WO2012052878A1

WO2012052878A1 - Isolated polynucleotides and nucleic acid constructs for directing expression of a gene-of-interest in cells

Info

Publication number: WO2012052878A1
Application number: PCT/IB2011/054493
Authority: WO
Inventors: Erez Feige; Tal Gershgoren; Livnat Bangio; Eyal Breitbart
Original assignee: Vascular Biogenics Ltd.
Priority date: 2010-10-19
Filing date: 2011-10-12
Publication date: 2012-04-26

Abstract

Isolated polynucleotides comprising at least 14 nucleotides of SEQ ID NO:6 of a pre-proendothelin promoter which comprise at least 2 consecutive sequences being positioned next to at least one nucleotide position selected from the group consisting of at least one nucleotide of SEQ ID NO:46, 47, 52, 49, 50, 53 and 54, which is mutated as compared to SEQ ID NO:6 such that when the isolated polynucleotide is integrated into the PPE-1 promoter and placed upstream of a luciferase coding sequence the expression level of the luciferase coding sequence is upregulated or downregulated as compared to when SEQ ID NO:6 is similarly integrated into the PPE-1 promoter and placed upstream of the luciferase coding sequence. Also provided are nucleic acid constructs comprising same, methods of using same and pharmaceutical compositions comprising same for increasing or decreasing expression of a polynucleotide of interest in endothelial and non-endothelial cells.

Description

ISOLATED POLYNUCLEOTIDES AND NUCLEIC ACID

CONSTRUCTS FOR DIRECTING EXPRESSION OF A GENE-OF-

INTEREST IN CELLS

FIELD AND BACKGROUND OF THE INVENTION

The present invention, in some embodiments thereof, relates to isolated polynucleotides and nucleic acid constructs for expression in cells and, more particularly, but not exclusively, to methods of using same for increasing expression of a gene-of-interest in specific cell types such as endothelial cells.

Angiogenesis is a process of new blood vessel formation by sprouting from pre- existing neighboring vessels. This process is common and major feature of several pathologies. Among these, are diseases in which excessive angiogenesis involves in the pathology and development of the disease and thus being a target for therapy, most significantly, cancer. Angiogenesis occurs in tumors and permits their growth, invasion and metastatic proliferation and thus inhibition of angiogenesis may be a strategy to arrest tumor growth.

Several cell surface molecules, transcription factors and growth factors are involved in angiogenesis. Hypoxia is an important environmental factor that leads to neovascularization, inducing release of several pro-angiogenic cytokines, including vascular endothelial growth factors (VEGF) and their receptors, members of the angiopoietin family, basic fibroblast growth factor, and endothelin-1 (ET-1). These factors mediate induction of angiogenesis through control of activation, proliferation and migration of endothelial cells.

Recombinant forms of endogenous inhibitors of angiogenesis have been tested for the treatment of cancer, however the potential pharmacokinetic, biotechnological and economic drawbacks of chronic delivery of these recombinant inhibitors have led scientists to develop other approaches. The development of the anti-VEGF monoclonal antibody bevacizumab has validated anti-angiogenic targeting as a complementary therapeutic modality to chemotherapy. Several small molecule inhibitors, including second-generation multi-targeted tyrosine kinase inhibitors, have also shown promise as antiangiogenic agents for cancer. The drawbacks of chronic delivery of recombinant inhibitors, antibodies, and small molecules, as well as the limited activity manifested when these drugs are administered as monotherapy have led to the development of anti-angiogenic gene therapies. Gene therapy is an emerging modality for treating inherited and acquired human diseases. However, a number of obstacles have impeded development of successful gene therapy, including duration of expression, induction of the immune response, cytotoxicity of the vectors and tissue specificity.

United States Patent 5,747,340 teaches use of a murine endothelial cell-specific promoter which shows selectivity towards angiogenic cells, and therapeutic applications thereof.

International Application WO/2008/132729 discloses a non-replicating adenovirus vector (Ad5, El deleted), containing a modified murine pre-proendothelin promoter (PPE-1-3X) and a fas-chimera transgene [Fas and human tumor necrosis factor (TNF) receptor] which has been developed, in which the modified murine promoter (PPE-1-3X), is able to restrict expression of the fas chimera transgene to angiogenic blood vessels, leading to targeted apoptosis of these vessels.

Endothelial-specific gene therapy with the PPE-1-3X promoter does not increase the specificity of viral interactions with the host (e.g. transfection) but restricts the expression of the transgene to those tissues that endogenously recognize the modified promoter - angiogenic endothelial cells. The chimeric receptor can trigger the Fas pathway by binding TNFa, which is less toxic in non-tumoral tissues than using the Fas/Fas ligand mechanism, which is highly expressed in non-tumoral normal tissues such as the liver. Further, TNFa was found to be abundant in the microenvironment of tumors adding to the specificity of the transgene activity in the tumor and its surroundings.

Bu X and Quertermous T, 1997 (J. Biol. Chem. 272:32613-32622) describe an endothelial cell-specific DNA regulatory element in the endothelin-1 promoter. SUMMARY OF THE INVENTION

According to an aspect of some embodiments of the present invention there is provided an isolated polynucleotide comprising at least 14 nucleotides of element X of a pre-proendothelin (PPE-1) promoter, the element X having a wild type sequence as set forth by SEQ ID NO:6, wherein the at least 14 nucleotides comprise at least 2 consecutive sequences derived from SEQ ID NO:6, each of the at least 2 consecutive sequences comprises at least 3 nucleotides, at least one of the at least 3 nucleotide being positioned next to at least one nucleotide position in SEQ ID NO:6, the at least one nucleotide position in SEQ ID NO: 6 is selected from the group consisting of:

(i) at least one nucleotide of wild type M4 sequence set forth by SEQ ID

NO:46 (CATTC);

(ii) at least one nucleotide of wild type M5 sequence set forth by SEQ ID NO:47 (CAATG);

(iii) at least one nucleotide of wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC);

(iv) at least one nucleotide of wild type M6 sequence set forth by SEQ ID NO:49 (GGGTG);

(v) at least one nucleotide of wild type M7 sequence set forth by SEQ ID NO:50 (ACTTT);

(vi) at least one nucleotide of wild type Ml sequence set forth by SEQ ID

NO:53 (GTACT); and

(v) at least one nucleotide of wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT);

the at least one nucleotide position is mutated as compared to SEQ ID NO: 6 by at least one nucleotide substitution, at least one nucleotide deletion and/or at least one nucleotide insertion, with the proviso that a mutation of the at least one nucleotide position does not result in nucleotides GGTA at position 21-24 of SEQ ID NO:6 and/or in nucleotides CATG at position 29-32 of SEQ ID NO:6, such that when the isolated polynucleotide is integrated into the PPE-1 promoter and placed upstream of a luciferase coding sequence the expression level of the luciferase coding sequence is upregulated or downregulated as compared to when SEQ ID NO: 6 is similarly integrated into the PPE-1 promoter and placed upstream of the luciferase coding sequence. According to an aspect of some embodiments of the present invention there is provided an isolated polynucleotide comprising a nucleic acid sequence which comprises a first polynucleotide comprising the pre-proendothelin (PPE-1) promoter set forth by SEQ ID NO: l and a second polynucleotide comprising at least one copy of a nucleic acid sequence selected from the group consisting of:

(i) wild type M4 sequence set forth by SEQ ID NO :46 (CATTC),

(ii) wild type M5 sequence set forth by SEQ ID NO:47 (CAATG),

(iii) wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC),

(iv) wild type M6 sequence set forth by SEQ ID NO:49 (GGGTG),

(v) wild type M7 sequence set forth by SEQ ID NO :50 (ACTTT);

(vi) wild type Ml sequence set forth by SEQ ID NO:53 (GTACT), and

(vii) wild type M3 sequence set forth by SEQ ID NO :54 (CTTTT),

with the proviso that the second polynucleotide is not SEQ ID NO:6, and wherein the isolated polynucleotide is not as set forth by SEQ 17 (PPE-1 -3X).

According to an aspect of some embodiments of the present invention there is provided a nucleic acid construct comprising a heterologous polynucleotide operably linked to the isolated polynucleotide of any of claims 1-5.

According to an aspect of some embodiments of the present invention there is provided a nucleic acid construct for directing expression of a heterologous polynucleotide in endothelial cells, comprising the nucleic acid construct of claim 6, 7, 8 or 9.

According to an aspect of some embodiments of the present invention there is provided a method of increasing expression of an expressible nucleic acid sequence of interest in endothelial cells of a subject, comprising expressing in cells of a subject the nucleic acid construct of any of claims 6-13, wherein the heterologous polynucleotide comprises the expressible nucleic acid sequence of interest, thereby increasing expression of the expressible nucleic acid sequence of interest in the endothelial cells.

According to an aspect of some embodiments of the present invention there is provided a method of increasing expression of an expressible nucleic acid sequence of interest in cells of a subject, comprising expressing in cells of a subject the nucleic acid construct of any of claims 21-23, wherein the heterologous polynucleotide comprises the expressible nucleic acid sequence of interest, thereby increasing expression of the expressible nuclei acid sequence in the cells of the subject.

According to an aspect of some embodiments of the present invention there is provided a method of decreasing expression of an expressible nucleic acid sequence of interest in cells of a subject, comprising expressing in cells of a subject the nucleic acid construct of claim 34, 35 or 36, wherein the heterologous polynucleotide comprises the expressible nucleic acid sequence of interest, thereby increasing expression of the expressible nuclei acid sequence in the cells of the subject.

According to an aspect of some embodiments of the present invention there is provided a pharmaceutical composition comprising the isolated polynucleotide of any of claims 1-5, 9, 15-23 and 25-43, or the nucleic acid construct of any of claims 6-13, 15- 23 and 25-43, and a pharmaceutically acceptable carrier.

According to some embodiments of the invention, the isolated polynucleotide further comprises at least one copy of a nucleic acid sequence selected from the group consisting of:

(i) wild type M4 sequence set forth by SEQ ID NO :46 (CATTC),

(ii) wild type M5 sequence set forth by SEQ ID NO:47 (CAATG),

(iii) wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC),

(iv) wild type M6 sequence set forth by SEQ ID NO:49 (GGGTG),

(v) wild type M7 sequence set forth by SEQ ID NO :50 (ACTTT);

(vi) wild type Ml sequence set forth by SEQ ID NO:53 (GTACT), and

(vii) wild type M3 sequence set forth by SEQ ID NO :54 (CTTTT).

According to some embodiments of the invention, the isolated polynucleotide further comprises an endothelial cell specific promoter.

According to some embodiments of the invention, the endothelial specific promoter is a PPE-1 promoter set forth in SEQ ID NO: 1.

According to some embodiments of the invention, the heterologous polynucleotide is an expressible nucleic acid sequence.

According to some embodiments of the invention, the polynucleotide is positioned in a distance not exceeding 3000 nucleotides from the element X.

According to some embodiments of the invention, the isolated polynucleotide consists of no more than 40 kb. According to some embodiments of the invention, the heterologous polynucleotide is capable of inducing angiogenesis.

According to some embodiments of the invention, the heterologous polynucleotide is capable of inhibiting angiogenesis.

According to some embodiments of the invention, the heterologous polynucleotide is capable of stabilizing and/or maturing blood vessels.

According to some embodiments of the invention, the isolated polynucleotide comprises at least one copy of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC).

According to some embodiments of the invention, the isolated polynucleotide comprises at least one copy of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG).

According to some embodiments of the invention, the isolated polynucleotide comprises at least one copy of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC) and at least one copy of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG).

According to some embodiments of the invention, the at least one nucleotide position which is mutated as compared to SEQ ID NO: 6 is at least one nucleotide of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC).

According to some embodiments of the invention, the isolated polynucleotide further comprises at least one copy of wild type Ml sequence set forth by SEQ ID NO:53 (GTACT).

According to some embodiments of the invention, the isolated polynucleotide further comprises wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC).

According to some embodiments of the invention, the isolated polynucleotide comprises at least one copy of the wild type M6 set forth by SEQ ID NO:49 (GGGTG).

According to some embodiments of the invention, the isolated polynucleotide comprises at least one copy of the wild type M7 sequence set forth by SEQ ID NO:50 (ACTTT).

According to some embodiments of the invention, the isolated polynucleotide comprises at least one copy of the wild type M6 set forth by SEQ ID NO:49 (GGGTG) and at least one copy of the wild type M7 sequence set forth by SEQ ID NO:50 (ACTTT).

According to some embodiments of the invention, the at least one nucleotide position which is mutated as compared to SEQ ID NO: 6 is at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC).

According to some embodiments of the invention, the at least one nucleotide position which is mutated as compared to SEQ ID NO: 6 is at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG).

According to some embodiments of the invention, the at least one nucleotide position which is mutated as compared to SEQ ID NO: 6 is at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC) and at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG).

According to some embodiments of the invention, the at least one nucleotide position which is mutated as compared to SEQ ID NO: 6 is at least one nucleotide of the wild type M6 set forth by SEQ ID NO:49 (GGGTG).

According to some embodiments of the invention, the at least one nucleotide position which is mutated as compared to SEQ ID NO: 6 is at least one nucleotide of the wild type M7 set forth by SEQ ID NO:50 (ACTTT).

According to some embodiments of the invention, the at least one nucleotide position which is mutated as compared to SEQ ID NO: 6 is at least one nucleotide of the wild type M6 set forth by SEQ ID NO:49 (GGGTG) and at least one nucleotide of the wild type M7 set forth by SEQ ID NO:50 (ACTTT). According to some embodiments of the invention, the isolated polynucleotide comprises at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC).

According to some embodiments of the invention, the isolated polynucleotide comprises at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT).

According to some embodiments of the invention, the isolated polynucleotide comprises at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT).

According to some embodiments of the invention, the cell is an endothelial cell and wherein the at least one mutation is in the at least one nucleotide of wild type M4 sequence set forth by SEQ ID NO:46 (CATTC) and/or in the at least one nucleotide of wild type M5 sequence set forth by SEQ ID NO:47 (CAATG).

According to some embodiments of the invention, the cells express endothelin.

According to some embodiments of the invention, the second polynucleotide comprises the wild type M7 sequence and the wild type M8 sequence (SEQ ID NO:52).

According to some embodiments of the invention, the second polynucleotide comprises the wild type M7 sequence and a wild type M9 sequence set forth by SEQ ID NO:766 (CTGGA).

According to some embodiments of the invention, the second polynucleotide comprises the wild type M8 sequence (SEQ ID NO:52) and a wild type M9 sequence set forth by SEQ ID NO:766 (CTGGA).

According to some embodiments of the invention, the second polynucleotide comprises the wild type M7 sequence, wild type M8 sequence and a wild type M9 sequence set forth by SEQ ID NO:766 (CTGGA).

Unless otherwise defined, all technical and/or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and/or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.

Implementation of the method and/or system of embodiments of the invention can involve performing or completing selected tasks manually, automatically, or a combination thereof. Moreover, according to actual instrumentation and equipment of embodiments of the method and/or system of the invention, several selected tasks could be implemented by hardware, by software or by firmware or by a combination thereof using an operating system.

For example, hardware for performing selected tasks according to embodiments of the invention could be implemented as a chip or a circuit. As software, selected tasks according to embodiments of the invention could be implemented as a plurality of software instructions being executed by a computer using any suitable operating system. In an exemplary embodiment of the invention, one or more tasks according to exemplary embodiments of method and/or system as described herein are performed by a data processor, such as a computing platform for executing a plurality of instructions. Optionally, the data processor includes a volatile memory for storing instructions and/or data and/or a non-volatile storage, for example, a magnetic hard-disk and/or removable media, for storing instructions and/or data. Optionally, a network connection is provided as well. A display and/or a user input device such as a keyboard or mouse are optionally provided as well.

BRIEF DESCRIPTION OF THE DRAWINGS

Some embodiments of the invention are herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings makes apparent to those skilled in the art how embodiments of the invention may be practiced.

In the drawings:

FIGs. 1A-C are schematic illustrations and a nucleic acid sequence depicting the

PPE-1 promoter. Figure 1A - Schematic illustration of the PPE-1 promoter which comprises the Nhel restriction enzyme site which was used for inserting the 3X DNA fragment shown in Figure IB. Figure IB - Schematic illustration of the 3X DNA fragment which includes 2 complete PPE elements in the right orientation (IX, marked with red arrows), each comprises part "1" upstream of part "2"; and an additional element (Χ', flipped PPE element, marked with a brown arrow), which comprises part "2" upstream of part "1". Figure 1C - Nucleic acid sequence of the 3X DNA fragment schematically shown in Figure IB (SEQ ID NO: 7).

FIGs. 2A-B depict the isolated polynucleotide according to some embodiments of the invention. Figure 2A - A schematic illustration in which element X or a mutated element X was inserted into the PPE-1 promoter (by cloning into the Nhel restriction enzyme site). The red arrow (IX) marks the endogenous sequence of wild type SEQ ID NO: 6 which is part of the PPE-1 promoter. Figure 2B - is a nucleic acid sequence information of the wild-type (WT; SEQ ID NO:36) and mutated (M1-M9; SEQ ID NOs:37-45) PPE-1 regulatory element X along with the Nhel sticky ends that enable its ligation into the PPE-1 promoter in plasmid pEL8. Note that in each mutated PPE-1 sequence the mutation (replacement of the wild type sequence with a stretch of 5 adenosine nucleotides, ^{^}ΑΛΛΛ ") is in a different position;

FIGs. 3A-B are histograms depicting luciferase expression under different PPE promoters in BAEC (Figure 3A) or B2B (Figure 3B) dividing cells at 50 % confluency. Promoter activity was tested as a function of the enzymatic activity of luciferase per milligram protein following infection of the cells with adenovirus (pJM17) containing the luciferase coding sequence under the regulation of the indicated promoters or in uninfected cells. The following promoters were used: CMV (SEQ ID NO:23), PPE-1 (SEQ ID NO: l), PPE-1-3X (SEQ ID NO: 17), PPE-l-[x+x+x] (SEQ ID NO:20), PPE-1- [x+x] (SEQ ID NO: 19). The measured values were normalized according to the luciferase activity measured using the PPE-1-(3X) promoter which was defined as relative expression "1". Results represent average ± standard deviation (S.D.) of 9 experiments performed in triplicates. Statistically significant differences (p < 0.05) relative to PPE-1 are marked with an asterisk.

FIG. 4 is a histogram depicting relative luciferase expression under different PPE promoters in NIH3T3 dividing cells at 50 % confluency. Promoter activity was tested as a function of the enzymatic activity of luciferase per milligram protein following infection of the cells with adenovirus (pJM17) containing the luciferase coding sequence under the regulation of the indicated promoters or in uninfected cells. The following promoters were used: CMV (SEQ ID NO:23), PPE-1 (SEQ ID NO: l), PPE-1-(3X) (SEQ ID NO: 17), PPE-l-[x+x+x] (SEQ ID NO:20), PPE-l-[x+x] (SEQ ID NO: 19). The measured values were normalized according to the luciferase activity as measured using the PPE-1 promoter at 100 multiplicity of infection (MOI) which was defined as relative expression "1". Results represent average ± S.D. of 3 experiments performed in triplicates. Statistically significant differences (p < 0.05) relative to all PPE forms are marked with an asterisk.

FIG. 5 is a histogram depicting luciferase expression under different PPE promoters in fully confluence BAEC cells. Promoter activity was tested as a function of the enzymatic activity of luciferase (milligram protein) following infection of the cells with adenovirus (pJM17) containing the luciferase coding sequence under the regulation of the indicated promoters or in uninfected cells. The following promoters were used: CMV (SEQ ID NO:23), PPE-1 (SEQ ID NO: l), PPE-1-(3X) (SEQ ID NO: 17), PPE-1- [x+x+x] (SEQ ID NO:20), PPE-l-[x+x] (SEQ ID NO: 19). The measured values were normalized according to the luciferase activity as measured using the PPE-l-(3x) promoter which is defined as relative expression "1". Results are presented as average ± standard deviation of 9 experiments performed in triplicates. Statistically significant differences (p < 0.05) relative to PPE-1 are marked with an asterisk (*).

FIG. 6 is a histogram depicting luciferase expression under different PPE promoters containing or lacking X' element in BAEC, B2B and NIH3T3 dividing cells. Promoter activity was tested as a function of the enzymatic activity of luciferase per milligram protein following liposomal transfection of the cells with the following plasmids: pEL8-PPE-l-Luc (containing the promoter set forth by SEQ ID NO: l), pEL8- PPE-l+[x']-Luc (containing the promoter set forth by SEQ ID NO:25), and pEL8-PPE- l+[x+x]-Luc (positive control; containing the promoter set forth by SEQ ID NO: 19). The measured values were normalized according to the luciferase activity as measured using the PPE-1 promoter in BAEC cells which was defined as relative expression "1". Results represent average ± standard deviation of 3 experiments performed in triplicates. Statistically significant p values are indicated.

FIGs. 7A-C are histograms depicting luciferase expression under mutated PPE promoters in BAEC (Figure 7A), B2B (Figure 7B) or NIH3T3 (Figure 7C) cells. Promoter activity was tested as a function of the enzymatic activity of luciferase (milligram protein) after liposomal transfection. The following promoters were tested: PPE-1 (SEQ ID NO: l), PPE-1-[M1] (SEQ ID NO:26), PPE-1-[M2] (SEQ ID NO:27), PPE-1-[M3] (SEQ ID NO:28), PPE-1-[M4] (SEQ ID NO:29), PPE-1-[M5] (SEQ ID NO:30), PPE-1-[M6] (SEQ ID NO:31), PPE-1-[M7] (SEQ ID NO:32), PPE-1-[M8] (SEQ ID NO:33), PPE-1-[M9] (SEQ ID NO:34) and PPE-l-[x] (SEQ ID NO:24). The measured values were normalized according to the luciferase activity as measured using the PPE-l-[x] promoter in each cell which is defined as relative expression "1". Results are presented as average ± standard deviation of 2 experiments (in BAEC), 3 experiments (in B2B and NIH3T3) which were performed in triplicates. Statistically significant differences (p < 0.05) relative to PPE-1 -[x] are marked with an asterisk (*).

