WO2013139479A1

WO2013139479A1 - New diagnostic markers of specific chronic myelomonocytic leukemia (cmml)

Info

Publication number: WO2013139479A1
Application number: PCT/EP2013/000852
Authority: WO
Inventors: Nathalie Droin; Eric Solary
Original assignee: Institut Gustave Roussy (Igr)
Priority date: 2012-03-21
Filing date: 2013-03-21
Publication date: 2013-09-26

Abstract

The present invention relates to a method for determining the prognosis of a subject suffering from CMML, which comprises the step of determining the presence of CD14-/CD24+/CD15+ cells in the PBMC fraction of said subject and wherein the presence of said cells in the PBMC fraction is indicative of a poor prognosis; to a composition for treating such a specific CMML; to a method for diagnosing a chronic myelomonocytic leukemia (CMML) associated with an increased level of immunosuppressive CD14-/CD24+/CD15+ cells in a subject, which comprises the steps of (i) determining the level of expression of dokl and dokl gene(s) in a biological sample from said subject, and (ii) comparing said level of expression of dokland dok2 genes in said biological sample with its normal level of expression; wherein an under- expression of dokland dok2 genes is associated with CMML; and to a kit for diagnosing such a CMML in a subject comprising at least two nucleic acid probes or oligonucleotides or at least two antibodies, which can be used in a such a method.

Description

NEW DIAGNOSTIC MARKERS OF SPECIFIC CHRONIC

MYELOMONOCYTIC LEUKEMIA (CMML)

This international patent application claims the priority of European patent application EP 12002011.0 and of provisional application US61/613,545 both filed on March 21 , 2012, and which are herein incorporated by reference.

FIELD OF THE INVENTION

The present invention relates to new identified genetic markers to diagnose specific chronic myelomonocytic leukemia (CMML), more a CMML with an increased content in immature granulocytes having an immunosupressor activity, which immunosupressor activity induces a disappearance of autologous lymphocytes activated with anti-CD3 and anti-CD28 antibodies through cell-cell contact and by inhibiting macrophagic differentiation through alpha-defensin secretion.

BACKGROUND OF THE INVENTION

Hematopoiesis is maintained by a hierarchical system where hematopoietic stem cells (HSCs) give rise to multipotent progenitors, which in turn differentiate into all types of mature blood cells. Clonal stem-cell disorders in this system lead to Acute Myeloid Leukemia (AML), Myeloproliferative Neoplasms (MPNs), Myelodysplastic Syndromes (MDS) and Myelodysplastic/Myeloproliferative disorders.

Among these disorders, myelodysplastic/myeloproliferative neoplasms include four myeloid diseases grouped in 1999 by the WHO: chronic myelomonocytic leukemia (CMML), juvenile myelomonocytic leukemia (JMML), atypical chronic myeloid leukemia (aCML) and unclassified myelodysplastic/myeloproliferative syndromes (U- MDS/MPS).

Concerning CMML, its four defining features include an absolute monocytosis of >1X10⁹/L, the absence of Philadelphia chromosome or BCR-ABL fusion gene or a fusion gene that include PDGFRb gene (e.g. TEL-PDGFRb fusion gene), a percentage of blast cells in the bone marrow lower than 20%, and a variable degree of dyplasia in all three lineages. Myeloblasts and promonocytes comprise less than 5% of nucleated cells in peripheral blood. Roughly half of patients present with an elevated white cell count that is commonly associated with hepatomegaly and splenomegaly, the so-called myeloproliferative form of the disease. Patients lacking these features are generally considered to have the myelodysplastic form of the disease.

Recent reports suggest frequent mutations in TET2, ASXL1, RUNX1/AML1 and SRSF2 genes (30-50% of patients), less frequent mutations in CBL, c-CBL, K-RAS or N-RAS (15-30%) and rare mutations in IDH1, IDH2, JAK2 and FLT3 (less that 10%). SUMMARY OF THE INVENTION

The invention is based on the discovery by the present inventors that the DOK1 and DOK2 genes are under-expressed in some CMML patients associated with an unusual monocytic fraction, which fraction comprises in immature granulocytes (CD 14- CD24+ CD 15+). Thus, dokl and/or dokl can be used as markers for diagnosing this specific

CMML patients' subgroup.

These immature granulocytes presents a cell contact immunosupressor activity, which is based on a ROS-dependent mechanism. Consequently, these immature granulocytes can be qualified of Myeloid-derived suppressor cells (MDSC). The inventors established that said cells, more than simple markers, are critical in the evolution of the disease, since patients presenting more than 20% of their PBMC content corresponding to such MDSC cells have a bad prognosis. This result shows that this new cell population is involved in the evolution of the disease and is correlated to prognosis and overall survival. The identification of this new CMML patients' subgroup with MDSC enables to envisage new therapies {See NAJJAR & FINKE, Front. Oncol, vol.3 (49), 2013) based on: 1) Promoting differentiation of said immature MDSCs into mature, non suppressive cells. Such MDSC differentiation can be obtained by using all- trans retinoic acid (ATRA, LEI et al, PloS One., vol.8(l): e53479), vitamin D or ultra-low doses of paclitaxel (MICHELS et al, J. Immunotoxicol, vol.9(3), p:292-300, 2012).

2) Decreasing MDSC levels by using, as an example, curcumin (TU et al, Cancer Prev Res (Phila). Vol.5(2), p:205-15, 2012), Gemcitabine (LE et al, Int. Immunopharmacol, vol.9, p:900-909, 2009), 5-Fluorouracil (VINCENT et al, Cancer Res., vol.70, p:3052-3061, 2010, .or sunitinib (XIN et al, Cancer Res., vol. 69(6), p:2506-13, 2009).

3) Functionaly inhibiting MDSCs using ROS inhibitors such as CDDO-Me (2- cyano-3,12-dioxooleana-l,9-dien-28-oic acid; NAGARAJ et al, Clin. Cancer Res., vol.l6(6), p: 1812-23, 2010), crizotinib (a TKI having ROS inhibitor capacities), histamine (See. International Patent application WO 02/033050) or deferoxamine (See. International Patent application WO 2007/067567)..

