WO2012013821A1

WO2012013821A1 - Inhibition of dicer function for treatment of cancer

Info

Publication number: WO2012013821A1
Application number: PCT/EP2011/063233
Authority: WO
Inventors: Jean-Christophe Marine; Irina Lambertz
Original assignee: Vib Vzw; Katholieke Universiteit Leuven, K.U.Leuven R&D
Priority date: 2010-07-30
Filing date: 2011-08-01
Publication date: 2012-02-02
Also published as: GB201012845D0

Abstract

The present application relates to the field of cancer, particularly cancers wherein p53 tumour suppression function is lost or impaired. It is shown herein that Dicer is a synthetic lethal partner of p53, allowing the selective targeting and killing of cancer cells. The effects of Dicer on survival on cancer cells are mediated through the miR17-92 cluster and inhibition of members of this miRNA cluster is an attractive treatment strategy in cancer. Most particularly, these findings are of importance in the field of retinoblastoma.

Description

INHIBITION OF DICER FUNCTION FOR TREATMENT OF CANCER

Field of the invention

The present application relates to the field of cancer, particularly cancers wherein p53 tumour suppression function is lost or impaired. It is shown herein that Dicer is a synthetic lethal partner of p53, allowing the selective targeting and killing of cancer cells. The effects of Dicer on survival on cancer cells are, at least partly, mediated through the miR17-92 cluster and inhibition of members of this miRNA cluster is an attractive treatment strategy in cancer. Most particularly, these findings are of importance in the field of retinoblastoma.

Background

A large body of evidence indicates that alterations in the expression of miRNAs contribute to cancer pathologies (1). This is at least partly the consequence of reduced stability and/or activity of DICER, an RNAse III endonuclease playing a critical role in miRNA biogenesis (2-6). Consistently, Dicerl is a haploinsufficient tumour suppressor in mice (7,8), supporting the hypothesis that a decrease in Dicerl function leads to a global downregulation of miRs and promotes tumorigenesis. Surprisingly, however, homozygous deletions or loss-of-function mutations in DICERl do not occur in human tumours and homozygous loss of Dicerl appears to be selected against in a K-Ras-induced mouse model of lung cancer (7) and Myc-induced mouse model of B-cell lymphoma (9).

A vast majority of human cancers are also characterized by the loss of p53 tumour suppression function (29). Therefore, identification of synthetic lethal interactors of p53 should lead to conceptually simple and attractive approaches to selective targeting of cancer cells. Synthetic lethality has been proposed as an interesting concept in the context of anticancer therapy (30). Two genes are synthetic lethal if mutation of either alone is compatible with viability but mutation of both leads to death. ("Synthetic" is thus used in the sense of synthesis, or coming together.) So, targeting a gene that is synthetic lethal to a cancer-relevant mutation, like for instance in p53, should kill only cancer cells and spare normal cells. Synthetic lethality therefore provides a conceptual framework for the development of cancer-specific cytotoxic agents. Although it has been shown to work for cells that have lost BRCA1 or BRCA2 (31, 32), no genetic/in vivo evidence for a synthetic lethal interaction with p53 tumour suppressor has been described to date.

Of note, also retinoblastoma (Rb) mutations are found in a majority of human cancers (33, 34). The Rb gene was initially identified as a genetic locus associated with the development of an inherited eye tumour. The realization that it was a loss of function of Rb that was associated with disease established the tumour suppressor paradigm. Mutations in Rb have also been seminal for the "two-hit hypothesis" of cancer, which states that cancer is the result of accumulated mutations to a cell's DNA.

Apart from its role in eye tumours, loss of Rb has for instance been demonstrated to increase the risk of osteosarcoma development in children and teenagers. In adults, human papillomavirus (HPV) is thought to initiate cervical carcinoma and squamous cell carcinoma of the head and neck in part by inactivating Rb through expression of the E7 oncoprotein, and similar mechanisms are possibly involved in virus-induced liver cancers. Rb is inactivated in more than 90% of human small-cell lung carcinomas (SCLC), and mouse genetic studies have confirmed that Rb is crucial in preventing the initiation of this lung cancer subtype. For an overview, see ref. 34, particularly Table 1 of this reference, incorporated herewith.

The disease retinoblastoma, affecting approximately 1 in 15,000 live births, is a rapidly developing cancer which develops in the cells of retina, the light detecting tissue of the eye. Both genetic and sporadic forms of retinoblastoma exist, and loss of Rb has been implicated in both. Moreover, it has recently been shown that, contrary to earl ier suggestions, both the Rb a nd p53 pathways are inactivated - although not necessarily mutated - in retinoblastoma (13).

It would be advantageous to identify a synthetic lethal partner for p53, which would provide a new therapeutic target in cancer. It would be particularly advantageous if this allows the selective targeting of cancer cells in which more than one tumor suppressor pathway is compromised, such as for instance retinoblastoma.

Summary

The data presented herein show that Dicerl is required for tumour formation. It is demonstrated that targeted homozygous loss of Dicerl completely prevents the formation of retinoblastoma in mice in which the Rb and p53 tumour suppressor pathways are inactivated. Unexpectedly, this shows that Dicerl deficiency selectively kills Rb-deficient retinal cells in which p53 is inactivated while sparing cells that retain functional p53. miRNA profiling of mouse and human primary retinoblastomas showed dramatic overexpression of the pro-oncogenic miR17-92 cluster in all samples analyzed. High- resolution array-CGH indicates that in -20% of human Retinoblastoma patients overexpression of miR17-92 results from copy number alterations. Crucially, functional inactivation of the miRNAs encoded by the miR17-92 cluster is sufficient to induce apoptotic death of human retinoblastoma cells. Our data identify Dicer as the first synthetic lethal partner of p53 and designate members of the miR- 17-92 cluster as a highly selective therapeutic target for the treatment of retinoblastoma. Accordingly, it is an object of the invention to provide methods of inducing cell death in a cell where p53 function is compromised, comprising inhibiting the function of Dicer. According to particular embodiments, cell death is due to synthetic lethality.

According to particular embodiments, in addition to the compromised function of p53, the cell is further characterized by activation of an oncogene or inhibition of a tumor suppressor gene (such as e.g. b).

According to specific embodiments, the cell wherein p53 function is compromised is a tumour cell. Most particularly, the tumour is a retinoblastoma (and the tumour cell thus is a retinoblastoma cell).

As will be described herein, inhibiting the function of Dicer can be done in different ways. It is particularly envisaged that the function of Dicerl is inhibited by inhibiting one or more of the miRNAs that are upregulated in the cell where p53 function is impaired. These miRNAs are listed in the application (e.g. in the tables provided herein). According to particular embodiments, the one or more miRNAs that are inhibited (i.e. that are upregulated in the cell wherein p53 function is impaired) are selected from the miR 17-92 cluster or a paralog thereof (such as the mir-106a-363 and mir-106b-25 cluster). According to further particular embodiments, the one or more miRNA is selected from the miR 17-92 cluster, most particularly selected from miR-17, miR-18a, miR-19a, miR-19b, miR-20a and miR- 92. As will be described herein, inhibition of miRNAs can be done in several ways. According to particular embodiments, inhibition of the miRNAs is with an LNA or an antagomir.

According to alternative embodiments, inhibiting the function of Dicer is done by inhibition of Dicer itself, i.e. by inhibiting the Dicerl gene, the Dicerl mRNA or the Dicer protein.

P53 function in the cell wherein p53 function is impaired can be impaired in different ways. According to particular embodiments, p53 function is impaired by functional dysregulation but not mutation. According to alternative embodiments, p53 function is impaired by at least one mutation. According to a further aspect, an inhibitor of Dicer function is provided for use in treatment of cancer. In particular embodiments, the cancer is retinoblastoma.

According to specific embodiments, the inhibitor of Dicer function is an inhibitor of one or more of the miRNAs that are upregulated in the cancer cells. More particularly, the miRNA is selected from the miR 17-92 cluster or a paralog thereof (such as the mir-106a-363 and mir-106b-25 cluster). According to further particular embodiments, the one or more miRNA is selected from the miR 17-92 cluster, most particularly selected from miR-17, miR-18a, miR-19a, miR-19b, miR-20a and miR-92.

According to alternative embodiments, the inhibitor is an inhibitor of the Dicerl gene, the Dicerl mRNA or the Dicer protein.

Brief description of the Figures

Figure 1. Dicerl is required for Retinoblastoma formation. (A) Kaplan-Meier curve showing the time to first observation of externally visible retinoblastoma. This time was markedly decreased in ChxlOCre;Rb^lox/lox;pl07^/;p53^lox/lox (TKO, blue line at bottom of graph) mice relative to Chxl0Cre;Rb^lox/lox;pl07^/~ (DKO, black line in middle of graph) littermates. ChxlOCre;Rb^lm/l°' ^<;pl07^{/ '}; _p53i x/iox. _Dj(J°x i°x (Q_{KOj re c}| | _{j n e a t t 0}p of gra ph) mice did not develop tumours (log rank test, P<0,0001). (B) Invasive tumours that fill the vitreous and the anterior chamber are found in TKO mice as early as P60. Hematoxylin and eosin stain with the three retinal nuclear layers (GL: ganglion layer; INL: inner nuclear layer; ONL: outer nuclear layer) indicated. (C) KI67 and ChxlO, Syntaxin, and Calbindin immunostaining of DKO and OKO retinae at P14 and P45. Black Scale bars are = 40μιη and the red scale bar in panel B is = 400μιη.

Figure 2. Chxl0/Rb/pl07-mutant cells are lost upon concomitant inactivation of Dicerl and p53. (A)

ChxlO and GFP immunostaining of ChxlOCre;Rb^lox/lox;pl07^/;D cer^lox/lox;p53^+/+ versus Chxl0Cre;Rb^lox/lox;pl07^/;D cer^lox/lox; p53^lox/lox retinae at P48. GFP-positive cells are only detected in p53 wild-type mice. (B) AP-stained transverse retinal sections from Chxl0Cre;Rb^lox/lox;pl07^/~ ;D\cer^lox/lox;p53^+/+ and ChxlOCre;Rb'^^m;plOT^/-;D\cer''^°^x _l-p53!°*^/l°^x adult mice (P82). Regions of AP reporter activity are only detected in p53 wild-type mice. (A) and (B) Scales bars =40μιη. (C) Schematic representation of the Dicerl and p53 wild-type, floxed and Cre-excised alleles (Top panels). DNA was prepared from P21 retinae of at least 5 mice with the indicated genotypes and examined by PCR using the primers depicted in the top panels. Representative PCRs are shown in the lower panels.

Figure 3. The miRNA-17-92 cluster is overexpressed in retinoblastoma and required for survival of established retinoblastoma cell lines. (A) Heatmap of the miRNA-17-92 and paralogue clusters in normal mouse retina (C/jxiOCre-negative mice, light green), normal human retina (dark green), 4 mouse TKO tumours (light blue) and 30 different primary human retinoblastoma (dark blue). (B) Expression analysis by RT-qPCR of miR-17 in normal human retina and the established retinoblastoma cell lines WERI-Rbl and Y79. Data represents the mean of three independent experiments ±SD. (C) Transfection of miR17-92 specific inhibitors affect the survival of the retinoblastoma cell line WERI-RBl as assessed by MTT assay. The Y axis represents the relative percentage of viable cells following transfection of the miRNA-inhibitors. The data are normalized to the percentage of viable cells following transfection of a scramble control oligonucleotide. Data represents the mean of three independent experiments ±SD. (D) Loss of Dicerl protects against the formation of aggressive and invasive retinoblastoma by selective kill ing of the Rb-deficient cells in which the p53 pathway is inactivated.

Figure 4. Dicer loss does not affect retinogenesis. ChxlO and GFP immunostaining indicate the presence of Dicerl-deficient cells in adult retina of ChxlOCre; Dicer^{,ox ,ox} mice. (A) construct used for GFP immunostaining. (B) Retinal lamination is normal in these mice. ONL, outer nuclear layer; RPE, retinal pigment epithelium; INL, inner nuclear layer; GL, ganglion layer. Scale bars = 40μιη.

Detailed description

Definitions

The present invention will be described with respect to particular embodiments and with reference to certain drawings but the invention is not limited thereto but only by the claims. Any reference signs in the claims shall not be construed as limiting the scope. The drawings described are only schematic and are non-limiting. In the drawings, the size of some of the elements may be exaggerated and not drawn on scale for illustrative purposes. Where the term "comprising" is used in the present description and claims, it does not exclude other elements or steps. Where an indefinite or definite article is used when referring to a singular noun e.g. "a" or "an", "the", this includes a plural of that noun unless something else is specifically stated.

Furthermore, the terms first, second, third and the like in the description and in the claims, are used for d istinguishing between sim ilar elements and not necessarily for describing a sequential or chronological order. It is to be understood that the terms so used are interchangeable under appropriate circumstances and that the embodiments of the invention described herein are capable of operation in other sequences than described or illustrated herein.

The following terms or definitions are provided solely to aid in the understanding of the invention. Unless specifically defined herein, all terms used herein have the same meaning as they would to one skilled in the art of the present invention. Practitioners are particularly directed to Sambrook et al., Molecular Cloning: A Laboratory Manual, 2^nd ed., Cold Spring Harbor Press, Plainsview, New York (1989); and Ausubel et al., Current Protocols in Molecular Biology (Supplement 47), John Wiley & Sons, New York (1999), for definitions and terms of the art. The definitions provided herein should not be construed to have a scope less than understood by a person of ordinary skill in the art.

As used herein, the term "inducing cell death" refers to a process that results in the killing of cells. Most particularly, as defined herein, the cell death is selective, i.e. cell death is induced in cells in which p53 function is compromised (thus, those cells die) and not induced in cells wherein p53 function is normal (those cells stay alive). According to particular embodiments, the term "cell death" refers to apoptotic cell death. The term "p53 function" as used herein, refers to the tumor suppressor function exerted by the p53 protein encoded by the TP53 gene (Gene ID: 7157 in humans). The tumor suppressor function of p53 involves one or more of the following: activating DNA repair proteins when DNA has sustained damage; inducing growth arrest by holding the cell cycle at the Gl/S regulation point on DNA damage recognition (if DNA repair proteins fix the damage, the cell will typically be allowed to continue the cell cycle); and/or initiating apoptosis if DNA damage proves to be irreparable.