FIG. 8 is a schematic illustration of the transcription factors which are predicted to bind the wild type sequences which correspond to sequences M4, M5 and M8 which are comprised in SEQ ID NO: 601. The mutated sequences are shown in the top (SEQ ID NOs: 40, 41 and 44).

FIG. 9 is a schematic illustration depicting regulatory elements in element X (SEQ ID NO:35), which includes SEQ ID NO:6 and an additional "G" at the 3 ' end. The regulatory elements include CATTCCAATG (SEQ ID NO: 602) which confers upregulation, and the GCTTC (SEQ ID NO:603) which confers downregulation.

FIG. 10 is a schematic illustration depicting the sequence of promoter set forth in

SEQ ID NO: 6 with the regulatory sequences identified herein. Domains M4 and M5 cause upregulation of transcription and domain M8 causes downregulation of transcription.

FIG. 11 depicts exemplary sequences comprised in the isolated polynucleotide of some embodiments of the invention as compared to the wild type (WT) sequence of the promoter set forth in SEQ ID NO:6, which comprises domains Ml, M2, M3, M4, M5, M6, M7 and M8. Exemplary sequences include those set forth in SEQ ID NOs: 787- 796.

FIG. 12 is a histogram depicting firefly-Luciferase expression in BAEC cells trans fected to express nucleic acid constructs comprising the exemplary sequences depicted in Figure 11 and a Renilla-Luciferase construct as reference. Each of the depicted sequences was cloned into the pEL8-PPE-l-(lx)-Luc construct for detecting effect of the isolated polynucleotide regulatory sequence on expression of a heterologous gene (a reporter gene such as luciferase). The measured values were normalized according to the Renilla-luciferase activity, and compared to the PPE-l-(lx) promoter (SEQ ID NO: l) which resulted in relative expression value of "8.0". Each of the sequences shown in Figure 11 was inserted into the Nhel cloning site of the PPE-1 promoter as shown in Figure 2 A. For example, the pEL8-lx-SEQ6(WT) is the PPE-1 promoter with an additional SEQ ID NO:6 cloned into Nhel cloning site; the pEL8-lx- SEQ8 is the PPE-1 promoter with SEQ ID NO: 8 cloned into Nhel cloning site; clone #146 (M1-M7 in pEL8) is the PPE-1 promoter with SEQ ID NO:787 cloned into Nhel cloning site; and the like. Results are presented as average ± standard deviation of two experiments performed in triplicates. Note that while expression of the PPE-1 promoter with additional copy of SEQ ID NO: 8 decreased expression of the heterologous polynucleotide, expression of the PPE-1 promoter with additional copy of the M1-M7 sequence (SEQ ID NO:787), or with two copies of M1-M7 (SEQ ID NO:790) resulted in significant increases in the expression of the heterologous polynucleotide. In addition, note the significant increase in promoter activity obtained with the PPE-1 promoter having additional copy of the M1-M9 sequence with a mutation in the M5 sequence as shown in SEQ ID NO: 791; the significant increase in promoter activity obtained with the PPE-1 promoter having additional copy of the M1-M9 sequence with a mutation in M8 (M8* v2, SEQ ID NO:795), or with the PPE-1 promoter having two copies of the M1-M9 sequence with a mutation in M8 ([M8*] X 2; SEQ ID NO:796).

FIG. 13 depicts exemplary sequences comprised in the isolated polynucleotide of some embodiments of the invention as depicted in SEQ ID NOs: 797-802). DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION

The present invention, in some embodiments thereof, relates to isolated polynucleotides and nucleic acid constructs for expression in endothelial and non- endothelial cells and, more particularly, but not exclusively, to methods of using same for increasing expression of a heterologous polynucleotide (e.g., gene-of-interest or an RNA silencing agent) in specific cells.

Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways.

The present inventors have uncovered novel enhancer and suppressor sequences which can be used to control expression of a nucleic acid sequence of interest in specific cell types.

Thus, as described in Example 1 (Figures 3A-B, 4 and 5) and 2 (Figure 6) of the Examples section which follows, the present inventors have uncovered that elements X or X' regulate the pre-proendothelin (PPE-1) promoter activity in host cells. In addition, serial site directed mutagenesis analysis revealed that the wild type sequence of element X (gtacttcatacttttcattccaatggggtgactttgcttctgga; SEQ ID NO:6) of the PPE-1 promoter includes several enhancers and suppressor sequences which can be used to regulate transcription of any coding sequence of interest. Thus, as shown in Figures 7A-C and described in Example 2 of the Examples section which follows, while a PPE-1 promoter which includes element X with mutations in the M4 and M5 sequences decreased expression of the reporter gene operably linked thereto in endothelial cells (e.g., BAEC) or in cells expressing endothelin (e.g., B2B) but not in cells which do not express endothelin (e.g., NIH3T3), a PPE-1 promoter which includes element X with mutations in the M6 and M7 sequences induced a general suppression of expression of a reporter gene in all tested cell types. In addition, a PPE-1 promoter which includes element X with mutations in M3 and mainly in M8 increased expression of the reporter gene in all cell types, suggesting that the wild type sequences of these sites are suppressors. Thus, these results suggest the use of isolated polynucleotides and nucleic acid constructs which comprise various enhancer and suppressor elements derived from SEQ ID NO: 6 for controlling expression of a nucleic acid sequence-of-interest in cells.

According to an aspect of some embodiments of the invention, there is provided an isolated polynucleotide comprising at least 6 nucleotides of element X of a pre- proendothelin (PPE-1) promoter, the element X having a wild type sequence as set forth by SEQ ID NO:6, wherein the at least 6 nucleotides comprise at least 2 consecutive sequences derived from SEQ ID NO:6, each of the at least 2 consecutive sequences comprises at least 3 nucleotides, at least one of the at least 3 nucleotide being positioned next to at least one nucleotide position in SEQ ID NO:6, the at least one nucleotide position in SEQ ID NO: 6 is selected from the group consisting of: (i) at least one nucleotide of wild type M4 sequence set forth by SEQ ID NO:46 (CATTC);

(iii) at least one nucleotide of wild type M8 sequence set forth by SEQ ID

NO:52 (GCTTC);

(vi) at least one nucleotide of wild type Ml sequence set forth by SEQ ID NO:53 (GTACT); and

wherein the at least one nucleotide position is mutated as compared to SEQ ID

NO:6 by at least one nucleotide substitution, at least one nucleotide deletion and/or at least one nucleotide insertion or duplication, with the proviso that a mutation of the at least one nucleotide position does not result in nucleotides GGTA at position 21-24 of SEQ ID NO:6 and/or in nucleotides CATG at position 29-32 of SEQ ID NO:6, such that when the isolated polynucleotide is integrated into the PPE-1 promoter and placed upstream of a reporter gene (e.g., luciferase coding sequence) the expression level of the reporter gene is upregulated or downregulated as compared to when SEQ ID NO: 6 is similarly integrated into the PPE-1 promoter and placed upstream of the reporter gene coding sequence.

As used herein the term "pre-proendothelin (PPE-1) promoter" refers to the promoter of the gene encoding endothelin-1 which is found in a variety of mammals such as Homo sapiens [EDN1, GenBank Accession No. NC_000006.11 (12290529..12297427); SEQ ID NO:604], Mus musculus [Ednl; GenBank Accession No. NC 000079.5 (42396845..42403359); SEQ ID NO:605], Rattus norvegicus [Ednl; GenBank Accession No. NC_005116.2 (28303886..28309775, complement); SEQ ID NO:606], sheep [e.g., Ovis aries PPET-1 GenelD: 443498; SEQ ID NO:607; GenBank Aaccession No. NM 001009810.1]; Wild boar [Sus scrofa; GenBank Accession No. NC 010449.1 (7483579..7489916); SEQ ID NO:608]; cows [e.g., Bos Taurus, Ednl; GenBank Accession No. AC 000180.1 (44010441..44017424, complement); SEQ ID NO:609], dogs [e.g., Canis lupus familiaris, ET-1; GenBank Accession No. NC_006617.2 (14818339..14824830); SEQ ID NO:610]; cats [e.g., Felis catus, EDNl, GenelD: 494214 NM 001009386.1; SEQ ID NO:611]; horses [Equus caballus, EDNl, GenBank Accession No. NC 009163.2 (12010034..12015438); SEQ ID NO:612]; rabbit [e.g., Oryctolagus cuniculus, ET-1, GenBank Accession No. NC 013680.1 (6011333..6037477); SEQ ID NO:613], as well as non-mammals such as frogs [e.g., Xenopus laevis [ednl, GenelD: 100036806, SEQ ID NO:614; GenBank Accession NO. NM 001097098].

The term "polynucleotide" as used herein refers to a single or double stranded nucleic acid sequence which is isolated and provided in the form of an RNA sequence, a complementary polynucleotide sequence (cDNA), a genomic polynucleotide sequence, a synthetic DNA (e.g., chemically synthesized), and/or a composite polynucleotide sequences (e.g., a combination of the above).

The term "isolated" as used herein refers to at least partially separated from the natural environment e.g., from a mammal, e.g., a human being.

As used herein the phrase "complementary polynucleotide sequence" refers to a sequence, which results from reverse transcription of messenger RNA using a reverse transcriptase or any other RNA dependent DNA polymerase. Such a sequence can be subsequently amplified in vivo or in vitro using a DNA dependent DNA polymerase.

As used herein the phrase "genomic polynucleotide sequence" refers to a sequence derived (isolated) from a chromosome and thus it represents a contiguous portion of a chromosome.

As used herein the phrase "composite polynucleotide sequence" refers to a sequence, which is at least partially complementary and at least partially genomic. A composite sequence can include some exonal sequences required to encode the polypeptide of the present invention, as well as some intronic sequences interposing therebetween. The intronic sequences can be of any source, including of other genes, and typically will include conserved splicing signal sequences. Such intronic sequences may further include cis acting expression regulatory elements. The isolated polynucleotide according to some embodiments of the invention comprising at least 6 nucleotides (e.g., 6), at least 7 nucleotides (e.g., 7), at least 8 nucleotides (e.g., 8), at least 9 nucleotides (e.g., 9), at least 10 nucleotides (e.g., 10), at least 11 nucleotides (e.g., 11), at least 12 nucleotides (e.g., 12), at least 13 nucleotides (e.g., 13), at least 14 nucleotides (e.g., 14), at least 15 nucleotides (e.g., 15), at least 16 nucleotides (e.g., 16), at least 17 nucleotides (e.g., 17), at least 18 nucleotides (e.g., 18), at least 19 nucleotides (e.g., 19), at least 20 nucleotides (e.g., 20), at least 21 nucleotides (e.g., 21), at least 22 nucleotides (e.g., 22), at least 23 nucleotides (e.g., 23), at least 24 nucleotides (e.g., 24), at least 25 nucleotides (e.g., 25), at least 26 nucleotides (e.g., 26), at least 27 nucleotides (e.g., 27), at least 28 nucleotides (e.g., 28), at least 29 nucleotides (e.g., 29), at least 30 nucleotides (e.g., 30), at least 31 nucleotides (e.g., 31), at least 32 nucleotides (e.g., 32), at least 33 nucleotides (e.g., 33), at least 34 nucleotides (e.g., 34), at least 35 nucleotides (e.g., 35), at least 36 nucleotides (e.g., 36), at least 37 nucleotides (e.g., 37), at least 38 nucleotides (e.g., 38), at least 39 nucleotides (e.g., 39), at least 40 nucleotides (e.g., 40), at least 41 nucleotides (e.g., 41), at least 42 nucleotides (e.g., 42), at least 43 nucleotides (e.g., 43), at least 44 nucleotides (e.g., 44) of element X of a pre- proendothelin (PPE-1) promoter having a wild type sequence as set forth by SEQ ID NO:6.

It should be noted that the isolated polynucleotide can be of any length and can include other sequences, in addition to the nucleic acid sequence of element X.

According to some embodiments of the invention, the isolated polynucleotide comprises at least about 50 nucleotides, at least about 100 nucleotides, at least about 150 nucleotides, at least about 200 nucleotides, at least about 250 nucleotides, at least about 300 nucleotides, at least about 350 nucleotides, at least about 400 nucleotides, at least about 450 nucleotides, at least about 500 nucleotides, at least about 550 nucleotides, at least about 600 nucleotides, at least about 650 nucleotides, at least about 700 nucleotides, at least about 750 nucleotides, at least about 800 nucleotides, at least about 850 nucleotides, at least about 900 nucleotides, at least about 1000 nucleotides, at least about 1500 nucleotides, at least about 2000 nucleotides, at least about 2500 nucleotides, at least about 3000 nucleotides, at least about 3500 nucleotides, at least about 4000 nucleotides, at least about 4500 nucleotides. According to some embodiments of the invention, the isolated polynucleotide consists of no more than about 60 kilo base (kb), e.g., no more than about 55 kb, no more than about 50 kb, no more than about 45 kb, no more than about 40 kb, no more than about 35 kb, no more than about 30 kb, no more than about 25 kb, no more than about 20 kb, no more than about 15 kb, no more than about 10 kb, no more than about 5 kb (5000 nucleotides).

According to some embodiments of the invention, the isolated polynucleotide is not naturally occurring in a genome or a whole chromosome sequence of an organism.

As used herein the phrase "naturally occurring" refers to as found in nature, without any man-made modifications.

As described above, the at least 6 nucleotides of element X comprise at least 2 consecutive sequences derived from SEQ ID NO:6.

As used herein the phrase "consecutive sequence derived from SEQ ID NO:6" refers to a nucleic acid sequence (a polynucleotide) in which the nucleotides appear in the same order as in the nucleic acid sequence of SEQ ID NO: 6 from which they are derived. It should be noted that the order of nucleotides is determined by the chemical bond (phosphodiester bond) formed between a 3'-OH of a preceding nucleotide and the 5'-phosphate of the following nucleotide.

According to some embodiments of the invention, each of the at least 2 consecutive sequences comprises at least 3 nucleotides, e.g., 3 nucleotides, 4 nucleotides, 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, 30 nucleotide, 31 nucleotides, 32 nucleotides, 33 nucleotides, 34 nucleotides, 35 nucleotides, 36 nucleotides, 37 nucleotides, 38 nucleotides, 39 nucleotides, 40 nucleotides, 41 nucleotides of SEQ ID NO:6.

As described, the isolated polynucleotide comprises at least 2 consecutive sequences derived from SEQ ID NO:6. According to some embodiments of the invention, the isolated polynucleotide comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 consecutive sequences derived from SEQ ID NO:6. As used herein the phrase "wild type" with respect to a nucleotide sequence refers to the nucleic acid sequence as appears in SEQ ID NO:6. Examples include, but are not limited to wild type M4 sequence (SEQ ID NO:46), wild type M5 sequence (SEQ ID NO:47), wild type M8 (SEQ ID NO:52), wild type M6 sequence (SEQ ID NO:49), wild type M7 sequence (SEQ ID NO:50), wild type Ml (SEQ ID NO:53) and wild type M3 sequence (SEQ ID NO:54).

According to some embodiments of the invention, the nucleotide substitution can be of any of the 4 nucleotides A (adenine), G (guanine), C (cytosine) and T (thymine) present in a DNA sequence or A (adenine), G (guanine), C (cytosine) and U (urcil) present in an RNA sequence, and can include all possible substitutions, e.g., A to G, A to C, A to T (or U); C to G, C to A, C to T (or U); G to C, G to A, G to T (or U); T (or U) to A, T (or U) to G, or T (or U) to C.

According to some embodiments of the invention, any of the nucleotide positions in SEQ ID NO: 6 can be deleted. According to some embodiments of the invention, the deletion includes more than one nucleotide, e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37 or 38 nucleotides of SEQ ID NO:6 can be deleted.

According to some embodiments of the invention, the mutation is an insertion of at least one nucleotide in a nucleotide position with respect to SEQ ID NO:6. According to some embodiments of the invention, the insertion includes at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides, e.g., at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55, at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, at least about 90, at least about 95, at least about 100, at least about 200, at least about 300, or more nucleotides.

It should be noted that the sequence which is inserted by the mutation can be derived from any source (e.g., species, tissue or cell type), and is not limited to the source of the sequence of element X.

According to some embodiments of the invention, the mutation is a duplication. According to some embodiments of the invention, the duplication is of at least one, two, three, four, five, six, seven, eight, nine, ten, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more copies of the nucleotide(s) sequence(s) of SEQ ID NO:6 (e.g., wild type or mutated).

According to some embodiments of the invention, the isolated polynucleotide comprises several copies of certain sequence elements of SEQ ID NO:6, such as at least one, two, three, four, five, six, seven, eight, nine, ten, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more copies of the wild type sequences of Ml (SEQ ID NO:53), M2 (SEQ ID NO:803 (TCATA), M3 (SEQ ID NO:54), M4 (SEQ ID NO:46), M5 (SEQ ID NO:47), M6 (SEQ ID NO: 49), M7 (SEQ ID NO:50), M8 (SEQ ID NO:52) and/or M9 (SEQ ID NO: 766), wherein the isolated polynucleotide is not the polynucleotide set forth by SEQ ID NO:6.

According to some embodiments of the invention, the isolated polynucleotide comprises at least one, two, three, four, five, six, seven, eight, nine, ten, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more copies of the wild type sequences of Ml (SEQ ID NO:53), M2 (SEQ ID NO:803 (TCATA), M3 (SEQ ID NO:54), M4 (SEQ ID NO:46), M5 (SEQ ID NO:47), M6 (SEQ ID NO: 49), M7 (SEQ ID NO:50), and/or M9 (SEQ ID NO: 766) but not the wild type sequence of M8 (SEQ ID NO:52).

According to some embodiments of the invention, the isolated polynucleotide comprises at least one, two, three, four, five, six, seven, eight, nine, ten, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more copies of the wild type sequences of Ml (SEQ ID NO:53), M2 (SEQ ID NO:803 (TCATA), M3 (SEQ ID NO:54), M4 (SEQ ID NO:46), M5 (SEQ ID NO:47), M6 (SEQ ID NO: 49), M7 (SEQ ID NO:50), and/or M9 (SEQ ID NO: 766), wherein none of these sequences is connected at the 3'-end thereof to the wild type sequence of M8 (SEQ ID NO:52).

According to some embodiments of the invention, the isolated polynucleotide comprises at least one, two, three, four, five, six, seven, eight, nine, ten, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more copies of the wild type sequences of Ml through M7 (i.e., Ml, M2, M3, M4, M5, M6, M7) and being devoid of wild type sequence of M8 (SEQ ID NO: 52) at the 3'-end of M7 sequence (i.e., the most 3'-end nucleotide of M7 sequence is not connected by a phosphodiester bond to the most 5'-end nucleotide of the M8 wild type sequence). Non- limiting examples include the polynucleotide set forth by SEQ ID NO: 804 (one copy of wild type sequence of Ml- M7), SEQ ID NO:805 (two consecutive copies of wild type sequence of M1-M7), SEQ ID NO: 806 (three consecutive copies of wild type sequence of M1-M7), SEQ ID NO: 807 (four consecutive copies of wild type sequence of M1-M7), SEQ ID NO: 808 (five consecutive copies of wild type sequence of M1-M7), SEQ ID NO: 809 (six consecutive copies of wild type sequence of M1-M7), and SEQ ID NO:810 (seven consecutive copies of wild type sequence of M 1 -M7).

According to some embodiments of the invention, the isolated polynucleotide comprises at least one, two, three, four, five, six, seven, eight, nine, ten, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more copies of the wild type sequences of M4 through M7 (i.e., M4, M5, M6 and M7) and being devoid of wild type sequence of M8 (SEQ ID NO: 52) at the 3'-end of M7 sequence (i.e., the most 3'-end nucleotide of M7 sequence is not connected by a phosphodiester bond to the most 5 '-end nucleotide of the M8 wild type sequence). Non-limiting examples include the polynucleotide set forth by SEQ ID NO:811 (one copy of wild type sequence of M4-M7), SEQ ID NO:812 (two consecutive copies of wild type sequence of M4-M7), SEQ ID NO:813 (three consecutive copies of wild type sequence of M4-M7), SEQ ID NO:814 (four consecutive copies of wild type sequence of M4-M7), SEQ ID NO:815 (five consecutive copies of wild type sequence of M4-M7), SEQ ID NO:816 (six consecutive copies of wild type sequence of M4-M7), SEQ ID NO:817 (seven consecutive copies of wild type sequence of M4-M7), SEQ ID NO:818 (eight consecutive copies of wild type sequence of M4-M7), SEQ ID NO:819 (nine consecutive copies of wild type sequence of M4- M7).

According to some embodiments of the invention, the isolated polynucleotide comprises at least one, two, three, four, five, six, seven, eight, nine, ten, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more copies of the wild type sequences of M4 and M5 and being devoid of wild type sequence of M8 (SEQ ID NO: 52) at the 3'- end of M5 sequence (i.e., the most 3 '-end nucleotide of M5 sequence is not connected by a phosphodiester bond to the most 5'-end nucleotide of the M8 wild type sequence), wherein the isolated polynucleotide is not set forth by SEQ ID NO: 6 or SEQ ID NO: l . Non-limiting examples include the polynucleotide set forth by SEQ ID NO:48 (one copy of wild type sequence of M4-M5), SEQ ID NO:820 ( two consecutive copies of wild type sequence of M4-M5), SEQ ID NO: 821 (three consecutive copies of wild type sequence of M4-M57), SEQ ID NO:822 (four consecutive copies of wild type sequence of M4-M5), SEQ ID NO:823 (five consecutive copies of wild type sequence of M4-M5), SEQ ID NO: 824 (six consecutive copies of wild type sequence of M4-M5), SEQ ID NO:825 (seven consecutive copies of wild type sequence of M4-M5), SEQ ID NO:826 (eight consecutive copies of wild type sequence of M4-M5), SEQ ID NO: 827 (nine consecutive copies of wild type sequence of M4-M5) and SEQ ID NO: 828 (ten consecutive copies of wild type sequence of M4-M5).

