaagg gtttcaagtg gatgggcatg atatacaccg acattggaaa gccaacatat 181 gctgaagagt tcaagggacg gtttgccttc tctttggaga cctctgccag cactgcctat 241 ttgcagatca acaacctcaa gaatgaggac acggctacat atttctgtgt aagagatcga 301 tatgattccc tctttgacta ctggggccaa ggcaccactc tcacagtctc ctca [0094] Protein Sequence Defining the Heavy Chain Variable Region of the 07D06

Antibody (SEQ ID NO: 2)

1 qiqlvqsgpe lkkpgetvki sckasgytft eypihwvkqa pgkgfkwmgm iytdigkpty 61 aeefkgrfaf sletsastay lqinnlkned tatyfcvrdr ydslfdywgq gttltvss [0095] Nucleic Acid Sequence Encoding the Kappa Chain Variable Region of the 07D06 Antibody (SEQ ID NO: 3)

1 gatgttgtga tgacccaaac tccactctcc ctgcctgtca gtcttggaga tcaagcctcc

61 atctcttgca gatctagtca gagccttgta cacagtaatg gaaacaccta tttacattgg

121 tacctgcaga agccaggcca gtctccaaag ctcctgatct acaaagtttc caaccgattt 181 tctggggtcc cagacaggtt cagtggcagt ggatcaggga cagatttcac actcaagatc

241 agcagagtgg aggctgagga tctgggagtt tatttctgct ctcaaagtac acatgttccg

301 tggacgttcg gtggaggcac caagctggaa atcaaa [0096] Protein Sequence Defining the Kappa Chain Variable Region of the 07D06 Antibody (SEQ ID NO: 4)

1 d vmtqtpls lpvslgdqas iscrssqslv hsngntylhw ylqkpgqspk lliykvsnrf 61 sgvpdrfsgs gsgtdftlki srveaedlgv yfcsqsthvp wtfgggtkle ik

[0097] Nucleic Acid Sequence Encoding the Heavy Chain Variable Region of the 12D03 Antibody (SEQ ID NO: 11)

1 gaaatgcagc tggtggagtc tgggggaggc ttcgtgaagc ctggagggtc cctgaaactc

61 tcatgtgcag cctctggatt cgctttcagt cactatgaca tgtcttgggt tcgccagact 121 ccgaagcaga ggctggagtg ggtcgcatac attgctagtg gtggtgatat cacctactat

181 gcagacactg tgaagggccg attcaccatc tccagagaca atgcccagaa caccctgtac

241 ctgcaaatga gcagtctgaa gtctgaggac acagccatgt tttactgttc acgatcctcc

301 tatggtaaca acggagatgc cctggacttc tggggtcaag gtacctcagt caccgtctcc 361 tea

[0098] Protein Sequence Defining the Heavy Chain Variable Region of the 12D03 Antibody (SEQ ID NO: 12)

1 emqlvesggg fvkpggslkl scaasgfafs hydmswvrqt pkqrlewvay_ iasggdityy 61 adtvkgrfti srdnaqntly lqmsslksed tamfycsrs_s ygnngdaldf wgqgtsvtvs 121 s

[0099] Nucleic Acid Sequence Encoding the Kappa Chain Variable Region of the 12D03

Antibody (SEQ ID NO: 13)

1 gatgttgtga tgacccaaac tccactctcc ctgcctgtca gtcttggaga tcaagcctcc 61 atetcttgea gatctagtca gagccttgtt cacagtaatg gaaacaccta tttacattgg

121 tacctgeaga agccaggcca gtctccaaag ctcctgatct acaaagtttc caaccgattt

181 tctggggtcc cagacaggtt cagtggcagt ggatcaggga cagatttcac actcaagatc

241 agcagagtgg aggctgagga tctgggagtt tatttctget ctcaaagtac acatgttctc

301 aegttegget eggggacaaa gttggaaata aaa

[0100] Protein Sequence Defining the Kappa Chain Variable Region of the 12D03 Antibody (SEQ ID NO: 14)

1 dvvmtqtpls lpvslgdqas iscrssqslv hsngntylhw ylqkpgqspk lliykvsnrf

61 sgvpdrfsgs gsgtdftlki srveaedlgv yfcsqsthyl tfgsgtklei k [0101] The amino acid sequences defining the immunoglobulin heavy chain variable regions for the antibodies produced in Example 1 are aligned in FIG. 2. Amino terminal signal peptide sequences (for proper expression/secretion) are not shown. CDR_l5 CDR₂, and CDR₃ (Kabat definition) are identified by boxes. FIG. 3 shows an alignment of the separate CDR_l5 CDR₂, and CDR₃ sequences for each antibody.

[0102] The amino acid sequences defining the immunoglobulin light chain variable regions for the antibodies in Example 1 are aligned in FIG. 4. Amino terminal signal peptide sequences (for proper expression/secretion) are not shown. CDR_l5 CDR₂ and CDR₃ are identified by boxes. FIG. 5 shows an alignment of the separate CDR_l5 CDR₂, and CDR₃ sequences for each antibody.

[0103] Table 1 shows the SEQ ID NO. of each sequence discussed in this Example.

Table 1

[0104] Mouse monoclonal antibody heavy chain CDR sequences (Kabat, Chothia, and IMGT definitions) are shown in Table 2.

Table 2

[0105] Mouse monoclonal antibody Kappa light chain CDR sequences (Kabat, Chothia, and IMGT definitions) are shown in Table 3.

Table 3

[0106] To create the complete heavy or kappa chain antibody sequences, each variable sequence above is combined with its respective constant region. For example, a complete heavy chain comprises a heavy variable sequence followed by the murine IgGl heavy chain constant sequence, and a complete kappa chain comprises a kappa variable sequence followed by the murine kappa light chain constant sequence.

[0107] Nucleic Acid Sequence Encoding 07D06 Murine IgGl Heavy Chain Constant Region (SEQ ID NO: 30)

1 gccaaaacga cacccccatc tgtctatcca ctggcccctg gatctgctgc ccaaactaac 61 tccatggtga ccctgggatg cctggtcaag ggctatttcc ctgagccagt gacagtgacc 121 tggaactctg gatccctgtc cagcggtgtg cacaccttcc cagctgtcct gcagtctgac 181 ctctacactc tgagcagctc agtgactgtc ccctccagca cctggcccag ccagaccgtc 241 acctgcaacg ttgcccaccc ggccagcagc accaaggtgg acaagaaaat tgtgcccagg 301 gattgtggtt gtaagccttg catatgtaca gtcccagaag tatcatctgt cttcatcttc 361 cccccaaagc ccaaggatgt gctcaccatt actctgactc ctaaggtcac gtgtgttgtg 421 gtagacatca gcaaggatga tcccgaggtc cagttcagct ggtttgtaga tgatgtggag 481 gtgcacacag ctcagacgca accccgggag gagcagttca acagcacttt ccgctcagtc

541 agtgaacttc ccatcatgca ccaggactgg ctcaatggca aggagttcaa atgcagggtc

601 aacagtgcag ctttccctgc ccccatcgag aaaaccatct ccaaaaccaa aggcagaccg

661 aaggctccac aggtgtacac cattccacct cccaaggagc agatggccaa ggataaagtc

721 agtctgacct gcatgataac agacttcttc cctgaagaca ttactgtgga gtggcagtgg

781 aatgggcagc cagcggagaa ctacaagaac actcagccca tcatggacac agatggctct

841 tacttcgtct acagcaagct caatgtgcag aagagcaact gggaggcagg aaatactttc

901 acctgctctg tgttacatga gggcctgcac aaccaccata ctgagaagag cctctcccac

961 tctcctggta aa

[0108] Protein Sequence Defining the 07D06 Murine IgGl Heavy Chain Constant Region (SEQ ID NO: 31)