"Compromised function" or "impaired function" as used throughout the application, particularly in the context of p53, refers to a reduced or absent functionality of this tumor suppressor function. The function can be compromised because one or both copies of the TP53 gene are mutated or absent in the cells (i.e. at the DNA level), and/or because the gene is not correctly transcribed or translated (i.e. at the RNA or protein level, respectively), and/or because no or mutant (non-functional) p53 protein is expressed in the cell, and/or because lower levels of functional p53 protein are expressed in the cells. "Lower levels" as used herein means lower levels than those observed in a suitable population of control cells, particularly 25% lower, 50% lower or 75% or more lower. For instance, 50% lower expression of functional p53 protein may arise from the loss of one functional p53 allele. However, a decrease in functional p53 levels may also be the consequence of inactivation of components of the p53 pathway or overexpression of other components, such as the p53 binding protein MDMX (13).

"Dicer" as used herein refers to the protein product of the DICERl gene (Gene ID: 23405 in humans). This gene encodes a protein possessing an RNA helicase motif containing a DEXH box in its amino terminus and an RNA motif in the carboxy terminus. The encoded protein functions as a ribonuclease (ribonuclease type III) and is required by the RNA interference and small temporal RNA (stRNA) pathways to produce the active small RNA component that represses gene expression. In humans, two transcript variants encoding the same protein have been identified for this gene. The "function of Dicer" as used herein is the processing of microRNAs or miRNAs (35, 36), and "inhibiting the function of Dicer" consequently means inhibiting the function of correctly processed miRNAs, be it by inhibiting their processing (e.g. by directly interfering with Dicer) or by inhibiting the miRNAs themselves (e.g. via LNAs or antagomirs). According to particular embodiments, "inhibiting the function of Dicer in a cell where p53 function is compromised" means inhibiting the miRNAs that are upregulated in cells where p53 function is compromised, wherein upregulation should be compared to suitable control cells wherein p53 function is not compromised. In particular embodiments, upregulation of miRNAs may also mean that they are expressed in cells wherein p53 function is compromised, whereas they are not expressed in control cells. According to very particular embodiments, "inhibiting the function of Dicer" means "inhibiting at least one miRNA from the miR 17-92 cluster".

According to the definitions herein, two genes are said to be in a "synthetic lethal" relationship or "synthetic lethal partners" or interactors if a mutation in, or downregulation or knockout of, either gene alone is not lethal but mutations/downregulation/knockout in or of both cause the death of the cell. Note that, according to this definition, genes can be synthetically lethal if e.g. a mutation in one gene is combined with e.g. downregulation of the other gene. In cancer research, a synthetic lethal partner is a gene that, when mutated or otherwise inhibited, kills cells that harbor a specific cancer- related alteration, such as a mutated tumor-suppressor gene or an activated oncogene, but spares otherwise identical cells lacking the cancer-related alteration (30). According to very particular embodiments, the synthetic lethal partner is synthetically lethal with mutations in, or functional dysregulation of, p53. According to even more specific embodiments, the synthetic lethal partner of p53 is Dicer or an effector of Dicer function, such as a specific miRNA, particularly one of the miR 17-92 cluster.

An "oncogene" as defined herein is a gene that has the potential to cause cancer. In tumor cells, they are often mutated or expressed at high levels. Typically, an oncogene is the result of changes (i.e. mutations, overexpression) of a normal gene, termed proto-oncogene. Proto-oncogenes typically code for proteins that help to regulate cell growth and differentiation. The proto-oncogene can become an oncogene by a relatively small modification of its original function, such as a mutation (e.g. leading to increase in protein or enzyme activity or loss in regulation), increase in protein concentration (e.g. by protein overexpression, increase in mRNA stability or gene duplication), or chromosomal translocation (leading to e.g. aberrant expression or constitutively active fusion genes encoding hybrid proteins). Conversion of proto-oncogenes in oncogenes can be quantitative or qualitative. Non-limiting examples of oncogenes (or proto-oncogenes that can become oncogenes upon activation) are listed further in the detailed description. A "tumor suppressor gene", or "anti-oncogene", as herein defined is a gene that protects a cell from one step on the path to cancer. When this gene is mutated to cause a loss or reduction in its function, the cell can progress to cancer, usually in combination with other genetic changes. Tumor-suppressor genes, or more precisely, the proteins for which they code, either have a dampening or repressive effect on the regulation of the cell cycle or promote apoptosis, and sometimes do both. Well-known examples of tumor suppressors are the p53 and retinoblastoma (pRb) proteins. The cell cycle may be coupled to DNA damage by tumor suppressors (i.e., as long as there is damaged DNA in the cell, it should not divide. If the damage can be repaired, the cell cycle can continue). Indeed, increased mutation rate from decreased DNA repair leads to increased inactivation of other tumor suppressors and activation of oncogenes (Markowitz, J Clin Oncol. 2000; 18(21 Suppl):75S-80S). Accordingly, in particular embodiments, DNA repair proteins are included in the definition of tumor suppressors. Non- limiting examples of such DNA repair proteins whose mutation leads to increased cancer risk include HNPCC, MENl and BRCA.

The disease "retinoblastoma" as used herein refers to an embryonic malignant neoplasm of retinal origin (OMIM +180200).

The "miR 17-92 cluster" as used herein is a polycistronic cluster consisting of different miRNAs that are processed from a common precursor transcript. The precursor transcript derived from the mir-17-92 gene contains six tandem stem-loop hairpin structures that ultimately yield six mature miRNAs: miR- 17, miR-18a, miR-19a, miR-20a, miR-19b-l, and miR-92-1 (18, 37, 38). The six miRNAs encoded by mir- 17-92 can be categorized into three separate miRNA families according to their seed sequences: the miR-17 family (including miR-17, miR-20, and miR-18), the miR-19 family (miR-19a and miR-19b), and the miR-92 family (18). It is worth noting that miR-18 exhibits a significant sequence homology with miR-17 and

miR-20, despite one nucleotide difference within the seed regions. Ancient gene duplications have given rise to two mir-17-92 cluster paralogs in mammals: mir-106a-363 and mir-106b-25, each of which only contains homologous miRNAs to a subset of mir-17-92 components (18, 37, 38), also referred to as paralogs or paralog clusters herein. The sequences of the miRNAs (including seed regions) and organization of the different clusters can also be found in these references.

microRNAs (miRNAs) are short (typically 20-24 nt) non-coding RNAs that are involved in post- transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA.

According to a first aspect, methods are provided for inducing cell death in a cell where p53 function is compromised. These methods involve the inhibition of the function of Dicer. Accordingly, it can be said that an inhibitor of Dicer function is provided for use in inducing cell death in a cell where p53 function is compromised.

According to specific embodiments, the cell death that is induced is apoptotic cell death.

According to particular embodiments, inhibiting the function of Dicer in a cell where p53 function is compromised will result in synthetic lethality. I.e., inhibiting Dicer function in cells wherein p53 function is not compromised will not kill the cells, but only when both p53 and Dicer function are compromised, the cells will die. As p53 function is most typically compromised in tumor cells, it is particularly envisaged that the method can be used to kill tumor cells. (In other words, inhibitors of Dicer function are provided for use in treatment of cancer). Moreover, the killing is selective, as cell death will not be induced in cells where p53 function is normal.

In cancer, it is often seen that the function of more than one tumor suppressor is compromised. Thus, cell death may also be induced in cells wherein, in addition to impaired p53 function, Rb function is compromised, and/or pl07 function is compromised. However, the methods provided herein require defective p53 function for cel l death to be ind uced, as inh ibiting Dicer function in a cel l with compromised Rb function but wherein p53 functions normally will not result in cell death. In other words, impaired Dicer function is synthetically lethal with compromised p53 function, but not with other tumor suppressors.

Nonetheless, as cancer cells typically undergo many genetic changes, according to particular embodiments, it is envisaged that the cell(s) to be killed are characterized by impaired function of another tumor suppressor gene (in addition to compromised function of p53), and/or activation of one or more (proto-)oncogenes. The compromised function or inhibition of the tumor suppressor gene may be through mutation of that gene (e.g. in the case of BRCA), or as a result of lower expression/stability of the gene product, or through genetic deletion. The activation of one or more oncogenes (or conversion of proto-oncogenes in oncogenes) may occur through mutation, gene amplification/overexpression, or chromosomal rearrangements.

In addition to TP53, tumor suppressors that may also be impaired in the cells to be killed include, but are not limited to, b, APC, CD95, ST5, YPEL3, ST7, and ST14. As mentioned above, tumor suppressors may also include DNA repair proteins such as HNPCC, MEN1 and BRCA genes.

A non-limiting list of (proto-)oncogenes that may be activated or overexpressed in the cells to be killed includes: regulatory GTPases such as RAS; cytoplasmic Serine/threonine kinases or regulatory subunits thereof, such as Raf kinases (e.g. B-Raf, C-Raf), AKT1, cyclin-dependent kinases (typically activated through overexpression); cytoplasmic tyrosine kinases such as the Src-family, Syk-ZAP-70 family, and BTK family of tyrosine kinases, or fusion genes like Nup-Abl, Bcr-Abl; receptor tyrosine kinases such as EGFR, PDGFR, VEGFR, Her2-Neu, Trk receptors or their ligands; growth factors such as c-Sis; Transcription factors such as Myb or Myc; Extracellular signal-regulated kinases (ERK or MAPK); and Wnt signaling proteins.

The further requirement (i.e. in addition to impaired p53 function) for oncogene activation or tumour suppressor inhibition ensures that only cells which truly undergo oncogene activation (i.e. tumour formation) are targeted for cell death.

According to most particular embodiments, the tumour or cancer to be treated is retinoblastoma. Thus, inhibitors of Dicer function are provided for use in treatment of retinoblastoma.

Although the methods can be used in vitro, e.g. to induce cell death in a cell line, it is particularly envisaged that they are applied in vivo, by inhibiting Dicer function in a subject in need thereof. Most particularly, this will be done by administering an inhibitor of Dicer function to a subject in need thereof, but gene therapy is also envisaged.

Most typically, the "subject" as used herein will be an animal, more particularly a mammal (e.g., cats, dogs, horses, cows, pigs, sheep, goats, llamas, monkeys, mice, rats, ...), most particularly a human.

Inhibiting Dicer function can be done in many ways. This can for instance be done by inhibiting functional expression of the Dicerl gene itself. With "functional expression" of the Dicerl gene, it is meant the transcription and/or translation of functional Dicerl gene product. "Inhibition of functional expression" can be achieved at three levels. First, at the DNA level, e.g. by removing or disrupting the Dicerl gene, or preventing transcription to take place (in both instances preventing synthesis of the Dicerl gene product). Second, at the RNA level, e.g. by preventing efficient translation to take place - this can be through destabilization of the mRNA so that it is degraded before translation occurs from the transcript, or by hybridizing to the Dicer mRNA. Third, at the protein level, e.g. by binding to the Dicer protein, inhibiting its function, and/or marking the protein for degradation.

If inhibition is to be achieved at the DNA level, this may be done using gene therapy to knock-out or disrupt the Dicerl gene. As used herein, a "knock-out" can be a gene knockdown or the gene can be knocked out by a mutation such as, a point mutation, an insertion, a deletion, a frameshift, or a missense mutation by techniques known in the art, including, but not limited to, retroviral gene transfer. Another way in which genes can be knocked out is by the use of zinc finger nucleases. Zinc- finger nucleases (ZFNs) are artificial restriction enzymes generated by fusing a zinc finger DNA-binding domain to a DNA-cleavage domain. Zinc finger domains can be engineered to target desired DNA sequences, which enables zinc-finger nucleases to target unique sequence within a complex genome. By taking advantage of endogenous DNA repair machinery, these reagents can be used to precisely alter the genomes of higher organisms.

In such embodiments, it will be particularly envisaged that the knock-out of the Dicerl gene is limited to the tissue where the tumour is located, and most particularly, the knock-out is limited to the tumour itself, and Dicerl is not inhibited in the host subject.

Apart from tissue-specific inhibition of Dicerl gene product function, the inhibition may also be temporary (or temporally regulated).

Temporally and tissue-specific gene inactivation may for instance also be achieved through the creation of transgenic organisms expressing antisense RNA, or by administering antisense RNA to the subject. An antisense construct can be delivered, for example, as an expression plasmid, which, when transcribed in the cell, produces RNA that is complementary to at least a unique portion of the cellular Dicer mRNA.