According to some embodiments of the invention, the isolated polynucleotide comprises at least one, two, three, four, five, six, seven, eight, nine, ten, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more copies of the wild type sequences of M1-M4 and M6-M9 and being devoid of wild type sequence of M5 (SEQ ID NO: 47) or having a mutated sequence of M5. Non-limiting examples include SEQ ID NO: 794, SEQ ID NO: 829 (2 copies of SEQ 794), and SEQ ID NO:830 (3 copies of SEQ ID NO:794).

According to some embodiments of the invention, the isolated polynucleotide comprises at least one, two, three, four, five, six, seven, eight, nine, ten, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more copies of the wild type sequences of M1-M7 and M9 and being devoid of wild type sequence of M8 (SEQ ID NO: 52) or having a mutated sequence of M8. Non- limiting examples include SEQ ID NO: 795, SEQ ID NO: 831 (2 copies of SEQ 795), SEQ ID NO: 832 (3 copies of SEQ ID NO:795), SEQ ID NO:796, SEQ ID NO: 833 (2 copies of SEQ ID NO:796), and SEQ ID NO:834 (3 copies of SEQ ID NO:796).

According to some embodiments of the invention, the isolated polynucleotide comprises several copies of certain sequence elements of SEQ ID NO:6, such as at least one, two, three, four, five, six, seven, eight, nine, ten, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more copies of the wild type sequences of M4 (SEQ ID NO:46), M5 (SEQ ID NO:47), M6 (SEQ ID NO: 49), M7 (SEQ ID NO:50), M8 (SEQ ID NO:52) and/or M9 (SEQ ID NO: 766), A non-limiting example includes SEQ ID NO:788.

According to some embodiments of the invention, the isolated polynucleotide comprises several copies of certain sequence elements of SEQ ID NO:6, such as at least one, two, three, four, five, six, seven, eight, nine, ten, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more copies of the wild type sequences of M4 (SEQ ID NO:46), M5 (SEQ ID NO:47), M6 (SEQ ID NO: 49), M7 (SEQ ID NO:50) and/or M9 (SEQ ID NO: 766), and being devoid of wild type sequence of M8 (SEQ ID NO: 52) or having a mutated sequence of M8. A non-limiting example includes SEQ ID NO:789.

According to some embodiments of the invention, the isolated polynucleotide comprises several copies of certain sequence elements of SEQ ID NO:6, such as at least one, two, three, four, five, six, seven, eight, nine, ten, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more copies of the wild type sequences of Ml (SEQ ID NO:53), M2 (SEQ ID NO:803 (TCATA), M3 (SEQ ID NO:54), M4 (SEQ ID NO:46), M6 (SEQ ID NO: 49), M7 (SEQ ID NO:50), M8 (SEQ ID NO:52) and/or M9 (SEQ ID NO: 766), and being devoid of wild type sequence of M5 (SEQ ID NO: 52) or having a mutated sequence of M5. A non- limiting example includes SEQ ID NO: 794.

According to some embodiments of the invention, the isolated polynucleotide comprises several copies of certain sequence elements of SEQ ID NO:6, such as at least one, two, three, four, five, six, seven, eight, nine, ten, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more copies of the wild type sequences of Ml (SEQ ID NO:53), M2 (SEQ ID NO:803 (TCATA), M3 (SEQ ID NO:54), M4 (SEQ ID NO:46), M6 (SEQ ID NO: 49), M7 (SEQ ID NO:50) and being devoid of wild type sequence of M5 (SEQ ID NO: 52) or having a mutated sequence of M5. A non-limiting example includes SEQ ID NO:802.

According to some embodiments of the invention, the isolated polynucleotide comprises several copies of certain sequence elements of SEQ ID NO:6, such as at least one, two, three, four, five, six, seven, eight, nine, ten, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more copies of the wild type sequences of M4 (SEQ ID NO:46) and a wild type sequence of M5. Non-limiting example includes SEQ ID NO:48 and 799.

According to some embodiments of the invention, the isolated polynucleotide comprises several copies of certain sequence elements of SEQ ID NO:6, such as at least one, two, three, four, five, six, seven, eight, nine, ten, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more copies of the wild type sequences of M4 (SEQ ID NO:46) and a mutated sequence of M5. Non-limiting examples include SEQ ID NOs: 801 and 802. According to some embodiments of the invention, the isolated polynucleotide of some embodiments of the invention (e.g., as described above) is positioned upstream, downstream or integrated into the wild type sequence of SEQ ID NO:6.

According to some embodiments of the invention, the isolated polynucleotide of some embodiments of the invention (e.g., as described above) is positioned upstream, downstream or integrated into the wild type sequence of SEQ ID NO: 1.

According to some embodiments of the invention, the mutation is a combination of any of the mutation types described above, i.e., substitution, insertion, duplication and deletion. For example, while one nucleotide position in SEQ ID NO: 6 can be subject to a substitution mutation, another nucleotide position in SEQ ID NO: 6 can be subject to a deletion or insertion. Additionally or alternatively, while one nucleotide position in SEQ ID NO: 6 can be subject to a deletion mutation, another nucleotide position in SEQ ID NO: 6 can be subject to a substitution, insertion or duplication. Additionally or alternatively, while one nucleotide position in SEQ ID NO: 6 can be subject to an insertion mutation, another nucleotide position in SEQ ID NO: 6 can be subject to a substitution or deletion. It should be noted that various other combinations are possible.

According to specific embodiments of the invention, the mutation in the isolated polynucleotide of the invention does not result in nucleotides GGTA at position 21-24 of SEQ ID NO:6 and/or in nucleotides CATG at position 29-32 of SEQ ID NO:6.

As mentioned, the effect of the mutation in the nucleotide position of SEQ ID

NO:6 is determined using a functional assay in which the regulatory effect (e.g., upregulation or downregulation) of the isolated polynucleotide of some embodiments when integrated into PPE-1 promoter on a reporter gene is compared to the effect of element X (SEQ ID NO:6) when integrated into PPE-1 promoter (i.e., SEQ ID NO:24) on the same reporter gene under the same assay conditions.

Various reporter gene coding sequences can be used to qualify the effect of the mutation in the isolated polynucleotide as compared to the native or wild type sequence of SEQ ID NO:6. Examples, include, but are not limited to, horseradish peroxidase (HRP) (GenBank Accession No. J05552.1; SEQ ID NO: 615), beta-galactosidase (GenBank Accession No. NC 007103; SEQ ID NO:616), alkaline phosphatase (AP) (GenBank Accession No. AY042185.1; SEQ ID NO:617), firefly luciferase (GenBank Accession No. AJ277960.1; SEQ ID NO:618), ReniUa luciferase (GenBank Accession No. AAX97748; SEQ ID NO:619), Chloramphenocol acetyltransferase (GenBank Accession No. M90091.1; SEQ ID NO: 620); beta-lactamase (GenBank Accession No. J01749.1; SEQ ID NO:621), Beta galactosidase (GenBank Accession No. EU626139, SEQ ID NO:622), blue fluorescent protein (GenBank Accession No. GQ221702; SEQ ID NO:623), yellow fluorescent protein (GenBank Accession No. AY485333; SEQ ID NO:624), Green fluorescent protein (GenBank Accession No. AF435427, SEQ ID NO:625), orange fluorescent protein (GenBank Accession No. AF435432, SEQ ID NO:626) and red fluorescent protein [GenBank Accession No. AY130757 (SEQ ID NO:627) or GenBank Accession No ACQ43936; SEQ ID NO:786)].

Methods of qualifying the expression level of the reporter coding sequence are known in the art and include various RNA detection methods such as Northern blot analysis, reverse transcription polymerase chain reaction (RT-PCR) analysis (including quantitative, semi-quantitative or real-time RT-PCR) and RNA-m situ hybridization; and/or various protein detection methods such as activity assays, Western blots using antibodies capable of specifically binding the polypeptide, Enzyme-Linked Immuno Sorbent Assay (ELISA), radio-immuno-assays (RIA), immunohistochemistry, immunocytochemistry, immunofluorescence and the like.

For example, the expression level of the luciferase coding sequence can be determined by monitoring light absorbance at specific wavelength (e.g., 550-570 nm). It should be noted that combinations of reporter genes can be used in order to calibrate expression of a reporter gene under the promoter-of-interest according to the expression level of another reporter gene under a control promoter. A non-limiting example of such a combination is the use of the Firefly luciferase [61 kDa protein isolated from beetles (Photinus pyralis), which uses luciferin in the presence of oxygen, ATP and magnesium to produce light] and the Renilla luciferase [a 36 kDa protein from sea pansy {Renilla reniformis) which requires coelenterazine and oxygen] using for example, the Promega Dual-Luciferase Reporter Assay System, Cat. No. E1960. In this case, while Firefly luciferase produces a greenish yellow light in the 550-570 nm range, the Renilla luciferase produces a blue light of 480 nm. These enzymes can be used in dual-reporter assays due to their differences in substrate requirements and light output. Examples of such analyses are provided in the Examples section which follows. As used herein the phrase "integrated into the PPE-1 promoter" refers to a nucleotide sequence (the isolated polynucleotide) which is covalently conjugated within the PPE-1 promoter sequence.

Integration of the isolated polynucleotide at any position with respect to a promoter sequence (e.g., the PPE-1 promoter) or a reporter gene coding sequence can be performed by means of recombinant DNA technology, e.g., by digestion with restriction enzymes followed by ligation; by site directed mutagenesis of the PPE-1 promoter, by PCR means, and/or by chemically synthesizing the PPE-1 promoter with the mutated element X.

(i) wild type M4 sequence set forth by SEQ ID NO :46 (CATTC),

(ii) wild type M5 sequence set forth by SEQ ID NO:47 (CAATG),

(iii) wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC),

(iv) wild type M6 sequence set forth by SEQ ID NO:49 (GGGTG),

(v) wild type M7 sequence set forth by SEQ ID NO :50 (ACTTT);

(vi) wild type Ml sequence set forth by SEQ ID NO:53 (GTACT), and

(vii) wild type M3 sequence set forth by SEQ ID NO :54 (CTTTT).

According to some embodiments of the invention, the isolated polynucleotide further comprises a promoter sequence, such as an endothelial cell specific promoter.

According to some embodiments of the invention, the isolated polynucleotide is integrated into (within), downstream of, or upstream of any known (or unknown) promoter sequence to thereby regulate (e.g., increase, decrease, modulate tissue- specificity, modulate inductive or constitutive expression) the transcriptional promoting activity of the promoter.

Non-limiting examples of endothelial cell specific promoters which can be comprised in the isolated polynucleotide of some embodiments of the invention include the preproendothelin-1 (PPE-1) promoter (e.g., SEQ ID NO: l), and modifications thereof, the TIE-1 promoter, the TIE-2 promoter, the Endoglin promoter, the von Willerband promoter, the KDR/flk-1 promoter, The FLT-1 promoter, the Egr-1 promoter, the ICAM-1 promoter, the VCAM-1 promoter, the PEC AM- 1 promoter and the aortic carboxypeptidase-like protein (ACLP) promoter.

Following are non limiting examples of isolated polynucleotide which can be used according to some embodiments of the invention.

According to some embodiments of the invention, the isolated polynucleotide is for increasing expression of a heterologous polynucleotide operably linked thereto in endothelial cells. Such a polynucleotide can include wild type sequences of M4 and/or M5 in the presence or absence of additional sequences from element X, and/or in the presence of other mutated sequences from element X.

According to some embodiments of the invention, the at least one nucleotide position which is mutated as compared to SEQ ID NO: 6 is at least one nucleotide of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC). It should be noted that such an isolated polynucleotide may further include a wild type M6 sequence (SEQ ID NO:49) and/or a wild type M7 sequence (SEQ ID NO:50)

Non-limiting examples of isolated polynucleotides which include at least one copy of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC) and a mutation in at least one nucleotide of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) are provided in SEQ ID NOs:55-62.

Non-limiting examples of isolated polynucleotides which include at least one copy of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG) and a mutation in at least one nucleotide of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) are provided in SEQ ID NOs: 63-66.

Non-limiting examples of isolated polynucleotides which include at least one copy of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), at least one copy of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG) and a mutation in at least one nucleotide of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) are provided in SEQ ID NOs: 67-70.

According to some embodiments of the invention, the isolated polynucleotide further comprising at least one copy of wild type Ml sequence set forth by SEQ ID NO:53 (GTACT).

Non-limiting examples of isolated polynucleotides which include at least one copy of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), at least one copy of the wild type Ml sequence set forth by SEQ ID NO:53 (GTACT), and a mutation in at least one nucleotide of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) are provided in SEQ ID NOs: 71-105.

Non-limiting examples of isolated polynucleotides which include at least one copy of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), at least one copy of the wild type Ml sequence set forth by SEQ ID NO:53 (GTACT) and a mutation in at least one nucleotide of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) are provided in SEQ ID NOs: 106-136.

Non-limiting examples of isolated polynucleotides which include at least one copy of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), at least one copy of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), at least one copy of the wild type Ml sequence set forth by SEQ ID NO:53 (GTACT) and a mutation in at least one nucleotide of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) are provided in SEQ ID NOs: 137-152.

According to some embodiments of the invention, the isolated polynucleotide reduces expression of a heterologous polynucleotide operably linked thereto in endothelial cells. Such a polynucleotide can include mutations in M4 and/or M5 in the presence or absence of additional sequences from element X, and/or in the presence of other mutated sequences from element X. According to some embodiments of the invention, the at least one nucleotide position which is mutated as compared to SEQ ID NO: 6 is at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC).

Non-limiting examples of isolated polynucleotides which includes a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC) are provided in SEQ ID NOs: 153-162.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG) are provided in SEQ ID NOs:163-171.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC) and a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG) are provided in SEQ ID NOs:172-180.

According to some embodiments of the invention, the isolated polynucleotide is for increasing expression of a heterologous polynucleotide operably linked thereto in cells other than endothelial cells. Such a polynucleotide can include mutations in M4 and/or M5 and wild type sequences of M6 and/or M7, in the presence or absence of additional sequences from element X, and/or in the presence of other mutated sequences from element X.

According to some embodiments of the invention, the isolated polynucleotide comprises a mutation in M4 (SEQ ID NO:46) and/or in M5 (SEQ ID NO:47) and at least one copy of the wild type M6 set forth by SEQ ID NO:49 (GGGTG) and/or at least one copy of wild type M7 set forth by SEQ ID NO:50.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC) and at least one copy of the wild type M6 set forth by SEQ ID NO:49 (GGGTG) are provided in SEQ ID NOs: 181-182.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG) and at least one copy of the wild type M6 set forth by SEQ ID NO:49 (GGGTG) are provided in SEQ ID NOs: 183-189.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG) and at least one copy of the wild type M6 set forth by SEQ ID NO:49 (GGGTG) are provided in SEQ ID NOs: 190-191.

According to some embodiments of the invention, the isolated polynucleotide further comprises at least one copy of the wild type M7 sequence set forth by SEQ ID NO:50 (ACTTT).

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46

(CATTC) and at least one copy of the wild type M7 sequence set forth by SEQ ID

NO:50 (ACTTT) are provided in SEQ ID NOs: 192-195.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47

(CAATG) and at least one copy of the wild type M7 sequence set forth by SEQ ID

NO:50 (ACTTT) are provided in SEQ ID NOs: 196-198.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG) and at least one copy of the wild type M7 sequence set forth by SEQ ID NO:50 (ACTTT) are provided in SEQ ID NOs: 199-202.

According to some embodiments of the invention, the isolated polynucleotide further comprises at least one copy of the wild type M6 set forth by SEQ ID NO:49 (GGGTG) and at least one copy of the wild type M7 sequence set forth by SEQ ID

NO:50 (ACTTT). Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), at least one copy of the wild type M6 set forth by SEQ ID NO:49 (GGGTG) and at least one copy of the wild type M7 sequence set forth by SEQ ID NO:50 (ACTTT) are provided in SEQ ID NOs:203-205.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), at least one copy of the wild type M6 set forth by SEQ ID NO:49 (GGGTG) and at least one copy of the wild type M7 sequence set forth by SEQ ID NO:50 (ACTTT) are provided in SEQ ID NOs:206-207.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), at least one copy of the wild type M6 set forth by SEQ ID NO:49 (GGGTG) and at least one copy of the wild type M7 sequence set forth by SEQ ID NO:50 (ACTTT) are provided in SEQ ID NOs:208-209.

According to some embodiments of the invention, the isolated polynucleotide reduces expression in cells of a heterologous polynucleotide operably linked thereto. Such a polynucleotide can include mutations in M4, M5, M6 and/or M7, in the presence or absence of additional sequences from element X, and/or in the presence of other mutated sequences from element X.

According to some embodiments of the invention, the isolated polynucleotide comprises at least one mutation in wild type M4 (SEQ ID NO:46) and/or in wild type M5 (SEQ ID NO:47) and in wild type M6 set forth by SEQ ID NO:49 (GGGTG).

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC) and a mutation in at least one nucleotide position of the wild type M6 set forth by SEQ ID NO:49 (GGGTG) are provided in SEQ ID NOs:210-213.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG) and a mutation in at least one nucleotide position of the wild type M6 set forth by SEQ ID NO:49 (GGGTG) are provided in SEQ ID NOs:214-222. Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), and a mutation in at least one nucleotide position of the wild type M6 set forth by SEQ ID NO:49 (GGGTG) are provided in SEQ ID NOs:223- 231.

According to some embodiments of the invention, the isolated polynucleotide further comprises at least one mutation in wild type M7 set forth by SEQ ID NO:50 (ACTTT).

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC) and a mutation in at least one nucleotide position of the wild type M7 set forth by SEQ ID NO:50 (ACTTT) are provided in SEQ ID NOs:232-236.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG) and a mutation in at least one nucleotide position of the wild type M7 set forth by SEQ ID NO:50 (ACTTT) are provided in SEQ ID NOs:237-240.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), and a mutation in at least one nucleotide position of the wild type M7 set forth by SEQ ID NO:50 (ACTTT) are provided in SEQ ID NOs:241- 248.

According to some embodiments of the invention, the isolated polynucleotide further comprises at least one mutation in wild type M6 set forth by SEQ ID NO:49 (GGGTG) and at least one mutation in wild type M7 set forth by SEQ ID NO:50 (ACTTT).

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), a mutation in at least one nucleotide position of the wild type M6 set forth by SEQ ID NO:49 (GGGTG) and a mutation in at least one nucleotide position of the wild type M7 set forth by SEQ ID NO:50 (ACTTT) are provided in SEQ ID NOs:249-258. Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), a mutation in at least one nucleotide position of the wild type M6 set forth by SEQ ID NO:49 (GGGTG) and a mutation in at least one nucleotide position of the wild type M7 set forth by SEQ ID NO:50 (ACTTT) are provided in SEQ ID NOs:259-264.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), a mutation in at least one nucleotide position of the wild type M6 set forth by SEQ ID NO:49 (GGGTG) and a mutation in at least one nucleotide position of the wild type M7 set forth by SEQ ID NO:50 (ACTTT) are provided in SEQ ID NOs:265-270.

As described above and shown in Figures 7A-C, mutations in the M8 and/or M3 sequences resulted in increased expression of the reporter gene in all tested cell types (endothelial cells, bronchial epithelial cells and mouse embryonic fibroblast cells), thus suggesting a suppressor activity of the wild type M8 (GCTTC) or the wild type M3 (CTTTT) sequence.

According to some embodiments of the invention, the isolated polynucleotide comprises at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) with additional wild type or mutated sequences derived from element X (SEQ ID NO:6).