1 akttppsvyp lapgsaaqtn smvtlgclvk gyfpepvtvt wnsgslssgv htfpavlqsd

61 lytlsssvtv psstwpsqtv tcnvahpass tkvdkkivpr dcgckpcict vpevssvfif

121 ppkpkdvlti tltpkvtcvv vdiskddpev qfswfvddve vhtaqtqpre eqfnstfrsv

181 selpimhqdw lngkefkcrv nsaafpapie ktisktkgrp kapqvytipp pkeqmakdkv

241 sltcmitdff peditvewqw ngqpaenykn tqpimdtdgs yfvysklnvq ksnweagntf 301 tcsvlheglh nhhtekslsh spgk

[0109] Nucleic Acid Sequence Encoding the 07D06 Murine Kappa Light Chain Constant Region (SEQ ID NO: 32)

1 cgggctgatg ctgcaccaac tgtatccatc ttcccaccat ccagtgagca gttaacatct

61 ggaggtgcct cagtcgtgtg cttcttgaac aacttctacc ccagagacat caatgtcaag

121 tggaagattg atggcagtga acgacaaaat ggtgtcctga acagttggac tgatcaggac

181 agcaaagaca gcacctacag catgagcagc accctcacat tgaccaagga cgagtatgaa

241 cgacataaca gctatacctg tgaggccact cacaagacat caacttcacc cattgtcaag

301 agcttcaaca ggaatgagtg t

[0110] Protein Sequence Defining the 07D06 Murine Kappa Light Chain Constant Region (SEQ ID NO: 33)

1 radaaptvsi fppsseqlts ggasvvcfln nfyprdinvk wkidgserqn gvlnswtdqd 61 skdstysmss tltltkdeye rhnsytceat hktstspivk sfnrnec [0111] Nucleic Acid Sequence Encoding the 12D03 Murine IgGl Heavy Chain Constant Region (SEQ ID NO: 34)

1 gccaaaacga cacccccatc tgtctatcca ctggcccctg gatctgctgc ccaaactaac

61 tccatggtga ccctgggatg cctggtcaag ggctatttcc ctgagccagt gacagtgacc

121 tggaactctg gatccctgtc cagcggtgtg cacaccttcc cagctgtcct gcagtctgac

181 ctctacactc tgagcagctc agtgactgtc ccctccagca cctggcccag cgagaccgtc

241 acctgcaacg ttgcccaccc ggccagcagc accaaggtgg acaagaaaat tgtgcccagg

301 gattgtggtt gtaagccttg catatgtaca gtcccagaag tatcatctgt cttcatcttc

361 cccccaaagc ccaaggatgt gctcaccatt actctgactc ctaaggtcac gtgtgttgtg

421 gtagacatca gcaaggatga tcccgaggtc cagttcagct ggtttgtaga tgatgtggag

481 gtgcacacag ctcagacgca accccgggag gagcagttca acagcacttt ccgctcagtc

541 agtgaacttc ccatcatgca ccaggactgg ctcaatggca aggagttcaa atgcagggtc

601 aacagtgcag ctttccctgc ccccatcgag aaaaccatct ccaaaaccaa aggcagaccg

661 aaggctccac aggtgtacac cattccacct cccaaggagc agatggccaa ggataaagtc

721 agtctgacct gcatgataac agacttcttc cctgaagaca ttactgtgga gtggcagtgg

781 aatgggcagc cagcggagaa ctacaagaac actcagccca tcatggacac agatggctct

841 tacttcgtct acagcaagct caatgtgcag aagagcaact gggaggcagg aaatactttc

901 acctgctctg tgttacatga gggcctgcac aaccaccata ctgagaagag cctctcccac

961 tctcctggta aa

[0112] Protein Sequence Defining the 12D03 Murine IgGl Heavy Chain Constant Region (SEQ ID NO: 35)

1 akttppsvyp lapgsaaqtn smvtlgclvk gyfpepvtvt wnsgslssgv htfpavlqsd

61 lytlsssvtv psstwpsetv tcnvahpass tkvdkkivpr dcgckpcict vpevssvfif

121 ppkpkdvlti tltpkvtcvv vdiskddpev qfswfvddve vhtaqtqpre eqfnstfrsv

181 selpimhqdw lngkefkcrv nsaafpapie ktisktkgrp kapqvytipp pkeqmakdkv

241 sltcmitdff peditvewqw ngqpaenykn tqpimdtdgs yfvysklnvq ksnweagntf 301 tcsvlheglh nhhtekslsh spgk

[0113] Nucleic Acid Sequence Encoding the 12D03 Murine Kappa Light Chain Constant Region (SEQ ID NO: 36)

1 cgggctgatg ctgcaccaac tgtatccatc ttcccaccat ccagtgagca gttaacatct

61 ggaggtgcct cagtcgtgtg cttcttgaac aacttctacc ccaaagacat caatgtcaag

121 tggaagattg atggcagtga acgacaaaat ggcgtcctga acagttggac tgatcaggac

181 agcaaagaca gcacctacag catgagcagc accctcacgt tgaccaagga cgagtatgaa

241 cgacataaca gctatacctg tgaggccact cacaagacat caacttcacc cattgtcaag 301 agcttcaaca ggaatgagtg t

[0114] Protein Sequence Defining the 12D03 Murine Kappa Light Chain Constant Region (SEQ ID NO: 37)

1 radaaptvsi fppsseqlts ggasvvcfln nfypkdinvk wkidgserqn gvlnswtdqd

61 skdstysmss tltltkdeye rhnsytceat hktstspivk sfnrnec

[0115] The following sequences represent the actual or contemplated full length heavy and light chain sequence (i.e., containing both the variable and constant regions sequences) for each antibody described in this Example. Signal sequences for proper secretion of the antibodies (e.g., signal sequences at the 5' end of the DNA sequences or the amino terminal end of the protein sequences) are not shown in the full length heavy and light chain sequences disclosed herein and are not included in the final secreted protein. Also not shown are stop codons for termination of translation required at the 3' end of the DNA sequences. It is within ordinary skill in the art to select a signal sequence and/or a stop codon for expression of the disclosed full length IgG heavy chain and light chain sequences. It is also contemplated that the variable region sequences can be ligated to other constant region sequences to produce active full length IgG heavy and light chains.