A more rapid method for the inhibition of gene expression is based on the use of shorter antisense oligomers consisting of DNA, or other synthetic structural types such as phosphorothiates, 2'-0- alkylribonucleotide chimeras, locked nucleic acid (LNA) (see further in the application for a more detailed discussion of this technology), peptide nucleic acid (PNA), or morpholinos. With the exception of RNA oligomers, PNAs and morpholinos, all other antisense oligomers act in eukaryotic cells through the mechanism of RNase H-mediated target cleavage. PNAs and morpholinos bind complementary DNA and RNA targets with high affinity and specificity, and thus act through a simple steric blockade of the RNA translational machinery, and appear to be completely resistant to nuclease attack. An "antisense oligomer" refers to an antisense molecule or anti-gene agent that comprises an oligomer of at least about 10 nucleotides in length. In embodiments an antisense oligomer comprises at least 15, 18 20, 25, 30, 35, 40, or 50 nucleotides. Antisense approaches involve the design of oligonucleotides (either DNA or RNA, or derivatives thereof) that are complementary to an mRNA encoded by polynucleotide sequences of Dicerl. Antisense RNA may be introduced into a cell to inhibit translation of a complementary mRNA by base pairing to it and physically obstructing the translation machinery. This effect is therefore stoichiometric. Absolute complementarity, although preferred, is not required. A sequence "complementary" to a portion of an RNA, as referred to herein, means a sequence having sufficient complementarity to be able to hybridize with the RNA, forming a stable duplex; in the case of double-stranded antisense polynucleotide sequences, a single strand of the duplex DNA may thus be tested, or triplex formation may be assayed. The ability to hybridize will depend on both the degree of complementarity and the length of the antisense polynucleotide sequence. Generally, the longer the hybridizing polynucleotide sequence, the more base mismatches with an RNA it may contain and still form a stable duplex (or triplex, as the case may be). One skilled in the art can ascertain a tolerable degree of mismatch by use of standard procedures to determine the melting point of the hybridized complex. Oligomers that are complementary to the 5' end of the message, e.g., the 5' untranslated region (UTR) up to and including the AUG translation initiation codon, should work most efficiently at inhibiting translation. However, sequences complementary to the 3' UTR of mRNAs have recently been shown to be effective at inhibiting translation of mRNAs as well (Wagner, R. (1994) Nature 372, 333-335). Therefore, oligomers complementary to either the 5', 3' UTRs, or non-coding regions of a Dicerl gene could be used in an antisense approach to inhibit translation of said endogenous m RNA encoded by Dicerl polynucleotides. Oligomers complementary to the 5' UTR of said mRNA should include the complement of the AUG start codon. Antisense oligomers complementary to mRNA coding regions are less efficient inhibitors of translation but could be used in accordance with the invention. Whether designed to hybridize to the 5', 3' or non-coding region of a said mRNA, antisense oligomers should be at least 10 nucleotides in length, and are preferably oligomers ranging from 15 to about 50 nucleotides in length. In certain embodiments, the oligomer is at least 15 nucleotides, at least 18 nucleotides, at least 20 nucleotides, at least 25 nucleotides, at least 30 nucleotides, at least 35 nucleotides, at least 40 nucleotides, or at least 50 nucleotides in length. A related method uses ribozymes instead of antisense RNA. Ribozymes are catalytic RNA molecules with enzyme-like cleavage properties that can be designed to target specific RNA sequences. Successful target gene inactivation, including temporally and tissue-specific gene inactivation, using ribozymes has been reported in mouse, zebrafish and fruitflies. RNA interference (RNAi) is a form of post-transcriptional gene silencing. The phenomenon of RNA interference was first observed and described in Caenorhabditis elegans where exogenous double-stranded RNA (dsRNA) was shown to specifically and potently disrupt the activity of genes containing homologous sequences through a mechanism that induces rapid degradation of the target RNA. Several reports describe the same catalytic phenomenon in other organisms, including experiments demonstrating spatial and/or temporal control of gene inactivation, including plant (Arabidopsis thaliana), protozoan (Trypanosoma bruceii), invertebrate (Drosophila melanogaster), and vertebrate species (Danio rerio and Xenopus laevis). The mediators of sequence- specific messenger RNA degradation are small interfering RNAs (siRNAs) generated by ribonuclease III cleavage from longer dsRNAs. Generally, the length of siRNAs is between 20-25 nucleotides (Elbashir et al. (2001) Nature 411, 494-498). The siRNA typically comprise a sense RNA strand and a complementary antisense RNA strand annealed together by standard Watson Crick base pairing interactions (hereinafter "base paired"). The sense strand comprises a nucleic acid sequence that is identical to a target sequence contained within the target mRNA. The sense and antisense strands of the present siRNA can comprise two complementary, single stranded RNA molecules or can comprise a single molecule in which two complementary portions are base paired and are covalently linked by a single stranded "hairpin" area (often referred to as shRNA). The term "isolated" means altered or removed from the natural state through human intervention. For example, an siRNA naturally present in a living animal is not "isolated," but a synthetic siRNA, or an siRNA partially or completely separated from the coexisting materials of its natural state is "isolated ." An isolated siRNA ca n exist in substantially purified form, or can exist in a non native environment such as, for example, a cell into which the siRNA has been delivered. The siRNAs of the invention can comprise partially purified RNA, substantially pure RNA, synthetic RNA, or recombinantly produced RNA, as well as altered RNA that differs from naturally occurring RNA by the addition, deletion, substitution and/or alteration of one or more nucleotides. Such alterations can include addition of non nucleotide material, such as to the end(s) of the siRNA or to one or more internal nucleotides of the siRNA, including modifications that make the siRNA resistant to nuclease digestion.

One or both strands of the siRNA of the invention can also comprise a 3' overhang. A "3' overhang" refers to at least one unpaired nucleotide extending from the 3' end of an RNA strand. Thus, in one embodiment, the siRNA of the invention comprises at least one 3' overhang of from one to about six nucleotides (which includes ribonucleotides or deoxynucleotides) in length, preferably from one to about five nucleotides in length, more preferably from one to about four nucleotides in length, and particularly preferably from about one to about four nucleotides in length.

In the embodiment in which both strands of the siRNA molecule comprise a 3' overhang, the length of the overhangs can be the same or different for each strand. In a most preferred embodiment, the 3' overhang is present on both strands of the siRNA, and is two nucleotides in length. In order to enhance the stability of the present s i R NAs, the 3' overhangs can also be stabil ized against degradation. In one embodiment, the overhangs are stabilized by including purine nucleotides, such as adenosine or guanosine nucleotides. Alternatively, substitution of pyrimidine nucleotides by modified analogues, e.g., substitution of uridine nucleotides in the 3' overhangs with 2' deoxythymidine, is tolerated and does not affect the efficiency of RNAi degradation. In particular, the absence of a 2' hydroxyl in the 2' deoxythymidine significantly enhances the nuclease resistance of the 3' overhang in tissue culture medium.

The siRNAs of the invention can be targeted to any stretch of approximately 19 to 25 contiguous nucleotides in any of the target Dicerl mRNA sequences (the "target sequence"), of which examples are given in the application. Techniques for selecting target sequences for siRNA are well known in the art. Thus, the sense strand of the present siRNA comprises a nucleotide sequence identical to any contiguous stretch of about 19 to about 25 nucleotides in the target mRNA.

The siRNAs of the invention can be obtained using a number of techniques known to those of skill in the art. For example, the siRNAs can be chemically synthesized or recombinantly produced using methods known in the art. Preferably, the siRNA of the invention are chemically synthesized using appropriately protected ribonucleoside phosphoramidites and a conventional DNA/RNA synthesizer.

The siRNA can be synthesized as two separate, complementary RNA molecules, or as a single RNA molecule with two complementary regions. Commercial suppliers of synthetic RNA molecules or synthesis reagents include Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, Colo., USA),

Pierce Chemical (part of Perbio Science, Rockford, III., USA), Glen Research (Sterling, Va., USA),

ChemGenes (Ashland, Mass., USA) and Cruachem (Glasgow, UK).

Alternatively, siRNA can also be expressed from recombinant circular or linear DNA plasmids using any suitable promoter. Suitable promoters for expressing siRNA of the invention from a plasmid include, for exam ple, the U6 or H I RNA pol I I I promoter sequences and the cytomegalovirus promoter. Selection of other suitable promoters is within the skill in the art. The recombinant plasmids of the invention can also comprise inducible or regulatable promoters for expression of the siRNA in a particular tissue or in a particular intracellular environment. The siRNA expressed from recombinant plasmids can either be isolated from cultured cell expression systems by standard techniques, or can be expressed intracellular^, e.g. in breast tissue or in neurons.

The siRNAs of the invention can also be expressed intracellular^ from recombinant viral vectors. The recombinant viral vectors comprise sequences encoding the siRNAs of the invention and any suitable promoter for expressing the siRNA sequences. Suitable promoters include, for example, the U6 or HI RNA pol III promoter sequences and the cytomegalovirus promoter. Selection of other suitable promoters is within the skill in the art. The recombinant viral vectors of the invention can also comprise inducible or regulatable promoters for expression of the siRNA in the tissue where the tumour is localized.

As used herein, an "effective amount" of the siRNA is an amount sufficient to cause RNAi mediated degradation of the target mRNA, or an amount sufficient to inhibit the progression of metastasis in a subject. RNAi mediated degradation of the target mRNA can be detected by measuring levels of the target mRNA or protein in the cells of a subject, using standard techniques for isolating and quantifying mRNA or protein as described above.

One skilled in the art can readily determine an effective amount of the siRNA of the invention to be administered to a given subject, by taking into account factors such as the size and weight of the subject; the extent of the disease penetration; the age, health and sex of the subject; the route of administration; and whether the administration is regional or systemic. Generally, an effective amount of the siRNA of the invention comprises an intracellular concentration of from about 1 nanomolar (nM) to about 100 nM, preferably from about 2 nM to about 50 nM, more preferably from about 2.5 nM to about 10 nM. It is contemplated that greater or lesser amounts of siRNA can be administered.

Recently it has been shown that morpholino antisense oligonucleotides in zebrafish and frogs overcome the limitations of RNase H-competent antisense oligonucleotides, which include numerous non-specific effects due to the non target-specific cleavage of other mRNA molecules caused by the low stringency requirements of RNase H. Morpholino oligomers therefore represent an important new class of antisense molecule. Oligomers of the invention may be synthesized by standard methods known in the art. As examples, phosphorothioate oligomers may be synthesized by the method of Stein et al. (1988) Nucleic Acids Res. 16, 3209-3021), methylphosphonate oligomers can be prepared by use of controlled pore glass polymer supports (Sarin et al. (1988) Proc. Natl. Acad. Sci. USA. 85, 7448-7451). Morpholino oligomers may be synthesized by the method of Summerton and Weller U.S. Patent Nos. 5,217,866 and 5,185,444.

The Dicer gene product inhibitor may also be an inhibitor of Dicer protein. A typical example thereof is an anti-Dicer antibody. The term 'antibody' or 'antibodies' relates to an antibody characterized as being specifically directed against Dicer or any functional derivative thereof, with said antibodies being preferably monoclonal antibodies; or an antigen-binding fragment thereof, of the F(ab')₂, F(ab) or single chain Fv type, or any type of recombinant antibody derived thereof. These antibodies of the invention, including specific polyclonal antisera prepared against Dicer or any functional derivative thereof, have no cross- reactivity to other proteins. The monoclonal antibodies of the invention can for instance be produced by any hybridoma liable to be formed according to classical methods from splenic cells of an animal, particularly of a mouse or rat immunized against Dicer or any functional derivative thereof, and of cells of a myeloma cell line, and to be selected by the ability of the hybridoma to produce the monoclonal antibodies recognizing Dicer or any functional derivative thereof which have been initially used for the im munization of the animals. The monoclonal antibodies according to this em bodiment of the invention may be humanized versions of the mouse monoclonal antibodies made by m eans of recombinant DNA technology, departing from the mouse and/or human genomic DNA sequences coding for H and L chains or from cDNA clones coding for H and L chains. Alternatively the monoclonal antibodies according to this embodiment of the invention may be human monoclonal antibodies. Such human monoclonal antibodies are prepared, for instance, by means of human peripheral blood lymphocytes (PBL) repopulation of severe combined immune deficiency (SCI D) mice as described in PCT/EP 99/03605 or by using transgenic non-human animals capable of producing human antibodies as described in US patent 5,545,806. Also fragments derived from these monoclonal antibodies such as Fab, F(ab)'₂ and scFv ("single chain variable fragment"), providing they have retained the original binding properties, form part of the present invention. Such fragments are commonly generated by, for instance, enzymatic digestion of the antibodies with papain, pepsin, or other proteases. It is well known to the person skilled in the art that monoclonal antibodies, or fragments thereof, can be modified for various uses. The antibodies involved in the invention can be labeled by an appropriate label of the enzymatic, fluorescent, or radioactive type. In a particular embodiment said antibodies against Dicer or a functional fragment thereof are derived from camels. Camel antibodies are fully described in W094/25591, WO94/04678 and in WO97/49805. Processes are described in the art which make it possible that antibodies can be used to hit intracellular targets. Since Dicer is an intracellular target, the antibodies or fragments thereof with a specificity for Dicer must be delivered into the cel ls. One such technology uses lipidation of the antibodies. The latter method is fully described in WO94/01131 and these methods are herein incorporated by reference. Another method is by fusing the antibody to cell-penetrating peptides (Chen and Harrison, Biochem Soc Trans. 2007). Antibodies binding to Dicer are commercially available, e.g. from Abeam, Santa Cruz biotechnology, Sigma-Aldrich and the like. If the tumour is located in the brain, the inhibitor should be able to pass the blood-brain barrier. Technologies of modifying antibodies to pass the blood-brain barrier are well known to the skilled person.

Other inhibitors of Dicer include, but are not limited to, peptide inhibitors of Dicer, peptide-aptamer (Tomai et al., J Biol Chem. 2006) inhibitors of Dicer, and protein interferors as described in WO2007/071789, incorporated herein by reference.

Small molecule inhibitors, e.g. small organic molecules, and other drug candidates can be obtained, for example, from combinatorial and natural product libraries.

According to particularly envisaged embodiments, however, Dicer function is inhibited downstream of Dicer, by inhibiting one or more miRNAs that are upregulated by Dicer in cells where p53 function is impaired. As will be detailed in the examples section, specific miRNAs that fall under this category are the members of the polycistronic miR 17-92 cluster. In some settings (like for instance retinoblastoma) upregulation of these miRNAs means that they are present in p53 deficient cells, whereas they are not expressed in control cells (e.g. retinoblasts). Thus, inhibition of these miRNAs can be done in tissues where they are not normally expressed, thereby reducing the risk of side effects.

Inhibition of one or more of the miRNAs upregulated by Dicer in cells where p53 is compromised can be done at the DNA or RNA level, as described for Dicer above. (Inhibition at the protein level is not feasible since miRNAs are non-protein coding RNAs). Particularly suited for inhibition of miRNAs are locked nucleic acids (LNAs) or antagomirs.

A locked nucleic acid, often referred to as inaccessible RNA, is a modified RNA nucleotide. The ribose moiety of an LNA nucleotide is modified with an extra bridge connecting the 2' oxygen and 4' carbon. The bridge "locks" the ribose in the 3'-endo (North) conformation, which is often found in the A-form of DNA or RNA. LNA nucleotides can be mixed with DNA or RNA bases in the oligonucleotide whenever desired. Such oligomers are commercially available (e.g. from Exiqon). The locked ribose conformation enhances base stacking and backbone pre-organization. This significantly increases the thermal stability (melting temperature) of oligonucleotides. Importantly, LNA incorporation generally improves mismatch discrimination compared to unmodified reference oligonucleotide, and LNA mediates high- affinity hybridization by using the Watson-Crick rules without compromising base pairing selectivity.

LNA oligonucleotides are readily transfected into cells using standard techniques: they are sequence- specific and non-toxic, and show improved nuclease resistance, which make them highly useful for powerful and selective antisense-based silencing. Hence, LNA oligonucleotides are uniquely suited for mimicking RNA structures and for miRNA targeting both in vivo and in vitro. Such LNA-based RNA antagonists have unusually high potency, biostability, and duration of action. See Nature Methods - 4, (2007) for more background on miRNA knockdown using LNA probes. Antagomirs are another example of chemically engineered oligonucleotides that can be used to silence endogenous microRNA. An antagomir is a small synthetic RNA that is perfectly complementary to the specific miRNA target with either mispairing at the cleavage site of Ago2 or some sort of base modification to inhibit Ago2 cleavage. Usually, antagomirs have some sort of modification to make it more resistant to degradation. It is unclear how antagomirization (the process by which an antagomir inhibits miRNA activity) operates, but it is believed to inhibit by irreversibly binding the m iRNA. Antagomirs are now used as a method to constitutively inhibit the activity of specific miRNAs (39). One clear advantage with respect to siRNA technology is that antagomirs did not induce an immune response.