Non-limiting examples of isolated polynucleotides which includes a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC) and at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) are provided in SEQ ID NOs:271-279.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG) and at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) are provided in SEQ ID NOs:280-287.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG) and at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) are provided in SEQ ID NOs:288-291.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), at least one copy of the wild type M6 set forth by SEQ ID NO:49 (GGGTG) and at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) are provided in SEQ ID NOs:294-298.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), at least one copy of the wild type M6 set forth by SEQ ID NO:49 (GGGTG) and at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) are provided in SEQ ID NOs:299-301.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), at least one copy of the wild type M6 set forth by SEQ ID NO:49 (GGGTG) and at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) are provided in SEQ ID NOs:302-303.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), at least one copy of the wild type M7 sequence set forth by SEQ ID NO:50 (ACTTT) and at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) are provided in SEQ ID NOs:304-308.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), at least one copy of the wild type M7 sequence set forth by SEQ ID NO:50 (ACTTT) and at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) are provided in SEQ ID NOs:309-311.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), at least one copy of the wild type M7 sequence set forth by SEQ ID NO:50 (ACTTT) and at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) are provided in SEQ ID NOs:312-315.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), at least one copy of the wild type M6 set forth by SEQ ID NO:49 (GGGTG), at least one copy of the wild type M7 sequence set forth by SEQ ID NO:50 (ACTTT) and at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) are provided in SEQ ID NO:316.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), at least one copy of the wild type M6 set forth by SEQ ID NO:49 (GGGTG), at least one copy of the wild type M7 sequence set forth by SEQ ID NO:50 (ACTTT) and at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) are provided in SEQ ID NO:317.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), at least one copy of the wild type M6 set forth by SEQ ID NO:49 (GGGTG), at least one copy of the wild type M7 sequence set forth by SEQ ID NO:50 (ACTTT) and at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) are provided in SEQ ID NO:318.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), a mutation in at least one nucleotide position of the wild type M6 set forth by SEQ ID NO:49 (GGGTG) and at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) are provided in SEQ ID NOs:319-327.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), a mutation in at least one nucleotide position of the wild type M6 set forth by SEQ ID NO:49 (GGGTG) and at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) are provided in SEQ ID NOs:328-333. Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), a mutation in at least one nucleotide position of the wild type M6 set forth by SEQ ID NO: 49 (GGGTG) and at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) are provided in SEQ ID NOs:334- 337.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), a mutation in at least one nucleotide position of the wild type M7 set forth by SEQ ID NO:50 (ACTTT) and at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) are provided in SEQ ID NOs:338-344.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), a mutation in at least one nucleotide position of the wild type M7 set forth by SEQ ID NO:50 (ACTTT) and at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) are provided in SEQ ID NOs:345-348.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), a mutation in at least one nucleotide position of the wild type M7 set forth by SEQ ID NO:50 (ACTTT) and at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) are provided in SEQ ID NOs:349-354.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), a mutation in at least one nucleotide position of the wild type M6 set forth by SEQ ID NO:49 (GGGTG), a mutation in at least one nucleotide position of the wild type M7 set forth by SEQ ID NO:50 (ACTTT) and at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) are provided in SEQ ID NOs:355-361.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), a mutation in at least one nucleotide position of the wild type M6 set forth by SEQ ID NO:49 (GGGTG), a mutation in at least one nucleotide position of the wild type M7 set forth by SEQ ID NO:50 (ACTTT) and at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) are provided in SEQ ID NOs:362-365.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), a mutation in at least one nucleotide position of the wild type M6 set forth by SEQ ID NO:49 (GGGTG), a mutation in at least one nucleotide position of the wild type M7 set forth by SEQ ID NO:50 (ACTTT) and at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) are provided in SEQ ID NOs:366-369.

According to some embodiments of the invention, the isolated polynucleotide comprises at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) with additional wild type or mutated sequences derived from element X (SEQ ID NO:6).

Non-limiting examples of isolated polynucleotides which includes a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NOs:378-384.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NOs:628-634.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NOs:370-377.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), at least one copy of the wild type M6 set forth by SEQ ID NO:49 (GGGTG) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NOs:385-390.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), at least one copy of the wild type M6 set forth by SEQ ID NO:49 (GGGTG) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NOs:391-396.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), at least one copy of the wild type M6 set forth by SEQ ID NO:49 (GGGTG) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NOs:397-401.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), at least one copy of the wild type M7 sequence set forth by SEQ ID NO:50 (ACTTT) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NOs:402-409.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), at least one copy of the wild type M7 sequence set forth by SEQ ID NO:50 (ACTTT) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NOs:410-417.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), at least one copy of the wild type M7 sequence set forth by SEQ ID NO:50 (ACTTT) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NOs:418-423.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), at least one copy of the wild type M6 set forth by SEQ ID NO:49 (GGGTG), at least one copy of the wild type M7 sequence set forth by SEQ ID NO:50 (ACTTT) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NOs:424-425.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), at least one copy of the wild type M6 set forth by SEQ ID NO:49 (GGGTG), at least one copy of the wild type M7 sequence set forth by SEQ ID NO:50 (ACTTT) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NOs:538-540.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), at least one copy of the wild type M6 set forth by SEQ ID NO:49 (GGGTG), at least one copy of the wild type M7 sequence set forth by SEQ ID NO:50 (ACTTT) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NO:426.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), a mutation in at least one nucleotide position of the wild type M6 set forth by SEQ ID NO:49 (GGGTG) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NOs:427-435.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), a mutation in at least one nucleotide position of the wild type M6 set forth by SEQ ID NO:49 (GGGTG) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NOs:436-444.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), a mutation in at least one nucleotide position of the wild type M6 set forth by SEQ ID NO:49 (GGGTG) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NOs:445- 451.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), a mutation in at least one nucleotide position of the wild type M7 set forth by SEQ ID NO:50 (ACTTT) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NOs:452-458.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), a mutation in at least one nucleotide position of the wild type M7 set forth by SEQ ID NO:50 (ACTTT) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NOs:459-465.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), a mutation in at least one nucleotide position of the wild type M7 set forth by SEQ ID NO:50 (ACTTT) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NO:466.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), a mutation in at least one nucleotide position of the wild type M6 set forth by SEQ ID NO:49 (GGGTG), a mutation in at least one nucleotide position of the wild type M7 set forth by SEQ ID NO:50 (ACTTT) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NOs:467-471.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), a mutation in at least one nucleotide position of the wild type M6 set forth by SEQ ID NO:49 (GGGTG), a mutation in at least one nucleotide position of the wild type M7 set forth by SEQ ID NO:50 (ACTTT) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NOs:472-477.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), a mutation in at least one nucleotide position of the wild type M6 set forth by SEQ ID NO:49 (GGGTG), a mutation in at least one nucleotide position of the wild type M7 set forth by SEQ ID NO:50 (ACTTT) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NOs:478-483.

According to some embodiments of the invention, the isolated polynucleotide further comprises at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) with additional wild type or mutated sequences derived from element X (SEQ ID NO:6).

Non-limiting examples of isolated polynucleotides which includes a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NOs:484-495.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NOs:496-507.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NOs:508-515.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), at least one copy of the wild type M6 set forth by SEQ ID NO:49 (GGGTG), at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NOs:516-519.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), at least one copy of the wild type M6 set forth by SEQ ID NO:49 (GGGTG), at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NOs:520-523.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), at least one copy of the wild type M6 set forth by SEQ ID NO:49 (GGGTG), at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NOs:524-525.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), at least one copy of the wild type M7 sequence set forth by SEQ ID NO:50 (ACTTT), at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NOs:526-529.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), at least one copy of the wild type M7 sequence set forth by SEQ ID NO:50 (ACTTT), at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NOs:530-533.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), at least one copy of the wild type M7 sequence set forth by SEQ ID NO:50 (ACTTT), at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NOs:534-535.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), at least one copy of the wild type M6 set forth by SEQ ID NO:49 (GGGTG), at least one copy of the wild type M7 sequence set forth by SEQ ID NO: 50 (ACTTT), at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT)are provided in SEQ ID NOs:536-537.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), at least one copy of the wild type M6 set forth by SEQ ID NO:49 (GGGTG), at least one copy of the wild type M7 sequence set forth by SEQ ID NO:50 (ACTTT) at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NOs:538-539.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), at least one copy of the wild type M6 set forth by SEQ ID NO:49 (GGGTG), at least one copy of the wild type M7 sequence set forth by SEQ ID NO:50 (ACTTT), at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NO:540.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), a mutation in at least one nucleotide position of the wild type M6 set forth by SEQ ID NO:49 (GGGTG), at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NOs:541-547.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), a mutation in at least one nucleotide position of the wild type M6 set forth by SEQ ID NO:49 (GGGTG), at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NOs:548-554.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), a mutation in at least one nucleotide position of the wild type M6 set forth by SEQ ID NO:49 (GGGTG), at least one copy of the wild type M8 sequence set forth by SEQ ID NO: 52 (GCTTC) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NOs:555- 559.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), a mutation in at least one nucleotide position of the wild type M7 set forth by SEQ ID NO:50 (ACTTT), at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NOs:560-566.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), a mutation in at least one nucleotide position of the wild type M7 set forth by SEQ ID NO:50 (ACTTT), at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NOs:567-573.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), a mutation in at least one nucleotide position of the wild type M7 set forth by SEQ ID NO:50 (ACTTT), at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NOs:574- 578. Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), a mutation in at least one nucleotide position of the wild type M6 set forth by SEQ ID NO:49 (GGGTG), a mutation in at least one nucleotide position of the wild type M7 set forth by SEQ ID NO:50 (ACTTT), at least one copy of the wild type M8 sequence set forth by SEQ ID NO: 52 (GCTTC) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NOs:579- 583.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), a mutation in at least one nucleotide position of the wild type M6 set forth by SEQ ID NO:49 (GGGTG), a mutation in at least one nucleotide position of the wild type M7 set forth by SEQ ID NO:50 (ACTTT), at least one copy of the wild type M8 sequence set forth by SEQ ID NO: 52 (GCTTC) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NOs:584- 588.

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC), a mutation in at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG), a mutation in at least one nucleotide position of the wild type M6 set forth by SEQ ID NO:49 (GGGTG), a mutation in at least one nucleotide position of the wild type M7 set forth by SEQ ID NO:50 (ACTTT), at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) are provided in SEQ ID NOs:589-592.

According to some embodiments of the invention, the isolated polynucleotide comprises at least one copy of wild type M3 sequence (SEQ ID NO:54) and at least one copy of wild type M8 sequence (SEQ ID NO:52), with at least one mutation in wild type M6 (SEQ ID NO:49) and/or in wild type M7 (SEQ ID NO:50).

Non-limiting examples of isolated polynucleotides which include at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) and at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT), with a mutation in at least one nucleotide of the wild type M6 sequence (SEQ ID NO:49), and/or a mutation in at least one nucleotide of the wild type M7 (SEQ ID NO:50) are provided in SEQ ID NOs:593-600.

The present inventors have envisaged that an isolated polynucleotide which includes the wild type M8 sequence (SEQ ID NO:52) and/or the wild type M3 (SEQ ID NO:54) sequence in addition to tissue specific enhancers (e.g., wild type M4 and/or wild type M5), and/or induced enhancers (e.g., developmentally related- or stress related- enhancers) is expected to exert a more specific regulatory effect by suppressing expression in non-target cells or under non-induced conditions.

According to some embodiments of the invention, the isolated polynucleotide comprises at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) and an endothelial specific enhancer sequence.

According to some embodiments of the invention, the isolated polynucleotide comprises at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) and at least one copy of wild type M4 sequence set forth by SEQ ID NO:46.

According to some embodiments of the invention, the isolated polynucleotide comprises at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) and at least one copy of wild type M5 sequence set forth by SEQ ID NO:47.

According to some embodiments of the invention, the isolated polynucleotide comprises at least one copy of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC), at least one copy of wild type M4 sequence set forth by SEQ ID NO:46 and at least one copy of wild type M5 sequence set forth by SEQ ID NO:47.

According to some embodiments of the invention, the isolated polynucleotide comprises at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) and an endothelial specific enhancer sequence.

According to some embodiments of the invention, the isolated polynucleotide comprises at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) and at least one copy of wild type M4 sequence set forth by SEQ ID NO:46.

According to some embodiments of the invention, the isolated polynucleotide comprises at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT) and at least one copy of wild type M5 sequence set forth by SEQ ID NO:47. According to some embodiments of the invention, the isolated polynucleotide comprises at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT), at least one copy of wild type M4 sequence set forth by SEQ ID NO:46 and at least one copy of wild type M5 sequence set forth by SEQ ID NO:47.

According to some embodiments of the invention, the isolated polynucleotide comprises at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT), at least one copy of wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) and an endothelial specific enhancer sequence.

According to some embodiments of the invention, the isolated polynucleotide comprises at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT), at least one copy of wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) and at least one copy of wild type M4 sequence set forth by SEQ ID NO:46.

According to some embodiments of the invention, the isolated polynucleotide comprises at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT), at least one copy of wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) and at least one copy of wild type M5 sequence set forth by SEQ ID NO:47.

According to some embodiments of the invention, the isolated polynucleotide comprises at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT), at least one copy of wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC), at least one copy of wild type M4 sequence set forth by SEQ ID NO:46 and at least one copy of wild type M5 sequence set forth by SEQ ID NO:47.

According to some embodiments of the invention, the isolated polynucleotide comprises at least one copy of the wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT), at least one copy of wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) and at least one enhancer element such as wild type M6 (SEQ ID NO:49) and/or wild type M7 sequence (SEQ ID NO: 50).

According to some embodiments of the invention, the isolated polynucleotide includes at least one copy of wild type M8 with additional flanking sequences such as at least one copy of a wild type M8 sequence (SEQ ID NO:52), at least one copy of wild type M7 (SEQ ID NO:50) and/or wild type M9 sequence (SEQ ID NO:766, CTGGA); and/or the isolated polynucleotide includes at least one copy of wild type M8 and at least one mutation in M7, with or without M9 (SEQ ID NO:635). Such polynucleotides can be used as a non-specific repressor.

According to some embodiments of the invention, the isolated polynucleotide is for increasing expression of a heterologous polynucleotide operably linked thereto in cells/tissues.

As shown in Figures 6A-C, mutations in the M6 and/or M7 sequences resulted in a reduced expression of a reporter gene in three different cells types BAEC, B2B and NIH3T3).

According to some embodiments of the invention, the isolated polynucleotide comprises at least one copy of wild type M6 sequence set forth by SEQ ID NO:49 (GGGTG) and/or at least one copy of wild type M7 sequence set forth by SEQ ID NO:50 (ACTTT).

According to some embodiments of the invention, the isolated polynucleotide includes at least one copy of wild type M6 (SEQ ID NO:49) and a mutation in at least one nucleotide of wild type M8 (SEQ ID NO:52).

Non-limiting examples of isolated polynucleotide which include at least one copy of wild type M6 (SEQ ID NO:49) and a mutation in at least one nucleotide of the wild type M8 (SEQ ID NO:52) are provided in SEQ ID NOs:636-639.

According to some embodiments of the invention, the isolated polynucleotide includes at least one copy of wild type M7 (SEQ ID NO: 50) and a mutation in at least one nucleotide of wild type M8 (SEQ ID NO:52).

Non-limiting examples of isolated polynucleotide which include at least one copy of wild type M7 (SEQ ID NO: 50) and a mutation in at least one nucleotide of the wild type M8 (SEQ ID NO:52) are provided in SEQ ID NOs:640-641.

According to some embodiments of the invention, the isolated polynucleotide includes at least one copy of wild type M6 (SEQ ID NO:49), at least one copy of wild type M7 (SEQ ID NO: 50) and a mutation in at least one nucleotide of wild type M8 (SEQ ID NO:52).

As shown in Figures 7A-C, mutations in Ml resulted in a decreased expression in endothelial cells and to a lesser extent in other cells, while a mutation in M8 resulted in increased expression in all cell types tested. According to some embodiments of the invention, the isolated polynucleotide includes at least one copy of wild type Ml (SEQ ID NO:53) and a mutation in at least one nucleotide of wild type M8 (SEQ ID NO:52).

Non-limiting examples of isolated polynucleotide which include at least one copy of wild type Ml (SEQ ID NO:53) and a mutation in at least one nucleotide of the wild type M8 (SEQ ID NO:52) are provided in SEQ ID NOs:642-685.

According to some embodiments of the invention, the isolated polynucleotide includes at least one copy of wild type Ml (SEQ ID NO:53), at least one copy of wild type M6 (SEQ ID NO:49) and/or at least one copy of wild type M7 (SEQ ID NO:50) and a mutation in at least one nucleotide of wild type M8 (SEQ ID NO:52).

Non-limiting examples of isolated polynucleotides which include a mutation in at least one nucleotide of wild type M8 (SEQ ID NO:52) and at least one copy of wild type Ml (SEQ ID NO:53), wild type M6 (SEQ ID NO:49) and/or wild type M7 (SEQ ID NO:50) are provided in SEQ ID NOs:686-699.

Additional examples of regulatory isolated polynucleotides which can be used according to some embodiments of the invention are provided in Example 5 (Table 2; SEQ ID NOs: 771-785) and in Example 6 and Figures 11, 12 and 13 (SEQ ID NOs:787- 802) in the Examples section which follows.

According to some embodiments of the invention, the isolated polynucleotide further comprises the wild type sequence of SEQ ID NO: 6 with any of the wild type or mutated sequences described hereinabove, in the Figures and in the Examples section which follows, in at least one, two, three, 4, 5, 6, 7, 8, 9, 10, or more copies.

According to an aspect of some embodiments of the invention, there is provided an isolated polynucleotide comprising a nucleic acid sequence which comprises a first polynucleotide comprising the pre-proendothelin (PPE-1) promoter set forth by SEQ ID NO: l and a second polynucleotide comprising at least one copy of a nucleic acid sequence selected from the group consisting of:

(i) wild type M4 sequence set forth by SEQ ID NO :46 (CATTC),

(ii) wild type M5 sequence set forth by SEQ ID NO:47 (CAATG),

(iii) wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC),

(iv) wild type M6 sequence set forth by SEQ ID NO:49 (GGGTG),

(v) wild type M7 sequence set forth by SEQ ID NO :50 (ACTTT); (vi) wild type Ml sequence set forth by SEQ ID NO:53 (GTACT), and

(vii) wild type M3 sequence set forth by SEQ ID NO :54 (CTTTT);

with the proviso that the second polynucleotide is not SEQ ID NO:6 (element X), and wherein the isolated polynucleotide is not SEQ ID NO: 17 (PPE-1-3X).

According to some embodiments of the invention, each of the wild type M4, M5,

M8, M6, M7 and/or Ml sequences is placed in a head to tail (5'—3') orientation with respect to the PPE-1 promoter set forth by SEQ ID NO: 1.

According to some embodiments of the invention, each of the wild type M4, M5, M8, M6, M7 and/or Ml sequences is placed in a tail to head (3'—5') orientation with respect to the PPE- 1 promoter set forth by SEQ ID NO : 1.

According to some embodiments of the invention, the wild type M4, M5, M8, M6, M7 and/or Ml sequences are placed in various orientations (head to tail or tail to head) and/or sequential order with respect the other wild type M4, M5, M8, M6, M7 and/or Ml sequences, and/or with respect to the orientation of SEQ ID NO: 1.

According to an aspect of some embodiments of the invention, there is provided a nucleic acid construct comprising a heterologous polynucleotide operably linked to the isolated polynucleotide of some embodiments of the invention.

As used herein the phrase "heterologous polynucleotide" refers to any nucleic acid sequence which may be not naturally expressed within the organism (e.g., a mammal, e.g., a human being) or which expression in cells of the organism is desired.

As used herein the phrase "expressible nucleic acid sequence" refers to any polynucleotide which can be expressed into an RNA and/or a polypeptide.

An expressible nucleic acid sequence is "operably linked" to a regulatory sequence (e.g., promoter) if the regulatory sequence is capable of exerting a regulatory effect on the expressible nucleic acid sequence (e.g., coding sequence) linked thereto.

According to some embodiments of the invention, the regulatory effect is in a constitutive or an inducible manner.

According to some embodiments of the invention, the regulatory effect is upregulation (i.e., increase) or downregulation (i.e., decrease) of the expression level of the expressible nucleic acid sequence (the heterologous nucleic acid sequence which is regulated by the isolated polynucleotide, e.g., promoter, enhancer).

According to some embodiments of the invention, the regulatory effect is the control of expression level (e.g., amount), when (e.g., in which developmental state or stage, in response to induction or suppression) and/or where (e.g., in which tissues or cell types) the expressible nucleic acid sequence is expressed.

According to some embodiments of the invention, the heterologous polynucleotide is an RNA silencing polynucleotide.

As used herein, the term "RNA silencing polynucleotide" refers to an RNA, or a DNA encoding same (e.g., such as a DNA vector encoding shRNA), which is capable of inhibiting or "silencing" the expression of a target gene. In certain embodiments, the RNA silencing agent is capable of preventing complete processing (e.g., the full translation and/or expression) of an mRNA molecule through a post-transcriptional silencing mechanism. RNA silencing polynucleotides include noncoding RNA molecules, for example RNA duplexes comprising paired strands, as well as precursor RNAs from which such small non-coding RNAs can be generated. Exemplary RNA silencing polynucleotides include dsRNAs such as siRNAs, miRNAs and shRNAs. In one embodiment, the RNA silencing polynucleotide is capable of inducing RNA interference. In another embodiment, the RNA silencing agent is capable of mediating translational repression.

It should be noted that a nucleic acid construct which comprises the isolated polynucleotide of some embodiments of the invention (which exhibits a regulatory effect) and a DNA polynucleotide encoding an RNA silencing agent can be used to direct a specific silencing of a gene in a cell. Once expressed within the cell, the RNA silencing polynucleotide can be further degraded into short RNA molecules such as double stranded or single stranded RNA molecules which interfere with gene expression.

RNA interference refers to the process of sequence-specific post-transcriptional gene silencing in animals mediated by short interfering RNAs (siRNAs).

The presence of long dsRNAs in cells stimulates the activity of a ribonuclease III enzyme referred to as dicer. Dicer is involved in the processing of the dsRNA into short pieces of dsRNA known as short interfering RNAs (siRNAs). Short interfering RNAs derived from dicer activity are typically about 21 to about 23 nucleotides in length and comprise about 19 base pair duplexes. The RNAi response also features an endonuclease complex, commonly referred to as an RNA-induced silencing complex (RISC), which mediates cleavage of single-stranded RNA having sequence complementary to the antisense strand of the siRNA duplex. Cleavage of the target RNA takes place in the middle of the region complementary to the antisense strand of the siRNA duplex.

Accordingly, the present invention contemplates use of dsRNA to downregulate protein expression from mRNA.

According to some embodiments, the dsRNA is greater than 30 bp. The use of long dsRNAs (i.e. dsRNA greater than 30 bp) has been very limited owing to the belief that these longer regions of double stranded RNA will result in the induction of the interferon and PKR response. However, the use of long dsRNAs can provide numerous advantages in that the cell can select the optimal silencing sequence alleviating the need to test numerous siRNAs; long dsRNAs will allow for silencing libraries to have less complexity than would be necessary for siRNAs; and, perhaps most importantly, long dsRNA could prevent viral escape mutations when used as therapeutics.