The inventors have also established that an increased expression of the dokl and/or dok2 gene after three cycles of the drug in patients suffering from CMML predicts a positive response of said patient to a DNA methyltransferase inhibitor therapy (decitabine). In a first object, the present invention relates to an in vitro method for determining the prognosis of a subject suffering from CMML, which comprises the step of determining the presence of CD14-/CD24+/CD15+ cells in the PBMC fraction of said subject and wherein the presence of said cells in the PBMC fraction is indicative of a poor prognosis. More specifically, said CD14-/CD24+/CD15+ cells are also CD 16-, HLA-DR^low and CD1 lb+. Said CD14-/CD24+/CD15+ cells correspond to MDSCs.

A PBMC fraction with more than 1%, preferably more than 10%, and more preferably more than 20%, of CD14-/CD24+/CD15+ cells is indicative of a CMML with a poor prognosis. The present invention further relates to an in vitro method for diagnosing a CMML associated with an increased level of immunosuppressive CD 14- /CD24+/CD15+ cells in a subject, which comprises the steps of:

(i) determining the level of expression of the dokl and/or dok2 gene(s) in a biological sample obtained from said subject,

(ii) comparing said level of expression of the dokl and/or dok2 gene(s) e in said biological sample with its normal level of expression; wherein an under-expression of the dokl and/or dok2 gene(s) is indicative of CMML.

Said human CD14-/CD24+/CD15+ immature CMML granulocytes inhibit autologous CD3⁺ lymphocytes activation in a contact dependent manner and inhibit macrophage differentiation of monocytes through alpha-defensin secretion.

In a first preferred embodiment, said CMML associated with an increased level of immunosuppressive CD14-/CD24+/CD15+ cells corresponds to a subject having a PBMC fraction with more than 1%, preferably more than 10%, and more preferably more than 20%, of CD14-/CD24+/CD15+ cells.

As demonstrated by the inventors, such particular CMML is associated with a poor prognosis.

Still preferably, the biological sample is a blood or bone marrow sample.

In a second preferred embodiment, said method comprises the step (i) of determining the level of expression of the dokl and/or dok2 gene(s) in monocytes and/or immature granulocytes subset(s) of said biological sample.

Still advantageously, the normal level of expression of the dokl and/or dok2 gene(s) is the level of expression of said genes in a control sample corresponding to a biological sample of non-tumoral cells.The present invention further relates to a composition for treating a subject suffering from such a CMML associated with an increased level of immunosuppressive CD14-/CD24+/CD15+ cells comprising a compound that: i) promotes the differentiation of said cells; ii) promotes the decrease of said cells; and/or iii) inhibits the immunosupressor activity of said cells.

The present invention also relates to a method for treating a subject suffering from such a CMML associated with an increased level of immunosuppressive CD 14- /CD24+/CD15+ cells comprising the steps of administrating to said subject an effective amount of a compound that: i) promotes the differentiation of said cells; ii) promotes the decrease of said cells; and/or iii) inhibits the immunosupressor activity of said cells; eventually associated with a pharmaceutically acceptable carrier.

The present invention further relates to an in vitro method for monitoring a DNA methyltransferase inhibitor treatment in a patient suffering from CMML and being diagnosed for an under-expression of the dokl and/or dokl gene(s) before treatment, said method comprising the steps of:

(i) determining the level of expression of the dokl and/or dok2 gene(s) in a biological sample obtained from said subject during or after said treatment,

(ii) comparing said level of expression of the dokl and/or dokl gene(s) in said biological sample obtained during or after the treatment with the level of expression of the dokl and/or dokl gene(s) determined before treatment, wherein an increased level of expression of the dokl and/or dokl gene(s) after treatment compared to the level determined before treatment is indicative of the efficiency of the DNA methyltransferase inhibitor treatment in said subject.

The invention further relates to a kit for diagnosing chronic myelomonocytic leukemia (CMML) associated with an increased level of immunosuppressive CD 14- /CD24+/CD15+ cells in a subject comprising at least one nucleic acid probe or oligonucleotide or at least one antibody, which can be used in a method as disclosed previously, for determining the level of expression of the dokl and/or dok2 gene(s).

BRIEF DESCRIPTION OF THE DRAWINGS

The drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.

The Figure 1 shows that mice deficient for DOK1/DOK2 have more CD24+/Grl+ cells in their blood with aging.

The Figure 2 shows that Dokl ^Dol^^7" mice exhibit a myeloproliferative disease with granular hyperplasia when they are aging.

The Figure 3 shows that granulocytic cells (Ly6G+) isolated from Dokl^{" "}Dok2^{" "} mice have immunosuppressive properties.

The Figure 4 shows that the expression study of DOK1 and DOK2 is decreased in some CMML patients. The Figure 5 shows that the expression of DOK1 and/or DOK2 genes is decreased in monocytes (CD 14+) and immature granulocytes (CD 14-) in some patients with CMML.

The Figure 6 shows that CMML patients accumulate immature granulocytes with a suppressor effect on T cells. The Figure 7 shows that that the immunosuppressive activity of immature granulocytes is ROS mediated.

The Figure 8 shows overall survival (OS) and progression-free survival (PFS) for the CMML patients as a function of the percentage of CD14-/CD24+ cells in the PBMC fraction. The Figure 9 shows that the expression of the DOK2 is restored after several cycle of treatment of decitabine in some patients.

The Figure 10 shows the methylation pattern of the DOK2 promoter in one CMML patient with low DOK2 mRNA level at inclusion (4a) and after 3 (4b) and 6 (4c) cycles of decitabine. DETAILED DESCRIPTION OF THE INVENTION

Consequently, a first object of the present invention relates to an in vitro method for determining the prognosis of a subject suffering from CMML, which comprises the step of determining the presence of CD14-/CD24+/CD15+ cells in the PBMC fraction of said subject and wherein the presence of said cells in the PBMC fraction is indicative · of a poor prognosis.

As demonstrated by the inventors said CD14-/CD24+/CD15+ cells enables to identify a specific CMML patients' subgroup.

More specifically, said CD14-/CD24+/CD15+ cells are also CD 16-, HLA-DR^,0W and CDl lb+. The inventors also demonstrate for the first time that such CMML patients' subgroup comprises Myeloid-derived suppressor cells (MDSC).