According to a specific embodiment, inhibition of Dicer function means inhibition of one or more of the following miRNAs: miR-17, miR-18a, miR-19a, miR-20a, miR-19b-l, and miR-92-1. Although inhibition of one of these miRNAs in cells in which p53 function is impaired already results in killing of these cells, it is envisaged that more than one of these miRNAs is inhibited, e.g. all members of the same miRNA family (see above), or also members of a paralog gene cluster, other family members of this gene cluster, and so on, may be inhibited as well. Inhibitors of these miRNAs may be used in treatment of cancer, particularly in retinoblastoma.

Although full inhibition of a given miRNA is particularly envisaged, partial inhibition may have beneficial effects as well (e.g. at least 25% inhibition, at least 50% inhibition or at least 75% inhibition). As Dicer function (and miRNA control) is important, inhibition of Dicer function is particularly envisaged to be temporally and/or spatially regulated, rather than just systemic inhibition. According to particular embodiments, inhibition will not be done during prenatal development. According to further particular embodiments, inhibition of Dicer function will be restricted in time: after the cells in which p53 function is compromised have died, Dicer function will no longer be inhibited.

According to other particular embodiments, inhibition of Dicer function will only be done in the tissue where cells with compromised p53 function are located (in practice: the tumour itself or the tissue where a tumour is located). A non-limiting example hereof is in the case of retinoblastoma, where inhibitors of Dicer function can be administered directly into the eye. A further benefit hereof is that th is direct adm inistration approach facil itates in hibition at the NA level - indeed, i n the case of systemic inhibition, stability of RNA inhibitors is often an issue, but if time and location of inhibition can be restricted, this allows more efficient inhibition. As m entio ned, the m ethods provided herei n i nd uce cel l death in cel l s wherein p53 fu nction is compromised. The way in which p53 function is compromised is in fact not essential to the invention. In many tumours, for instance, p53 function is compromised as a result of one or more mutations. However, it is particularly envisaged herein that p53 function may also be compromised by functional dysregulation that is not the result of m utation in p53. "Functiona l dysregulation" as used herein typically means that p53 function is impaired as the result of downregulation of levels of functionally active p53 protein. This may for instance be the result of mutations in other components of the p53 pathway that ultimately result in lowering of the levels of functional p53. As a non-limiting example, p53 function is compromised in retinoblastoma as a result of amplification of the M DMX gene, and not due to mutations in p53 itself (13).

It is to be understood that although particular embodiments, specific configurations as well as materials and/or molecules, have been discussed herein for cells and methods according to the present invention, various changes or modifications in form and detail may be made without departing from the scope and spirit of this invention. The following exam ples are provided to better ill ustrate particular embodiments, and they should not be considered limiting the application. The application is limited only by the claims. Note that, due to the requirements of black and white reproducibility of the figures, some experimental data are not shown in the figures, but can be obtained upon request. Examples

Example 1. Dicerl is a synthetic lethal partner of p53

I n order to test whether Dicer is req u ired for retinoblastoma formation we conditiona l ly inactivated Dicerl in mice that develop aggressive and invasive retinoblastoma (10). ChxlOCre; Rb^lox/lox; plOT^ mice (thereafter referred to as DKO mice) develop early hyperproliferative lesions (11), which only rarely go on to become aggressive and invasive tumours. Accordingly, these mice develop only retinoblastoma with delayed and variable kinetics (Figure 1A). As previously reported (10;12), conditional inactivation of p53 on this sensitized background (ChxlOCre; Rb^lox/lox; plOJ^1'; p53^lox/lox, referred to as the TKO m ice) leads to rapid formation of visible retinoblastoma in virtually al l m ice analyzed (122 out of 129). On average it takes 100 days for these mice to develop visible tumours (Figure 1A). Moreover, while DKO mice only ever develop unilateral tumours more than 80% of TKO mice (97 out of 122) develop bilateral retinoblastoma with clear evidence of anterior chamber invasion. In addition, metastatic tumours that had invaded local tissues outside of the eye through the optic nerve are only observed in TKO mice (data not shown). In sharp contrast to this very aggressive and nearly 100% penetrant phenotype, none of the ChxlOCre; Rb^lm/Im; ρ107 ; p53^lm/lm; Dicerl^lm/Im (referred to as Q.KO) mice analyzed (19 out of 19) developed visible retinoblastoma within their first year of life (Figure 1A). This striking result argues in favour of a critical role for Dicer in the formation of retinoblastoma. Unexpectedly, retinae of OKO mice have a normal cytoarchitecture (Figure IB). The retinal laminar organization of DKO mice is slightly disrupted due to focal expansion of immature cells from the inner nuclear layer (INL) and their protrusion through the outer plexiform layer (OPL), in agreement with a previous report (13). Additionally, defects in the maturation of the rod photoreceptors lead to a hypocellular outer nuclear layer (ONL) (Figure IB). This phenotype is exacerbated upon loss of p53, and tumours rapidly develop in retinae of TKO mice. In contrast, no evidence of tumour formation was seen in any of the OKO retinae examined. More surprisingly, dysplastic lesions were absent in these retinae and the ONL appeared intact (Figure IB). We assessed cell proliferation in retinae at P14, by which time retinogenesis is normally complete. As previously reported (11;8), we found extensive BrdU incorporation and numerous Ki67-positive cells in DKO retinae (Figure 1C). This phenotype was significantly exacerbated in TKO retinae and BrdU- and Ki67-positive cells were found in all early dysplastic lesions and late (i.e. P200) retinoblastoma tumours (data not shown). Consistent with the absence of dysplastic lesions we found no evidence of ectopic cell proliferation in OKO retinae from P14 onwards. In fact, the retinal cytoarchitecture of OKO mice was indistinguishable from wild-type retinae at all stages and in all mice analyzed. The integrity of the retinal cytoarchitecture was further confirmed by analyzing the proportion and distribution of the retinal cell types in the OKO retinas and controls (Figure 1C and data not shown).

As it is unlikely that loss of Dicerl completely reverts the transformed bl/pl07/p53-deficient retinoblasts into phenotypically normal cells, we hypothesized that biallelic loss of Dicerl compromises the survival of the tumour initiating cells. Because of the mosaicism exhibited in the ChxlOCre transgenic line (14), there remained a possibility that Cre-positive cells, and therefore the Dicerl deficient cells, might be eliminated and/or outcompeted by the remaining Dicerl wild-type Cre- negative cells without causing any obvious retinal morphological defects. In order to fate map the Dicerl deficient cells we took advantage of the green fluorescent protein (GFP) and alkaline phosphatase (AP) reporter genes present in the BAC ChxlO transgenic construct (14;15). GFP expression accurately marks subsets of ChxlO-positive cells that underwent Cre-mediated recombination (15). In adult retinae GFP is detected in a subset of postmitotic bipolar and Muller cells, which are located within the INL, at the interface between the INL and OPL (Figure 2A). Importantly, we found that Dicer is dispensable for the expansion, cell fate specification and differentiation of retinal progenitor cells since GFP-positive cells were identified in the I N L of ChxlOCre; Dicerl^lox/lox retinae; moreover, these retinae were indistinguishable from those of wild-type littermates (Figure 4). Consistent with a previous study (16) focal and progressive retinal degeneration was observed in a few older mice suggesting that Dicer might be required for the survival of some terminally differentiated neuronal cell populations. However, the penetrance of this phenotype was extremely low (1 out of 11 mice examined). Critically, GFP-positive cells could also be identified in retinae of ChxlOCre; Rb^lox/lox; plOT'^'; Dicerl^lox/lox (Figure 2A) indicating that Dicer deficiency does not compromise the viability of the retinal progenitors on either wild-type or b/pl07-deficient backgrounds.

To further demonstrate the presence of Dicer-deficient cells in ChxlOCre; Dicerl^lox/lox and ChxlOCre; Rb^lox/lox; plOJ^1'; Dicerl^lox/lox retinae we determined mature miRNAs expression levels in FACS- sorted GFP-positive cells from three retinae of each genotype. Consistent with the loss of Dicer function we observed a dramatic global shut-down/down-regulation in steady-state miRNA levels in all samples analyzed compared to the levels in ChxlOCre; Dicerl^+/+ and ChxlOCre; Rb^lox/lox; plOJ^1'; Dicerl^+/+ retinae (data not shown). This analysis supports the presence of Dicer-deficient cells in these retinae. In sharp contrast, GFP-positive cells could not be identified in QKO adult retinae (Figure 2A), indicating that the ChxlOCre/GFP-positive cells are specifically eliminated and/or segregated out during development upon inactivation of both Dicerl and p53. To substantiate this observation we dissociated QKO and control adult retinae and scored individual GFP-positive cells in 3 independent samples for each genotype by FACS. This analysis confirmed the presence of GFP-positive cells in ChxlOCre; Dicerl'°^x/lox and ChxlOCre; Rb'°^x/lox; plOT^A; Dicerl'°^x/lox but not in QKO retinae (data not shown). Consistently, AP reporter activity was detected in all ChxlOCre; Rb^lox/lox; plOJ^1'; Dicerl^lox/lox adult retinae analyzed (Figure 2B). In contrast, no activity could be detected in 3 out of 4 QKO adult retinae analyzed and very few positive-cells were identified in the remaining sample, most likely due to incomplete Cre-mediated recombination of at least one of the floxed loci (Figure 2B). In keeping with the above observations, PCR-based genotyping confirmed Cre-mediated recombination of the conditional Dicerl allele in ChxlOCre; Rb'°^x/lox; plOT'^' Dicerl'°^x/lox but not in QKO adult retinae (P20) (Figure 2C). Consistent with the mosaicism exhibited in the ChxlOCre transgenic line the non- recombined Dicerl allele remained detectable in all Dicerl^lox/lox samples analyzed. To exclude that the lack of Cre-positive cells in QKO adult retinae is due to compromised Cre expression we performed whole-mounts AP staining on Ell.5 mutant and control embryos, a developmental stage at which the ChxlO-positive retinal progenitor cells are first detected. AP reporter activity was detected in the retina of all C ixiOCre-positive embryos, including QKO, but as expected not in C ixiOCre-negative embryos (data not shown). The presence of the mutant cells in the retina of QKO Ell.5 embryos was further confirmed using the GFP reporter (data not shown).

As mutant cells are detected in QKO retinae at Ell.5 but not in adult mice, we searched for evidence of apoptotic cell death as a possible cause for their elimination from Ell.5 onwards (data not shown). All GFP-positive cells were negative for the activated-form of caspase-3 (casp-3*) in ChxlOCre; Rb^lm/Im; ρ107 ; Dicerl^lm/Im retinae at al l stages analyzed ( Ell.5, E13.5 and E14.5). I n contrast, GFP/Casp-3*-double positive cells were detected as early as Ell.5 in QKO retinae (data not shown). At E14,5, GFP-positive cells (as well as AP-reporter activity) were only detected in ChxlOCre; Rb^lox/lox; plOT^_; Dicerl^lox/lox, but not QKO, retinae (data not shown). These findings indicate that apoptosis contributes to the rapid elimination of Rb/pl07/Dicer/p53-mutant cells during development and that Dicerl is required for the survival of Rbl/pl07-deficient retinal progenitor cells in which p53 function is disabled but not in cells with an intact p53 pathway. Collectively, our results demonstrate that inactivation of Dicer and p53 is synthetically lethal to susceptible (Rb/pl07-deficient) cells. To the best of our knowledge, this is the first genetic evidence of an in vivo synthetic lethal interaction with p53.

Example 2. Dicer effects on survival mediated via miR 17-92 cluster

These data indicate that pharmacological inactivation of Dicer enzymatic activity may represent an attractive therapeutic modality, at least in the context of retinoblastoma. However, we have previously shown that partial Dicerl inactivation enhances rather than inhibits retinoblastoma formation (8). We therefore set out to investigate the underlying molecular basis for tumour suppression elicited by complete Dicerl inactivation in order to explore more appropriate therapeutic approaches. We reasoned that a subset of miRNAs, the maturation of which depends on Dicer function, is likely to promote Dicerl-mediated survival of Rb/pl07/p53-deficient retinoblastoma cells. To search for such miRNAs we profiled miRNA expression in P21 retinae from wild-type (Cre-negative), DKO and dissected tumour material from TKO mice. This analysis identified a set of 102 miRNAs that are significantly up-regulated in the TKO tumours (Table 1 and data not shown). To find correlates of the mouse data in human tumours, we also profiled miRNA expression in 30 different human primary retinoblastomas. 68 miRNAs were significantly up-regulated in retinoblastoma compared to normal human retinae (Table 2 and data not shown). Cross-species comparison identified 25 miRNAs that were up-regulated in both mouse and human tumours (Table 3). Strikingly, 12 of them are members of the known oncogenic miR-17-92 and 106b-25/miR-106a-92 paralogue clusters (17,18). Consistently, hierarchical clustering of all RB cases and normal retinae based on miRNA expression singled out all members of these clusters as being dramatically up-regulated in all mouse and human tumours analyzed (Figure 3A and data not shown). Sporadic retinoblastomas are often more advanced than tumours from patients with germline RBI mutations, mainly due to the fact that they tend to be diagnosed significantly later (19). Interestingly, miR-17-92 expression levels are significantly higher in sporadic retinoblastoma samples (heatmap data not shown; Mann-Whitney P<0,05).

To explore the potential causes of miRNA deregulation in human retinoblastoma we looked for genomic aberrations using a 44K oligonucleotide array which was specifically designed to include regions harbouring miRNA genes. In addition to identifying previously reported retinoblastoma- associated genomic aberrations (lq gain and 6p22 gain were frequently seen in our cohort) focal amplification of the miR-17-92 locus, which lies on chromosome 13, was found in one patient (data not shown). Another patient had a whole chromosome 13 gain and 3 patients had copy number gains including the miR-17-92 cluster but, importantly, not the closely linked Rb-1 locus. miR-17-92 copy number gains were found in 17% of the patients (5 out of 29 cases analysed). Moreover, while the Rb-1 locus was deleted in 21% of cases (6/29) this deletion never included the closely linked miR-17-92 locus. This analysis therefore indicates that up-regulation of the miR-17-92 cluster is, at least in a proportion of retinoblastoma cases, a direct consequence of increased gene copy number. Since transcription of miR-17-92 is positively regulated by the E2Fs (20) and negatively regulated by p53 (21), deregulation of their transcriptional activities may also account for miR-17-92 overexpression in retinoblastoma. Regardless of the underlying mechanism, our data demonstrate that the miR17-92 cluster is overexpressed in 100% of retinoblastomas analysed.