[0116] Nucleic Acid Sequence Encoding the Full Length Heavy Chain Sequence (Heavy Chain Variable Region and IgGl Constant Region) of 07D06 (SEQ ID NO: 38)

1 cagatccagt tggtgcagtc tggacctgag ctgaagaagc ctggagagac agtcaagatc 61 tcctgcaagg cctctgggta taccttcaca gaatatccaa tacactgggt gaagcaggct 121 ccaggaaagg gtttcaagtg gatgggcatg atatacaccg acattggaaa gccaacatat 181 gctgaagagt tcaagggacg gtttgccttc tctttggaga cctctgccag cactgcctat 241 ttgcagatca acaacctcaa gaatgaggac acggctacat atttctgtgt aagagatcga

301 tatgattccc tctttgacta ctggggccaa ggcaccactc tcacagtctc ctcagccaaa 361 acgacacccc catctgtcta tccactggcc cctggatctg ctgcccaaac taactccatg 421 gtgaccctgg gatgcctggt caagggctat ttccctgagc cagtgacagt gacctggaac 481 tctggatccc tgtccagcgg tgtgcacacc ttcccagctg tcctgcagtc tgacctctac 541 actctgagca gctcagtgac tgtcccctcc agcacctggc ccagccagac cgtcacctgc

601 aacgttgccc acccggccag cagcaccaag gtggacaaga aaattgtgcc cagggattgt 661 ggttgtaagc cttgcatatg tacagtccca gaagtatcat ctgtcttcat cttcccccca 721 aagcccaagg atgtgctcac cattactctg actcctaagg tcacgtgtgt tgtggtagac 781 atcagcaagg atgatcccga ggtccagttc agctggtttg tagatgatgt ggaggtgcac 841 acagctcaga cgcaaccccg ggaggagcag ttcaacagca ctttccgctc agtcagtgaa

901 cttcccatca tgcaccagga ctggctcaat ggcaaggagt tcaaatgcag ggtcaacagt

961 gcagctttcc ctgcccccat cgagaaaacc atctccaaaa ccaaaggcag accgaaggct

1021 ccacaggtgt acaccattcc acctcccaag gagcagatgg ccaaggataa agtcagtctg

1081 acctgcatga taacagactt cttccctgaa gacattactg tggagtggca gtggaatggg

1141 cagccagcgg agaactacaa gaacactcag cccatcatgg acacagatgg ctcttacttc

1201 gtctacagca agctcaatgt gcagaagagc aactgggagg caggaaatac tttcacctgc

1261 tctgtgttac atgagggcct gcacaaccac catactgaga agagcctctc ccactctcct

1321 ggtaaa

[0117] Protein Sequence Defining the Full Length Heavy Chain Sequence (Heavy Chain Variable Region and IgGl Constant Region) of 07D06 (SEQ ID NO: 39)

1 qiqlvqsgpe lkkpgetvki sckasgytft eypihwvkqa pgkgfkwmgm iytdigkpty 61 aeefkgrfaf sletsastay lqinnlkned tatyfcvrdr ydslfdywgq gttltvssak 121 ttppsvypla pgsaaqtnsm vtlgclvkgy fpepvtvtwn sgslssgvht fpavlqsdly 181 tlsssvtvps stwpsqtvtc nvahpasstk vdkkivprdc gckpcictvp evssvfifpp 241 kpkdvltitl tpkvtcvvvd iskddpevqf swfvddvevh taqtqpreeq fnstfrsvse 301 lpimhqdwln gkefkcrvns aafpapiekt isktkgrpka pqvytipppk eqmakdkvsl 361 tcmitdffpe ditvewqwng qpaenykntq pimdtdgsyf vysklnvqks nweagntftc 421 svlheglhnh htekslshsp gk

[0118] Nucleic Acid Sequence Encoding the Full Length Light Chain Sequence (Kappa Chain Variable Region and Constant Region) of 07D06 (SEQ ID NO: 40)

1 gatgttgtga tgacccaaac tccactctcc ctgcctgtca gtcttggaga tcaagcctcc

61 atctcttgca gatctagtca gagccttgta cacagtaatg gaaacaccta tttacattgg

121 tacctgcaga agccaggcca gtctccaaag ctcctgatct acaaagtttc caaccgattt

181 tctggggtcc cagacaggtt cagtggcagt ggatcaggga cagatttcac actcaagatc

241 agcagagtgg aggctgagga tctgggagtt tatttctgct ctcaaagtac acatgttccg

301 tggacgttcg gtggaggcac caagctggaa atcaaacggg ctgatgctgc accaactgta

361 tccatcttcc caccatccag tgagcagtta acatctggag gtgcctcagt cgtgtgcttc

421 ttgaacaact tctaccccag agacatcaat gtcaagtgga agattgatgg cagtgaacga

481 caaaatggtg tcctgaacag ttggactgat caggacagca aagacagcac ctacagcatg

541 agcagcaccc tcacattgac caaggacgag tatgaacgac ataacagcta tacctgtgag

601 gccactcaca agacatcaac ttcacccatt gtcaagagct tcaacaggaa tgagtgt [0119] Protein Sequence Defining the Full Length Light Chain Sequence (Kappa Chain

Variable Region and Constant Region) of 07D06 (SEQ ID NO: 41)

1 d vmtqtpls lpvslgdqas iscrssqslv hsngntylhw ylqkpgqspk lliykvsnrf

61 sgvpdrfsgs gsgtdftlki srveaedlgv yfcsqsthvp wtfgggtkle ikradaaptv

121 sifppsseql tsggas vcf lnnfyprdin vkwkidgser qngvlnswtd qdskdstysm

181 sstltltkde yerhnsytce athktstspi vksfnrnec

[0120] Nucleic Acid Sequence Encoding the Full Length Heavy Chain Sequence (Heavy Chain Variable Region and IgGl Constant Region) of 12D03 (SEQ ID NO: 42)

1 gaaatgcagc tggtggagtc tgggggaggc ttcgtgaagc ctggagggtc cctgaaactc

61 tcatgtgcag cctctggatt cgctttcagt cactatgaca tgtcttgggt tcgccagact

121 ccgaagcaga ggctggagtg ggtcgcatac attgctagtg gtggtgatat cacctactat

181 gcagacactg tgaagggccg attcaccatc tccagagaca atgcccagaa caccctgtac

241 ctgcaaatga gcagtctgaa gtctgaggac acagccatgt tttactgttc acgatcctcc

301 tatggtaaca acggagatgc cctggacttc tggggtcaag gtacctcagt caccgtctcc

361 tcagccaaaa cgacaccccc atctgtctat ccactggccc ctggatctgc tgcccaaact

421 aactccatgg tgaccctggg atgcctggtc aagggctatt tccctgagcc agtgacagtg

481 acctggaact ctggatccct gtccagcggt gtgcacacct tcccagctgt cctgcagtct

541 gacctctaca ctctgagcag ctcagtgact gtcccctcca gcacctggcc cagcgagacc

601 gtcacctgca acgttgccca cccggccagc agcaccaagg tggacaagaa aattgtgccc

661 agggattgtg gttgtaagcc ttgcatatgt acagtcccag aagtatcatc tgtcttcatc

721 ttccccccaa agcccaagga tgtgctcacc attactctga ctcctaaggt cacgtgtgtt

781 gtggtagaca tcagcaagga tgatcccgag gtccagttca gctggtttgt agatgatgtg

841 gaggtgcaca cagctcagac gcaaccccgg gaggagcagt tcaacagcac tttccgctca

901 gtcagtgaac ttcccatcat gcaccaggac tggctcaatg gcaaggagtt caaatgcagg

961 gtcaacagtg cagctttccc tgcccccatc gagaaaacca tctccaaaac caaaggcaga

1021 ccgaaggctc cacaggtgta caccattcca cctcccaagg agcagatggc caaggataaa

1081 gtcagtctga cctgcatgat aacagacttc ttccctgaag acattactgt ggagtggcag

1141 tggaatgggc agccagcgga gaactacaag aacactcagc ccatcatgga cacagatggc

1201 tcttacttcg tctacagcaa gctcaatgtg cagaagagca actgggaggc aggaaatact

1261 ttcacctgct ctgtgttaca tgagggcctg cacaaccacc atactgagaa gagcctctcc 1321 cactctcctg gtaaa [0121] Protein Sequence Defining the Full Length Heavy Chain Sequence (Heavy Chain

Variable Region and IgGl Constant Region) of 12D03 (SEQ ID NO: 43)

1 emqlvesggg fvkpggslkl scaasgfafs hydmswvrqt pkqrlewvay iasggdityy

61 adtvkgrfti srdnaqntly lqmsslksed tamfycsrss ygnngdaldf wgqgtsvtvs 121 sakttppsvy plapgsaaqt nsmvtlgclv kgyfpepvtv twnsgslssg vhtfpavlqs