A PBMC fraction with more than 1%, preferably more than 10%, and more preferably more than 20%, of CD14-/CD24+/CD15+ cells is indicative of a CMML with a poor prognosis. In a second object, the present invention relates to an in vitro method for diagnosing a CMML associated with an increased level of immunosuppressive CD 14- /CD24+/CD15+ cells in a subject, which comprises the steps of:

(i) determining the level of expression of the dokl and/or dok2 gene in a biological sample obtained from said subject,

(ii) comparing said level of expression of the DOKl and/or DOK2 gene in said biological sample with its normal level of expression; wherein an under-expression of the dokl and/or dok2 gene is indicative of such CMML.

In fact, the inventors clearly established that said increased level of immunosuppressive CD14-/CD24+/CD15+ cells is associated to both dokl (P=0.007) and dok2 (P=0.039) genes under-expression. The term "dokl gene", also known as p62DOK, MGC 1 17395 or MGC 138860, refers to a gene encoding a DOKl protein ("docking 1 protein" or "downstream of tyrosine kinase 1") which is a part of a signal transduction pathway downstream of receptor tyrosine kinase. The DOKl gene or protein can be from any source, but typically is a mammalian (e.g., human and non- human primate) DOKl, particularly a human DOKl . An exemplary human native DOKl amino acid sequence is provided in GenPept database under accession number NP 001372 (SEQ id n°l) and an exemplary human native DOK2 nucleotide sequence is provided in GenBank database under accession number NM_001381 (SEQ id n°2).

The term "dok2 gene", also known as p56DOK or p56DOK-2, refers to a gene encoding a DOK2 protein ("docking 2 protein" or "downstream of tyrosine kinase 2") which is constitutively tyrosine phosphorylated in hematopoietic progenitors isolated from chronic myelogenous leukemia (CML) patients in chronic phase. The DOK2 gene or protein can be from any source, but typically is a mammalian (e.g., human and non- human primate) DOK2, particularly a human DOK2. An exemplary human native DOK2 amino acid sequence is provided in GenPept database under accession number NP 003965 (SEQ id n°3) and an exemplary human native DOK2 nucleotide sequence is provided in GenBank database under accession number NM 003974 (SEQ id n°4).

As used herein, the term "subject" refers to a mammal, preferably a human. According to the invention, said subject may be healthy, but the method of the invention is particularly useful for testing a subject thought to develop or to be predisposed to developing chronic myelomonocytic leukemia (CMML) associated with an increased level of immunosuppressive CD14/CD24+/CD15+ cells.. In that case, the method of the invention enables to confirm that said subject develops or is predisposed for developing CMML.

As used herein, the expression "biological sample" refers to solid tissues such as, for example, a bone marrow biopsy, a splenoctomy or any tissue biopsy in case of cell infiltration; and to fluids and excretions such as for example, blood, serum or plasma. Preferably, said biological sample is a blood, bone marrow sample or any tissue biopsy in case of cell infiltration, preferably a blood or bone marrow sample.

Advantageously, the method of the invention comprises the step (i) of determining the level of expression of the dokl and/or dokl gene in the monocytes and/or immature granulocytes subset(s) of said biological sample, preferably in the monocytes subset of said biological sample. The term "monocytes" refers to a type of leukocytes (representing about 3 to 8% of total leukocytes) produced by the bonne marrow from haematopoietic stem cell precursors called monoblasts. Classical monocytes are characterized by a high expression level of the CD 14 cell surface receptor (CD 14+ cells).

The term "granulocytes" refers to a type of leukocytes characterized by the presence of granules in their cytoplasm. Granulocytes are also characterized by a high expression level of the CD24 cell surface receptor (CD24+ cells).

Said monocytes and immature granulocytes may be selected by well known methods in the art (such as flow cytometry) using the specific surface markers expressed on the cells (CD 14 and CD24 respectively). As used herein, the "under-expression" of the dokl and/or dok2 gene occurs when the transcription and/or the translation of said gene is lower than the standard error of the assay employed to assess expression, and is preferably at least 50% inferior to the normal level of expression of said gene, preferably at least 75% inferior to the normal level of expression of said gene, and most preferably at least 85% inferior to the normal level of expression of said gene.

As used herein, the "normal level of expression" of the dokl and/or D dok2 gene is the level of expression of said gene in a control sample corresponding to a biological sample of non-tumoral cells, preferably in the monocytes and/or granulocytes subset(s) of said biological sample of non-tumoral cells, most preferably in the monocytes subset of said biological sample of non-tumoral cells. Said biological sample of non-tumoral cells can be simply obtained, as an example, from a healthy subject such as by purification of peripheral blood monocytes sorted from a healthy donor blood sample. Said normal level of expression is assessed in a control sample and preferably is the average expression level of said gene in several control samples.

Methods for analysing the expression of a gene are well known for the man skilled in the art.

In a particular embodiment of the invention, the level of expression of the dokl and/or dok2 gene is assessed by determining the level of expression of its mRNA transcript or mRNA precursors, such as nascent RNA, of said gene.

Such analysis can be assessed by preparing mRNA/cDNA from cells in a biological sample from a subject, and hybridizing the mRNA/cDNA with a reference polynucleotide. The prepared mRNA/cDNA can be used in hybridization or amplification assays that include, but are not limited to, Southern or Northern analyses, polymerase chain reaction analyses, such as quantitative PCR (TAQMAN), and probes arrays such as GENECHIPTM DNA Arrays (AFFYMETRIX).