The miR17-92 cluster is also expressed at very high levels in the human retinoblastoma cell lines Rbl5, WERI-Rbl and Y-79 in which both the Rb and p53 tumour suppressor pathways are inactivated and/or compromised (12). Data for miR-17 are shown in figure 3B. To explore if the viability of the retinoblastoma cells is dependent on functional miR-17-92 expression, each miRNA of the cluster was inhibited by transient transfection of miRNA-inhibitors. Inhibition of all individual miRNAs induced a significant decrease in cell viability as measured by MTT (Figure 3C) and caspase-glow (data not shown) assays. The apoptotic effects of miR17-92 knockdown were evident in the two cell lines tested, Y79 and WERI-RB1 (Figure 3C and data not shown).

Conclusion

These results lead us to propose the following working model for the role of Dicer inactivation- induced tumour suppression (Figure 3D). First, complete Dicerl inactivation does not affect survival and/or differentiation of retinal progenitor cells, even in cells experiencing oncogenic stress elicited as a result of Rb inactivation. Second, Dicer and p53 inactivation are synthetically lethal to cells harbouring a deficient Rb pathway. Given that the Rb and p53 pathways are inactivated in most human cancers, our observations (i) provide a rational explanation for the selection against homozygous loss of DICERl in human cancer (22) and (ii) identify a novel pharmacological mode of tumour-type-specific intervention. Third, inactivation of members of the miR-17-92 cluster is sufficient to kill human retinoblastoma cells and, im portantly, we show that it does so in a selective manner. Indeed, inactivation of Dicer, and consequently processing of the pre-miRs, in normal retinoblasts does not affect their survival and function. The miR-17-92 cluster is in fact not normally expressed in these cells. Therapeutic silencing of another pro-oncogenic miR, miRlOb, was recently shown to successfully suppress metastasis in a mouse mammary tumour model (23). Our results call for the development and optimization of miR17-92 inhibitors for the treatment of Retinoblastoma patients. Importantly, in the context of retinoblastoma there will be no need for systemic exposure to the miR-inhibitors thus reducing the potential side effects of such treatment in other tissues/organs. Retinoblastomas could be simply treated by sub-conjuctival injection of the miRNA-inhibitory molecules.

Table 1

Differential miRNA expression in mouse tumors

Tumour vs. normal retina Tumour vs. DKO miRNA fold change p value fold change p value