Various studies demonstrate that long dsRNAs can be used to silence gene expression without inducing the stress response or causing significant off-target effects - see for example [Strat et al, Nucleic Acids Research, 2006, Vol. 34, No. 13 3803-3810; Bhargava A et al. Brain Res. Protoc. 2004;13: 115-125; Diallo M., et al, Oligonucleotides. 2003;13:381-392; Paddison P.J., et al, Proc. Natl Acad. Sci. USA. 2002;99: 1443-1448; Tran N., et al, FEBS Lett. 2004;573: 127-134].

In particular, the present invention also contemplates introduction of long dsRNA (over 30 base transcripts) for gene silencing in cells where the interferon pathway is not activated (e.g. embryonic cells and oocytes) see for example Billy et al., PNAS 2001, Vol 98, pages 14428-14433. and Diallo et al, Oligonucleotides, October 1, 2003, 13(5): 381-392. doi: 10.1089/154545703322617069.

The present invention also contemplates introduction of long dsRNA specifically designed not to induce the interferon and PKR pathways for down-regulating gene expression. For example, Shinagwa and Ishii [Genes & Dev. 17 (11): 1340-1345, 2003] have developed a vector, named pDECAP, to express long double-strand RNA from an RNA polymerase II (Pol II) promoter. Because the transcripts from pDECAP lack both the 5 '-cap structure and the 3'-poly(A) tail that facilitate ds-RNA export to the cytoplasm, long ds-RNA from pDECAP does not induce the interferon response.

Another method of evading the interferon and PKR pathways in mammalian systems is by introduction of small inhibitory RNAs (siRNAs) either via transfection or endogenous expression.

The term "siRNA" refers to small inhibitory RNA duplexes (generally between 18-30 basepairs) that induce the RNA interference (RNAi) pathway. Typically, siRNAs are chemically synthesized as 21mers with a central 19 bp duplex region and symmetric 2-base 3 '-overhangs on the termini, although it has been recently described that chemically synthesized RNA duplexes of 25-30 base length can have as much as a 100- fold increase in potency compared with 21mers at the same location. The observed increased potency obtained using longer RNAs in triggering RNAi is theorized to result from providing Dicer with a substrate (27mer) instead of a product (21mer) and that this improves the rate or efficiency of entry of the siRNA duplex into RISC.

It has been found that position of the 3 '-overhang influences potency of an siRNA and asymmetric duplexes having a 3 '-overhang on the antisense strand are generally more potent than those with the 3'-overhang on the sense strand (Rose et al., 2005). This can be attributed to asymmetrical strand loading into RISC, as the opposite efficacy patterns are observed when targeting the antisense transcript.

The strands of a double-stranded interfering RNA (e.g., an siRNA) may be connected to form a hairpin or stem-loop structure (e.g., an shRNA). Thus, as mentioned the RNA silencing agent of the present invention may also be a short hairpin RNA (shRNA).

The term "shRNA", as used herein, refers to an RNA polynucleotide having a stem-loop structure, comprising a first and second region of complementary sequence, the degree of complementarity and orientation of the regions being sufficient such that base pairing occurs between the regions, the first and second regions being joined by a loop region, the loop resulting from a lack of base pairing between nucleotides (or nucleotide analogs) within the loop region. The number of nucleotides in the loop is a number between and including 3 to 23, or 5 to 15, or 7 to 13, or 4 to 9, or 9 to 11. Some of the nucleotides in the loop can be involved in base-pair interactions with other nucleotides in the loop. Examples of oligonucleotide sequences that can be used to form the loop include 5'-UUCAAGAGA-3' (Brummelkamp, T. R. et al. (2002) Science 296: 550) and 5^*-UUUGUGUAG-3^* (Castanotto, D. et al. (2002) RNA 8: 1454). It will be recognized by one of skill in the art that the resulting single chain oligonucleotide forms a stem-loop or hairpin structure comprising a double-stranded region capable of interacting with the RNAi machinery.

According to another embodiment the RNA silencing polynucleotide may be a miRNA. miRNAs are small RNAs made from genes encoding primary transcripts of various sizes. They have been identified in both animals and plants. The primary transcript (termed the "pri-miRNA") is processed through various nucleolytic steps to a shorter precursor miRNA, or "pre-miRNA." The pre-miRNA is present in a folded form so that the final (mature) miRNA is present in a duplex, the two strands being referred to as the miRNA (the strand that will eventually basepair with the target). The pre-miRNA is a substrate for a form of dicer that removes the miRNA duplex from the precursor, after which, similarly to siRNAs, the duplex can be taken into the RISC complex. It has been demonstrated that miRNAs can be transgenically expressed and be effective through expression of a precursor form, rather than the entire primary form (Parizotto et al. (2004) Genes & Development 18:2237-2242 and Guo et al. (2005) Plant Cell 17:1376-1386).

Unlike, siRNAs, miRNAs bind to transcript sequences with only partial complementarity (Zeng et al., 2002, Molec. Cell 9: 1327-1333) and repress translation without affecting steady-state RNA levels (Lee et al, 1993, Cell 75:843-854; Wightman et al, 1993, Cell 75:855-862). Both miRNAs and siRNAs are processed by Dicer and associate with components of the RNA-induced silencing complex (Hutvagner et al., 2001, Science 293:834-838; Grishok et al, 2001, Cell 106: 23-34; Ketting et al, 2001, Genes Dev. 15:2654-2659; Williams et al, 2002, Proc. Natl. Acad. Sci. USA 99:6889- 6894; Hammond et al, 2001, Science 293: 1146-1150; Mourlatos et al, 2002, Genes Dev. 16:720-728). A recent report (Hutvagner et al, 2002, Sciencexpress 297:2056- 2060) hypothesizes that gene regulation through the miRNA pathway versus the siRNA pathway is determined solely by the degree of complementarity to the target transcript. It is speculated that siRNAs with only partial identity to the mRNA target will function in translational repression, similar to an miRNA, rather than triggering RNA degradation. Selection of R A silencing agents suitable for use with the present invention can be effected as follows. First, the mRNA sequence is scanned downstream of the AUG start codon for AA dinucleotide sequences. Occurrence of each AA and the 3' adjacent 19 nucleotides is recorded as potential siRNA target sites. Preferably, siRNA target sites are selected from the open reading frame, as untranslated regions (UTRs) are richer in regulatory protein binding sites. UTR-binding proteins and/or translation initiation complexes may interfere with binding of the siRNA endonuclease complex [Tuschl ChemBiochem. 2:239-245]. It will be appreciated though, that siRNAs directed at untranslated regions may also be effective, as demonstrated for GAPDH wherein siRNA directed at the 5' UTR mediated about 90 % decrease in cellular GAPDH mRNA and completely abolished protein level (www.ambion.com/techlib/tn/91/912.html).

Second, potential target sites are compared to an appropriate genomic database (e.g., human, mouse, rat etc.) using any sequence alignment software, such as the BLAST software available from the NCBI server (World Wide Web (dot) ncbi (dot) nlm (dot) nih (dot) gov/BLAST/). Putative target sites which exhibit significant homology to other coding sequences are filtered out.

Qualifying target sequences are selected as template for siRNA synthesis. Preferred sequences are those including low G/C content as these have proven to be more effective in mediating gene silencing as compared to those with G/C content higher than 55 %. Several target sites are preferably selected along the length of the target gene for evaluation. For better evaluation of the selected siRNAs, a negative control is preferably used in conjunction. Negative control siRNA preferably include the same nucleotide composition as the siRNAs but lack significant homology to the genome. Thus, a scrambled nucleotide sequence of the siRNA is preferably used, provided it does not display any significant homology to any other gene.

mRNAs to be targeted using RNA silencing agents include, but are not limited to, those whose expression is correlated with an undesired phenotypic trait. Exemplary mRNAs that may be targeted are those that encode truncated proteins i.e. comprise deletions. Accordingly the RNA silencing agent of the present invention may be targeted to a bridging region on either side of the deletion. Introduction of such RNA silencing agents into a cell would cause a down-regulation of the mutated protein while leaving the non-mutated protein unaffected. According to some embodiments of the invention, the heterologous polynucleotide is positioned in a distance not exceeding about 3000 nucleotides from element X or from the PPE-1 promoter, e.g., from the at least 3 consecutive nucleotides of at least one the two consecutive sequences of SEQ ID NO:6.

According to some embodiments of the invention, the heterologous polynucleotide is positioned in a distance not exceeding about 2500 nucleotides from element X, e.g., not exceeding about 2000, not exceeding about 1500, not exceeding about 1000, not exceeding about 900, not exceeding about 800, not exceeding about 700, not exceeding about 600, not exceeding about 500, not exceeding about 400, not exceeding about 300, not exceeding about 250, not exceeding about 200, not exceeding about 150, not exceeding about 100, not exceeding about 90, not exceeding about 80, not exceeding about 70, not exceeding about 60, not exceeding about 50, not exceeding about 40, not exceeding about 30, not exceeding about 20, not exceeding about 10, not exceeding about 9, not exceeding about 8, not exceeding about 7, not exceeding about 6, not exceeding about 5, not exceeding about 4, not exceeding about 3, not exceeding about 2, not exceeding about 1, e.g., 0 nucleotides from element X or from the PPE-1 promoter.

It should be noted that the isolated polynucleotide can be placed upstream or downstream of the heterologous polynucleotide.

According to some embodiments of the invention, the orientation of isolated polynucleotide and the orientation of the heterologous polynucleotide within the nucleic acid construct of the invention are such that both sequences are positioned (placed) head to tail (5^*→3^*).

For example, the first nucleotide of the heterologous polynucleotide (i.e., the most 5'-nucleotide can be adjacent to the last nucleotide of mutated element X (the most 3 '-nucleotide).

For example, the last nucleotide of heterologous polynucleotide (i.e., the most 3'- nucleotide) can be adjacent to the first nucleotide of mutated element X (e.g., in this case both the expressible nucleic acid sequence and mutated element X sequence are in a "head to tail" orientation with respect to each other).

According to some embodiments of the invention, the orientation of isolated polynucleotide and the orientation of the heterologous polynucleotide within the nucleic acid construct of the invention are such that one sequence is placed head to tail (5'—3') and the other is placed tail to head (3'—5').

For example, the last nucleotide of the heterologous polynucleotide (i.e., the most 3 '-nucleotide) can be adjacent to the last nucleotide of mutated element X (e.g., in this case heterologous polynucleotide is in a "head to tail" orientation, and element X is in a "tail to head" orientation).

According to some embodiments of the invention, the orientation of isolated polynucleotide and the orientation of the heterologous polynucleotide within the nucleic acid construct of the invention are such that both sequences are positioned (placed) tail to tail.

According to some embodiments of the invention, the orientation of isolated polynucleotide and the orientation of the heterologous polynucleotide within the nucleic acid construct of the invention are such that both sequences are positioned (placed) head to head (5^*→3^*).

According to some embodiments of the invention, the nucleic acid construct is designed for expression of the heterologous polynucleotide e.g., the expressible nucleic acid sequence in endothelial cells.

Endothelial cells are the cell lining the interior surface of blood vessels, forming an interface between circulating blood in the lumen and the rest of the vessel wall.

According to some embodiments of the invention, the heterologous polynucleotide e.g., the expressible nucleic acid sequence is capable of inducing angiogenesis.

As described in the Background section, angiogenesis is a process of new blood vessel formation by sprouting from pre-existing neighboring vessels. Angiogenesis is affected by factors which increase endothelial cell proliferation and/or migration. The level of angiogenesis of the blood vessels can be tested ex vivo or in vivo.

The phrase "ex vivo" refers to being outside of or removed from a living organism.

The phrase "in vivo" refers to within a living organism, e.g., an animal or a human body.

According to some embodiments of the invention, the nucleic acid construct is capable of inducing angiogenesis (increasing the level of angiogenesis) following expression thereof in cells by at least about 2 %, at least about 3 %, at least about 4 %, at least about 5 %, at least about 10 %, at least about 15 %, at least about 20 %, at least about 30 %, at least about 40 %, at least about 50 %, at least about 60 %, at least about 70 %, at least about 80 %, about 100%, about 2 times, about 10 times, about 100 times, about 1000 times or more as compared to control cells [e.g., cells not transformed or infected with the nucleic acid construct of some embodiments of the invention; or cells transformed with a control nucleic acid construct (e.g., a nucleic acid construct which does not comprise an angiogenic-related expressible nucleic acid sequence)] under the same experimental conditions.

Following is a non- limiting list of expressible nucleic acid sequences (genes) which are capable of inducing angiogenesis and which can be comprised in the nucleic acid construct according to some embodiments of the invention (some of which are described in Burton ER and Libutti SK. "Targeting TNF-a for cancer therapy"; Journal of Biology, 2009, Minireview, 8:85, which is fully incorporated herein by reference): Factors affecting endothelial proliferation and migration such as Vascular endothelial growth factors (VEGF family, such as VEGFA, GenBank Accession No. NM 001025366.2; SEQ ID NO:700), fibroblast growth factors (FGF family, such as FGF2 GenBank Accession No. NM 002006; SEQ ID NO:701), platelet-derived growth factor (PDGFB GenBank Accession No. NM 002608; SEQ ID NO:702), epidermal growth factor (EGF), angiopoietins (ANGPT1 GenBank Accession No. NM 001146.3; SEQ ID NO:703 and ANGPT2 GenBank Accession No. NM 001147.2; SEQ ID NO: 704), angiopoietin-related factors such as ANGPTL3, FARP and PGAR, TIE receptors (TIE1, GenBank Accession No. NM 005424.2; SEQ ID NO:705, and TIE2/TEK GenBank Accession No. NM 000459.3; SEQ ID NO:706), Eph receptors and Ephrins, hepatocyte growth factor (HGF GenBank Accession No. NM 000601.4; SEQ ID NO:707), thymidine phosphorylase (TYMP GenBank Accession No. NM 001113755.1; SEQ ID NO:708), and neuropeptide Y (NPY GenBank Accession No. NM 000905.3; SEQ ID NO:709); and Factors affecting the basement membrane and extracellular matrix such as tissue factor (TF/F3 coagulation factor GenBank Accession No. NM 001993.4; SEQ ID NO:710), thrombin (GenBank Accession No. NM 004101.2; SEQ ID NO:711), plasminogen activator urokinase (PLAUR GenBank Accession No. NM 001005376.1; SEQ ID NO:712), tissue plasminogen activator (PLAT GenBank Accession No. NM 000930.3; SEQ ID NO:713), Plasmin, matrix metalloproteinases (MMPs), chymases, heparanases and integrins; hypoxia inducible factor (HIFla; GenBank Accession No. NM 001530; SEQ ID NO:714), and the HIFla triple mutant [P402A, P564G, N803A (SEQ ID NO:715, encoding a polypeptide SEQ ID NO:716 and further described in WO/2008/015675)].

According to some embodiments of the invention, the expressible nucleic acid sequence is capable of inhibiting angiogenesis.

According to some embodiments of the invention, the nucleic acid construct is capable of inhibiting angiogenesis (decreasing the level of angiogenesis) following expression thereof in cells by at least about 2 times, at least about 3 times, at least about 4 times, at least about 5 times, at least about 6 times, at least about 7 times, at least about 8 times, at least about 9 times, at least about 10 times, at least about 20 times, at least about 100 times, at least about 200 times, at least about 500 times, at least about 1000 times, at least about 2000 times or more as compared to control cells [e.g., cells not transformed or infected with the nucleic acid construct of some embodiments of the invention; or cells transformed with a control nucleic acid construct (e.g., a nucleic acid construct which does not comprise an angiogenic-related expressible nucleic acid sequence)] under the same experimental conditions.

Following is a non-limiting list of expressible nucleic acid sequence capable of inhibiting angiogenesis (some of which are described in Albini A., et al. "Functional genomics of endothelial cells treated with anti-angiogenic or angiopreventive drugs". Clin. Exp. Metastasis, published online on April 10, 2010, which is fully incorporated herein by reference).

Expressible nucleic acid sequences encoding toxic polypeptides or suicide polypeptides such as p53 and egr-l-TNF-alpha, cytotoxic pro-drug/enzymes for drug susceptibility therapy such as ganciclovir/thymidine kinase and 5- fluorocytosine/cytosine deaminase [e.g., E. coli cytosine deaminase (CD; e.g. Gene ID: 944996 nucleotides NC 000913.2 (355395.356678), SEQ ID NO: 13;], herpes simplex virus thymidine kinase [TK; e.g., human herpesvirusl GenelD: 2703374, nucleotides NC 001806.1 (46672-47802, complement) SEQ ID NO:717) or human herpesvirus 2 [GenelD: 1487307, NC 001798.1 (46870-48000, complement) SEQ ID NO:718], antimetastatic polypeptides such as 5 El A, Pseudomonas exotoxin (GenBank Accession No. EU090068; SEQ ID NO:719), Diphtheria toxin (GenBank Accession No. AY820132.1; SEQ ID NO:720), Ricin toxin (GenBank Accession No. EQ975183; SEQ ID NO: 721) and Fas chimera (SEQ ID NO: 722) can be used to inhibit angiogenesis.

Expressible nucleic acid sequences encoding endogenous inhibitors of angiogenesis: Arresten (COL4A1, GenBank Accession No. NM 001845.4, SEQ ID NO:723); Canstatin (COL4A2, GenBank Accession No. NM_001846.2, SEQ ID NO:724); Endorepellin (HSPG2, GenBank Accession No. NM 005529.5, SEQ ID NO:725); Endostatin (COL18A1, GenBank Accession No. NMJ30445.2, SEQ ID NO:726); Fibronectin fragment (Anastellin, FN1, GenBank Accession No. NM_212476.1, SEQ ID NO:727); Fibulin (FBLN1, GenBank Accession No. NM 006486.2, SEQ ID NO:728); Thrombospondin (THSD1 variant 2 GenBank Accession No. NM 199263.2, SEQ ID NO:729; or THSD1 variant 1 GenBank Accession No. NM 018676.3, SEQ ID NO:730); Tumstatin (COL4A3, GenBank Accession No. NM 000091.4, SEQ ID NO:731); Long Pentraxin (PTX3, GenBank Accession No. NM_002852.3, SEQ ID NO:732); Pigment epithelium derived factor (PEDF; SERPINF1, GenBank Accession No. NM 002615.4, SEQ ID NO:733); Angiostatin (PLG, GenBank Accession No. NM 000301.3, SEQ ID NO:734); Antithrombin III (SERPINC1, GenBank Accession No. NM 000488.2, SEQ ID NO:735); Platelet factor 4 (PF4, GenBank Accession No. NM 002619.2, SEQ ID NO:736); Tissue inhibitors of metalloproteinases (TIMPs) (TIMP1, GenBank Accession No. NM_003254.2, SEQ ID NO:737; TIMP2, GenBank Accession No. NM_003255.4, SEQ ID NO:738; TIMP3, GenBank Accession No. NM 000362.4, SEQ ID NO:739; TIMP4, GenBank Accession No. NM 003256.2, SEQ ID NO:740); PEX (MMP2, GenBank Accession No. NM 004530.4, SEQ ID NO:741 Soluble Fms-like tyrosine kinase-1 (S-Flt-1; FLT4, GenBank Accession No. NMJ82925.4, SEQ ID NO:742); Troponin I (TNNI1, GenBank Accession No. NM_003281.3, SEQ ID NO:743); Vasostatin (CHGA, GenBank Accession No. NM 001275.3, SEQ ID NO:744); VEGI- 192 or TNFSF15 (GenBank Accession No. NM_005118.2, SEQ ID NO:745); VEGF165B (VEGFA, GenBank Accession No.NM OO 1025366.2, SEQ ID NO:746); Vasohibin (VASH1, GenBank Accession No. NM 014909.4, SEQ ID NO:747; VASH2, GenBank Accession No. NM 024749.3, SEQ ID NO:748); TrpRS (WARS2, GenBank Accession No. NM_201263.2, SEQ ID NO:749); Neutrophil gelatinase-associated lipocalin (LCN2, GenBank Accession No. NM 005564.3, SEQ ID NO:750); DLL4 (Delta-like ligand 4; GenBank Accession No. NM 019074.2, SEQ ID NO:751); and Angiopoietin 1 (ANGPTl, GenBank Accession No. NM 001146.3, SEQ ID NO:752). It should be noted that under high density of endothelial cells ANGPTl acts as a glue between adjacent cells which tightly contact each other and do not proliferate. Under these circumstances, ANGPTl strongly activates the AKT survival pathway which contributes to endothelial cells survival and vasculature quiescence (FUKUHARA et al, Nat Cell Biol. 10, 513-526, 2008).

Expressible nucleic acid sequences encoding interferons and cytokines: Interferons (IFNA1, GenBank Accession No. NM_024013.1, SEQ ID NO:753; IFNA2, GenBank Accession No. NM 000605.3, SEQ ID NO:754; IFNB, GenBank Accession No. NM 002176.2, SEQ ID NO:755; IFNG, GenBank Accession No. NM 000619.2, SEQ ID NO:756); Interleukin 1 (ILIA, GenBank Accession No. NM 000575.3, SEQ ID NO:757); Interleukin 4 (IL4, GenBank Accession No. NM_000589.2, SEQ ID NO:758); Interleukin 12 (IL12A, GenBank Accession No. NM 000882.2, SEQ ID NO:759; IL12B, GenBank Accession No. NM 002187.2, SEQ ID NO:760); Interleukin 18 (IL18, GenBank Accession No. NM 001562.2, SEQ ID NO:761);

Expressible nucleic acid sequences encoding hormones such as 2- methoxyestradiol; Human chorionic gonadotropin (CGB, GenBank Accession No. NM 000737.2, SEQ ID NO:762); Prolactin fragments (PRL, GenBank Accession No. NM 000948.4 SEQ ID NO:763); and Somatostatin (SST, GenBank Accession No. NM 001048.3, SEQ ID NO:764).