Advantageously, the analysis of the expression level of mRNA transcribed from the dokl and/or dok2 gene(s) involves the process of nucleic acid amplification, e. g., by RT-PCR (the experimental embodiment set forth in U. S. Patent No. 4,683, 202), ligase chain reaction (BARANY, Proc. Natl. Acad. Sci. USA, vol.88, p: 189-193, 1991), self sustained sequence replication (GUATELLI et al., Proc. Natl. Acad. Sci. USA, vol.87, p: 1874-1878, 1990), transcriptional amplification system (KWOH et al., 1989, Proc. Natl. Acad. Sci. USA, vol.86, p: 1173-1177, 1989), Q-Beta Replicase (LIZARDI et al., Biol. Technology, vol.6, p: 1197, 1988), rolling circle replication (U. S. Patent No. 5,854, 033) or any other nucleic acid amplification method, followed by the detection of the amplified molecules using techniques well known to those of skill in the art. These detection schemes are especially useful for the detection of nucleic acid molecules if such molecules are present in very low numbers. As used herein, amplification primers are defined as being a pair of nucleic acid molecules that can anneal to 5' or 3 'regions of a gene (plus and minus strands, respectively, or vice-versa) and contain a short region in between. In general, amplification primers are from about 10 to 30 nucleotides in length and flank a region from about 50 to 200 nucleotides in length. Under appropriate conditions and with appropriate reagents, such primers permit the amplification of a nucleic acid molecule comprising the nucleotide sequence flanked by the primers.

In another particular embodiment, the expression of the dokl and/or dok2 gene is assessed by determining the level of expression of the DOK1 and/or DOK2 protein.

Such analysis can be assessed using an antibody (e.g., a radio-labelled, chromophore-labelled, fluorophore-labelled, or enzyme-labelled antibody), an antibody derivative (e.g., an antibody conjugate with a substrate or with the protein or ligand of a protein of a protein/ligand pair (e.g., biotin-streptavidin)), or an antibody fragment (e.g., a single-chain antibody, an isolated antibody hypervariable domain, etc.) which binds specifically to the protein translated from DOK1 and/or DOK2. Said analysis can be assessed by a variety of techniques well known by one of skill in the art including, but not limited to, enzyme immunoassay (EIA), radioimmunoassay (RIA), Western blot analysis and enzyme linked immunoabsorbant assay (ELISA).

Polyclonal antibodies can be prepared by immunizing a suitable animal, such as mouse, rabbit or goat, with the DOK1 and/or DOK2 protein or a fragment thereof (e.g., at least 10 or 15 amino acids). The antibody titer in the immunized animal can be monitored over time by standard techniques, such as with an ELISA using immobilized polypeptide. At an appropriate time after immunization, e.g., when the specific antibody titers are highest, antibody producing cells can be obtained from the animal and used to prepare monoclonal antibodies (mAb) by standard techniques, such as the hybridoma technique originally described by KOHLER and MILSTEIN (Nature, vol.256, p:495- 497, 1975), the human B cell hybridoma technique (KOZBOR et al., Immunol., vol.4, p: 72, 1983), the EBV- hybridoma technique (COLE et al., In Monoclonal Antibodies and Cancer Therapy, Alan R. Liss,Inc, p: 77-96, 1985) or trioma techniques. The technology for producing hybridomas is well known (see generally Current Protocols in Immunology, COLIGAN et al. ed., John Wiley & Sons, New York, 1994). Hybridoma cells producing the desired monoclonal antibody are detected by screening the hybridoma culture supernatants for antibodies that bind the polypeptide of interest, e.g., using a standard ELISA.

Monoclonal antibodies directed against DOK1 protein are well known from the skilled person such as the antibodies commercialized by ABCAM, ABGENT, ACRIS ANTIBODIES, ABNOVA CORPORATION, etc. Monoclonal antibodies directed against DOK2 protein are well known from the skilled person such as the antibodies commercialized by ABCAM, ABGENT, ACRIS ANTIBODIES, ABNOVA CORPORATION, CELL SIGNALLING TECHNOLOGY, GENETEX, etc.

A third object of the invention relates to a composition for treating a subject suffering from such a CMML associated with an increased level of immunosuppressive CD14-/CD24+/CD15+ cells comprising a compound that: i) promotes the differentiation of said cells; ii) promotes the decrease of said cells; and/or iii) inhibits the immunosupressor activity of said cells; eventually associated with a pharmaceutically acceptable carrier.

In fact, the inventors have shown for the first time that said CMML patients comprise a fraction of MDSC, which fraction is implicated in the disease progression. The identification of such immunosuppressive fraction associated with the fact that solid tumors expressing similar fractions have been successfully treated enables to predict that said specific CMML patients can be treated with similar protocols.

Such compounds can be simply identified by the skilled person. As an example of such compounds, one can cites the ones disclosed in NAJJAR & FINKE, (abo vementioned, 2013).

As an example of a compound that promotes the differentiation of MDSC, one can cites all-trans retinoic acid (ATRA), vitamin D or paclitaxel.

As an example of a compound that promotes the decrease of MDSC, one can cites curcumin, Gemcitabine, 5-Fluorouracil or sunitinib

As an example of a compound that inhibits the immunosupressor activity of MDSC, one can cites ROS inhibitors such as CDDO-Me (2-cyano-3,12-dioxooleana- l,9-dien-28-oic acid), crizotinib, histamine or deferoxamine.

A CMML associated with an increased level of immunosuppressive CD 14- /CD24+/CD15+ cells corresponds to a subject having a PBMC fraction with more than 1%, preferably more than 10%, and more preferably more than 20%, of CD 14- /CD24+/CD15+ cells.

The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that are physiologically tolerable and do not typically produce an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a human. Preferably, as used herein, the term "pharmaceutically acceptable" means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans. The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which the compound is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water or aqueous solution saline solutions and aqueous dextrose and glycerol solutions are preferably employed as carriers, particularly for injectable solutions. Suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by E.W. Martin.

A forth aspect of the invention relates to a method for treating a subject suffering from such a CMML associated with an increased level of immunosuppressive CD 14- /CD24+/CD15+ cells comprising the steps of administrating to said subject an effective amount of a compound that: i) promotes the differentiation of said cells; ii) promotes the decrease of said cells; and/or iii) inhibits the immunosupressor activity of said cells; eventually associated with a pharmaceutically acceptable carrier. Such compound is as previously described.

According to the present invention, an "effective amount" of a composition is one which is sufficient to achieve a desired biological effect, in this case i) inducing the differentiation of MDSC, ii) the decrease of MDSC and/or, iii) the inhibition of the immunosupressor activity of said MDSCs. It is understood that the effective dosage will be dependent upon the age, sex, health, and weight of the subject, kind of concurrent treatment, if any, frequency of treatment, and the nature of the effect desired. The ranges of effective doses provided below are not intended to limit the invention and represent preferred dose ranges. However, the preferred dosage can be tailored to the individual subject, as is understood and determinable by one of skill in the art, without undue experimentation.