181 dlytlsssvt vpsstwpset vtcnvahpas stkvdkkivp rdcgckpcic tvpevssvfi

241 fppkpkdvlt itltpkvtcv vdiskddpe vqfswfvddv evhtaqtqpr eeqfnstfrs

301 vselpimhqd wlngkefkcr vnsaafpapi ektisktkgr pkapqvytip ppkeqmakdk

361 vsltcmitdf fpeditvewq wngqpaenyk ntqpimdtdg syfvysklnv qksnweagnt 421 ftcsvlhegl hnhhteksls hspgk

[0122] Nucleic Acid Sequence Encoding the Full Length Light Chain Sequence (Kappa Chain Variable Region and Constant Region) of 12D03 (SEQ ID NO: 44)

1 gatgttgtga tgacccaaac tccactctcc ctgcctgtca gtcttggaga tcaagcctcc 61 atctcttgca gatctagtca gagccttgtt cacagtaatg gaaacaccta tttacattgg

121 tacctgcaga agccaggcca gtctccaaag ctcctgatct acaaagtttc caaccgattt

181 tctggggtcc cagacaggtt cagtggcagt ggatcaggga cagatttcac actcaagatc

241 agcagagtgg aggctgagga tctgggagtt tatttctgct ctcaaagtac acatgttctc

301 acgttcggct cggggacaaa gttggaaata aaacgggctg atgctgcacc aactgtatcc 361 atcttcccac catccagtga gcagttaaca tctggaggtg cctcagtcgt gtgcttcttg

421 aacaacttct accccaaaga catcaatgtc aagtggaaga ttgatggcag tgaacgacaa

481 aatggcgtcc tgaacagttg gactgatcag gacagcaaag acagcaccta cagcatgagc

541 agcaccctca cgttgaccaa ggacgagtat gaacgacata acagctatac ctgtgaggcc

601 actcacaaga catcaacttc acccattgtc aagagcttca acaggaatga gtgt

[0123] Protein Sequence Defining the Full Length Light Chain Sequence (Kappa Chain Variable Region and Constant Region) of 12D03 (SEQ ID NO: 45)

1 dvvmtqtpls lpvslgdqas iscrssqslv hsngntylhw ylqkpgqspk lliykvsnrf

61 sgvpdrfsgs gsgtdftlki srveaedlgv yfcsqsthvl tfgsgtklei kradaaptvs 121 ifppsseqlt sggasvvcfl nnfypkdinv kwkidgserq ngvlnswtdq dskdstysms

181 stltltkdey erhnsytcea thktstspiv ksfnrnec

[0124] Table 4 is a concordance chart showing the correspondence between the full length sequences of the antibodies with those presented in the Sequence Listing. Table 4

S Q II) NO. Nucleic Acid or Protein

38 07D0e ) Heavy Variable + IgGl Constant— nucleic acid

39 07D0e ) Heavy Variable + IgGl Constant— protein

40 07D0e ) Kappa Variable + Constant— nucleic acid

41 07D0e ) Kappa Variable + Constant— protein

42 12D02 > Heavy Variable + IgGl Constant— nucleic acid

43 12D02 > Heavy Variable + IgGl Constant— protein

44 12D02 > Kappa Variable + Constant— nucleic acid

45 12D02 > Kappa Variable + Constant— protein

Example 5: Binding Affinities

[0125] The binding affinities and kinetics of the binding of monoclonal antibodies 07D06 and 12D03 to recombinant human EGFR/Fc fusion protein (rhEGFR-Fc) (R&D Systems, Inc., Minneapolis, MN) were measured by surface plasmon resonance using a Biacore^® T100 instrument (GE Healthcare, Piscataway, NJ).

[0126] Rabbit anti-mouse IgGs (GE Healthcare) were immobilized on carboxymethylated dextran CM4 sensor chips (GE Healthcare) by amine coupling, using a standard coupling protocol according to vendor's instructions. The analyses were performed at 25°C and 37°C, using PBS containing 0.05% surfactant P20 (GE Healthcare) as running buffer.

[0127] The antibodies were captured in individual flow cells at a flow rate of 10 μΐ/minute. Injection time was varied for each antibody to yield an Rmax between 30 and 60 RU. Buffer and rhEGFR-Fc diluted in running buffer was injected sequentially over a reference surface (no antibody captured) and the active surface (antibody to be tested) for 300 seconds, at 60 μΐ/minute. The dissociation phase was monitored for up to 3600 seconds. The surface was then regenerated with two 60-second injections of 10 mM Glycine-HCl (pH 1.7), at a flow rate of 60 μΐ/minute. The rhEGFR-Fc protein concentration range tested was 20 nM to 1.25 nM (two-fold dilutions).

[0128] Kinetic parameters were determined using the kinetic function of the BIAevaluation software (GE Healthcare) with double reference subtraction. Kinetic parameters for each antibody, k_a (association rate constant), k_d (dissociation rate constant) and KD (equilibrium dissociation constant) were determined. Kinetic values of the monoclonal antibodies on rhEGFR-Fc at 25°C and 37°C are summarized in Table 5.

Table 5

[0129] The results in Table 5 demonstrate that antibodies 07D06 and 12D03 bind rhEGFR- Fc with a KD of about 10 nM or less, 7.5 nM or less, 5 nM or less, 2.5 nM or less, 500 pM or less, 400 pM or less, 250 p M or less, 100 pM or less.

Example 6: Neutralization Activity

[0130] The antibodies were tested for inhibition of recombinant human pro-EGF binding to wild-type human EGFR extracellular domain (ECD). Standard 96- well binding plates (Meso Scale Discovery, Cat. No. L15XA-6) were coated with 50 μΐ of 0.5 μg/ml rhEGFR/Fc (R&D systems, Cat. No.348-RB) in PBS for overnight at 4°C with no agitation. The plates then were washed three times with PBS/0.1% Tween 20 and blocked with 200 μΐ of PBS containing 5% BSA for 1.5 hour, at room temperature. After washing the plates three times with PBS, 25 μΐ of the antibody dilutions were added to the plates for another hour at room temperature with agitation. Ligand rh-pro-EGF (R&D Systems, Cat. No. 4289-EG-025, 112 kDa) was added to the wells at the final concentration of 0.25 μg/ml. The plates were washed three times with PBS and incubated with 25 μΐ of 1 μg/ml human EGF biotinylated affinity purified polyclonal antibody (R&D systems, Cat. No BAF236) that was pre-incubated for one hour with SULTO- TAG Streptavidin (Meso Scale Discovery, Cat. No R32AD-5) for one hour at room

temperature with agitation. The plates were washed three times with PBS, and 150 μΐ of IX read buffer (Meso Scale Discovery, Cat. No. R92TC-1) was added to each well before the plates were analyzed on a Sector Imager 2400 instrument (Meso Scale Discovery). The interaction of rh-pro-EGF with EGFR was inhibited by antibodies cetuximab, panitumumab and antibody 12D03. Antibody 07D06 displayed minimal inhibition of pro-EGF binding to EGFR (FIG.6). The IC₅₀ values were calculated, and are shown in Table 6.

Table 6

[0131] Antibody 12D03 efficiently neutralized rh-pro-EGF binding to rhEGFR, but did so with about six-fold less potency than cetuximab or panitumumab. Antibody 07D06 was 100- fold less potent than cetuximab in inhibiting rh-pro-EGFR binding to hEGFR.