According to some embodiments of the invention, the expressible nucleic acid sequence is capable of stabilizing, effecting and/or maturing blood vessels.

As used herein the phrase "stabilizing and/or maturing blood vessles" refers to at least enhancing the survival of endothelial cells or stroma cells (e.g., pericytes, smooth muscle cells and fibroblasts), or enhancing the interaction between endothelial cells, or between endothelial cells and stromal cells in the surrounding tissue, in a manner which reduces leakage of the blood vessel and/or extend endurance of the blood vessel resulting in appropriate and longlasting blood flow.

Non-limiting examples of expressible nucleic acid sequences which can be used to stabilize and/or mature blood vessels include Platelet derived growth factor-BB (PDGFB; GenBank Accession No. NM 002608; SEQ ID NO:765; Levanon et al, Pathobiology, 2006;73(3): 149-58; also Cao et al. Nature Med. 9: 604-613, 2003) and ANGPT1.

Thus, according to some embodiments, the nucleic acid construct can be used to decrease or increase the level of angiogenesis. Although these nucleic acid constructs can be expressed in any cell type, according to some embodiments of the invention their expression in endothelial cells is preferred and/or desired.

According to an aspect of some embodiments of the invention, there is provided a method of increasing expression of a heterologous polynucleotide (e.g., an expressible nucleic acid sequence) in endothelial cells of a subject, the method is effected by expressing the nucleic acid construct of some embodiments of the invention in cells of the subject, thereby increasing expression of the heterologous polynucleotide in the endothelial cells. Non-limiting examples of such nucleic acid constructs are those which comprise an isolated polynucleotide which comprises at least one copy of wild type M4 and/or M5 sequences, with or without at least one copy of wild type Ml, in the presence or absence of a mutation in M8, such as the polynucleotide selected from the group consisting of SEQ ID NOs:55-152.

According to a specific embodiment, the level of expression in endothelial cells is at least 5 times higher than in non-endothelial cells.

According to some embodiments of the invention, the cells express endothelin.

Non-limiting examples of cells which express endothelin include endothelial cells (e.g.,

BAEC), human umbilical vein endothelial cells (HUVEC), and bronchial epithelial cells

(e.g., B2B).

The teachings of the invention enable the design and selection of nucleic acid constructs encoding toxic proteins or cell growth inhibitors which are useful for treating cancer in any cell type (e.g., endothelial and non-endoethelial cells). Exampels of non- endothelial cells include, but are not limited to blood cells, hepatic cells, lung cells, kidney cells, cardiac cells, neuronal cells, epithelial cells, lymphocytes, myoblasts, and bone marrow cells.

Other expressible nucleic acid sequence which expression in cells is beneficial or desired include various reporter genes as described above. Thus, according to an aspect of some embodiments of the invention, there is provided a method of increasing expression of a heterologous polynucleotide (e.g., an expressible nucleic acid sequence) in cells of a subject, comprising expressing the nucleic acid construct of some embodiments of the invention in cells of a subject, thereby increasing expression of the heterologous polynucleotide in the cells of the subject.

Non-limiting examples of nucleic acid constructs for expression in any cell type are those which comprise an isolated polynucleotide which comprises at least one copy of wild type M6 and/or M7 sequences, in the presence or absence of a mutation in M8, and in the presence or absence of wild type Ml such as the polynucleotide selected from the group consisting of SEQ ID NOs:636-639, 640-641, and 686-699.

According to some embodiments of the invention, the nucleic acid construct is for expression in any cell-of interest (not necessarily endothelial cells). Non-limiting examples of such nucleic acid constructs are those which comprise an isolated polynucleotide which comprises a mutation in M4 and/or M5 and wild type sequences of M6 and/or M7 in the presence or absence of additional sequences from element X, and/or in the presence of other mutated sequences from element X, such as the polynucleotide selected from the group consisting of SEQ ID NOs: 181-209.

The nucleic acid construct (also referred to herein as an "expression vector") of some embodiments of the invention includes additional sequences which render this vector suitable for replication and integration in prokaryotes, eukaryotes, or preferably both (e.g., shuttle vectors). In addition, a typical cloning vectors may also contain a transcription and translation initiation sequence, transcription and translation terminator and a polyadenylation signal. By way of example, such constructs will typically include a 5' LTR, a tRNA binding site, a packaging signal, an origin of second-strand DNA synthesis, and a 3' LTR or a portion thereof.

The nucleic acid construct of the present invention typically includes a signal sequence for secretion of the peptide from a host cell in which it is placed. Preferably the signal sequence for this purpose is a mammalian signal sequence or the signal sequence of the polypeptide variants of the present invention.

Eukaryotic promoters typically contain two types of recognition sequences, the TATA box and upstream promoter elements. The TATA box, located 25-30 base pairs upstream of the transcription initiation site, is thought to be involved in directing RNA polymerase to begin RNA synthesis. The other upstream promoter elements determine the rate at which transcription is initiated.

Preferably, the promoter utilized by the nucleic acid construct of the present invention is active in the specific cell population transformed. Examples of cell type- specific and/or tissue-specific promoters include promoters such as albumin that is liver specific [Pinkert et al, (1987) Genes Dev. 1 :268-277], lymphoid specific promoters [Calame et al, (1988) Adv. Immunol. 43:235-275]; in particular promoters of T-cell receptors [Winoto et al, (1989) EMBO J. 8:729-733] and immunoglobulins; [Banerji et al. (1983) Cell 33729-740], neuron-specific promoters such as the neurofilament promoter [Byrne et al. (1989) Proc. Natl. Acad. Sci. USA 86:5473-5477], pancreas- specific promoters [Edlunch et al. (1985) Science 230:912-916] or mammary gland- specific promoters such as the milk whey promoter (U.S. Pat. No. 4,873,316 and European Application Publication No. 264,166).

Enhancer elements can stimulate transcription up to 1,000 fold from linked homologous or heterologous promoters. Enhancers are active when placed downstream or upstream from the transcription initiation site. Many enhancer elements derived from viruses have a broad host range and are active in a variety of tissues. For example, the SV40 early gene enhancer is suitable for many cell types. Other enhancer/promoter combinations that are suitable for the present invention include those derived from polyoma virus, human or murine cytomegalovirus (CMV), the long term repeat from various retroviruses such as murine leukemia virus, murine or Rous sarcoma virus and HIV. See, Enhancers and Eukaryotic Expression, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. 1983, which is incorporated herein by reference.

In the construction of the expression vector, the promoter is preferably positioned approximately the same distance from the heterologous transcription start site as it is from the transcription start site in its natural setting. As is known in the art, however, some variation in this distance can be accommodated without loss of promoter function.

Polyadenylation sequences can also be added to the expression vector in order to increase the efficiency of mRNA translation (of the expressible nucleic acid sequence). Two distinct sequence elements are required for accurate and efficient polyadenylation: GU or U rich sequences located downstream from the polyadenylation site and a highly conserved sequence of six nucleotides, AAUAAA, located 11-30 nucleotides upstream. Termination and polyadenylation signals that are suitable for the present invention include those derived from SV40.

In addition to the elements already described, the expression vector of the present invention may typically contain other specialized elements intended to increase the level of expression of cloned nucleic acids or to facilitate the identification of cells that carry the recombinant DNA. For example, a number of animal viruses contain DNA sequences that promote the extra chromosomal replication of the viral genome in permissive cell types. Plasmids bearing these viral replicons are replicated episomally as long as the appropriate factors are provided by genes either carried on the plasmid or with the genome of the host cell.

The vector may or may not include a eukaryotic replicon. If a eukaryotic replicon is present, then the vector is amplifiable in eukaryotic cells using the appropriate selectable marker. If the vector does not comprise a eukaryotic replicon, no episomal amplification is possible. Instead, the recombinant DNA integrates into the genome of the engineered cell, where the promoter directs expression of the desired nucleic acid.

The expression vector of the present invention can further include additional polynucleotide sequences that allow, for example, the translation of several proteins from a single mRNA such as an internal ribosome entry site (IRES) and sequences for genomic integration of the promoter-chimeric polypeptide.

Examples for mammalian expression vectors include, but are not limited to, pcDNA3, pcDNA3.1 (+/-), pGL3, pZeoSV2(+/-), pSecTag2, pDisplay, pEF/myc/cyto, pCMV/myc/cyto, pCR3.1, pSinRep5, DH26S, DHBB, pNMTl, pNMT41, pNMT81, which are available from Invitrogen, pCI which is available from Promega, pMbac, pPbac, pBK-RSV and pBK-CMV which are available from Strategene, pTRES which is available from Clontech, and their derivatives.

Expression vectors containing regulatory elements from eukaryotic viruses such as retroviruses can be also used. SV40 vectors include pSVT7 and pMT2. Vectors derived from bovine papilloma virus include pBV-lMTHA, and vectors derived from Epstein Bar virus include pHEBO, and p205. Other exemplary vectors include pMSG, pAV009/A⁺, pMTO10/A⁺, pMAMneo-5, baculo virus pDSVE, and any other vector allowing expression of proteins under the direction of the SV-40 early promoter, SV-40 later promoter, metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown effective for expression in eukaryotic cells.

As described above, viruses are very specialized infectious agents that have evolved, in many cases, to elude host defense mechanisms. Typically, viruses infect and propagate in specific cell types. The targeting specificity of viral vectors utilizes its natural specificity to specifically target predetermined cell types and thereby introduce a recombinant gene into the infected cell. Thus, the type of vector used by the present invention will depend on the cell type transformed. The ability to select suitable vectors according to the cell type transformed is well within the capabilities of the ordinary skilled artisan and as such no general description of selection consideration is provided herein. For example, bone marrow cells can be targeted using the human T cell leukemia virus type I (HTLV-I) and kidney cells may be targeted using the heterologous promoter present in the baculo virus Autographa californica nucleopolyhedro virus (AcMNPV) as described in Liang CY et al, 2004 (Arch Virol. 149: 51-60).

Recombinant viral vectors are useful for in vivo expression of expressible sequences of interest since they offer advantages such as lateral infection and targeting specificity. Lateral infection is inherent in the life cycle of, for example, retrovirus and is the process by which a single infected cell produces many progeny virions that bud off and infect neighboring cells. The result is that a large area becomes rapidly infected, most of which was not initially infected by the original viral particles. This is in contrast to vertical-type of infection in which the infectious agent spreads only through daughter progeny. Viral vectors can also be produced that are unable to spread laterally. This characteristic can be useful if the desired purpose is to introduce a specified gene into only a localized number of targeted cells.

Various methods can be used to introduce the expression vector of the present invention into stem cells. Such methods are generally described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (1989, 1992), in Ausubel et al, Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (1989), Chang et al, Somatic Gene Therapy, CRC Press, Ann Arbor, Mich. (1995), Vega et al, Gene Targeting, CRC Press, Ann Arbor Mich. (1995), Vectors: A Survey of Molecular Cloning Vectors and Their Uses, Butterworths, Boston Mass. (1988) and Gilboa et at. [Biotechniques 4 (6): 504-512, 1986] and include, for example, stable or transient transfection, lipofection, electroporation and infection with recombinant viral vectors. In addition, see U.S. Pat. Nos. 5,464,764 and 5,487,992 for positive-negative selection methods.

Introduction of nucleic acids by viral infection offers several advantages over other methods such as lipofection and electroporation, since higher transfection efficiency can be obtained due to the infectious nature of viruses.

According to one embodiment the adenoviral vector is a non-replicating serotype 5 (Ad5) adenoviral vector.

Currently preferred in vivo nucleic acid transfer techniques include transfection with viral or non-viral constructs, such as adenovirus (e.g., Ad5 virus vector), lentivirus, Herpes simplex I virus, or adeno-associated virus (AAV) and lipid-based systems. Useful lipids for lipid-mediated transfer of the gene are, for example, DOTMA, DOPE, and DC-Choi [Tonkinson et al., Cancer Investigation, 14(1): 54-65 (1996)]. The most preferred constructs for use in gene therapy are viruses, most preferably adenoviruses, AAV, lentiviruses, or retroviruses. A viral construct such as a retroviral construct includes at least one transcriptional promoter/enhancer or locus-defining element(s), or other elements that control gene expression by other means such as alternate splicing, nuclear RNA export, or post-translational modification of messenger. Such vector constructs also include a packaging signal, long terminal repeats (LTRs) or portions thereof, and positive and negative strand primer binding sites appropriate to the virus used, unless it is already present in the viral construct. In addition, such a construct typically includes a signal sequence for secretion of the peptide from a host cell in which it is placed. Preferably the signal sequence for this purpose is a mammalian signal sequence or the signal sequence of the polypeptide variants of the present invention. Optionally, the construct may also include a signal that directs polyadenylation, as well as one or more restriction sites and a translation termination sequence. By way of example, such constructs will typically include a 5' LTR, a tRNA binding site, a packaging signal, an origin of second-strand DNA synthesis, and a 3' LTR or a portion thereof. Other vectors can be used that are non-viral, such as cationic lipids, polylysine, and dendrimers. Other than containing the necessary elements for the transcription and translation of the inserted coding sequence, the expression construct of the present invention can also include sequences engineered to enhance stability, production, purification, yield or toxicity of the expressed peptide. For example, the expression of a fusion protein or a cleavable fusion protein comprising the protein encoded by the expressible nucleic acid sequence described above and a heterologous protein can be engineered. Such a fusion protein can be designed so that the fusion protein can be readily isolated by affinity chromatography; e.g., by immobilization on a column specific for the heterologous protein. Where a cleavage site is engineered between the two proteins, the protein can be released from the chromatographic column by treatment with an appropriate enzyme or agent that disrupts the cleavage site [e.g., see Booth et al. (1988) Immunol. Lett. 19:65-70; and Gardella et al, (1990) J. Biol. Chem. 265: 15854-15859].

As mentioned hereinabove, a variety of prokaryotic or eukaryotic cells can be used as host-expression systems to express the polypeptides of the present invention. These include, but are not limited to, microorganisms, such as bacteria transformed with a recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vector containing the coding sequence; yeast transformed with recombinant yeast expression vectors containing the coding sequence; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors, such as Ti plasmid, containing the coding sequence. Mammalian expression systems can also be used to express the polypeptides of the present invention.

Examples of bacterial constructs include the pET series of E. coli expression vectors [Studier et al. (1990) Methods in Enzymol. 185:60-89).

In yeast, a number of vectors containing constitutive or inducible promoters can be used, as disclosed in U.S. Pat. Application No: 5,932,447. Alternatively, vectors can be used which promote integration of foreign DNA sequences into the yeast chromosome.

In cases where plant expression vectors are used, the expression of the coding sequence can be driven by a number of promoters. For example, viral promoters such as the 35S RNA and 19S RNA promoters of CaMV [Brisson et al. (1984) Nature 310:511- 514], or the coat protein promoter to TMV [Takamatsu et al. (1987) EMBO J. 6:307- 311] can be used. Alternatively, plant promoters such as the small subunit of RUBISCO [Coruzzi et al. (1984) EMBO J. 3: 1671-1680 and Brogli et al, (1984) Science 224:838- 843] or heat shock promoters, e.g., soybean hspl7.5-E or hspl7.3-B [Gurley et al. (1986) Mol. Cell. Biol. 6:559-565] can be used. These constructs can be introduced into plant cells using Ti plasmid, Ri plasmid, plant viral vectors, direct DNA transformation, microinjection, electroporation and other techniques well known to the skilled artisan. See, for example, Weissbach & Weissbach, 1988, Methods for Plant Molecular Biology, Academic Press, NY, Section VIII, pp 421-463.

Other expression systems such as insects and mammalian host cell systems which are well known in the art and are further described hereinbelow can also be used by the present invention.

Recovery of the recombinant polypeptide is effected following an appropriate time in culture. The phrase "recovering the recombinant polypeptide" refers to collecting the whole fermentation medium containing the polypeptide and need not imply additional steps of separation or purification. Not withstanding the above, polypeptides of the present invention can be purified using a variety of standard protein purification techniques, such as, but not limited to, affinity chromatography, ion exchange chromatography, filtration, electrophoresis, hydrophobic interaction chromatography, gel filtration chromatography, reverse phase chromatography, concanavalin A chromatography, chromatofocusing and differential solubilization.

According to an aspect of some embodiments of the invention, the nucleic acid construct is used for directing expression of a heterologous polynucleotide (e.g., an expressible nucleic acid sequence of interest) in cells ex vivo.

For example, the nucleic acid construct of some embodiments of the invention can be introduced to cells or tissue(s) which are obtained from the a living organism, e.g., a mammal, e.g., a human being, in order to express the heterologous polynucleotide therein (e.g., for increasing or decreasing expression of a polynucleotide-of-interest).

Suitable modes of administration of the nucleic acid construct to cells include, but are not limited to lipofection, electroporation, nucleofection, microinjection, Calcium-phosphate co-precipitation, viral infection, polymer-based delivery, nanoparticle-based delivery, particle bombardment/biolistic delivery, laser irradiation and sonoporation (Karra D and Dahm R., J Neurosci. 2010 May 5;30(18):6171-7; Hakama et al, Pharmacol Rep. 2009 Nov-Dec;61(6):993-9; Kim and Eberwine., Anal Bioanal Chem. 2010 Jun 13).

According to some embodiments of the invention, following administration of the nucleic acid construct to the cells or tissues, the cells or tissues can be introduced into a subject. According to some embodiments of the invention the cells or tissues which are introduced into a subject are form the same subject (autologous source) or from allogeneic sources such as embryonic stem cells which are not expected to induce an immunogenic reaction.

According to some embodiments of the invention, introducing is effected affected by injection of cells. According to some embodiments of the invention, introducing is effected by implantation.

According to some embodiments of the invention, the administration of the cell or tissues into the subject is performed after a partial or a complete therapeutic effect of the heterologous polynucleotide or the nucleic acid construct has been achieved.

According to an aspect of some embodiments of the invention, the nucleic acid construct is used for directing expression of a heterologous polynucleotide (e.g., an expressible nucleic acid sequence of interest) in cells in vivo. For example, such a use can be for treating a disease by expression of the expressible nucleic acid sequence of interest in diseased cells (e.g., for killing these cells) or for increasing or inhibiting angiogenesis and thus controlling the disease (e.g., inhibiting angiogenesis in case of cancers, and increasing angiogenesis in case of ischemic diseases).

The nucleic acid construct of some embodiments of the invention can be administered to an organism per se, or in a pharmaceutical composition where it is mixed with suitable carriers or excipients.

As used herein a "pharmaceutical composition" refers to a preparation of one or more of the active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients. The purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism.

Herein the term "active ingredient" refers to the nucleic acid construct of some embodiments of the invention accountable for the biological effect.

Hereinafter, the phrases "physiologically acceptable carrier" and "pharmaceutically acceptable carrier" which may be interchangeably used refer to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound. An adjuvant is included under these phrases.

Herein the term "excipient" refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient. Examples, without limitation, of excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols.

Techniques for formulation and administration of drugs may be found in "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, PA, latest edition, which is incorporated herein by reference.

Suitable routes of administration may, for example, include oral, rectal, transmucosal, especially transnasal, intestinal or parenteral delivery, including intramuscular, subcutaneous and intramedullary injections as well as intrathecal, direct intraventricular, intracardiac, e.g., into the right or left ventricular cavity, into the common coronary artery, intravenous, inrtaperitoneal, intranasal, or intraocular injections, topical administration, intradermal administration, intra ocular or ophthalmological manner.

Non-limiting examples of introducing the pharmaceutical composition which comprises the nucleic acid construct of some embodiments of the invention into the eye include systemic or localized injection, electroporation, viral infection, topical instillation, osmotic pump, encapsulated cell technology, transfection or nanoparticle delivery (see e.g., El Sanharawi t al, Prog Retin Eye Res. 2010, which is fully incorporated herein by reference).

Non-limiting examples of modes of introducing the pharmaceutical composition of some embodiments of the invention into topical administration include transfection, fibrin-lipoplex complexes, systemic or localized injection, electroporation, viral infection, osmotic pump, and magnetic- or polymer- nanoparticle delivery (see e.g., Woodrow et al, Nat Mater. 2009 Jun;8(6):526-33.; Kulkarni et al, Biomacromolecules. 2009 Jun 8;10(6): 1650-4, each of which is fully incorporated herein by reference).

Non-limiting examples of introducing the pharmaceutical composition which comprises the nucleic acid construct of some embodiments of the invention intradermally include injection, infection, trans fection, protrusion array device (PAD) that allows skin barrier penetration and laser pulser (e.g., Gonzalez-Gonzalez et al., Mol Ther. 2010; Zeira et al, FASEB J. 2007 Nov;21(13):3522-33, each of which is fully incorporated herein by reference).

Conventional approaches for drug delivery to the central nervous system (CNS) include: neurosurgical strategies (e.g., intracerebral injection or intracerebroventricular infusion); molecular manipulation of the agent (e.g., production of a chimeric fusion protein that comprises a transport peptide that has an affinity for an endothelial cell surface molecule in combination with an agent that is itself incapable of crossing the BBB) in an attempt to exploit one of the endogenous transport pathways of the BBB; pharmacological strategies designed to increase the lipid solubility of an agent (e.g., conjugation of water-soluble agents to lipid or cholesterol carriers); and the transitory disruption of the integrity of the BBB by hyperosmotic disruption (resulting from the infusion of a mannitol solution into the carotid artery or the use of a biologically active agent such as an angiotensin peptide). However, each of these strategies has limitations, such as the inherent risks associated with an invasive surgical procedure, a size limitation imposed by a limitation inherent in the endogenous transport systems, potentially undesirable biological side effects associated with the systemic administration of a chimeric molecule comprised of a carrier motif that could be active outside of the CNS, and the possible risk of brain damage within regions of the brain where the BBB is disrupted, which renders it a suboptimal delivery method.