let-7a 0.734301438 0.273072124 0.895076406 0.691557694 let-7a* 5.500790963 0.01960028 5.415980315 0.021881848 let-7b 3.535319648 0.010370294 2.780131413 0.044361147 let-7c 3.359480225 0.029237804 2.438476587 0.068784999 let-7c-l* 4.741319935 0.12659217 3.893437575 0.169852634 let-7d 1.234074148 0.297825824 1.172828306 0.456789172 let-7d* 0.369079986 0.088943386 0.530989595 0.119000858 let-7e 1.284143189 0.16447827 1.396422488 0.14130197 let-7f 0.944737925 0.776895779 1.00984217 0.97561554 let-7g 1.135094436 0.376289911 1.315125134 0.258536706 let-7g* 2.633175622 0.103630898 4.144327923 0.072340757 let-7i 1.946962814 0.047999992 1.303389019 0.239329412 let-7i* 1.393543863 0.564728821 2.186352712 0.272723927 miR-1 0.793125549 0.828543422 0.953113488 0.97561554 miR-100 2.12461644 0.299729218 1.60608008 0.514352631 miR-101 2.426418798 0.028992766 2.840896611 0.132338746 miR-lOlb 2.288168687 0.031233542 2.551209713 0.150229027 miR-103 1.304877384 0.395284529 1.114962608 0.755335075 miR-106a 51.88732466 0.009211953 22.434866 0.044361147 miR-106b 6.475493206 0.008756512 5.22690581 0.037187565 miR-106b* 9.844896779 0.005663749 7.645337351 0.093681498 miR-107 0.516511513 0.076016013 0.489836945 0.074673743 miR-lOa 3.007375768 0.109853962 3.007375768 0.120591568 miR-122 2.411861573 0.068257972 1.876264315 0.193963821 miR-124* 0.385164461 0.092967467 2.18350663 0.234819943 miR-124a 0.201127661 0.013065457 0.422317566 0.090516995 miR-125a-3p 0.934740784 0.868020022 0.878067241 0.755335075 miRNA fold change p value fold change p value miR-125a-5p 1.596537378 0.081265395 1.390863409 0.169906827 miR-125b 1.088496483 0.886038235 0.818446203 0.769067534 miR-125b-l* 1.770265293 0.457427124 0.831135341 0.830086967 miR-125b* 5.297581936 0.06229364 4.625811288 0.084606159 miR-126 2.66222575 0.029237804 4.879164064 0.044174334 miR-126* 1.811762582 0.088943386 3.263671823 0.048681312 miR-127 0.721441505 0.456333899 0.70710633 0.514352631 miR-127-5p 0.650588359 0.370899476 1.057760247 0.939920721 miR-128a 0.682300808 0.388937085 0.654503545 0.398452113 miR-129 0.112886294 0.009114302 0.16193731 0.031840324 miR-129-3p 0.096027627 0.131817586 0.137454408 0.184663709 miR-130a 1.714212739 0.009211953 1.992597859 0.008284863 miR-130b 0.584223581 0.218057936 0.76690631 0.545897969 miR-130b* 0.648138518 0.35055361 0.928990552 0.884258382 miR-132 1.610414979 0.071921844 1.995821337 0.045032645 miR-133a 1.209649917 0.85756787 1.341565656 0.784560308 miR-133b 0.819424977 0.816788557 0.913055327 0.927148592 miR-134 2.533648981 0.082752178 2.182816839 0.13242275 miR-135a 0.947012745 0.896990567 0.711812659 0.514352631 miR-135b 2.695144104 0.056906094 2.055214293 0.101841409 miR-136 1.454762185 0.369116137 1.824672752 0.339420243 miR-136* 0.888645206 0.86965276 1.195340751 0.846473322 miR-137 4.292698447 0.029314715 3.841261671 0.062517807 miR-138 0.774582196 0.404055957 0.734488596 0.399768272 miR-138* 1.066972749 0.896990567 1.277755155 0.688990152 miR-139-5p 0.931787036 0.868020022 0.797496216 0.65840633 miR-140 2.735000626 0.108061678 3.059077333 0.093644648 miR-140-3p 2.747517645 0.110169748 3.598233545 0.081908469 miR-141 1.910039874 0.22554139 1.910039874 0.241987116 miR-141* 0.739060349 0.338434293 0.820596646 0.305973764 miR-142-3p 16.58444981 0.009211953 4.825204192 0.049181724 miR-142-5p 1.764389659 0.251822108 1.764389659 0.26818725 miR-143 0.944622517 0.867361688 1.985466353 0.272723927 miR-145 0.874432289 0.437037218 2.019517987 0.272723927 miR-146a 11.11818391 0.002195316 3.384791564 0.169906827 miR-146b 7.609411663 0.025658662 3.48580934 0.156890504 miR-146b* 5.421234813 0.034057514 3.357236673 0.272723927 miR-148a 1.419358221 0.172214176 1.550539374 0.170193706 miR-148b 0.496591566 0.019160538 0.701865297 0.26072901 miR-149 1.413545671 0.553677869 1.070146451 0.927148592 miR-150 1.077543601 0.850026351 1.605402811 0.421756911 miR-151 1.443399753 0.120638185 1.95622999 0.045032645 miR-152 1.8558237 0.077264211 2.100334454 0.07594739 miR-153 0.973132222 0.918184799 1.012256895 0.97561554 miR-154 0.413246188 0.350076141 0.269319659 0.048681312 miR-154* 1.463869297 0.350076141 1.409677841 0.42548775 miR-155 5.933582476 0.015061298 5.046847506 0.13464374 miR-15a 0.79465405 0.365620036 1.596374249 0.140793064 miR-15a* 6.458406117 0.015061298 7.178543943 0.032975304 miR-15b 5.453081609 0.042476325 4.601895305 0.119290587 miR-15b* 63.19234564 0.004880222 54.2892756 0.071472927 miR-16 3.03333113 0.031145366 5.157747255 0.021881848 miR-16* 33.00514612 0.004880222 18.22452737 0.068784999 miR-17 47.58305778 0.003001541 21.55266196 0.048681312 miR-17* 7.05075498 0.028402843 11.1288388 0.021881848 miR-181a 0.389439038 0.033900585 0.37898382 0.045032645 miR-181c 0.541217538 0.149815607 0.545253329 0.169906827 miR-182 0.048317007 0.172214176 0.275678755 0.514352631 miR-183 0.01589759 0.113284896 0.106294068 0.297958323 miRNA fold change p value fold change p value miR-183* 0.055440811 0.19087909 0.266099108 0.514352631 miR-184 0.702490237 0.518954901 0.709519298 0.585727041 miR-185 1.293797425 0.218834142 1.097829361 0.664490289 miR-186 7.494097062 0.002195316 6.952665003 0.008284863 miR-186* 8.533299375 0.015061298 9.996246045 0.016693972 miR-187 1.027614389 0.980198027 1.008589011 0.993935867 miR-188-5p 0.667991583 0.469533282 1.01831524 0.977738661 miR-18a 72.27794902 0.002806999 20.79573463 0.086537932 miR-18a* 7.461352046 0.023256995 5.850095442 0.03182938 miR-190 0.608081033 0.456333899 0.642448143 0.615865824 miR-190b 1.50113164 0.868020022 1.896581777 0.813855461 miR-191 1.517794263 0.003001541 2.736758872 0.001019177 miR-191* 1.033571955 0.816788557 1.895671408 0.031840324 miR-192 2.614714927 0.034279558 2.872128728 0.070328146 miR-193* 1.154246211 0.818492942 1.444852692 0.621086022 miR-193a-3p 3.384089903 0.126516653 2.558701214 0.22188577 miR-193b 2.205458831 0.104792913 1.333084513 0.456789172 miR-194 1.527037153 0.176652403 1.687718055 0.239130081 miR-195 3.362819079 0.007422321 2.881220841 0.021881848 miR-197 1.171123896 0.456333899 1.171123896 0.514352631 miR-199a-3p 3.291284517 0.092894954 3.076816693 0.104739682 miR-199b 2.038745576 0.177764775 2.402577967 0.14130197 miR-19a 9.927933234 0.010215094 13.18852662 0.021881848 miR-19a* 1.670580162 0.19087909 1.670580162 0.208481167 miR-19b 10.94909897 0.009211953 13.99269546 0.021881848 miR-200b 2.76435281 0.299729218 2.76435281 0.32227898 miR-200c 1.550928585 0.331120109 1.550928585 0.358211754 miR-202 1.350339304 0.504186314 1.261854694 0.664490289 miR-203* 1.563018795 0.224988858 1.563018795 0.241480188 miR-204 0.720597805 0.307830726 0.793270468 0.552196956 miR-205 15.45435663 0.031233542 10.87447684 0.045032645 miR-206 0.214325624 0.131817586 0.220662084 0.14130197 miR-20a 36.49125415 0.009367224 14.18148047 0.082523815 miR-20a* 12.64508979 0.031145366 12.64508979 0.045032645 miR-20b 45.10422985 0.009778614 17.69737212 0.072340757 miR-21 1.530207798 0.241105342 2.11482555 0.098003228 miR-21* 2.178372553 0.273587458 2.178372553 0.289295829 miR-210 1.068042579 0.868020022 1.898411281 0.15264265 miR-211 0.101938501 0.00269215 0.184349707 0.148151099 miR-212 2.095296625 0.121654045 2.929655266 0.032615321 miR-214 1.249048156 0.338434498 1.249048156 0.368787367 miR-214* 6.444509298 0.087108433 8.736090098 0.086350539 miR-215 5.7967875 0.057413845 5.772739652 0.021881848 miR-216b 0.449015451 0.746146781 0.456152379 0.76428247 miR-217 0.917777961 0.933056246 1.095641499 0.955360333 miR-218 3.359471008 0.123495218 4.383785358 0.111992679 miR-218-1* 1.216832772 0.299729218 1.039949396 0.856459229 miR-218-2* 5.394466383 0.126740139 5.394466383 0.14130197 miR-22 0.726056134 0.243229591 1.468079822 0.549700638 miR-22* 0.439713022 0.053252118 0.714149279 0.517563385 miR-221 1.439574378 0.404055957 1.098312104 0.857942498 miR-222 8.233459518 0.002477929 5.760855863 0.02196098 miR-224 1.616805345 0.128099157 2.424040963 0.283239022 miR-23b 0.549417777 0.131817586 0.591267648 0.184663709 miR-24 2.935123408 0.004880222 3.008964137 0.031840324 miR-24-2* 8.262577106 0.009778614 7.379976617 0.021881848 miR-25 3.301359495 0.009211953 3.953525313 0.147449509 miR-26a 0.955412338 0.868020022 1.122090337 0.755335075 miR-26b 0.622394369 0.187404783 1.383676479 0.39095235 miRNA fold change p value fold change p value miR-26b* 1.57311448 0.16447827 2.513156903 0.030023219 miR-27a 2.128180224 0.029237804 1.854173712 0.086001101 miR-27a* 14.50243499 0.010592223 8.470060818 0.045703577 miR-27b 0.564000917 0.210139343 0.73676401 0.494743354 miR-27b* 2.019547735 0.19087909 3.221104938 0.089837184 miR-28 2.53628581 0.011718545 2.18151906 0.021881848 miR-28* 3.334422074 0.010296625 2.616597308 0.093681498 miR-292-3p 0.756824001 0.462734767 1.467777214 0.289229344 miR-294 0.284616114 0.025036412 0.460831722 0.445352694 miR-296 0.57961935 0.339739106 0.553266603 0.336484438 miR-296-3p 2.793743218 0.141726173 2.739625394 0.156890504 miR-297a* 1.971740006 0.113284896 2.010202832 0.12049269 miR-298 4.078869679 0.101060762 2.662832771 0.209875402 miR-29a 1.106416311 0.864949181 1.046986915 0.961527386 miR-29a* 0.982755597 0.975686838 1.106716723 0.920800726 miR-29b 0.532832996 0.338434293 0.645308267 0.613669566 miR-29b* 1.128941383 0.404392937 1.119747668 0.689327143 miR-29c* 0.63573551 0.350076141 1.275140009 0.709363957 miR-300* 0.70568922 0.428115117 0.875143602 0.846473322 miR-301 4.171971098 0.025036412 4.175698588 0.037187565 miR-301b 3.731903884 0.025648621 3.878303154 0.032975304 miR-30a-3p 1.181700893 0.568071703 1.51203164 0.209875402 miR-30a-5p 0.764071999 0.370256504 1.112925416 0.793409148 miR-30b* 0.743174547 0.233382276 1.559178475 0.398452113 miR-30c 1.186731174 0.38520049 1.733321867 0.127055907 miR-30c-2* 0.288265326 0.370256504 0.680034832 0.779398143 miR-30d 0.75400365 0.265997027 0.990977927 0.977738661 miR-30e 1.046184279 0.801569724 1.685014195 0.17380784 miR-30e-3p 1.312239675 0.299729218 1.762942388 0.090516995 miR-31 1.258277385 0.339739106 0.882067364 0.735171366 miR-31* 1.302160544 0.362179657 0.997946753 0.992428383 miR-32 1.968680846 0.128099157 2.787876058 0.083290936 miR-320 1.68260058 0.121654045 1.549664415 0.169906827 miR-322* 3.186523933 0.058839215 4.027983886 0.048681312 miR-323-3p 1.385764477 0.311612691 1.126559487 0.719103365 miR-324-3p 1.693398183 0.151319454 1.346138634 0.374315528 miR-324-5p 1.386265489 0.370899476 1.367864504 0.427515762 miR-326 1.339559268 0.412198934 1.048609239 0.690257512 miR-328 0.401820455 0.121654045 0.341491126 0.101075499 miR-329 0.392018347 0.01960028 0.392297259 0.021881848 miR-330 0.376728552 0.047566241 0.410819253 0.086001101 miR-330-5p 0.208501643 0.021084568 0.244828159 0.06894565 miR-331 1.215237109 0.395284529 1.156358906 0.555544935 miR-331-5p 1.329401064 0.200967878 1.097067146 0.433778552 miR-335 0.34794996 0.091473239 0.60235664 0.363569096 miR-335* 0.492432367 0.081265395 1.127428997 0.726765601 miR-337-3p 0.922626731 0.747038992 0.987637197 0.977738661 miR-337-5p 1.135879266 0.550334698 0.975404531 0.942290692 miR-338-3p 1.264343814 0.481069555 1.047223646 0.927148592 miR-339-3p 1.512618669 0.105930341 3.051383536 0.021881848 miR-339-5p 0.718037823 0.199777922 0.909743133 0.71427332 miR-33a* 2.581623585 0.046809672 3.978300936 0.037187565 miR-340 3.188345552 0.071604623 3.084818792 0.083302341 miR-340* 2.667250664 0.068172479 2.610031398 0.076261141 miR-342-3p 3.997027494 0.017397038 3.753691047 0.021881848 miR-342-5p 2.500670539 0.066726255 2.487495781 0.081726277 miR-344 1.655242867 0.176101917 1.285483116 0.448692586 miR-345-3p 0.92216192 0.82850515 1.135903869 0.76428247 miR-345-5p 0.687386734 0.299729218 0.932411689 0.846473322 miRNA fold change p value fold change p value miR-34b-3p 10.55748467 0.001159773 5.124725257 0.083290936 miR-34b-5p 7.063390153 0.002195316 3.821921762 0.008284863 miR-34c 5.707106215 0.004880222 2.629549816 0.048681312 miR-34c* 3.72344702 0.004880222 3.304202056 0.044361147 miR-350 2.207086231 0.029314715 2.065103962 0.081908469 miR-361 0.552326147 0.065612423 0.585848584 0.12135725 miR-362-3p 0.633463031 0.037408149 1.195985373 0.720252214 miR-362-5p 2.221917366 0.091171643 2.71380723 0.045032645 miR-365 0.824623509 0.595041808 0.783795889 0.608286912 miR-369-3p 0.819879142 0.652767457 0.684251965 0.419175589 miR-369-5p 0.661743335 0.336087302 0.524967159 0.204276192 miR-370 1.793307426 0.172214176 1.49546994 0.321170272 miR-374-5p 14.90076157 0.00269215 18.4683778 0.008284863 miR-375 0.026637006 0.046666911 0.030708812 0.048681312 miR-376a 1.329384861 0.529884042 1.274801167 0.664490289 miR-376a* 1.488607762 0.329228454 1.745751338 0.36261197 miR-376b 1.642789821 0.368672372 1.253600212 0.71364656 miR-376b* 1.527510888 0.350076141 1.613538586 0.398452113 miR-376c 4.800449482 0.025036412 4.883448374 0.030023219 miR-379 2.591977294 0.029314715 2.166626535 0.045703577 miR-380-5p 1.858433626 0.068257972 1.804782827 0.14130197 miR-381 0.840433066 0.783714269 0.837869954 0.793409148 miR-382 0.680076053 0.377542333 0.664518105 0.405733666 miR-383 0.604287357 0.570538299 0.657994796 0.692629097 miR-384-3p 0.830275623 0.477475762 0.749497028 0.514504677 miR-384-5p 1.263544957 0.356435352 1.256898147 0.555544935 miR-409-3p 1.668592979 0.086848647 1.411265241 0.187850527 miR-409-5p 0.263755713 0.030591879 0.233114933 0.031840324 miR-410 0.741091926 0.4093458 0.808024249 0.596983315 miR-411 3.542896933 0.013065457 2.935804524 0.021881848 miR-411* 2.480316104 0.006051333 2.509954849 0.045032645 miR-412 0.76903269 0.469533282 0.729580249 0.458576975 miR-423-5p 0.487791913 0.273296662 0.742411259 0.647239401 miR-424 3.428612823 0.023285286 2.594904442 0.048995445 miR-425 1.385804901 0.19087909 2.243967185 0.044361147 miR-431 2.883067265 0.051828341 2.914596654 0.13912127 miR-433 0.393321988 0.151319454 0.360022629 0.14130197 miR-434-3p 0.90344285 0.767783897 0.893649494 0.782556356 miR-434-5p 1.613209246 0.310939846 1.394632488 0.489816324 miR-448 0.422943062 0.121654045 0.248566155 0.049181724 miR-449 102.6824215 0.004880222 56.61076425 0.088862403 miR-449b 128.9933081 0.004880222 44.61289388 0.116681589 miR-450a 1.381592985 0.183220355 0.830173285 0.585232362 miR-465a-3p 1.99424507 0.273296662 1.99424507 0.289229344 miR-466d-3p 1.585382229 0.233382276 1.585382229 0.249458962 miR-467* 1.723813659 0.036500299 1.922333409 0.037187565 miR-467b 1.54226347 0.148331233 1.505981445 0.08226263 miR-467c 5.252469016 0.003001541 3.688157233 0.101841409 miR-467d 4.959036126 0.01960028 3.490504124 0.1249962 miR-467e 1.14489331 0.545017463 0.964910193 0.91993227 miR-470* 0.461332125 0.271593853 0.821692068 0.76428247 miR-483* 41.75718578 0.154057991 16.19056621 0.274864415 miR-484 2.600402741 0.004880222 2.25064809 0.02196098 miR-485-3p 1.224395796 0.491579492 1.200872579 0.57670453 miR-485-5p 0.758859203 0.456333899 0.721217957 0.552196956 miR-487b 1.068581679 0.903647597 0.51057984 0.492132068 miR-488* 2.399873308 0.057413845 2.039168975 0.086350539 miR-489 2.237001632 0.439867626 2.015723732 0.552196956 miR-491 1.668119812 0.121654045 1.526443999 0.187741925 miRNA fold change p value fold change p value miR-493 2.288713925 0.218610127 2.239356065 0.242136244 miR-494 1.919773463 0.065556364 1.490057663 0.176394532 miR-495 0.764449222 0.439496494 0.672112821 0.374327019 miR-496 0.434944607 0.124402182 0.369536813 0.090087879 miR-497 5.181492004 0.009211953 2.7617805 0.090087879 miR-500 0.821677071 0.425002275 1.072299931 0.814600896 miR-501* 0.596201536 0.139840583 1.206867544 0.675993427 miR-503 1.711918045 0.180312483 1.711918045 0.193963821 miR-503* 3.126537158 0.046809672 3.243329079 0.048681312 miR-504 0.358906171 0.2919671 0.507132848 0.552196956 miR-532 2.121351093 0.046666911 2.280616436 0.045032645 miR-532-3p 1.782203809 0.01102795 1.607152405 0.03182938 miR-541 2.942632062 0.077241102 2.491735463 0.1249962 miR-542-3p 0.855281405 0.477475762 1.306195185 0.40382326 miR-542-5p 0.950842963 0.902032977 1.424200536 0.254267886 miR-543 0.524686562 0.087217891 0.446754499 0.076261141 miR-544 0.345383264 0.088943386 0.350655233 0.14130197 miR-547 2.541613068 0.08836386 2.217181941 0.125039073 miR-551b 0.28349257 0.287355951 0.277024071 0.292826252 miR-574-3p 2.973537623 0.007422321 2.515454473 0.045032645 miR-582-3p 4.165620504 0.057413845 4.138268237 0.070133539 miR-582-5p 1.399029044 0.456333899 1.17434746 0.755335075 miR-592 2.289089699 0.271593853 1.778765192 0.433778552 miR-598 0.426074317 0.068257972 0.408875563 0.088773549 miR-652 0.636293739 0.194070228 0.700346562 0.29089308 miR-665 1.700791643 0.19087909 1.035713632 0.955360333 miR-666 0.473046844 0.116648667 0.407443158 0.08761121 miR-667 0.711059691 0.336087302 0.642043519 0.258536706 miR-668 0.290739651 0.178598651 0.246709498 0.153516058 miR-669a 1.449460227 0.166039541 1.222400887 0.494586921 miR-671-3p 1.374227314 0.143397391 1.305526804 0.209875402 miR-672 8.983491367 0.001838729 4.031887344 0.076261141 miR-673 2.492276551 0.020873863 2.043056703 0.060357995 miR-673-3p 1.635569434 0.369116137 1.635569434 0.404595183 miR-674 1.155102262 0.594497898 1.118446046 0.755335075 miR-674* 2.226094873 0.028402843 2.175479108 0.028237922 miR-676 1.583016083 0.288734017 0.989037638 0.97786865 miR-676* 1.931133627 0.121914991 1.401418726 0.374327019 miR-677 2.166066503 0.013845756 1.268218255 0.675993427 miR-678 0.951977191 0.828543422 0.92431852 0.735171366 miR-680 1.995818651 0.159229059 1.995818651 0.170193706 miR-682 2.011180321 0.273296662 1.684415297 0.406256121 miR-684 1.792610927 0.238613487 1.139238088 0.880698728 miR-685 2.325010927 0.38520049 2.644261601 0.374315528 miR-690 2.338722322 0.01960028 2.733449386 0.028768204 miR-694 1.839427985 0.029314715 1.40766756 0.088210532 miR-699 1.029833303 0.886038235 1.383595518 0.205791448 miR-7* 2.095520783 0.057413845 3.162943047 0.045032645 miR-700 1.177692243 0.545017463 1.350393622 0.13464374 miR-701 8.360447968 0.016106684 7.559666875 0.021881848 miR-702 0.295973602 0.035503778 0.367094184 0.086001101 miR-704 0.498610757 0.076092689 0.617381002 0.076261141 miR-706 3.315589915 0.034057514 3.212761001 0.048681312 miR-708 1.862467279 0.547038088 1.662053508 0.675993427 miR-709 2.41065996 0.01960028 2.279881086 0.032975304 miR-720 3.141664044 0.046255445 3.112153735 0.090516995 miR-721 1.012018813 0.932335465 1.028011824 0.927148592 miR-741 1.197128719 0.356435352 1.197128719 0.393791022 miR-744 1.408439893 0.251822108 1.416693905 0.26072901 miRNA fold change p value fold change p value miR-744* 1.729464216 0.299729218 2.368809057 0.070772723 miR-760 1.477122606 0.091171643 1.350277872 0.082523815 miR-764-5p 0.848747797 0.370256504 0.752519347 0.184272096 miR-770-3p 0.679425174 0.299729218 0.524444615 0.123910683 miR-770-5p 0.205624489 0.091783392 0.167023585 0.08455984 miR-7b 0.698605261 0.429744436 0.582983448 0.412944332 miR-802 0.484868745 0.377542333 0.683187703 0.674028334 miR-804 1.832576274 0.43434326 2.249789457 0.22743239 miR-805 7.454970171 0.01102795 8.344999686 0.021881848 miR-872 1.34031196 0.389235666 2.617246084 0.077926571 miR-872* 1.653821653 0.143397391 3.620843307 0.008284863 miR-873 0.479110688 0.298230697 0.964124373 0.977738661 miR-875-5p 0.50208087 0.120638185 0.847081339 0.689327143 miR-877* 0.653592007 0.123495218 0.70658629 0.209875402 miR-878-3p 1.092119012 0.464148893 0.763159963 0.65946088 miR-879 1.117983007 0.868020022 1.645889118 0.358211754 miR-879* 2.832452305 0.063455872 2.752840607 0.032975304 miR-881* 1.379222746 0.464148893 1.379222746 0.520838834 miR-9 1.103277147 0.878261768 0.925655215 0.927148592 miR-9* 1.869502085 0.448244867 2.642650853 0.31397158 miR-92 2.935771459 0.063681353 5.773853137 0.070020922 miR-93 30.58766513 0.002195316 9.491046446 0.12573963 miR-93* 7.585371012 0.001838729 5.86831438 0.083302341 miR-96 0.010674683 0.068893257 0.092353946 0.209875402 miR-99a 1.974761714 0.34280185 1.537660844 0.552196956 miR-99b 0.573127422 0.028147949 0.69967891 0.14130197 miR-99b* 2.242795888 0.019861482 2.247101168 0.044361147