Example 7: Inhibition of EGFR^L858R/T790M-Dependent Cell Growth

[0132] The antibodies were tested for inhibition of EGFR^L858R/T790M-dependent proliferation of BaF3 cells. Antibodies were tested in the BaF3 cell system engineered to express

EGFR^L858R/T790M. Assays were conducted in a 96-well plate (10,000 cells/well) in the presence of blasticidin (50 μg/ml) and various concentrations of antibodies (0.018-10000 ng/ml in 100 μΐ final volume). MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assays were conducted three days after antibody addition. Dose-dependent inhibition of

EGFR -dependent growth of BaF3 cells by murine anti-human EGFR antibodies

12D03, 07D06, and cetuximab is shown in terms of IC₅₀ in FIG. 7. Data showing

iinnhhiibbiittiioonn ooff EEGGFFRR^{LL885588RR//TT779900MM}--ddeeppeennddeenntt proliferation of BaF3 cells by antibodies 12D03 and antibody 07D06 are included in Table 7.

Table 7

[0133] The results in FIG. 7 and Table 7 demonstrate that antibodies 07D06 and 12D03 inhibited _EGFR^L858R/T790M dependent proliferation in BaF3 cells.

Example 8: Inhibition of EGFR^L858R-Dependent Cell Growth

[0134] The antibodies were tested for inhibition of EGFR^L858R-dependent proliferation of BaF3 cells. Antibodies were tested in the BaF3 cell system engineered to express EGFR L858R

Assays were conducted in a 96-well plate (10,000 cells/well) in the presence of 10 μg/ml in 100 μΐ final volume. MTT assays were conducted three days after antibody addition. Data showing the inhibition of EGFR L858R -dependent proliferation of BaF3 cells by antibodies 12D03 and 07D06 are included below in Table 8. The results in Table 8 demonstrate that antibodies 12D03 and 07D06 inhibited EGFR^L858R-dependent proliferation of B aF3 cells .

Example 9: Inhibition of EGFR^T790M-Dependent Cell Growth

[0135] The antibodies were tested for inhibition of EGFR^T790M-dependent proliferation of BaF3 cells. Antibodies were tested in the BaF3 cell system engineered to express EGFR^T790M. Assays were conducted in a 96-well plate (10,000 cells/well) in the presence of 10 ug/ml in 100 μΐ final volume. MTT assays were conducted three days post antibody addition. Data showing inhibition of EGFR^T790M-dependent proliferation of BaF3 cells by antibodies 12D03 and 07D06 are included below in Table 8. The results in Table 8 demonstrate that antibodies 12D03 and 07D06 inhibited EGFR^T790M-dependent proliferation of BaF3 cells.

Example 10: Inhibition of EGFRvIII-Dependent Cell Growth

[0136] The antibodies were tested for inhibition of EGFRvIII-dependent proliferation of BaF3 cells. Antibodies were tested in the BaF3 cell system engineered to express EGFRvIII. Assays were conducted in a 96-well plate (10,000 cells/well) in the presence of 10 μg/ml in 100 μΐ final volume. MTT assays were conducted three days post antibody addition. Data showing inhibition of EGFRvIII-dependent proliferation of BaF3 cells by antibodies 12D03 and 07D06 are included below in Table 8. The results in Table 8 demonstrate that antibodies 12D03 and 07D06 inhibited EGFRvIII-dependent proliferation of BaF3 cells.

Example 11: Anti-Proliferative Activity Against A431 Squamous Cancer Cells

[0137] A431 cells (ATCC, Cat. No. CRL-2592), which has EGFR gene amplification, were maintained as recommended by ATCC. Cells were plated at 5,000 cells/well in a 96-well plate. The following day, antibodies were added to the cells at the concentration of 4μg/ml in 100 μΐ final volume. MTT assays were conducted three days after antibody addition. The results in Table 8 (below) show that antibody 12D03 inhibited EGFR-dependent proliferation of A431 cells, while inhibition by antibody 07D03 was minimal.

Example 12: Inhibition of Growth of NSCLC H1975 Cancer Cells

[0138] H1975 cells (ATCC, Cat. No. CRL-5908), which express _EGFR^L858R/T790M, were maintained as recommended by ATCC. Cells were plated at a density of 5,000 cells/well in a 96-well plate. The following day, antibodies were added to the cells at a concentration of 10 μg/ml, in 100 μΐ final volume. MTT assays were conducted three days after antibody addition. The results in Table 8 (below) show that antibodies 12D03 and 07D06 inhibited

E_GFRL858R/T79OM __dependent proliferation of H1975 cells.

Example 13: Inhibition of Growth of NSCLC HCC827 Cancer Cells

[0139] HCC827 cells (ATCC, Cat. No. CRL-2868), which expresses EGFR ⁹, were maintained as recommended by ATCC. Cells were plated at a density of 5,000 cells/well in a 96-well plate. The following day, antibodies (10 μg/ml, in 100 μΐ final volume) were added to the cells. MTT assays were conducted three days after antibody addition. The results in Table 8 (below) show that antibodies 12D03 and 07D06 inhibited EGFR ⁹-dependent proliferation of HCC827 cells.

Example 14: Inhibition of Growth of NSCLC H226 Cancer Cells

[0140] H226 cells (ATCC, Cat. No. CRL-5826), which has wild-type EGFR expression and showed resistance to EGFR TKI and EGFR antibodies, were maintained as recommended by ATCC. Cells were plated at 5,000 cells/well in a 96-well plate. The following day, antibodies were added to the cells at the concentration of 10μg/ml in 100 μΐ final volume. MTT assays were conducted three days post antibody addition. The results in Table 8 (below) show that antibodies 12D03 and 07D06 inhibited the proliferation of H226 cells. Table 8

[0141] The results in Table 8 demonstrate that antibodies 07D06 and 12D03 inhibited EGFR-dependent proliferation of BaF3 cells expressing _EGFR^L858R/T790M ₅ EGFR^L858,

EGFR^T790M, and EGFRvIII, H1975 cells, HCC827 cells, and H226 cells. The results in Table 8 also show that antibody 12D03 inhibited EGFR-dependent proliferation of A431 cells.

Example 15: Inhibition of EGF-induced EGFR Phosphorylation

[0142] The antibodies were tested for inhibition of EGF-dependent phosphorylation of EGFR in the EGFR-overexpressing, epidermoid cancer cell line A431. A431 cells (ATCC, Cat. No CRL-2592) were starved overnight in serum-free media, pre-treated with antibody (5 μg/ml) for one hour followed by EGF (R&D Systems, Cat. No. 236-EG) (50 ng/ml) stimulation for 15 minutes. The phosphorylation of EGFR was analyzed by Western blot. The result showed that antibody 12D03 inhibited EGF-induced phosphorylation of EGFR, while antibody 07D06 did not.

Example 16: EGFR Degradation

[0143] The antibodies in Example 2 were tested for promotion of degradation of EGFR in H1975 and H226 cell lines. H226 (ATCC, Cat. No. CRL-5826) and H1975 cells (ATCC, Cat. No. CRL-5908) and were maintained as recommended by ATCC. H1975 cells and H226 were cultured in recommended medium with 10% fetal bovine serum (FBS) (GIBCO, Cat. No. 10438-026) and treated with antibody at a final concentration of 10 μg/ml for three hours or 24 hours. Total EGFR was analyzed by Western blot. This experiment demonstrated that antibodies 12D03 and 07D06 potently promoted degradation of total EGFR in H1975 and H226 cell lines.