Alternately, one may administer the pharmaceutical composition in a local rather than systemic manner, for example, via injection of the pharmaceutical composition directly into a tissue region of a patient.

The term "tissue" refers to part of an organism consisting of cells designed to perform a function or functions. Examples include, but are not limited to, brain tissue, retina, skin tissue, hepatic tissue, pancreatic tissue, bone, cartilage, connective tissue, blood tissue, muscle tissue, cardiac tissue brain tissue, vascular tissue, renal tissue, pulmonary tissue, gonadal tissue, hematopoietic tissue.

Pharmaceutical compositions of the present invention may be manufactured by processes well known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.

Pharmaceutical compositions for use in accordance with the present invention thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations which, can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.

For injection, the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological salt buffer. For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.

For oral administration, the pharmaceutical composition can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art. Such carriers enable the pharmaceutical composition to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for oral ingestion by a patient. Pharmacological preparations for oral use can be made using a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carbomethylcellulose; and/or physiologically acceptable polymers such as polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.

Dragee cores are provided with suitable coatings. For this purpose, concentrated sugar solutions may be used which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses. Pharmaceutical compositions which can be used orally, include push-fit capsules made of gelatin as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules may contain the active ingredients in admixture with filler such as lactose, binders such as starches, lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active ingredients may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added. All formulations for oral administration should be in dosages suitable for the chosen route of administration.

For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner.

For administration by nasal inhalation, the active ingredients for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from a pressurized pack or a nebulizer with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane or carbon dioxide. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of, e.g., gelatin for use in a dispenser may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.

The pharmaceutical composition described herein may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multidose containers with optionally, an added preservative. The compositions may be suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.

Pharmaceutical compositions for parenteral administration include aqueous solutions of the active preparation in water-soluble form. Additionally, suspensions of the active ingredients may be prepared as appropriate oily or water based injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes. Aqueous injection suspensions may contain substances, which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the active ingredients to allow for the preparation of highly concentrated solutions.

Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile, pyrogen- free water based solution, before use.

The pharmaceutical composition of the present invention may also be formulated in rectal compositions such as suppositories or retention enemas, using, e.g., conventional suppository bases such as cocoa butter or other glycerides.

Pharmaceutical compositions suitable for use in context of the present invention include compositions wherein the active ingredients are contained in an amount effective to achieve the intended purpose. More specifically, a therapeutically effective amount means an amount of active ingredients (nucleic acid construct of some embodiments of the invention) effective to prevent, alleviate or ameliorate symptoms of a disorder (e.g., cancer) or prolong the survival of the subject being treated.

Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.

For any preparation used in the methods of the invention, the therapeutically effective amount or dose can be estimated initially from in vitro and cell culture assays. For example, a dose can be formulated in animal models to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans.

Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals. The data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human. The dosage may vary depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See e.g., Fingl, et al., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 p.l).

Dosage amount and interval may be adjusted individually to provide tissue levels of the active ingredient are sufficient to induce or suppress the biological effect (minimal effective concentration, MEC). The MEC will vary for each preparation, but can be estimated from in vitro data. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations.

Depending on the severity and responsiveness of the condition to be treated, dosing can be of a single or a plurality of administrations, with course of treatment lasting from about one hour, a single day, several days to several weeks or until cure is effected or diminution of the disease state is achieved.

The amount of a composition to be administered will, of course, be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc.

Compositions of the present invention may, if desired, be presented in a pack or dispenser device, such as an FDA approved kit, which may contain one or more unit dosage forms containing the active ingredient. The pack may, for example, comprise metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration. The pack or dispenser may also be accommodated by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions or human or veterinary administration. Such notice, for example, may be of labeling approved by the U.S. Food and Drug Administration for prescription drugs or of an approved product insert. Compositions comprising a preparation of the invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition, as is further detailed above.

As used herein the term "about" refers to ± 10 %.

The terms "comprises", "comprising", "includes", "including", "having" and their conjugates mean "including but not limited to".

The term "consisting of means "including and limited to".

The term "consisting essentially of means that the composition, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure. As used herein, the singular form "a", "an" and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a compound" or "at least one compound" may include a plurality of compounds, including mixtures thereof.

Throughout this application, various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.

Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases "ranging/ranges between" a first indicate number and a second indicate number and "ranging/ranges from" a first indicate number "to" a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween.

As used herein the term "method" refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.

As used herein, the term "treating" includes abrogating, substantially inhibiting, slowing or reversing the progression of a condition, substantially ameliorating clinical or aesthetical symptoms of a condition or substantially preventing the appearance of clinical or aesthetical symptoms of a condition.

It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.

Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.

EXAMPLES

Reference is now made to the following examples, which together with the above descriptions illustrate some embodiments of the invention in a non limiting fashion.

Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, "Molecular Cloning: A laboratory Manual" Sambrook et al, (1989); "Current Protocols in Molecular Biology" Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al, "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al, "Recombinant DNA", Scientific American Books, New York; Birren et al. (eds) "Genome Analysis: A Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; "Cell Biology: A Laboratory Handbook", Volumes I-III Cellis, J. E., ed. (1994); "Current Protocols in Immunology" Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), "Basic and Clinical Immunology" (8th Edition), Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (eds), "Selected Methods in Cellular Immunology", W. H. Freeman and Co., New York (1980); available immunoassays are extensively described in the patent and scientific literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153; 3,850,752; 3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219; 5,011,771 and 5,281,521; "Oligonucleotide Synthesis" Gait, M. J., ed. (1984); "Nucleic Acid Hybridization" Hames, B. D., and Higgins S. J., eds. (1985); "Transcription and Translation" Hames, B. D., and Higgins S. J., Eds. (1984); "Animal Cell Culture" Freshney, R. I., ed. (1986); "Immobilized Cells and Enzymes" IRL Press, (1986); "A Practical Guide to Molecular Cloning" Perbal, B., (1984) and "Methods in Enzymology" Vol. 1-317, Academic Press; "PCR Protocols: A Guide To Methods And Applications", Academic Press, San Diego, CA (1990); Marshak et al, "Strategies for Protein Purification and Characterization - A Laboratory Course Manual" CSHL Press (1996); all of which are incorporated by reference as if fully set forth herein. Other general references are provided throughout this document. The procedures therein are believed to be well known in the art and are provided for the convenience of the reader. All the information contained therein is incorporated herein by reference.

GENERAL MATERIALS AND EXPERIMENTAL METHODS

Table 1 below provides names and catalogue numbers of certain materials used in this study.

Table 1

Materials Supplier/Man u facturer .Catalogue No

Tissue culture

DMEM, high glucose Biological Industries 01-055-1A

DMEM, low glucose Biological Industries 01-050-1A

Trypsin 0.25% Biological Industries 03-052-1A

Trypsin 0.05% Biological Industries 03-053-1A

Foetal Bovine Serum, Heat

Biological Industries 04-121-1A inactivated

Foetal Bovine Serum (for BAEC) Gibco 10270-106

Pen-Strep-Glut Gibco 10378-016

Pen- Strep Biological Industries 03-031-1B

L-Glutmaine 200mM Biological Industries 03-020-1B

MgCl (lOuM) Sigma M1028

Pyruvate (20ml/L) Gibco 11360 Materials Supplier/Man u facturer .Catalogue No

PBS xlO Biological Industries 02-023-5A

Trypan Blue (0.5% w/v) Biological Industries 03-102-1B

DMSO Sigma D2650

Lipofectamine2000 Invitrogen 11668-019

Molecular biology

PCR:

AB- ReddyMix ABgene

0575/DC/LD/A

Agarose Gel Invitrogen 15510-027

TAE x50 Biological Industries 01-870-1A

Ethidium Bromide Mercury 5450

SYBR Safe Invitrogen S33102

Applied Biological

Safe view G108

Materials

GeneRuUer 1Kb DNA ladder Fermentas SM0311

GeneRuUer DNA ladder Ultra Low

Fermentas SM1213 Range

6x Loading Dye Fermentas R0611

QIAquick gel extraction kit Qiagen 28706

Purified Water Sigma W4502

Bacterial growth

MAX Efficiency DH5a Invitrogen 18258-012

S.O.C medium Invitrogen 15544-034

LB BROTH Hy-labs BP302/400s

TERRIFIC BROTH Hy-labs BP323-100S

Ampicilin Sigma A-9518

Ampiciln plate Hy-labs PD178

Miniprep Kit Qiagen 27106 Materials Supplier/Man u facturer .Catalogue No

Pure Link HiPure Plasmid Midiprep

Invitrogen K2100-05 Kit

Enzymes:

Nhel, CIP, PNK, T4-Ligase, New England Biolab

Protein purification and activity test

PLB x5 Promega El 94 A

CCLR x5 Promega E153A

Luciferase Assay System Promega E1501

Dual-Luciferase Reporter Assay

Promega E1960 System

BCA protein assay kit Pierce 23227

Micro BCA protein assay kit Pierce 23235

Viruses

High pure viral nuclear acid kit Roche 1-858-874

Mycoplasma test kit Biological Industries 20-700-20

VP test

20% SDS Amresco 151-21-3

Glycerol Merck 04093

PFU test:

QuickTiter Adenovirus Titer Cell Biolab VPK-109 Immunoassay kit

Sea plaque agarose Cambrex 50100

MTT solution Sigma M5655-100MG

Table 1.

Protocols related to handling the tissue culture cells

Freezing cells - Cells were harvested from the Petri dish according to the appropriate protocol, centrifuged for 10 minutes at 1500 rpm, and re-suspended in a freezing medium containing fetal bovine serum (FBS) 90% and DMSO 10%. The suspension was kept overnight at -80°C and transferred the next morning to storage in liquid nitrogen. Thawing cells - Cells were thawed after storage in liquid nitrogen by transferring the test tube to a 37°C bath until fully thawed (about one minute). Cells were then transferred to a 100-mm Petri dish containing 10 ml growth medium (10% FBS + DMEM + antibiotic), and incubated overnight. The next morning, the medium was replaced with fresh medium to remove DMSO from the cells. When it was not possible to replace the medium the next morning, defrosted cells were centrifuged together with 10 ml growth medium for 10 minutes at 1500 rpm on thawing day. The supernatant was aspirated off the cells, which were re-suspended in fresh growth medium. The cell suspension was transferred to a new 100-mm dish which was incubated for further use.

Splitting cells (lysis) - Cells were split according to the protocol established for each cell type, using the appropriate concentration of trypsin (0.05% or 0.25%>).

Producing viral vectors - The endo-viral vector, pjM17, served as the basis for the various viruses used in the experiments described herein. This vector contains the entire Ad5 genome, however the El gene is mutated and the E3 gene is missing. Viruses were produced according to a protocol previously described by Becker et al. (1994).

Up-regulation - HEK293 cells were thawed and divided into 10 100-mm Petri dishes and one 50-mm Petri dish. The small dish was inoculated with 100 μιη virus, while cells growth continued in the larger dishes. The medium from the small dish containing the virus was collected, subjected to three freezing-defrosting cycles, and used to inoculate 5 of the 10 larger dishes. The cells in the remaining 5 dishes were divided into 45 150-mm Petri dishes. The medium in the 5 inoculated dishes containing the virus was collected, subjected to three freezing-thawing cycles, and used to inoculate the 45 larger dishes. When all cells appeared to be full of virus and before the virus was released into the medium (after 48 hours), the medium was collected and centrifuged. The pellet, which contained the virus-infected cells, was re-suspended in approximately 20 ml and subjected to three freezing-thawing cycles. The final suspension was stored at -80°C until the purification stage.

Purification - The virus was first purified using a discontinuous CsCl gradient composed of 1.2 and 1.4 density layers. The virus was collected from the gradient by aspirating the appropriate fraction from the test tube and loaded onto a continuous gradient composed of the same CsCl density layers. The virus was collected from the continuous gradient by aspiration of the appropriate fraction from the test tube, and was loaded onto PD-10 columns that help clean the virus from residual CsCl. Finally, glycerol was added to the virus at 10% of the final volume and the virus was stored at - 80°C until use.

Measuring concentration - Virus concentration at end of production was determined using a spectrophotometer at OD₂₆o. The virus was subjected to lysis with SDS and was diluted in PBS solution containing 10% glycerol. Virus concentration at end of production was in the order of 10¹² virions per ml and concentration was calculated using the following formula:

OD₂6o dilution factor x 1.1 x 10¹².

Plaque-forming unit (PFU) content - PFU content was determined first by inoculating HEK293 cells into 10-mm Petri dishes so that the cells reached 80-90% coverage of the dish area and infecting them with various dilutions of virus. Following infection, dishes were incubated for 2 hours at 37°C after which liquid agarose was added to each dish. After the agarose hardened, dishes were returned to the incubator and were monitored until plaques appeared, usually within two weeks. Cells were stained with MTT and plaques were counted. This method was later on replaced by a QuickTiter Adenovirus Titer Immunoassay kit used to determine PFU content according to the kit protocol.

Infection of cells with viral vectors - BAEC, B2B, NIH3T3, and B16F0 cells were harvested from the Petri dishes using trypsin. Cells were counted under a microscope using a camera and were inoculated into 12-well plates. Thirty-six wells of each cell type were inoculated for a single experiment. Cell infection was performed when cell coverage reached 50%> of the well area. Each virus was diluted 100-fold (10 μΐ virus in 990 μΐ DMEM), to a concentration of approximately 10¹⁰ viruses per ml. Cells were infected with each virus at three different concentrations: 10, 100, and 1000 viruses per cell. Cells were infected by the different viruses in an infection medium (lacking serum and enriched in MgCl) and regular growth medium was added 30 minutes after infection. Each experiment was executed in triplicate, i.e., sets of 3 wells were infected with the same virus at the same concentration. Transfections - BAEC, B2B, and NIH3T3 cells were harvested from the dishes using trypsin, counted and inoculated into 24-well plates. Plates were then placed in the incubator. Transfection was performed when cell coverage reached 80-90% of the well area using Lipofectamin 2000 (Invitrogen) according to the manufacturer's protocol.

Examination of the activity of various promoter patterns - Forty-eight hours after infecting the cells with the virus, the growth medium was aspirated, cells were rinsed with PBS, and passive lysis buffer (PLB) was added to the cells to induce cell destruction (250 μΐ PLB per 12-well plate well and 200 μΐ PLB per 24-well plate well). Luciferase activity (and when applicable Renilla activity) as well as protein concentration were determined for each lysate sample.

Promoter activity assay - In order to measure the ability of a promoter sequence of interest to induce expression of a heterologous gene of interest, the level of expression of a reporter gene (Firefly Luciferase) was detected. As a control for the transfection efficiency, the cells were co-trans fected with the pGL4.74 [hRluc/TK] plasmid (Promega Cat # E692A) comprising the Renilla Luciferase coding sequence under the transcriptional regulation of a known promoter (e.g., Thymidine Kinase).

The expression level of Firefly Luciferase and Renilla Luciferase was measured in lysates of cell cultures after transfections, according to the Dual-luciferase reporter assay system, Promega, Cat # El 960, technical manual TM040, using luminometer settings as described in DLR3 protocol. The apparatus measures the amount of Firefly Luciferase in the sample by injecting a luciferase substrate into each well and measuring the intensity of light emitted as a result of the reaction between luciferase and the substrate. In cases where measurement of Renilla Luciferase was also needed, the wells were injected with a renilla substrate, after the luciferase is measured, and the intensity of light emitted as a result of the reaction between the renilla and the substrate was measured. In order to normalize luciferase activity in tissues protein content was measured using the Bradford method according to the manufacturer protocol [BCA kit (PIRECE)]. The micro-BCA kit (PIRECE) was used on lysates of cell cultures.

Construction of new vectors - In order to examine at a high resolution the endothelial-specific regulatory "element x" of the promoter endothelin-1 promoter, new vectors were engineered based on the pEL8 plasmid in which the luciferase gene was driven by the original endothelin-1 promoter. An additional copy of the wild-type or locally mutated regulatory element was inserted into Nhel site in the plasmid (Figure 2A). The expression of luciferase under these patterns was examined by transfection into BAEC, B2B, and NIH3T3 cells.

Generation of plasmids - A copy of the regulatory element, x, and a series of local mutations (depicted in Figures 2A-B) were ligated into plasmid pEL8 by cutting the plasmid using the restriction enzyme Nhel. Calf-intestinal phosphatase was used to prevent self-ligation of the empty plasmid, and T4 DNA Ligase (New-England Biolabs) was used to insert the desired segment. Plasmids were reproduced in E. coli (DH5a) and ligation products (about 100 base pairs) were examined by PCR [2X Reddymix PCR Master kit (Thermo Scientific)] using primers CTT GAT TCT TGA ACT CTG GGG CTG GC (SEQ ID NO:767) and GAG CAG CAG CCC GCT TCC CCT TTT G (SEQ ID NO:768) which are flanking the Nhel site and subsequently verified by DNA sequencing.

Analysis of transcription factors expected to bind to the PPE-1 promoter sequence was performed using the TFSEARCH and ALGEN PROMO software.

EXAMPLE 1

THE NATURE AND NUMBER OF ELEMENT COPIES AFFECT PPE-1

PROMOTER ACTIVITY

Experimental Results

Comparison between different variants of the PPE-1 promoter - As described in the Background section, the PPE-1 promoter exhibits high specificity to endothelial cells. Another tissue in which promoter activity was observed is epithelial cells from the upper respiratory tract. In order to examine the activity of the various variants of the promoter, BAEC cells (bovine endothelial cells), and B2B cells (human bronchial epithelial cells) were used. As negative control for promoter activity NIH3T3 mouse fibroblast cells and B16-F0 murine melanoma cells were used. The activity of the following promoters was evaluated: PPE-1 (wild type promoter; SEQ ID NO: l), PPE-1 - (3x) (SEQ ID NO: 17; contains two endothelial-specific elements x and an element x' in between), PPE-l-[x+x+x] (SEQ ID NO:20) and PPE-l-[x+x] (SEQ ID NO: 19). Luciferase expression under the various promoter forms was examined in dividing BAEC (Figure 3A) and B2B (Figure 3B) cells by infecting the cells with the various viruses. As positive control, cells were infected with the Ad.CMV-Luc virus, in which the luciferase gene is controlled by the CMV promoter (SEQ ID NO:23), which is constitutively active.

As shown in Figures 3 A and 3B, the various forms of PPE-1 promoter yield luciferase expression in BAEC and B2B cells, but luciferase expression is highest under promoters PPE-1 -[x+x+x] and PPE-1 -[x+x]. On the other hand, luciferase expression under the PPE-1 -(3x) promoter, is higher than under the basic PPE-1 promoter, but lower than under the other promoters. These results show that adding an enhancer element, X, to the basic PPE-1 promoter increases the promoter's activity in endothelial cells. In terms of the impact on the activity of the number of copies of element X, no significant advantage was observed when three copies of element X were added as compared to two copies of element X, and in B2B cells a slight decrease in promoter activity was observed following the addition of the third copy of element X. Luciferase expression was also examined in the negative control NIH3T3 cells (Figure 4). As expected, luciferase expression under the CMV promoter increased linearly with the increase in virus titer (calculated as multiplicity of infection, MOI) for all cell types. On the other hand, luciferase levels were negligible in these cells under all different forms of promoter PPE-1 examined, despite the use of increasing MOI (Figure 4). The activity of the various promoters was further examined in B16-F0 cells. No luciferase expression was observed in these cells under the various forms of promoter PPE-1 , and no increase in expression was observed even at higher MOI, whereas promoter CMV yielded linearly increasing expression relative to the MOI (data not shown).

Luciferase expression in BAEC cells was examined under two different confluences of cells during infection: 50% cell coverage of well area (as presented above in Figures 3A, 50%> coverage), and 100% coverage (as presented in Figure 5, 100% coverage). This enabled to compare luciferase expression levels under the different promoter forms in dividing cells and in confluent-stationary cells (an effect caused by contact inhibition), since the specificity of expression of the PPE-1 promoter was previously demonstrated for dividing endothelial cells (such as those that partake in the angiogenesis process). It is evident from these results that even among cells with 100%) confluence, luciferase expression was highest under promoters variants PPE-1 -[x+x+x] and PPE-l-[x+x]. When compared with results for BAEC cells with 50% coverage (Figure 3 A), promoter PPE-l-[x+x+x] activity was similar to that observed in cells with 50% coverage, whereas the promoter form PPE-l-[x+x] yielded higher luciferase activity in cells with 100% coverage. It is worth mentioning that the confluent cell model does not offer absolute simulation of arrested cells, and it is likely that some cells are still dividing in the dish during the experiment in a way that might affect the results. Altogether, these results demonstrate that element x plays a specific role in the up- regulation of promoter activity in BAEC and B2B cells.

EXAMPLE 2

PROMOTER ACTIVITY OF PPE-1 WITH ELEMENTS X OR X'

Experimental Results

Role of element x versus element x' in regulation of promoter activity - The effect of the elements x and x' was further examined on promoter activity using liposomal transfections. In these experiments, equal amounts of DNA from the pEL8- PPE-l-Luc, pEL8-PPE-l+[x']-Luc and pEL8-PPE-l+[x+x]-Luc (positive control) plasmids were transfected along with a fixed amount of TK- renilla so as to accurately normalize luciferase levels (taking transfection efficiency into account). Promoter activity was measured as the enzymatic activity of luciferase per mg protein following lipofectamine 2000 transfections. For reference, values were normalized to expression under promoter PPE-1 in BAEC which was defined as "1". The results shown in Figure 6 emphasize the difference between the basic expression levels of PPE-1 promoter in different cells and the fact that BAEC and B2B cells tend to activate the promoter 5 and 2.5 times more, respectively, than do NIH3T3 cells. In addition, the results support findings obtained from viral infection experiments whereby adding two copies of x to the basic PPE-1 promoter leads to a marked up-regulation of the promoter's activity in endothelial cells. In addition, the results show that x' regulates PPE-1 promoter activity.