Table 2

Differential miRNA expression in human tumors

tumour vs. normal retina

miRNA fold change p value

hsa-let-7a 0.35537902 0.00013862

hsa-let-7b 0.09604549 7.16E-06

hsa-let-7c 0.08579614 7.16E-06

hsa-let-7d 0.2603711 0.00013862

hsa-let-7e 1.07286876 0.77502568

hsa-let-7f 0.34865756 0.00043067

hsa-let-7g 0.25157949 7.16E-06

hsa-let-7i 0.31234196 4.01E-05

hsa-mir-1 0.05903321 0.00049403

hsa-mir-100 0.08595542 7.16E-06

hsa-mir-101 0.34705063 0.00033484

hsa-mir-103 2.72037506 7.16E-06

hsa-miR-105 1.57465508 0.09943833

hsa-mir-106a 22.4668082 7.16E-06

hsa-mir-106b 10.6402635 7.16E-06

hsa-mir-lOa 2.19201791 0.04611805

hsa-mir-lOb 1.34390722 0.74156615

hsa-mir-124a 0.0900642 0.00043067

hsa-mir-125a 0.52319617 0.00226454

hsa-mir-125b 0.07878721 7.16E-06

hsa-miR-126 0.45730233 0.24270864

hsa-mir-126* 0.62578168 0.25602782

hsa-mir-127 0.0342777 7.16E-06 miRNA fold change p value hsa-mir-128a 0.78245662 0.13861277 hsa-mir-128b 0.32953805 0.00043067 hsa-mir-129 0.28183933 7.16E-06 hsa-mir-130a 2.25433284 0.01339514 hsa-mir-130b 21.4342907 7.16E-06 hsa-mir-132 1.49485219 0.0054634 hsa-mir-133a 0.0436029 0.00018537 hsa-mir-133b 0.06463161 0.00033484 hsa-mir-134 0.04372136 7.16E-06 hsa-mir-135a 0.68609293 0.32682787 hsa-mir-135b 2.46777872 0.01539956 hsa-mir-136 0.20587978 4.14E-05 hsa-mir-137 0.11902455 0.03203347 hsa-mir-139 0.41085904 0.0013856 hsa-mir-140 0.44076828 0.00897368 hsa-mir-142-3p 1.00447986 0.85372115 hsa-mir-142-5p 1.1893089 0.48954435 hsa-mir-143 0.41216203 0.00025116 hsa-mir-145 1.21216392 0.26976018 hsa-mir-146a 0.68463308 0.19350179 hsa-miR-146b 0.49382848 0.05480526 hsa-mir-147 1.02106039 0.72621669 hsa-mir-148a 0.43564789 0.00152628 hsa-mir-148b 0.80433376 0.30889578 hsa-mir-149 1.01129007 0.90770942 hsa-mir-150 0.50410072 0.0227267 hsa-mir-151 1.07359588 0.46559024 hsa-mir-152 0.2517561 7.16E-06 hsa-mir-153 0.39547506 0.0117662 hsa-mir-155 2.13489084 0.01749556 hsa-mir-15a 2.06363552 0.00900422 hsa-mir-15b 26.1777272 7.16E-06 hsa-mir-16 7.00699074 7.16E-06 hsa-mir-17-3p 2.9472995 0.00025116 hsa-mir-17-5p 26.3119159 0.00043067 hsa-mir-181a 0.41250441 0.0018715 hsa-mir-181b 0.4559957 0.00418778 hsa-mir-181c 0.38846465 0.00018537 hsa-mir-181d 0.70318804 0.12703441 hsa-mir-182 0.35232871 0.00043067 hsa-mir-182* 0.42557789 0.01749556 hsa-mir-183 0.5743967 0.02859318 hsa-mir-184 0.06398151 7.16E-06 hsa-miR-185 1.54155538 0.12703441 hsa-mir-186 1.85438899 0.00124058 hsa-mir-187 0.46481307 0.39367912 hsa-mir-188 0.88806239 0.72621669 hsa-mir-189 0.16893503 0.00030233 hsa-mir-18a 79.0815882 7.16E-06 hsa-mir-18a* 63.9114703 7.16E-06 hsa-mir-190 1.64013997 0.2889012 hsa-mir-191 1.10477886 0.26976018 hsa-mir-192 0.14622399 7.16E-06 hsa-mir-193a 1.16789826 0.67465852 hsa-mir-193b 4.2090245 0.00013862 hsa-mir-194 0.20907205 7.16E-06 hsa-mir-195 2.85739458 0.00018537 hsa-mir-196a 16.7342353 0.00043067 hsa-mir-196b 17.7581272 0.00043067 miRNA fold change p value hsa-mir-197 3.3116927 7.16E-06 hsa-mir-199a* 0.55000083 0.10843751 hsa-mir-19a 6.88751333 7.16E-06 hsa-mir-19b 4.49373357 1.30E-05 hsa-mir-200b 0.42791773 0.00378473 hsa-mir-200c 1.41579868 0.01749556 hsa-mir-202 1.1245744 0.26368061 hsa-mir-203 0.83558823 0.48954435 hsa-mir-204 0.03706516 7.16E-06 hsa-mir-205 0.53675893 0.07581168 hsa-mir-206 0.95807252 0.77502568 hsa-mir-20a 26.4811479 7.16E-06 hsa-mir-20b 14.1612372 7.16E-06 hsa-mir-21 0.57656504 0.01339514 hsa-mir-210 0.96285721 0.99060345 hsa-mir-211 0.02482795 0.00043067 hsa-mir-213 0.48361999 0.24766578 hsa-mir-214 1.38943797 0.12703441 hsa-mir-216 2.32107449 0.00939182 hsa-mir-217 7.81322416 1.30E-05 hsa-mir-218 0.25179093 0.00762549 hsa-mir-219 0.94631518 0.960105 hsa-mir-22 0.05253163 7.16E-06 hsa-mir-221 1.40947664 0.5272094 hsa-mir-222 1.09339696 0.67465852 hsa-mir-223 0.89534602 0.85372115 hsa-mir-224 291.864825 7.16E-06 hsa-mir-23b 0.42004824 2.44E-05 hsa-mir-24 0.63896374 0.04906702 hsa-mir-25 15.6401857 7.16E-06 hsa-mir-26a 0.59553671 0.04427405 hsa-mir-26b 0.5583957 0.03203347 hsa-mir-27a 0.3573996 0.00025116 hsa-mir-27b 0.36225236 7.16E-06 hsa-mir-28 1.03190904 0.64778272 hsa-mir-296 2.13514657 0.00013862 hsa-mir-29a 0.0421722 7.16E-06 hsa-mir-29b 0.0482461 0.00021017 hsa-mir-29c 0.02886594 7.16E-06 hsa-mir-301 7.42502783 0.00043067 hsa-mir-302a 0.83938937 0.56829947 hsa-mir-302b 0.67342364 0.52689892 hsa-mir-302c 1.19328061 0.77502568 hsa-mir-30a-3p 0.14800778 7.16E-06 hsa-mir-30a-5p 0.53136762 0.00063136 hsa-mir-30b 0.54588527 0.01339514 hsa-mir-30c 0.55939359 0.00391308 hsa-mir-30d 0.7681248 0.53670222 hsa-mir-30e-3p 0.21060566 4.01E-05 hsa-mir-31 0.02101799 0.00043067 hsa-mir-32 1.76548942 0.04427405 hsa-mir-320 1.12000353 0.3483077 hsa-mir-323 0.33369345 0.00141352 hsa-mir-324-3p 1.26345004 0.25054001 hsa-mir-324-5p 1.93278119 0.00226454 hsa-mir-328 0.33475394 0.00013862 hsa-mir-329 0.05237916 0.0007761 hsa-mir-33 0.48968232 0.091318 hsa-mir-330 0.09526962 0.00043067 miRNA fold change p value hsa-mir-331 1.20513488 0.06785334 hsa-mir-335 0.31105792 6.49E-05 hsa-mir-337 0.20862313 0.00900422 hsa-mir-338 0.95192321 0.72621669 hsa-mir-339 0.97027964 0.99060345 hsa-mir-340 4.3996595 4.01E-05 hsa-mir-342 1.20499242 0.26976018 hsa-mir-345 2.23359741 0.00063136 hsa-mir-34a 3.29325121 0.00251841 hsa-mir-34b 2.18090789 0.00404264 hsa-mir-34c 11.480094 0.00043067 hsa-mir-361 1.64485503 0.00018537 hsa-mir-362 4.66675665 9.72E-05 hsa-mir-363 0.76690276 0.26976018 hsa-mir-365 3.18513195 0.00043067 hsa-mir-367 0.78848663 0.70717062 hsa-mir-368 0.2349716 0.00010121 hsa-mir-369-3p 0.02751693 0.00091092 hsa-mir-369-5p 0.08361946 0.00251841 hsa-mir-370 0.07476827 0.00060692 hsa-mir-371 0.48418781 0.10843751 hsa-mir-372 0.54306705 0.04415163 hsa-mir-373 0.95097536 0.62116166 hsa-mir-374 1.99163251 0.08189477 hsa-mir-375 1.25035362 0.85372115 hsa-mir-376a 0.07683527 0.00049403 hsa-miR-376a* 0.09681493 9.39E-06 hsa-mir-378 0.12962734 7.16E-06 hsa-mir-379 0.03956945 0.00025116 hsa-miR-380-5p 0.03800462 0.00069548 hsa-mir-381 0.46185069 0.0254578 hsa-mir-382 0.0307304 0.00017972 hsa-mir-383 0.0283853 0.00049403 hsa-mir-409-5p 0.3510641 0.00048429 hsa-mir-410 0.05228181 0.00124058 hsa-mir-411 0.0505212 0.0022499 hsa-mir-422a 0.19101909 9.72E-05 hsa-mir-422b 0.12338888 0.00055578 hsa-mir-423 1.28423439 0.00939182 hsa-mir-424 0.37428883 0.02624396 hsa-mir-425 1.28014247 0.0244766 hsa-miR-425-5p 1.62536378 0.03203347 hsa-mir-429 0.3929063 0.00994593 hsa-mir-432 0.0528755 0.00332382 hsa-mir-432* 0.27657592 0.00163922 hsa-mir-433 0.03069235 0.00031742 hsa-mir-449 155.434676 0.00043067 hsa-mir-449b 16.6971009 0.00043067 hsa-mir-451 0.46332132 0.01339514 hsa-mir-452* 50.0864717 0.00043067 hsa-mir-455 0.7951811 0.62116166 hsa-miR-484 1.17789333 0.52511306 hsa-mir-485-3p 0.11089838 0.00063136 hsa-mir-486 5.9867152 7.16E-06 hsa-mir-487a 0.34346089 1.49E-05 hsa-mir-487b 0.03597225 0.00074741 hsa-miR-488 0.20122425 9.72E-05 hsa-mir-489 0.31905186 0.00900422 hsa-mir-491 0.36527896 0.00081334 miRNA fold change p value hsa-mir-493-3p 0.68599194 0.00259778 hsa-mir-495 0.03849728 0.00076348 hsa-mir-496 0.3300278 0.00479033 hsa-mir-497 0.2185559 0.00074164 hsa-mir-500 3.25977843 0.01446879 hsa-mir-501 4.79990937 0.00404264 hsa-mir-502 4.99722754 0.00378473 hsa-miR-504 0.48939463 0.01584247 hsa-mir-511 1.99855529 0.03799159 hsa-mir-516-3p 2.69457618 0.0007761 hsa-mir-517c 0.69861325 0.25602782 hsa-mir-518b 0.68684019 0.24796386 hsa-mir-520b 1.62964764 0.02510968 hsa-mir-520c 0.70751266 0.32020428 hsa-mir-520d 1.14690339 0.93441565 hsa-mir-520f 1.11158693 0.90770942 hsa-mir-520g 1.3021177 0.90770942 hsa-mir-524 1.43984302 0.1241732 hsa-mir-526b* 1.0973129 1 hsa-miR-532 3.49359963 0.00098366 hsa-mir-539 0.05218903 0.0007761 hsa-mir-542-3p 0.14402793 0.00124243 hsa-mir-544 2.62052266 0.02211232 hsa-miR-545 1.01146185 0.90770942 hsa-miR-548a 2.05655775 0.02510968 hsa-miR-548c 1.45298408 0.49035982 hsa-mir-548d 67.9436778 0.00043067 hsa-mir-550 7.76782145 7.16E-06 hsa-mir-551b 1.89296142 0.07482871 hsa-miR-556 1.40849181 0.10164507 hsa-mir-563 1.83609752 0.22335188 hsa-mir-564 0.80404032 0.69033352 hsa-mir-565 1.86022235 0.04427405 hsa-mir-572 1.57248444 0.11788226 hsa-mir-574 1.7388258 0.0400753 hsa-miR-576 3.46042567 0.00939182 hsa-miR-579 1.45550865 0.17876651 hsa-mir-580 1.67404523 0.07581168 hsa-mir-586 3.5635258 0.00416508 hsa-miR-589 2.73919005 0.02246324 hsa-miR-591 1.78203829 0.32614379 hsa-miR-592 3.68492668 0.00391308 hsa-miR-594 5.95325565 0.0018715 hsa-miR-597 1.07407362 0.93441565 hsa-mir-601 1.56904541 0.20907235 hsa-mir-604 0.89158812 0.85372115 hsa-miR-606 0.93037864 0.83163543 hsa-mir-610 1.67142973 0.04906702 hsa-mir-616 1.13999295 0.46559024 hsa-miR-617 0.99644562 1 hsa-miR-618 0.55607267 0.11788226 hsa-mir-624 0.71607099 0.38454635 hsa-mir-627 1.17089243 0.85372115 hsa-miR-628 1.76076528 0.06916151 hsa-miR-629 13.7301513 7.16E-06 hsa-mir-630 0.91056169 0.64778272 hsa-mir-632 2.19061098 0.02859318 hsa-miR-638 1.36058072 0.43080058 hsa-mir-639 1.28944024 0.7278872 miRNA fold change p value hsa-miR-641 1.17976993 0.77502568 hsa-miR-642 0.67712899 0.85372115 hsa-mir-643 1.35673645 0.15056971 hsa-miR-645 0.65285887 0.0400753 hsa-mir-650 1.3372344 0.4175414 hsa-mir-651 2.83286228 0.00569964 hsa-miR-653 0.33088794 0.00250862 hsa-mir-655 0.06240409 0.00200424 hsa-mir-656 0.13595654 0.00017353 hsa-mir-660 1.75285267 0.0610666 hsa-mir-7 42.6616607 7.16E-06 hsa-mir-9 0.26396093 6.49E-05 hsa-mir-9* 0.19311894 2.44E-05 hsa-mir-92 6.40573466 7.16E-06 hsa-mir-93 23.3811787 7.16E-06 hsa-mir-95 2.18070927 0.03239561 hsa-mir-96 0.15148064 1.30E-05 hsa-mir-98 0.350188 0.03239561 hsa-mir-99a 0.09033381 7.16E-06 hsa-mir-99b 1.46567717 0.00762549

Table 3

List of miRNAs that are up-regulated both in mouse and human tumours

Column 1 : miRNAs; column 2: Murine tumour vs. normal retina; column 3: Human tumour vs. normal retina; column 4: Mouse Validated targets according to http://mirecords.biolead.org/;

found more than once are highlighted in bold Materials and Methods Mice

All animal experiments were performed in accordance with the guidelines of the University of Leuven Animal Care and Use ethical Committee. BrdU (100 μg/g of body weight) was injected intraperitoneally lhr prior to sacrifice.