A fifth object of the invention relates to an in vitro method for monitoring a DNA methyltransferase inhibitor treatment in a patient suffering from such a CMML associated with an increased level of immunosuppressive CD14-/CD24+/CD15+ cells and being diagnosed for an under-expression of the dokl and/or dokl gene(s) before treatment, said method comprising the steps of:

(ii) comparing said level of expression of the dokl and/or dokl gene(s) in said biological sample obtained during or after the treatment with the level of expression of dokl and/or dokl gene(s) determined before treatment, wherein an increased level of the dokl and/or dokl gene(s) after treatment compared to the level determined before treatment is indicative of the efficiency of the DNA methy transferase inhibitor treatment for said subject.

Advantgeously, said method is for further determining the prognosis of said patient, wherein an increase of the expression of dokl and/or of dok2 genes is correlated to a good prognosis.

In a particular embodiment, the invention relates to an in vitro method for monitoring a DNA methyltransferase inhibitor treatment in a patient suffering from CMML and being diagnosed for an under-expression of dok2gem before treatment, said method comprising the steps of:

(i) determining the level of expression of the dokl gene in a biological sample obtained from said subject during or after said treatment,

(ii) comparing said level of expression of the dok2 gene in said biological sample obtained during or after the treatment with the level of expression of the dok2 gene determined before treatment, wherein an increased level of the dok2 gene after treatment compared to the level determined before treatment is indicative of a positive response of the subject to the DNA methyltransferase inhibitor treatment.

According to the invention, the method comprises the step (i) of determining the level of expression of the dokl and/or dok2 gene(s) in the monocytes and/or immature granulocytes subset(s) of said biological sample.

Preferably, said DNA methyltransferase inhibitor is decitabine.

A sixth object of the invention relates to a kit for diagnosing such a CMML associated with an increased level of immunosuppressive CD14-/CD24+/CD15+ cells in a subject comprising at least one nucleic acid probe or oligonucleotide or at least one antibody, which can be used in a method as disclosed previously, for determining the level of expression of the dokl and/or dok2 gene(s). Preferably, the oligonucleotide is at least one PCR primer, preferably a set of PCR primers is provided, which allows amplifying the dokl and/or dok2 gene(s) or a fragment thereof. The skilled person readily provides such an oligonucleotide or set of PCR primers which allows amplifying a region of the dokl and/or dok2 gene(s), provided that the nucleic acid sequence of dokl and/or dokl gene(s) is well known.

In a preferred embodiment, the kit comprises at least the PCR primer pair: CCAAGCTCGGGTGAAGGA (SEQ id n°5) and GTGGCACAGCGTAGTCATCAGT (SEQ id n°6) for determining the level of expression of the DOK1 gene.

In another preferred embodiment, the kit comprises at least the PCR primer pair: GGCAGTGAAACAAGGCTTCTTG (SEQ id n°7) and CGAAGCGGCGCCATT (SEQ id n°8) for determining the level of expression of the DOK2 gene.

In another preferred embodiment, the kit comprises at least the both PCR primer pair SEQ id n°5-6 and SEQ id n°7-8 for determining the level of expression of the dokl and dok2 genes respectively. As used herein, the term "kit" refers to any delivery system for delivering materials. In the context of reaction assays, such delivery systems include systems that allow for the storage, transport, or delivery of reaction reagents (e.g., oligonucleotides, enzymes, etc. in the appropriate containers) and/or supporting materials (e.g., buffers, written instructions for performing the assay etc.) from one location to another. For example, kits include one or more enclosures (e.g., boxes) containing the relevant reaction reagents and/or supporting materials. As used herein, the term "fragmented kit" refers to delivery systems comprising two or more separate containers that each contains a subportion of the total kit components. The containers may be delivered to the intended recipient together or separately. For example, a first container may contain an enzyme for use in an assay, while a second container contains oligonucleotides. The term "fragmented kit" is intended to encompass kits containing Analyte specific reagents (ASR's) regulated under section 520(e) of the Federal Food, Drug, and Cosmetic Act, but are not limited thereto. Indeed, any delivery system comprising two or more separate containers that each contains a subportion of the total kit components are included in the term "fragmented kit." In contrast, a "combined kit" refers to a delivery system containing all of the components of a reaction assay in a single container (e.g., in a single box housing each of the desired components). The term "kit" includes both fragmented and combined kits.

The present kits can also include one or more reagents, buffers, hybridization media, nucleic acids, primers, nucleotides, probes, molecular weight markers, enzymes, solid supports, databases, computer programs for calculating dispensation orders and/or disposable lab equipment, such as multi-well plates, in order to readily facilitate implementation of the present methods. Enzymes that can be included in the present kits include nucleotide polymerases and the like. Solid supports can include beads and the like whereas molecular weight markers can include conjugatable markers, for example biotin and streptavidin or the like.

In one embodiment, the kit is made up of instructions for carrying out the method described herein for diagnosing a myeloid cancer in a subject. The instructions can be provided in any intelligible form through a tangible medium, such as printed on paper, computer readable media, or the like.

EXAMPLES

The following examples describe some of the preferred modes of making and practicing the present invention. However, it should be understood that the examples are for illustrative purposes only and are not meant to limit the scope of the invention.

1) Increased CD24⁺/Grl⁺ cells in the blood of Dokl^{' '}Dok2^{' '} mice

The inventors have analysed the expression of Grl and CD24 markers in the blood of two control mice and two Dokl^Dol^^7" mice at 3, 6 and 12 months by FACS analysis. The Figure 1 A shows an example of the expression of Grl and CD24 markers in the blood of two control mice and two Dokl^{" "}Dok2^{" "} mice at 3, 6 and 12 months.