Altogether, these results show that two copies of promoter PPE-l's element x, up-regulate the promoter's activity specifically in endothelial and pulmonary epithelial cells. EXAMPLE 3

MUTAGENESIS OF THE ENDOTHELIAL SPECIFIC ELEMENT X

To identify the sequence within element X that imparts its specific activity, the present inventors have generated a series of plasmids that harbor the luciferase gene under regulation of a modified PPE-1 promoter to which a mutant element X was added. In each variant, five different nucleotides in the sequence of element X were replaced by an AAAAA sequence (SEQ ID NO:769). Plasmids containing the mutant promoters (as described in Figure 2) were transfected into BAEC, B2B, and NIH3T3 cells and luciferase activity under the indicated mutated promoters was determined (Figures 7 A, 7B and 7C).

Wild type sequences corresponding to M6 and M7 are non-tissue specific enhancers - Mutated promoters variants M6 and M7 yielded diminished activity in all three cell types (Figures 7A, 7B and 7C), which was expressed by a decrease in luciferase levels compared to the promoter containing the normal factor, PPE-l-[x]. Since this phenomenon was observed in all cell types, it likely involves sites that are required for promoter activity but are not specific to endothelial cells. Thus, the wild type sequences corresponding to M6 (SEQ ID NO:49) and M7 (SEQ ID NO:50) are required for enhanced transcription, in a non-tissue specific manner.

Wild type sequences corresponding to M4 and M5 are endothelial tissue specific enhancers - Mutated promoters M4 and M5 significantly inhibited promoter activity in both BAEC cells and B2B cells (Figures 7 A and 7B). No decrease in the activity of promoters containing these mutations was, however, observed in NIH3T3 cells (Figure 6C). These results raise the possibility that it is the sequence at the site of mutations M4 and M5 that imparts specific activity to endothelial specific element. The wild type sequence corresponding to M4 (SEQ ID NO:46) and M5 (SEQ ID NO:47) possibly binds to specific transcription factors that play a role in angiogenesis or in endothelial cell proliferation.

Wild type sequences of MS is a non-specific suppressor- It can also be seen that under mutation M8, the promoter activity increased, which was manifested in a significant increase in luciferase levels in BAEC (Figure 7 A) and B2B (Figure 7B) cells and a more moderate increase in NIH3T3 (Figure 7C) cells. This result indicates the possibility that the wild type sequence corresponding to M8 (SEQ ID NO:52) inhibits the promoter's activity in a non-specific manner (regardless of the tissue).

Altogether, these results demonstrate that regulatory element X contains a site that exhibits positive control over the promoter's specific activity in the endothelial tissue (wild type M4-M5 zone) and another site with negative, non-specific control over the promoter's activity (wild-type M8 zone). The presence of the two sites together on the up-regulation factor X of promoter PPE-1 imparts specific activity to the promoter in endothelial tissue.

EXAMPLE 4

IDENTIFICATION OF TRANSCRIPTION FACTORS EXPECTED TO SPECIFICALLY BIND TO THE PROMOTER IN ENDOTHELIAL CELLS

Using bioinformatics tools as described under "General Materials and Experimental Methods " a variety of transcription factors that are expected to bind the regulatory elements were identified. These factors were sorted according to the site they possibly bind on element X (and as a result do not bind to promoters with a mutation at that same site).

Figure 8 schematically describes the transcription factors that are expected to bind to wild-type sequences corresponding to M4-M5 and M8 sites.

To identify the site within element X that imparts specific activity to the PPE-1 - (3x) promoter, the present inventors investigated which transcription factors are expected to bind to this element and impart specific activity to the promoter.

In addition, the present inventors tested whether the connection point between element X and element X' forms a new transcription factor binding site that may contribute to the inhibition of the promoter's activity. An examination of the connection site between the two elements revealed that a transcription factor, called zinc finger and BTB domain-containing protein 6 (ZBTB6), is indeed expected to bind the connection sequence between X and X^* (CTTCTGGAGCCA; SEQ ID NO:770).

In order to investigate this point, the present inventors have co-transfected ZBTB6 with plasmid PPE-l-(3x)Luc and tested its effect on promoter activity. It was found that the over-expression of this factor does not affect PPE-1 -(3x) promoter activity (data not shown). Thus, these findings indicate that the differences in the activity of the various forms of the promoter indeed stem from the internal sequence of element X as opposed to X', rather than from the connection of various elements on the promoter.

EXAMPLE 5

NON-LIMITING EXAMPLES OF REGUALTORY ISOLATED POLYNUCLEOTIDES AND THEIR PROPOSED USE

Table 2

Schematic representation of PPE-l-derived regulatory elements

Sequence

(Each could be as single or multiple copies, in direct or Rational

reverse-complement orientation ).

Full sequence, except M8 can

GTACTTCATACTTTTCATTCCAATGGGGTGACTTT- be any NNNNN except (NNNNNVTGGA (SEO ID NO:771)

GCTTC that reduces activity, and present in multiple copies.

Ml-M2-M3-M4-M5-M6-M7-(M8*)_n-M9

Expected to increase potency.

GTACTTCATACTTTTCATTCCAATGGGGTGACTTT

(SEQ ID NO:772) Removal of M8 (inhibitor) and

M9 (possibly dispensable).

M 1 -M2-M3-M4-M5-M6-M7

CATTCCAATGGGGTGACTTTGCTTC (SEQ ID NO:773)

Core element, directly affecting promoter activity. M4-M5-M6-M7-M8

Addition of M9 to the previous

CATTCCAATGGGGTGACTTTGCTTCTGGA (SEQ ID

option, since the M8 effect

NO:774)

might be due to TF binding sites located at the M8-M9

M4-M5-M6-M7-M8-M9

junction point.

CATTCCAATGGGGTGACTTT (SEQ ID NO: 775) The presence of wild-type M8 sequence decreases activity; its M4-M5-M6-M7 removal can enhance activity.

ACTTTGCTTCTGGA (SEQ ID NO: 776) M8 sequence and flanking sequences might serve as a M7-M8-M9 repressor

ACTTTGCTTC (SEQ ID NO: 777) M8 sequence and flanking sequences might serve as a M7-M8 repressor

GCTTCTGGA (SEQ ID NO:778) M8 sequence and flanking sequences might serve as a M8-M9* repressor

GCTTCTGGA (SEQ ID NO:784) M8 sequence and flanking sequences might serve as a M8-M9 repressor

Table 2: Non- limiting examples of isolated regulatory polynucleotides which can be used for specific expression of a gene-of-interest. An element marked with * is referred to an element having at least one mutation (substitution, deletion or insertion) as compared to the wild type sequence of the element in SEQ ID NO:6. "n" can be any integer equals or higher than 1. When there is a sequence of NNNNN at least one of these nucleotides is mutated with respect to the wild type sequence. Wild-type sequence of element X (SEQ ID NO:6: GTACTTCATACTTTTCATTCCAATGGGGTGACTTTGCTTCTGGA.

EXAMPLE 6

ISOLATED REGULATORY SEQUENCES AND THEIR EFFECT ON TRANSCRIPTION OF A HETEROLOGOUS POLYNUCLEOTIDE IN A HOST

CELL Figures 11 and 13 provide exemplary regulatory sequences according to some embodiments of the invention. Figure 12, demonstrates the effect of using isolated polynucleotides according to some embodiments of the invention on transcription of a heterologous polynucleotide operably linked thereto.

Experimental Results

Mutations in inhibitory sequences

As shown in Figure 12, expression of a heterologous sequence (luciferase) under the transcriptional regulation of a regulatory sequence devoid of the M8 sequence (inhibitory sequence) such as the M1-M7 sequence (SEQ ID NO:787) resulted in a significant upregulation of luciferase expression (18.7 arbitrary units) as compared to expression of a wild type sequence (SEQ ID NO:6) (7.6 arbitrary units) or the pEL8-lx- Luc (baseline, 8 arbitrary units). In addition, as is further shown expression of a heterologous sequence under the transcriptional regulation of the M1-M9 sequence in which the M8 is mutated (M8* v2, SEQ ID NO: 795) resulted in upregulation of transcription (12.7 units), which is about 1.5 fold higher than the base line transcription. In addition, it was unexpectedly found that expression of a heterologous sequence under the regulation of two copies of the M1-M9 sequence in which M8 is mutated ([M8*] x2 (SEQ ID NO: 796)) resulted in higher expression levels of the heterologous polynucleotide (17.6 arbitrary units).

These results demonstrate that abolishment of the M8 sequence by either deletion thereof, or mutation therein results in unexpectedly higher expression levels of the heterologous polynucleotide operably linked thereto.

Mutations in enhancer sequences

As shown in Figure 12, expression of a heterologous sequence (luciferase) under the transcriptional regulation of a regulatory sequence having the M1-M9 sequences yet with a mutated M5 sequence (CAAAA instead of CAATG) resulted in unexpectedly high levels of transcriptional activity (16.4 arbitrary units), which is more than 2 folds higher than expression under the wild type sequence (base line).

Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.

All publications, patents and patent applications mentioned in this specification are herein incorporated in their entirety by reference into the specification, to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting.

Claims

WHAT IS CLAIMED IS:

1. An isolated polynucleotide comprising at least 14 nucleotides of element X of a pre-proendothelin (PPE-1) promoter, said element X having a wild type sequence as set forth by SEQ ID NO:6, wherein said at least 14 nucleotides comprise at least 2 consecutive sequences derived from SEQ ID NO:6, each of said at least 2 consecutive sequences comprises at least 3 nucleotides, at least one of said at least 3 nucleotide being positioned next to at least one nucleotide position in SEQ ID NO:6, said at least one nucleotide position in SEQ ID NO: 6 is selected from the group consisting of:

(i) at least one nucleotide of wild type M4 sequence set forth by SEQ ID NO:46 (CATTC);

said at least one nucleotide position is mutated as compared to SEQ ID NO: 6 by at least one nucleotide substitution, at least one nucleotide deletion and/or at least one nucleotide insertion, with the proviso that a mutation of said at least one nucleotide position does not result in nucleotides GGTA at position 21-24 of SEQ ID NO:6 and/or in nucleotides CATG at position 29-32 of SEQ ID NO:6, such that when the isolated polynucleotide is integrated into the PPE-1 promoter and placed upstream of a luciferase coding sequence the expression level of said luciferase coding sequence is upregulated or downregulated as compared to when SEQ ID NO:6 is similarly integrated into the PPE-1 promoter and placed upstream of said luciferase coding sequence.

2. The isolated polynucleotide of claim 1, wherein the isolated polynucleotide further comprises at least one copy of a nucleic acid sequence selected from the group consisting of:

(i) wild type M4 sequence set forth by SEQ ID NO:46 (CATTC),

(ϋ) wild type M5 sequence set forth by SEQ ID NO:47 (CAATG),

(iii) wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC),

(iv) wild type M6 sequence set forth by SEQ ID NO:49 (GGGTG),

(v) wild type M7 sequence set forth by SEQ ID NO:50 (ACTTT);

(vi) wild type Ml sequence set forth by SEQ ID NO:53 (GTACT), and

(vii) wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT).

3. The isolated polynucleotide of claim 1 or 2, wherein the ii polynucleotide further comprises an endothelial cell specific promoter.

4. The isolated polynucleotide of claim 3, wherein said endothelial specific promoter is a PPE-1 promoter set forth in SEQ ID NO: 1.

5. An isolated polynucleotide comprising a nucleic acid sequence which comprises a first polynucleotide comprising the pre-proendothelin (PPE-1) promoter set forth by SEQ ID NO: l and a second polynucleotide comprising at least one copy of a nucleic acid sequence selected from the group consisting of:

(i) wild type M4 sequence set forth by SEQ ID NO :46 (CATTC),

(ii) wild type M5 sequence set forth by SEQ ID NO:47 (CAATG),

(iii) wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC),

(iv) wild type M6 sequence set forth by SEQ ID NO:49 (GGGTG),

(v) wild type M7 sequence set forth by SEQ ID NO :50 (ACTTT);

(vi) wild type Ml sequence set forth by SEQ ID NO:53 (GTACT), and

(vii) wild type M3 sequence set forth by SEQ ID NO :54 (CTTTT), with the proviso that said second polynucleotide is not SEQ ID NO: 6, and wherein the isolated polynucleotide is not as set forth by SEQ 17 (PPE-1 -3X).

6. A nucleic acid construct comprising a heterologous polynucleotide operably linked to the isolated polynucleotide of any of claims 1-5.

7. The nucleic acid construct of claim 6, wherein said heterologous polynucleotide is an expressible nucleic acid sequence.

8. The nucleic acid construct of claim 6 or 7, wherein said polynucleotide is positioned in a distance not exceeding 3000 nucleotides from said element X.

9. The isolated polynucleotide of any of claims 1-5, or the nucleic acid construct of claim 6, 7, or 8, wherein the isolated polynucleotide consists of no more than 40 kb.

10. A nucleic acid construct for directing expression of a heterologous polynucleotide in endothelial cells, comprising the nucleic acid construct of claim 6, 7, 8 or 9.

1 1. The nucleic acid construct of claim 10, wherein said heterologous polynucleotide is capable of inducing angiogenesis.

12. The nucleic acid construct of claim 10, wherein said heterologous polynucleotide is capable of inhibiting angiogenesis.

13. The nucleic acid construct of claim 10, wherein said heterologous polynucleotide is capable of stabilizing and/or maturing blood vessels.

14. A method of increasing expression of an expressible nucleic acid sequence of interest in endothelial cells of a subject, comprising expressing in cells of a subject the nucleic acid construct of any of claims 6-13, wherein said heterologous polynucleotide comprises the expressible nucleic acid sequence of interest, thereby increasing expression of the expressible nucleic acid sequence of interest in the endothelial cells.

15. The isolated polynucleotide of claim 1, 2, 3 or 4, the nucleic acid construct of any of claims 10-13, or the method of claim 14, wherein said isolated polynucleotide comprises at least one copy of said wild type M4 sequence set forth by SEQ ID NO:46 (CATTC).

16. The isolated polynucleotide of claim 1, 2, 3 or 4, the nucleic acid construct of any of claims 10-13, or the method of claim 14, wherein said isolated polynucleotide comprises at least one copy of said wild type M5 sequence set forth by SEQ ID NO:47 (CAATG).

17. The isolated polynucleotide of claim 1, 2, 3 or 4, the nucleic acid construct of any of claims 10-13, or the method of claim 14, wherein said isolated polynucleotide comprises at least one copy of said wild type M4 sequence set forth by SEQ ID NO:46 (CATTC) and at least one copy of said wild type M5 sequence set forth by SEQ ID NO:47 (CAATG).

18. The isolated polynucleotide, the nucleic acid construct or the method of claim 15, 16 or 17, wherein said at least one nucleotide position which is mutated as compared to SEQ ID NO:6 is at least one nucleotide of the wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC).

19. The isolated polynucleotide, the nucleic acid construct or the method of claim 15, 16 or 17, further comprises at least one copy of wild type Ml sequence set forth by SEQ ID NO:53 (GTACT).

20. The isolated polynucleotide, the nucleic acid construct or the method of claim 19, wherein the isolated polynucleotide further comprises wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC).

21. The isolated polynucleotide of claim 1, 2, 3 or 4, the nucleic acid construct of claim 6, 7, 8 or 9, wherein said isolated polynucleotide comprises at least one copy of said wild type M6 set forth by SEQ ID NO:49 (GGGTG).

22. The isolated polynucleotide of claim 1, 2, 3 or 4, the nucleic acid construct of claim 6, 7, 8 or 9, wherein said isolated polynucleotide comprises at least one copy of said wild type M7 sequence set forth by SEQ ID NO:50 (ACTTT).

23. The isolated polynucleotide of claim 1, 2, 3 or 4, the nucleic acid construct of claim 6, 7, 8 or 9, wherein said isolated polynucleotide comprises at least one copy of said wild type M6 set forth by SEQ ID NO:49 (GGGTG) and at least one copy of said wild type M7 sequence set forth by SEQ ID NO:50 (ACTTT).

24. A method of increasing expression of an expressible nucleic acid sequence of interest in cells of a subject, comprising expressing in cells of a subject the nucleic acid construct of any of claims 21-23, wherein said heterologous polynucleotide comprises the expressible nucleic acid sequence of interest, thereby increasing expression of the expressible nuclei acid sequence in the cells of the subject.

25. The isolated polynucleotide of claim 1, 2, 3 or 4, or the nucleic acid construct of claim 6, 7, 8 or 9, wherein said at least one nucleotide position which is mutated as compared to SEQ ID NO: 6 is at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC).

26. The isolated polynucleotide of claim 1, 2, 3 or 4, or the nucleic acid construct of claim 6, 7, 8 or 9, wherein said at least one nucleotide position which is mutated as compared to SEQ ID NO: 6 is at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG).

27. The isolated polynucleotide of claim 1, 2, 3 or 4, or the nucleic acid construct of claim 6, 7, 8 or 9, wherein said at least one nucleotide position which is mutated as compared to SEQ ID NO: 6 is at least one nucleotide of the wild type M4 sequence set forth by SEQ ID NO:46 (CATTC) and at least one nucleotide of the wild type M5 sequence set forth by SEQ ID NO:47 (CAATG).

28. The isolated polynucleotide or the nucleic acid construct of claim 25, 26 or 27, wherein said isolated polynucleotide comprises at least one copy of said wild type M6 set forth by SEQ ID NO:49 (GGGTG).

29. The isolated polynucleotide or the nucleic acid construct of claim 25, 26 or 27, wherein said isolated polynucleotide comprises at least one copy of said wild type M7 sequence set forth by SEQ ID NO:50 (ACTTT).

30. The isolated polynucleotide or the nucleic acid construct of claim 25, 26 or 27, wherein said isolated polynucleotide comprises at least one copy of said wild type M6 set forth by SEQ ID NO:49 (GGGTG) and at least one copy of said wild type M7 sequence set forth by SEQ ID NO:50 (ACTTT).

31. The isolated polynucleotide or the nucleic acid construct of claim 25, 26 or 27, wherein said at least one nucleotide position which is mutated as compared to SEQ ID NO: 6 is at least one nucleotide of the wild type M6 set forth by SEQ ID NO:49 (GGGTG).

32. The isolated polynucleotide or the nucleic acid construct of claim 25, 26 or 27, wherein said at least one nucleotide position which is mutated as compared to SEQ ID NO:6 is at least one nucleotide of the wild type M7 set forth by SEQ ID NO:50 (ACTTT).

33. The isolated polynucleotide or the nucleic acid construct of claim 25, 27 or 28, wherein said at least one nucleotide position which is mutated as compared to SEQ ID NO: 6 is at least one nucleotide of the wild type M6 set forth by SEQ ID NO:49 (GGGTG) and at least one nucleotide of the wild type M7 set forth by SEQ ID NO:50 (ACTTT).

34. The isolated polynucleotide or the nucleic acid construct of any of claims 25-33, wherein said isolated polynucleotide comprises at least one copy of said wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC).

35. The isolated polynucleotide or the nucleic acid construct of any of claims 25-33, wherein said isolated polynucleotide comprises at least one copy of said wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT).

36. The isolated polynucleotide or the nucleic acid construct of any of claims 25-33, wherein said isolated polynucleotide comprises at least one copy of said wild type M8 sequence set forth by SEQ ID NO:52 (GCTTC) and at least one copy of said wild type M3 sequence set forth by SEQ ID NO:54 (CTTTT).

37. A method of decreasing expression of an expressible nucleic acid sequence of interest in cells of a subject, comprising expressing in cells of a subject the nucleic acid construct of claim 34, 35 or 36, wherein said heterologous polynucleotide comprises the expressible nucleic acid sequence of interest, thereby increasing expression of the expressible nuclei acid sequence in the cells of the subject.

38. The method of claim 37, wherein said cell is an endothelial cell and wherein said at least one mutation is in said at least one nucleotide of wild type M4 sequence set forth by SEQ ID NO:46 (CATTC) and/or in said at least one nucleotide of wild type M5 sequence set forth by SEQ ID NO:47 (CAATG).

39. The isolated polynucleotide of claim 1, 2, 3 or 4, the nucleic acid construct of claim 6, 7, or 8, or the method of claim 9, wherein said cells express endothelin.

40. The isolated polynucleotide of claim 5 or the nucleic acid construct of any of claims 6-9, wherein said second polynucleotide comprises said wild type M7 sequence and said wild type M8 sequence (SEQ ID NO:52).

41. The isolated polynucleotide of claim 5 or the nucleic acid construct of any of claims 6-9, wherein said second polynucleotide comprises said wild type M7 sequence and a wild type M9 sequence set forth by SEQ ID NO:766 (CTGGA).

42. The isolated polynucleotide of claim 5 or the nucleic acid construct of any of claims 6-9, wherein said second polynucleotide comprises said wild type M8 sequence (SEQ ID NO:52) and a wild type M9 sequence set forth by SEQ ID NO:766 (CTGGA).

43. The isolated polynucleotide of claim 5 or the nucleic acid construct of any of claims 6-9, wherein said second polynucleotide comprises said wild type M7 sequence, wild type M8 sequence and a wild type M9 sequence set forth by SEQ ID NO:766 (CTGGA).

44. A pharmaceutical composition comprising the isolated polynucleotide of any of claims 1-5, 9, 15-23 and 25-43, or the nucleic acid construct of any of claims 6- 13, 15-23 and 25-43, and a pharmaceutically acceptable carrier.