Immunohistochemistry

Eyes were fixed overnight in 4% paraformaldehyde/PBS, and paraffin embedded. 5μιη sections were immunostained with the following antibodies: GFP (Santa Cruz Biotechnology, 1/100); BrdU (BD Pharmingen); Ki-67 (DAKO cytomation); cleaved Caspase-3 (Cell Signaling); GFP (Santa Cruz

Biotechnology); ChxlO (Exalpha Biologicals); syntaxin (Sigma); calbindin (Abeam); Calretinin (Millipore). AP staining

Dissected retinae were fixed for lh in 4% paraformaldehyde/PBS on ice, heated to 65°C for 30min and embedded in 4% agarose/PBS. 40μιη sections were rinsed once in AP detection buffer (lOOmM Tris pH9.5, 50mM MgCI₂, 100 mM NaCI) before developing in Nitro blue tetrazolium chloride/5-Bromo-4- chloro-3-indolyl phosphate (NBT/BCIP Ready-to-use tablets, Roche) for 4h.

Recombination analysis

DNA was isolated from dissected retinae and isolated tumours using DNeasy Blood&Tissue Kit (Qjagen). Dicerl reco m b i n at io n wa s a n a l yzed by PC R u s i ng t h e fo l l owi ng p ri m e rs : a 5'- ATTGTTACCAGCGCTTAGAATTCC; c 5'-TCGGAAT AGGAACTTCGTTTAAAC and the reverse b primer 5'- GGGAGGTGTACGTCTA CAATT. P53 recombination was analyzed by PCR using the following primers: d 5'-CACAAAAACAGGTTAAACCCAG and the reverse primers f 5'-AGCACATAGGAGGCAGAGAC and e 5'- GAAGACAGAAAAGGGGAGGG. PCR conditions were as fol low: lx precycle at 94°C for 3m in a nd 30cycles of 94°C, 30sec; 60°C, 30sec; 72°C, 45sec.

Retinoblastoma tumour samples and RNA isolation

Immediately following enucleation, dissected retinae or tumour samples were removed from the mouse eyes under the binocular using forceps. The specimens were placed on ice and immediately processed for RNA or DNA isolation. Before tumour samples were collected from human

retinoblastoma samples, serial cryosections where obtained from all tumours. The first and last cryosection of each series were H&E stained for tumour cell content verification. 3-5mm³ samples were placed on ice and immediately processed for RNA and DNA isolation. Total RNA and genomic DNA were isolated using the miRNeasy kit (Qjagen) and the QJAmp mini kit (Qjagen), respectively, according to manufacturer's instructions. Written informed consent was obtained from patients and/or their parents. All procedures have been approved by the institutional review board of the Children's University Hospital of Essen. microRNA Expression analyses

For human samples, miRNA expression profiling was performed as described previously (24). For murine samples, 60 ng of total RNA was reverse transcribed using the murine stem-loop megaplex pool A and B followed by limited cycle pre-amplification (Applied Biosystems). Expression of 430 human and 509 murine miRNAs was profiled using Taqman miRNA assays on a 7900HT detection system (Applied Biosystems). Data were normalized using the global mean (25). miRNA expression data are available as RDML-files upon request (26). Differentially expressed miRNAs were identified using the Mann- Whitney test followed by multiple testing correction according to the Benjamini-Hochberg algorithm. Hierarchical clustering was performed using method Ward and distance Manhattan. All statistical analyses were performed using R Bioconductor software.

Array CGH

Samples were profiled on a custom designed 44K/60K array (Agilent Technologies) enriched for miRNA and T-UCR regions and regions around cancer gene census genes. Utilizing random prime labelling (BioPrime ArrayCGH Genomic Labeling System, Invitrogen), 150 ng of test and control DNA (DNA from an EBV cell line if cell lines were tested or male control DNA, Promega if tumour samples were tested) was labeled with Cy3 and Cy5 dyes (GE healthcare). Slides were scanned using an Agilent scanner (Agilent Technologies) an in-house developed visual isation software program arrayCG H base (http://medgen.ugent.be/arrayCGHbase) (27). Array CGH profiles were evaluated by using the circulary binary segmentation (CBS) algorithm.

Cell culture and Inhibition of miRNAs

Retinoblastoma cell lines Weri and Y79 were authenticated by DNA fingerprinting (DMSZ, Braunschweig, Germany). Cells were cultured in suspension in Dulbecco's Modified Eagles's Medium (DMEM) (Invitrogen), containing 15% FCS, Penicillin/Streptomycin, 4mM L-G l utam in, 50μΜ β- Mercaptoethanol and 0.1% Insulin (all from Invitrogen). lxlO⁴ Weri and Y79 cells / well were seeded on 24-well plates and transfected with specific antagomirs or scrambled Cy3-labelled control oligos (all from Ambion) at a final concentration of ΙΟΟηΜ using NeoFx transfection agent (Ambion) according to the manufacturers recommendations. Further, antisense inhibitors were designed against all members of the miR-17/92 cluster using the locked nucleic acid (LNA) technology. The inhibitors were synthesized as fully phosphorothiolated DNA/LNA mixmers and purified by preparative H PLC before use. The number and position of LNA nucleotides was chosen in each case in order to maximize affinity and selectivity towards the specific miRNA target.

3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) cell proliferation assay MTT assays were performed as previously described (28). Briefly, after the addition of 200 μί MTT solution (6 mg/mL in PBS, Roche, Germany), cells were incubated for lh and then solubilized by the addition of 1 mL stop solution (10% SDS, 5% acetic acid in dimethyl sulfoxide). Absorbance at 570 nm was measured using a GloMax^®-Multi Microplate Multimode Reader (Promega).

Croce, CM., Causes and consequences of microRNA dysregulation in cancer. Nat Rev Genet 10 (10), 704-714 (2009).

Karube, Y. et al., Reduced expression of Dicer associated with poor prognosis in lung cancer patients. Cancer Sci 96 (2), 111-115 (2005).

Kumar, M.S., Lu, J., Mercer, K.L, Golub, T.R., & Jacks, T., Impaired microRNA processing enhances cellular transformation and tumourigenesis. Nat Genet 39 (5), 673-677 (2007).

Melo, S.A. et al., A TARBP2 mutation in human cancer impairs microRNA processing and DICERl function. Nat Genet 41 (3), 365-370 (2009).

Pampalakis, G., Diamandis, E. P., Katsaros, D., & Sotiropoulou, G., Down-regulation of dicer expression in ovarian cancer tissues. Clin Biochem (2009).

Hill, D.A. et al., DICERl mutations in familial pleuropulmonary blastoma. Science 325 (5943), 965 (2009).

Kumar, M.S. et al., Dicerl functions as a haploinsufficient tumour suppressor. Genes Dev (2009).

Lambertz, I. et al., Monoallelic but not biallelic loss of Dicerl promotes tumourigenesis in vivo. Cell Death Differ 17 (4), 633-641.

Arrate, M. P. et al., MicroRNA Biogenesis Is Required for Myc-lnduced B-Cell Lymphoma Development and Survival. Cancer Res.

Zhang, J., Schweers, B., & Dyer, M.A., The first knockout mouse model of retinoblastoma. Cell Cycle 3 (7), 952-959 (2004).

Zhang, J. et al., Rb regulates proliferation and rod photoreceptor development in the mouse retina. Nat Genet 36 (4), 351-360 (2004).

Laurie, N.A. et al., Inactivation of the p53 pathway in retinoblastoma. Nature 444 (7115), 61-66 (2006).

Donovan, S.L., Schweers, B., Martins, R., Johnson, D., & Dyer, M.A., Compensation by tumour suppressor genes during retinal development in mice and humans. BMC Biol 4, 14 (2006).

Rowan, S. & Cepko, C.L., Genetic analysis of the homeodomain transcription factor ChxlO in the retina using a novel multifunctional BAC transgenic mouse reporter. Dev Biol 271 (2), 388- 402 (2004).

Donovan, S.L. & Dyer, M.A., Developmental defects in Rb-deficient retinae. Vision Res 44 (28), 3323-3333 (2004).

Dam ian i, D. et al., Dicer inactivation leads to progressive functional and structural degeneration of the mouse retina. J Neurosci 28 (19), 4878-4887 (2008). Olive, V., Jiang, I., & He, L, mir-17-92, a cluster of miRNAs in the midst of the cancer network. IntJ Biochem Cell Biol.

van Haaften, G. & Agami, R., Tumourigenicity of the miR-17-92 cluster distilled. Genes Dev 24 (1), 1-4.

Shields, C.L. & Shields, J. A., Basic understanding of current classification and management of retinoblastoma. Curr Opin Ophthalmol 17 (3), 228-234 (2006).

Aguda, B.D., Kim, Y., Piper-Hunter, M.G., Friedman, A., & Marsh, C.B., MicroRNA regulation of a cancer network: consequences of the feedback loops involving miR-17-92, E2F, and Myc. Proc Natl Acad Sci U S A 105 (50), 19678-19683 (2008).

Yan, H.L. et al., Repression of the miR-17-92 cluster by p53 has an im portant function in hypoxia-induced apoptosis. EMBO J 28 (18), 2719-2732 (2009).

Marine, J.C., Journal club. A cancer geneticist looks at the link between small RNA molecules and cancer. Nature 464 (7293), 1249.

Ma, L. et al., Therapeutic silencing of miR-lOb inhibits metastasis in a mouse mammary tumour model. Nat Biotechnol 28 (4), 341-347.

Mestdagh, P. et al., High-throughput stem-loop RT-qPCR miRNA expression profiling using minute amounts of input RNA. Nucleic Acids Res 36 (21), el43 (2008).

Mestdagh, P. et al., A novel and universal method for microRNA RT-qPCR data normalization. Genome Biol 10 (6), R64 (2009).

Lefever, S. et al., RDML: structured language and reporting guidelines for real-time quantitative PCR data. Nucleic Acids Res 37 (7), 2065-2069 (2009).

Menten, B. et al., arrayCGHbase: an analysis platform for comparative genomic hybridization microarrays. BMC Bioinformatics 6, 124 (2005).

Mosmann, T., Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J Immunol Methods 65 (1-2), 55-63 (1983).

Levine, A.J., p53, the cellular gatekeeper for growth and division. Cell 88 (3), 323-331 (1997).

Kaelin WG Jr., The concept of synthetic lethality in the context of anticancer therapy. Nat Rev Cancer , 5(9) :689-98 (2005).

Farmer H, et al., Targeting the DNA repair defect in BRCA mutant cells as a therapeutic strategy. Nature 434:917-921 (2005).

Fong PC, et al., Inhibition of poly(ADP-ribose) polymerase in tumors from BRCA mutation carriers. N Engl J Med; 361:123-134 (2009).

Nevins JR., The Rb/E2F pathway and cancer. Hum Mol Genet; 10(7):699-703 (2001). Burkhart DL, et al., Cellular mechanisms of tumour suppression by the retinoblastoma gene. Nat Rev Cancer, 8(9):671-82 (2008).

Bartel B, MicroRNAs directing siRNA biogenesis. Nat Struct Mol β/Ό/ ;12(7):569-71 (2005).

Ryan BM, et al., Genetic variation in microRNA networks: the implications for cancer research. Nat Rev Cancer, 10(6) :389-402 (2010).

Ventura A, et al., Targeted Deletion Reveals Essential and Overlapping Functions of the miR-17- 92 Family of miRNA Clusters. Cell 132, 875-886, (2008).

Tanzer A, et al., Molecular evolution of a microRNA cluster. J Mol Biol; 339:327-35 (2004).

Krutzfeldt J, et al., Silencing of microRNAs in vivo with 'antagomirs'. Nature l;438(7068):685-9 (2005).

Claims

1. A method of inducing cell death in a cell where p53 function is compromised, comprising inhibiting the function of Dicer.

2. The method according to claim 1, wherein the cell death is due to synthetic lethality.

3. The method according to claim 1 or 2, wherein the cell is further characterized by activation of an oncogene or inhibition of a tumor suppressor gene.

4. The method according to any one of claims 1 to 3, wherein the cell is a tumour cell.

5. The method according to claim 4, wherein the tumour is a retinoblastoma.

6. The method according to claim 5, wherein the function of Dicerl is inhibited by inhibiting one or more of the miRNAs that are upregulated in the cell where p53 function is impaired.

7. The method according to claim 5, wherein the miRNA is selected from the miR 17-92 cluster, particularly selected from miR-17, miR-18a, miR-19a, miR-19b, miR-20a and miR-92.

8. The method according to claim 6 or 7, wherein inhibition of the miRNAs is with an LNA or an antagomir.

9. The method according to any one of claims 1 to 5, wherein inhibiting the function of Dicer is done by inhibition of the Dicerl gene, the Dicerl mRNA or the Dicer protein.

10. The method according to any one of claims 1 to 9, wherein p53 function is impaired by functional dysregulation but not mutation.

11. The method according to any one of claims 1 to 9, wherein p53 function is impaired by at least one mutation.

12. An inhibitor of Dicer function for use in treatment of cancer.

13. The inhibitor according to claim 12, wherein the cancer is retinoblastoma.

14. The inhibitor according to claim 13, which is an inhibitor of one or more of the miRNAs that are upregulated in the cancer cells.

15. The inhibitor according to claim 14, wherein the miRNA is selected from the miR 17-92 cluster, particularly selected from miR-17, miR-18a, miR-19a, miR-19b, miR-20a and miR-92.

6. The inhibitor according to claim 12 or 13, which is an inhibitor of the Dicerl gene, the Dicerl mRNA or the Dicer protein.