Figure IB shows the evolution of total CD24+ Grl+ double positive cells in the blood of control and Dok ^"Dok2^{" "} mice with aging at 3 (controls: n = 5; Dokl^Dol^^": n = 5); 6 (controls: n = 4; Dokl^{" "}Dok2^{" "}: n = 5) and 12 months (controls: n = 5; Dokl^{" "} Dok2^{_ "}: n = 5). The median is represented by a black line. /

The results show that the Dokl^^'Dol^^7" mice have increased CD24+/Grl+ cells in their blood with aging. 2) Increased CDl Ib⁺/Lv6-G⁺ cells in the blood of Dokr ^'Dok2^{' '} mice

The inventors further analysed by FACS the expression of monocytes (CDl lb + Ly6C +), granulocytes (SSC, Ly6G +) and myeloid (CDl lb + Grl +) markers in the blood of Dokl T>okr ^" mouse of 22 months.

The figure 2A shows an example of comparison of the expression of monocytic markers (CDl lb + Ly6C +), granulocytes markers (SSC, Ly6G +) and myeloid markers (CDl lb + Grl +) in the blood of one control mouse and one Dokl^"/"Dok2^"/" mouse of 22 months.

The figure 2B, C and D show the total leukocytes, granulocytes and monocytes G/L population by age at 4-6 months (controls: n - 14; Dokl^{" "}Dok2^{" "}: n = 10); 9-12 months (Dokl^Dol^^7": n = 18) and 18-22 months (controls: n = 9; Dokl^"/"Dok2^"/": n = 8) respectively. The median is represented by a black line. (EO: eosinophils; PN:

polynuclear; MONO: monocytes.)

The results indicate that Dokl^" ok2^{" "} mice exhibit a myeloproliferative disease with granular hyperplasia when they are aging 3) Increased suppressor granular cells in Dokl^{" "}Dok2^"/" mice

In functional assay, the inventors used spleen cells from OT-1 mice, which have CD8+ T cells expressing a transgenic TCR recognizing the peptide SIINFEKL.

CD8+ T cells were purified from said mice with CD8 microbeads (MILTENYI BIOTEC) and stained 10 minutes with CFSE (Carboxyfluorescein diacetate succinimidyl ester) (1 μΜ in PBS) at 37°C, then washed 3 times in complete medium. CD8+ cells were cultured with specific peptide SIINFEKL (BACHEM) (10 μ^ιηΐ) in the presence of Grl+ cells isolated from control or Dokl-/-Dok2-/- mice (GrlWT abd GrlDKO, respectively) (1 :1 ratios). Three days later, proliferation of OT-1 cells was evaluated with CFSE dilution by flow cytometry.

The figure 3 A shows the stimulation of CSFE loaded OT-I cells in presence of wt or Dokl^{" "}Dok2^"/" Gr cells. The figure 3 B and C illustrate the proliferation of autologous T cells labeled with CFSE, cultured alone or in presence of an equivalent amount of monocytic cells (Ly6C +) or granulocytic cells (Ly6G +) sorted by flow cytometry from bone marrow of control (B) or Dokl ok2 ^" (C) mice of 22 months. The peak corresponding to the number of T cells on day 0 is not shown for clarity. Top: the peak corresponding to the number of T cells at day 2 cultured alone (black) is overlaid with the one corresponding to T cells at day 2 cultured in presence of monocytic cells (Ly6C +) or granulocytic cells (Ly6G +) (blue). The fluorescence intensity is represented on the abscissa, the number of cells on the ordinate. Bottom: cells are represented at day 2 according to their size (horizontal axis) and their granularity (y axis), the absolute number is the number of living cells in the window corresponding to T cells.

The results show that the induction of T cells proliferation is impaired in the presence of the Grl⁺ cells from the Dokl^"/"Dok2^{" "} mice.

4) Decreased monocytes dokl and/or dok2 gene expression observed in some CMML patients Similarities between the Dokl^{" "}Dok2^"/" mice phenotvpe (i.e. presence of a immature granulocytes) and the phenotype of some CMML patients, incited the inventors to analysed the expression of dokl and dok2 genes in said patients.

The inventors thus studied the expression level of messenger RNA by RT-qPCR (normalized to the gene L32) of DOK1 and DOK2 in CD14 + cells (niRNA was extracted from purified monocytes of healthy donors) of 152 patients suffering from CMML, which expression was compared to the average value obtained from 15 normal subjects.

The figure 4 shows the observed DOK1 and DOK2 mRNA expression level in group #1 DOK1 and DOK2 low, ·; group #2 DOK1 low, O group #3 DOK2 low, ®; group #4 DOKl and DOK2 normal, ·. Median (black bar) is expressed in relative mR A expression units (average value with standard deviation,♦).

The results show that four CMML patients distinct groups can be identified and corresponding to dokl/dok2 low (37.5%), dokl low (11.8%), dok2 low (32.2%) and normal (18.5%).

5) Confirmed decreased of dokl and/or dok2 gene expression in some CMML patients having immature granulocytes

The inventors have next studied the mRNA and protein expression levels of the dokl and dok2 genes in monocytes and immature granulocytes of some patients. The analysis of dokl and dok2 transcripts expression was carried out by RT- qPCR (normalized to the gene L32) in CD14⁺ and CD 14^" (n = 4) compared with CD 14 ⁺ cells from normal subjects (n = 3).

For the protein analysis, the proteins extracted from human monocytes and immature granulocytes were denaturated by boiling in LAEMMLI buffer then separated by SDS-PAGE and electro-blotted to nitrocellulose membranes. Membranes were blocked in IX PBS-T (0.1%) and BSA (5%) (blocking buffer) during lh at room temperature. Membranes were incubated with the primary antibody (DOKl or DOK2, CELL SIGNALING) diluted in the blocking buffer at 4°C overnight. Then, the membranes were washed three times in IX PBS-T (0.1%) during 10 min each. Secondary antibodies conjugated with horseradish peroxidase were added, and the membranes were incubated at room temperature during lh. Membranes were then washed three times in IX PBS-T (0.1%) during 10 min each. ECL Western blotting reagent kit (MILLIPORE) was used for protein detection. Equivalent loading of lanes was controlled by Ponceau Red Stain and the use of an anti-BCL-XL antibody (SANTA CRUZ BIOTECHNOLOGY).