Example 17: Cell Surface Binding (FACS)

[0144] The antibodies were tested for binding to mutant EGFR or wild-type EGFR on the cell surface. BaF3/EGFR^L858R, BaF3/EGFR^L858R/T790M, BaF3/EGFRvIII, H1975, H226, and A431 cells were used in cell surface binding assays. Adherent cells were dissociated with cell dissociation buffer. Cells were centrifuged, washed with FACS buffer (0.5% BSA in PBS), centrifuged and re-suspended in cold FACS buffer. Cells were then plated at 2.5 x 10⁶ cells/well in a V-bottom 96-well plate. The primary antibody was added at a concentration of 5 μg/ml in a final volume of 100 μΐ, and incubated for one hour at 4°C. Wells were washed with FACS buffer (100 μΐ/well), centrifuged at 1,000 rpm for five minutes at 4°C. A volume of 100 μΐ of PE-conjugated goat anti-mouse secondary antibody (Jackson ImmunoResearch, Cat. No. 115-115-164) or anti-human secondary antibody (Jackson ImmunoResearch, Cat. No. 109-115- 098) was added and incubated for one hour at 4°C (light blocked). After one hour, 100 μΐ washing buffer was added to each well and plates were centrifuged at 1,000 rpm for five minutes at 4°C. Plates were then washed again and cells were resuspended in FACS buffer (200 μΐ/ well), and then transferred to Falcon tubes (BD Falcon™, Catalog No. 352058) containing an additional 200 μΐ FACS buffer. Tubes were kept cold and light blocked. Cell surface binding was analyzed using FACS machine and data were analyzed using the Flow- Jo software. These experiments demonstrated that antibodies 12D03 and 07D06 both bind to BaF3/EGFR^L858R, BaF3/EGFR^L858R/T790M, BaF3/EGFRvIII, _EGFR^L858R/T790M expressed in H1975 cells, and wild-type EGFR expressed on H226 and A431 cells.

Example 18: Inhibition of Proliferation of Human Primary Keratinocytes

[0145] The antibodies were tested for inhibition of the proliferation of primary

keratinocytes. Primary human epidermal keratinocytes (Invitrogen; Cat. No. C-001-5C) were cultured according to the vendor's recommendations. Cells were plated at a density of 5,000 cells/well in a 96-well plate. The following day, antibodies (^g/ml or 10μg/ml in 100 μΐ final volume) were added to the cells. MTT assays were conducted five days after antibody addition. This experiment showed that antibody 12D03, cetuximab and panitumumab inhibited keratinocyte proliferation, while antibody 07D06 had minimal inhibitory effect on proliferation of keratinocytes (FIG. 8).

Example 19: Inhibition of EGFR phosphorylation in Human Primary Keratinocytes

[0146] The antibodies were tested for inhibition of EGF-dependent phosphorylation of EGFR in primary human epidermal keratinocytes (Invitrogen, Cat. No. C-001-5C). Primary human epidermal keratinocytes were starved overnight in serum-free media, pre-treated with antibody (10 μ^πύ) for one hour followed by EGF (R&D Systems, Cat. No. 236-EG) (50 ng/ml) stimulation for 15 minutes. Phosphorylation of EGFR was analyzed by Western blot. This experiment demonstrated that antibody 12D03 inhibited the phosphorylation of EGFR in response to EGF in human epidermal keratinocytes, while antibody 07D06 did not inhibit EGF- induced phosphorylation of EGFR.

Example 20: Inhibition of Lung Chimeric EGFR^{L858R T790M} Tumor Xenograft Growth

[0147] The antibodies were tested for inhibition of tumor growth in a human lung chimeric EGFR ¹ ' ^W1V1 tumor xenograft model. The model was obtained as described in Zhou et al., 2010, NAT. BIOTECHNOL. 28:71-78. Genetically modified ES cells were used to generate mice possessing cells engineered with EGFR^L858R/T790M alleles. Thus, the tissues of chimeras were composed of cells from both the genetically modified ES cells and the genetically wild-type host blastocyst. For in vivo studies, the EGFR^1™'^{1 ,W1V1} tumor cells were inoculated subcutaneously into the flank of 8-week old female NCr nude mice with lx 10⁵ cells per mouse in 50% matrigel (BD Biosciences, Cat No. 356237). Tumor measurements were taken twice weekly, using vernier calipers. Tumor volume was calculated using the formula: width x width x length 12. When tumors reached approximately 150 mm , the mice were randomized into five groups of ten mice each. FIG. 9 is a graph summarizing data from a study to compare antibodies 07D06 and 12D03 against cetuximab and panitumumab. Each group (ten mice each) received one of the following treatments: human IgG control, cetuximab, panitumumab, antibody 07D06, or antibody 12D03, each dosed at 4 mg/kg . As shown in FIG. 9, antibody 07D06 (tumor growth inhibition ("TGI"): 63%) and cetuximab (TGI: 54%) displayed similar efficacy in this model (p<0.001). Antibody 12D03 was superior (TGI: 84%) to 07D06 and cetuximab. Of the antibodies tested, panitumumab displayed the least growth inhibition (TGI: 18%). Example 21: Inhibition of NSCLC H1975 Tumor Xenograft Growth

[0148] The antibodies were tested for inhibition of xenograft tumor growth from NSCLC H1975. H1975 cells were inoculated subcutaneously into the flank of 8-week old female NCr nude mice with 1 x 10⁶ cells per mouse in 50% matrigel. Tumor measurements were taken twice weekly, using vernier calipers. Tumor volume was calculated using the formula: width x width x length 12. When tumors reached approximately 150 mm , the mice were randomized into four groups of ten mice each. FIG. 10 summarizes results of study performed to compare antibodies 07D06 and 12D03 against cetuximab. Each group (ten mice each) received one of the following treatments: hlgG control, cetuximab, antibody 07D06, or antibody 12D03, each dosed at 0.5 mg/kg given intra-peritoneal twice weekly for three weeks. The results in FIG. 10 demonstrate that antibodies 07D06, 12D03 and cetuximab displayed similar efficacy, i.e., tumor growth inhibition, in this model.

Example 22: Inhibition of A431 Tumor Xenograft Growth

[0149] The antibodies were tested for inhibition of xenograft tumor growth from human epidermoid squamous carcinoma A431 cells. For in vivo studies, A431 cells were grown in culture in 37°C in an atmosphere containing 5% C0₂, using DMEM medium containing 10% FBS. Cells were inoculated subcutaneously into the flank of 8-week old female NCr nude mice (Taconic Labs) with lx 10⁶ cells per mouse in 50% matrigel. Tumor measurements were taken twice weekly, using vernier calipers. Tumor volume was calculated using the formula: width x width x length 12. When tumors reached approximately 150 mm , the mice were randomized into four groups of ten mice each. Each group (ten mice each) received one of the following treatments: hulgG control, cetuximab, antibody 07D06, or antibody 12D03, each dosed at 2.5 mg/kg given intra-peritoneal twice weekly for three weeks. The results in FIG. 11 show that antibodies 07D06, 12D03 and cetuximab displayed similar efficacy in this model. This indicates that these antibodies possess similar activity and potency against amplified wild-type EGFR.