The figure 5 shows the dokl and dok2 transcripts expression in cells of different healthy donors (1, 2 and 3) and in duplicate in some CMML patients (i.e., 432, 428, 440 and 441). For the 440 and 441 CMML patients, the obtained expression of DOKl and DOK 2 protein in CD14⁺ and CD 14^" cells is shown as compared to the Bcl-X protein (control).

The results confirm the observed decreased of dokl and/or dok.2 transcripts expression level observed in some CMML patients. The results further established that this transcripts decrease correlates with DOK1 and/or DOK2 protein decrease in the same monocyte and immature granulocytes. Thus, dokl and/or dok2 genes can be used as markers for said "some" CMML patients comprising a fraction of immature granulocytes (CD 14-, CD 15+, CD 16-, CD24+, HLA-DR^low).

6) Some CMML patients accumulate immature granulocytes with a suppressor effect on T cells.

The inventors have previously shown in some CMML patients in sorted monocyte cells the presence of two cell populations, monocytes and also immature granulocytes, that can be hardly distinguished on regular blood smears (DROIN et al, Blood, vol.1 15(1), p:78-88, 2010). 2 x 10⁵ CD3⁺ T cells from two distinct CMML patients and labeled with CFSE were activated during one day with immobilized anti-CD3 (^g/ml) and anti-CD28 (^g/ml) antibodies in the presence or absence of 2 x 10⁵ autologous CD147CD24⁺ cells in transwell or in co-culture. The obtained proliferation was then determined by flow cytometry for these two distincts patients. The figure 6 A and B show for the CMML1 and CMML2 patients respectively the T cell proliferation induction in the absence of autologous CD147CD24⁺ cells, or in the presence of said CD147CD24⁺ cells in transwell or in co-culture. The fluorescence intensity is represented on the abscissa, the number of cells on the ordinate. The peak corresponding to the number of T cells at day 1 cultured alone (grey) is overlaid with the one corresponding to T cells at day 1 cultured in presence of immature granulocyte (CD 14-) in a transwell (middle panel) or in co-culture (right panel). For patient #2 (CMML#2): cells are represented at day 1 according to their size (horizontal axis) and their granularity (y axis), the absolute number is the number of living cells in the window corresponding to T cells. The results show that the CD3⁺ CMML lymphocytes loaded with CFSE and stimulated with anti-CD3/28 antibodies disappeared when incubated with immature granulocytes compared with lymphocytes alone (Figure 6 A and B). Moreover, this immunosuppression requires cell-cell contact since immature granulocytes incubated in an upper insert have no effect (Figure 6 A and B).

Thus, the inventors established that these immature granulocytes are MDSCs, which cells are probably critical in the evolution of the disease.

7) This immunosuppression is mediated through ROS production

The suppressive function of these CD14-/CD24+ immature granulocytes was measured by their ability to inhibit the proliferation of autologous T cells.

Fresh CD3+ T cells isolated from PBMCs of autologous CMML patients by anti-CD3 microbeads (MILTENYI BIOTEC) were CFSE labelled (INVITROGEN) and seeded in 96-well or 24-well plates respectively at 2 x 10⁵ or 1 x 10⁶ cells per well. CD14-/CD24+ cells were added to these labelled lymphocytes at 1 : 1 ratio. T cell stimulation was provided by anti-CD3/CD28 antibodies (EBIOSCIENCE). For each patient, T cells were cultured in presence of CD3/CD28 stimulation, in presence or not of CD 14- /CD24+ cell with or without NAC, a ROS inhibitor.

Suppression assay wells were then analysed by flow cytometry for proliferation of T cells after 2 or 3 days. A total of 10,000 events per sample were collected and data were analysed using FLOWJO software.

The figure 7 shows the percentage of alive lymphocytes in the presence of immature granulocytes with or without ROS inhibitor. Activated lymphocytes were arbitrary put at 100% of living cells and the percentage of living cells was calculated in accordance. The results show that human CD14-/CD24+ immature CMML granulocytes inhibit autologous CD3+ lymphocytes activation in a ROS-dependent manner.

8) The MDSCs fraction is a prognosis marker

The inventors determined, in a series of 110 CMML patients, the percentage of CD14-/CD24+ cells ranging from 0 to 95%.

This first determination step identified a median level of expression of 20%, which was used as a cut off for determining the potential impact of this MDSC The Overall survival (OS) for the patients was defined as the time between inclusion onset and death. Univariate analyses were performed with the log-rank test and Cox model for dichotomic and continuous variables. Statistical analysis was performed on STATA Version 10 and R Version 2.10.1 software packages.

The figure 8A shows the OS for the CMML patients as a function of the percentage of CD14-/CD24+ cells in the PBMC fraction.

The figure 8B then shows the PFS for the CMML patients as a function of the percentage of CD14-/CD24+ cells in the PBMC fraction.

9) The results established that this cell fraction, when present, is critical so as to determine the prognosis of the patient, with a severely decreased OS and

PFS for the CMML patients having a percentage of CD14-/CD24+ cells in their PBMC fraction superior to 20%.Dok2 expression is restored in some CMML patients after several cycles of decitabine treatment.

The inventors further determined the dok2 expression in CMML patients treated with decitabine and with different prognostic.

Dok2 gene expression was determined by quantitative PCR analysis as previously in monocytes from CMML patients at inclusion and after 3 and 6 cycles of decitabine treatment. The peripheral blood mononuclear cells were selected from CMML patient before AutoMacs negative selection for monocyte enrichment. Side/forward scatters were analyzed by flow cytometry at inclusion and after 3 and 6 cycles of decitabine. The response to the treatment has been scored as following: 5: complete response; 1 : stable disease and 0: progression.

The figure 9 shows the dok2 transcript expression in the peripheral blood monocytes for CMML patients at the inclusion, after 3 and 6 decitabine cycles treatment for two well responsive patients (i.e. Score 5, A and B), one low-responsive patient (i.e., Score 1, C) and one non-responsive patient (i.e., Score 0, D).