Example 23: Inhibition of Lung Chimeric EGFRvIII Tumor Xenograft Growth

[0150] The antibodies were tested for inhibition of xenograft tumor growth from human EGFRvIII-driven lung mouse model. For in vivo studies, EGFRvIII expressing tumor cells were inoculated subcutaneously into the flank of 8-week old female NCr nude mice (Taconic Labs) with lx 10⁵ cells per mouse in 50% matrigel (BD Biosciences, Cat No. 356237). Tumor measurements were taken twice weekly, using vernier calipers. Tumor volume was calculated using the formula: width x width x length 12. When tumors reached approximately 150 mm , the mice were randomized into five groups of ten mice each. Each group (ten mice each) received one of the following treatments: hlgG control, cetuximab, panitumumab, 07D06 or 12D03, each dosed at 5 mg/kg given intra-peritoneal twice weekly for three weeks. The results in FIG. 12 show the superiority of 12D03 compared to cetuximab and 07D06, at targeting EGFRvIII tumor growth. Of the antibodies tested, panitumumab displayed the least growth inhibition.

Example 24: Epitope Binning

[0151] The epitope binning of monoclonal antibodies 07D06 and 12D03 to antibodies cetuximab (Erbitux™) and panitumumab (Vectibix™) was measured by BioLayer

Interferometry (BLI) based technology using a Octet QK instrument (ForteBio, Menlo Park, CA). Antigen was bound to one antibody, and then binding of a second EGFR antibody to the antigen was measured. If the second antibody did not bind, the two antibodies were considered to be in the same epitope bin, i.e., recognizing very similar, or largely overlapping, epitopes.

[0152] The analyses were performed at 30°C. lx Sample diluent (ForteBio) was used as dilution buffer for all reagents. Anti-human IgG Fc or anti-murine IgG Fv Biosensors

(ForteBio) were used to immobilize monoclonal antibodies 07D06, 12D03, cetuximab, or panitumumab depending on whether human or murine antibody was used. Antibody immobilization onto the biosensor was performed by dipping the biosensor into 25 μg/ml antibody solution for 300 seconds. The biosensors were then moved to lx sample diluent (ForteBio) for 200 seconds. The non-specific binding of proteins to the biosensors were blocked by dipping them into 500 nM of human or mouse IgG (R&D Systems, Inc.,

Minneapolis, MN) for 300 seconds. The biosensors were then moved to 400 nM of rhEGFR- Fc (R&D Systems, Inc.) for 200 seconds. Baselines were established by dipping the biosensors into lx sample diluent (ForteBio) for 200 seconds. Quantitative binding kinetics of a second antibody (cetuximab, panitumumab, 07D06, orl2D03) were measured by dipping the biosensors into 25 μg/ml antibody solutions for 200 seconds and then into lx sample diluent (ForteBio) for 800 seconds. Human EGFR Affinity Purified Polyclonal Ab, Goat IgG (R&D Systems, Inc., Catalog No. AF231) was used as positive control and an antibody to an unrelated antigen was used as negative control. [0153] Epitope binning experiments were carried out in two directions. Antibody 07D06 or 12D03 was immobilized onto anti-murine IgG Fv Biosensors first, and then cetuximab or panitumumab was added as the second antibody or vice versa. Epitope binning results were determined by measuring the binding of the second antibody to rhEGFR-Fc. If the second antibody binds the same or very similar epitope as the immobilized antibody, no binding will be observed. Therefore, the second antibody "bins" with first antibody. The epitope binning results are summarized in Table 9.

Table 9

Binding of 2nd Epitope binning 1st antibody 2nd antibody antibody result

07D06 cetuximab NB Bin

07D06 panitumumab NB Bin

07D06 Control antibody AF231 Binding Does not Bin

07D06 Control antibody 07F01 NB Bin

12D03 cetuximab NB Bin

12D03 panitumumab NB Bin

12D03 Control antibody AF231 Binding Does not Bin

12D03 Control antibody 07F01 NB Bin

panitumumab 07D06 NB Bin

panitumumab 12D03 NB Bin

panitumumab Control antibody AF231 Binding Does not Bin panitumumab Control antibody 07F01 NB Bin

cetuximab 07D06 NB Bin

cetuximab 12D03 Binding Does not Bin cetuximab Control antibody AF231 Binding Does not Bin cetuximab Control antibody 07F01 NB Bin

NB = no binding

[0154] The results in Table 9 demonstrate that antibody 07D06 binds to the same or a similar epitope bound by cetuximab or panitumumab. The results also demonstrate that antibody 12D03 binds to the same or a similar epitope as panitumumab, and may bind to the same or a similar epitope as cetuximab. The difference in binning results observed with antibody 12D03 and cetuximab may depend on the order in which the antibodies were added. For example, when antibody 12D03 was the immobilized (i.e., first) antibody, cetuximab did not bind. When cetuximab was the immobilized antibody, antibody 12D03 did bind. The order in which the antibodies are added can be informative if binding of the first antibody results in a conformational change in the rhEGFR-Fc upon binding.

INCORPORATION BY REFERENCE

[0155] The entire disclosure of each of the patent documents and scientific articles referred to herein is incorporated by reference for all purposes.

EQUIVALENTS

[0156] The invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. The foregoing embodiments are therefore to be considered in all respects illustrative rather than limiting on the invention described herein. Scope of the invention is thus indicated by the appended claims rather than by the foregoing description, and all changes that come within the meaning and the range of equivalency of the claims are intended to be embraced therein. [0157] What Is Claimed Is:

Claims

1. An isolated antibody that binds human EGFR, comprising an immunoglobulin heavy chain variable region and an immunoglobulin light chain variable region selected from the group consisting of:

(a) (i) an immunoglobulin heavy chain variable region comprising a CDR_HI comprising the amino acid sequence selected from the group consisting of SEQ ID NO: 15 (12D03) and SEQ ID NO: 21 (12D03), a CDR_H2 comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 16 (12D03) and SEQ ID NO: 22 (12D03), and a CDR_H3 comprising the amino acid sequence of SEQ ID NO: 17 (12D03); and

(ii) an immunoglobulin light chain variable region comprising a CDR_LI comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 8 (12D03) and SEQ ID NO: 29 (07D06, 12D03), a CDR_L2 comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 9 (07D06, 12D03) and KVS, and a CDR_L3 comprising the amino acid sequence of SEQ ID NO: 18 (12D03); and

(b) (i) an immunoglobulin heavy chain variable region comprising a CDR_Hi comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 5 (07D06) and SEQ ID NO: 19 (07D06), a CDR_H2 comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 6 (07D06) and SEQ ID NO: 20 (07D06), and a CDR_H3 comprising the amino acid sequence of SEQ ID NO: 7 (07D06); and

(ii) an immunoglobulin light chain variable region comprising a CDR_L1 comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 8 (07D06, 12D03) and SEQ ID NO: 29 (07D06, 12D03), a CDR_L2 comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 9 (07D06, 12D03) and KVS, and a CDR_L3 comprising the amino acid sequence of SEQ ID NO: 10 (07D06).

2. The antibody of claim 1, wherein the immunoglobulin heavy chain variable region comprises a CDR_HI comprising the amino acid sequence of SEQ ID NO: 15 (12D03), a CDR_H2 comprising the amino acid sequence of SEQ ID NO: 22 (12D03), and a CDR_H3 comprising the amino acid sequence of SEQ ID NO: 17 (12D03); and

the immunoglobulin light chain variable region comprises a CDR_LI comprising the amino acid sequence of SEQ ID NO: 29 (07D06, 12D03), a CDR_L2 comprising the amino acid sequence of KVS, and a CDR_L3 comprising the amino acid sequence of SEQ ID NO: 18

(12D03).

3. The antibody of claim 1 , wherein the immunoglobulin heavy chain variable region comprises a CDR_Hi comprising the amino acid sequence of SEQ ID NO: 5 (07D06), a CDR_H2 comprising the amino acid sequence of SEQ ID NO: 20 (07D06), and a CDR_H3 comprising the amino acid sequence of SEQ ID NO: 7 (07D06); and

the immunoglobulin light chain variable region comprises a CDR_L1 comprising the amino acid sequence of SEQ ID NO: 29 (07D06, 12D03), a CDR_L2 comprising the amino acid sequence of KVS, and a CDR_L3 comprising the amino acid sequence of SEQ ID NO: 10

(07D06).

4. The antibody of any one of claims 1-3, wherein the Complementarity Determining

Region (CDR) sequences are interposed between human and humanized framework sequences.

5. An isolated nucleic acid comprising a nucleotide sequence encoding an

immunoglobulin heavy chain variable region of any one of claims 1-3.

6. An isolated nucleic acid comprising a nucleotide sequence encoding an

immunoglobulin light chain variable region of any one of claims 1-3.

7. An expression vector containing the nucleic acid of claim 5.

8. An expression vector containing the nucleic acid of claim 6.

9. The expression vector of claim 8, further comprising the nucleic acid of claim 5.

10. A host cell comprising the expression vector of claim 7.

1 1. A host cell comprising the expression vector of claim 8.

12. A host cell comprising the expression vector of claim 9.

13. The host cell of claim 1 1 , further comprising the expression vector of claim 7.

14. A method of producing a polypeptide comprising an immunoglobulin heavy chain variable region or an immunoglobulin light chain variable region, the method comprising:

(a) growing the host cell of claim 10 or 1 1 under conditions so that the host cell express the polypeptide comprising the immunoglobulin heavy chain variable region or the

immunoglobulin light chain variable region; and (b) purifying the polypeptide comprising the immunoglobulin heavy chain variable region or the immunoglobulin light chain variable region.

15. A method of producing an antibody that binds human EGFR or an antigen binding fragment of the antibody, the method comprising:

(a) growing the host cell of claim 12 or 13 under conditions so that the host cell expresses a polypeptide comprising the immunoglobulin heavy chain variable region and/or the immunoglobulin light chain variable region, thereby producing the antibody or the antigen- binding fragment of the antibody; and

(b) purifying the antibody or the antigen-binding fragment of the antibody.

16. An isolated antibody that binds human EGFR, comprising an immunoglobulin heavy chain variable region and an immunoglobulin light chain variable region selected from the group consisting of:

(a) an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 12 (12D03), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO: 14 (12D03); and

(b) an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 2 (07D06), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO: 4 (07D06).

17. The antibody of claim 16, wherein the immunoglobulin heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 12 (12D03), and the immunoglobulin light chain variable region comprises the amino acid sequence of SEQ ID NO: 14 (12D03).

18. The antibody of claim 16, wherein the immunoglobulin heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 2 (07D06), and the immunoglobulin light chain variable region comprises the amino acid sequence of SEQ ID NO: 4 (07D06).

19. An isolated nucleic acid comprising a nucleotide sequence encoding an

immunoglobulin heavy chain variable region of any one of claims 16-18.

20. An isolated nucleic acid comprising a nucleotide sequence encoding an

immunoglobulin light chain variable region of any one of claims 16-18.

21. An expression vector containing the nucleic acid of claim 19.

22. An expression vector containing the nucleic acid of claim 20.

23. The expression vector of claim 22, further comprising the nucleic acid of claim 19.

24. A host cell comprising the expression vector of claim 21.

25. A host cell comprising the expression vector of claim 22.

26. A host cell comprising the expression vector of claim 23.

27. The host cell of claim 25, further comprising the expression vector of claim 21.

28. A method of producing a polypeptide comprising an immunoglobulin heavy chain variable region or an immunoglobulin light chain variable region, the method comprising:

(a) growing the host cell of claim 24 or 25 under conditions so that the host cell express the polypeptide comprising the immunoglobulin heavy chain variable region or the

immunoglobulin light chain variable region; and

(b) purifying the polypeptide comprising the immunoglobulin heavy chain variable region or the immunoglobulin light chain variable region.

29. A method of producing an antibody that binds human EGFR or an antigen binding fragment of the antibody, the method comprising:

(a) growing the host cell of claim 26 or 27 under conditions so that the host cell expresses a polypeptide comprising the immunoglobulin heavy chain variable region and/or the immunoglobulin light chain variable region, thereby producing the antibody or the antigen- binding fragment of the antibody; and

(b) purifying the antibody or the antigen-binding fragment of the antibody.

30. An isolated antibody that binds human EGFR comprising an immunoglobulin heavy chain and an immunoglobulin light chain selected from the group consisting of:

(a) an immunoglobulin heavy chain comprising the amino acid sequence of SEQ ID NO: 43 (12D03), and an immunoglobulin light chain comprising the amino acid sequence of SEQ ID NO: 45 (12D03); and

(b) an immunoglobulin heavy chain comprising the amino acid sequence of SEQ ID NO: 39 (07D06), and an immunoglobulin light chain comprising the amino acid sequence of SEQ ID NO: 41 (07D06).

31. The antibody of claim 30, wherein the immunoglobulin heavy chain comprises the amino acid sequence of SEQ ID NO: 43 (12D03), and the immunoglobulin light chain comprises the amino acid sequence of SEQ ID NO: 45 (12D03).

32. The antibody of claim 30, wherein the immunoglobulin heavy chain comprises the amino acid sequence of SEQ ID NO: 39 (07D06), and the immunoglobulin light chain comprises the amino acid sequence of SEQ ID NO: 41 (07D06).

33. An isolated nucleic acid comprising a nucleotide sequence encoding an

immunoglobulin heavy chain of any one of claims 30-32.

34. An isolated nucleic acid comprising a nucleotide sequence encoding an

immunoglobulin light chain of any one of claims 30-32.

35. An expression vector containing the nucleic acid of claim 33.

36. An expression vector containing the nucleic acid of claim 34.

37. The expression vector of claim 36, further comprising the nucleic acid of claim 33.

38. A host cell comprising the expression vector of claim 35.

39. A host cell comprising the expression vector of claim 36.

40. A host cell comprising the expression vector of claim 37.

41. The host cell of claim 39, further comprising the expression vector of claim 35.

42. A method of producing a polypeptide comprising an immunoglobulin heavy chain variable region or an immunoglobulin light chain variable region, the method comprising:

(a) growing the host cell of claim 38 or 39 under conditions so that the host cell express the polypeptide comprising the immunoglobulin heavy chain variable region or the

immunoglobulin light chain variable region; and

(b) purifying the polypeptide comprising the immunoglobulin heavy chain variable region or the immunoglobulin light chain variable region.

43. A method of producing an antibody that binds human EGFR or an antigen binding fragment of the antibody, the method comprising:

(a) growing the host cell of claim 40 or 41 under conditions so that the host cell expresses a polypeptide comprising the immunoglobulin heavy chain variable region and/or the immunoglobulin light chain variable region, thereby producing the antibody or the antigen- binding fragment of the antibody; and

(b) purifying the antibody or the antigen-binding fragment of the antibody.

44. A method of inhibiting or reducing proliferation of a tumor cell comprising exposing the cell to an effective amount of the antibody of claim 1, 16, or 30 to inhibit or reduce proliferation of the tumor cell.

45. A method of inhibiting or reducing tumor growth in a mammal, the method comprising exposing the mammal to an effective amount of the antibody of claim 1, 16, or 30 to inhibit or reduce proliferation of the tumor.

46. A method of treating cancer in a human patient, the method comprising administering an effective amount of the antibody of claim 1, 16, or 30 to a mammal in need thereof.

47. The method of claim 46, wherein the cancer is selected from the group consisting of breast, ovarian, prostate, cervical, colorectal, lung, pancreatic, gastric, brain, and head and neck cancers.