The results show that interestingly, two CMML patients expressing initially a very low dok2 level and who achieved a complete remission after 3 and 6 cycles of decitabine treatment harbored a normal DOK2 expression in their sorted peripheral blood (PB) monocytes (Figure 9 A and B). The results confirm this correlation on one other CMML patient expressing a very low dok2 transcript level and who is with a stable disease. In fact, said patient harbored a dok2 re-expression in his sorted PB monocytes after 3 cycles of decitabine, but is down-regulate after 6 cycles (Figure 9 C). Finally, one CMML patient expressing a very low DOK2 level and who is in progression disease never re-expressed DOK2 mRNA after treatment (Figure 9 D). It should be further noticed that the decitabine treatment induced a partial disappearance of the immature granulocyte population except in the patient that does not respond.

Finally, the results have shown that the dok2 expression can be used as a marker of response to decitabine in CMML patients. 10) Dok2 is an epigenetically regulated gene in CMML patients.

So as to determine the methylation level of the dok2 gene in the CMML patients before and after decitabine treatment, the sequence of said gene was determined before and after said treatment using bisulfite sa as t identified methylated cytosine.

The figure 10 shows the obtained sequence for the CMML patient described previously in Figure 9A at the inclusion (4a) and after 3 (4b) or 6 (4c) decitabine cycle treatment.

The results show that the methylation pattern of said gene is seriously impaired in said CMML patient and established that the dok2 gene is epigenetically regulated.

Claims

1. An in vitro method for determining the prognosis of a subject suffering from CMML, which comprises the step of determining the presence of CD 14- /CD24+/CD15+ cells in the PBMC fraction of said subject and wherein the presence of said cells in the PBMC fraction is indicative of a poor prognosis.

2. The method of claim 1, wherein said CD14-/CD24+/CD15+ cells are also CD 16-, HLA-DR^low and CD1 lb+.

3. The method of claim 1, wherein said CD14-/CD24+/CD15+ cells are Myeloid derived suppressor Cells (MDSCs).

4. A composition for treating a subject suffering from such a CMML associated with an increased level of immunosuppressive CD14-/CD24+/CD15+ cells comprising a compound that:

i) promotes the differentiation of said cells;

ii) promotes the decrease of said cells; and/or

iii) inhibits the immunosupressor activity of said cells;

eventually associated with a pharmaceutically acceptable carrier.

5. The composition of claim 4, wherein said compound that promotes the differentiation of MDSC is selected in the group comprising all-trans retinoic acid (ATRA), vitamin D and paclitaxel.

6. The composition of claim 4, wherein said compound that promotes the decrease of MDSC is selected ine the group comprising curcumin, Gemcitabine, 5-Fluorouracil and sunitinib.

7. The composition of claim 4, wherein said compound that inhibits the immunosupressor activity of MDSC is a ROS inhibitor selected in the group comprising CDDO-Me (2-cyano-3,12-dioxooleana-l,9-dien-28-oic acid), crizotinib, histamine and deferoxamine.

8. An In vitro method for diagnosing a CMML associated with an increased level of immunosuppressive CD14-/CD24+/CD15+ cells in a subject, which comprises the steps of:

(ii) comparing said level of expression of the dokl and/or dokl gene(s) e in said biological sample with its normal level of expression;

wherein an under-expression of the dokl and/or dokl gene(s) is indicative of such CMML.

9. The in vitro method of claims 8, wherein said biological sample is selected in the group comprising solid tissues such as bone marrow biopsy, a splenoctomy or any tissue biopsy in case of cell infiltration; fluids and excretions such as blood, serum or plasma.

10. The in vitro method of any one of claims 8 or 9, wherein said biological sample is a blood or bone marrow sample.

11. The in vitro method of any one of claims 8 to 10, which comprises the step (i) of determining the level of expression of the dokl and/or dok.2 gene(s) in the monocytes and/or immature granulocytes subset(s) of said biological sample.

12. An in vitro method for monitoring a DNA methyltransferase inhibitor treatment in a patient suffering from CMML associated with an increased level of immunosuppressive CD14-/CD24+/CD15+ cells and being diagnosed for an under- expression of the dokl and/or dokl gene(s) before treatment, said method comprising the steps of:

(i) determining the level of expression of the dokl and/or dokl gene(s) in a biological sample obtained from said subject during or after said treatment,

(ii) comparing said level of expression of the dokl and/or dok2 gene(s) in said biological sample obtained during or after the treatment with the level of expression of the dokl and/or dok2 gene(s) determined before treatment,

wherein an increased level of expression of the dokl and/or dokl gene(s) after treatment compared to the level determined before treatment is indicative of the efficiency of the DNA methyltransferase inhibitor treatment in said subject.

13. The in vitro method of claim 12, said method comprising the steps of:

(i) determining the level of expression of the dokl gene in a biological sample obtained from said subject during or after said treatment, (ii) comparing said level of expression of the dokl gene in said biological sample obtained during or after the treatment with the level of expression of the dokl determined before treatment,

wherein an increased level of expression of the DOK2 after treatment compared to the level determined before treatment is indicative of a positive response of the subject to the DNA methyltransferase inhibitor treatment.

14. The in vitro method of any one of claims 12 or 13, wherein said biological sample is a blood sample or a bone marrow sample.

15. The in vitro method of any one of claims 12 to 14, which comprises the step (i) of determining the level of expression of the dokl and/or dok2 gene(s) in the monocytes and/or immature granulocytes subset(s) of said biological sample.

16. A kit for diagnosing chronic myelomonocytic leukemia (CMML) associated with an increased level of immunosuppressive CD14-/CD24+/CD15+ cells in a subject comprising at least one nucleic acid probe or oligonucleotide or at least one antibody, which can be used in a method as disclosed previously, for determining the level of expression of the dokl and/or dok2 gene(s).

17. The kit of claim 16, said kit comprising at least the primers pair comprises CCAAGCTCGGGTGAAGGA (SEQ id n°5) and

GTGGCACAGCGTAGTCATCAGT (SEQ id n°6) for determining the level of expression of the dokl gene.

18. The kit of any one of claims 16-17, said kit comprising at least the PCR primer pair: GGCAGTGAAACAAGGCTTCTTG (SEQ id n°7) and

CGAAGCGGCGCCATT (SEQ id n°8) for determining the level of expression of the dokl gene. The kit of any one of claims 16-18, said kit comprising at least the both PCR primer pair SEQ id n°5-6 and SEQ id n°7-8 for determining the level of expression of the dokl and dok2 genes respectively.