WO2014033314A1

WO2014033314A1 - Antisense oligonucleotide targeting bacterial glucosyltransferases

Info

Publication number: WO2014033314A1
Application number: PCT/EP2013/068153
Authority: WO
Inventors: Dan Ericson; Tomas KACERGIUS
Original assignee: Uab Bioseka
Priority date: 2012-09-03
Filing date: 2013-09-03
Publication date: 2014-03-06

Abstract

The present invention provides isolated antisense oligonucleotides (ASO) and methods for reducing, preventing or inhibiting biofilm formation such as biofilm in the oral cavity. The present invention further provides compositions such as pharmaceutical compositions comprising said ASO.

Description

ANTISENSE OLIGONUCLEOTIDE TARGETING BACTERIAL GLUCOSYLTRANSFERASES

All patent and non-patent references cited in the present application, are hereby incorporated by reference in their entirety.

Technical Field

The present invention relates to the field of bacterial biofilm formation in the oral cavity and dental caries. More specifically it relates to oral care and inhibition, reduction or prevention of biofilm formation in the oral cavity, as well as compositions relating thereto.

Background of the Invention

Oral care is the subject of intense scrutiny and relates to two aspects; a cosmetic aspect as well as a health aspect relating biofilm associated diseases as dental caries and periodontitis. Dental caries has a high worldwide prevalence despite the availability of fluoride toothpastes, water fluoridation, dental sealants, oral health educational programs and various antiseptic mouth rinses. One important reason for this is uncontrolled increase in consumption of foods containing considerable sucrose concentration, especially among children.

A human mouth contains around 500 species of bacteria that form an ecosystem in the oral cavity. While some of the bacteria in our mouths are harmful and can cause serious disease, much of our oral bacteria are actually beneficial in preventing disease. Streptococci make up a large part of oral bacteria. There are four main phylogenetic units within oral streptococci: mutans, salivarius, anginosus, and mitis groups.

Only a few specific species of bacteria are directly associated with dental caries in man: Streptococcus mutans, Streptococcus sobrinus and Lactobacillus species are considered most important. Bacteria accumulate around the teeth and gums because they build a sticky, creamy-coloured biofilm called plaque on teeth surfaces. For efficient bacterial colonization of surfaces, the bacteria primarily need to adhere to teeth and form biofilm (dental plaque). In this initial process, mutans group streptococci (especially S. mutans) take the essential part by generating sticky glucan polymers. Dietary sucrose is a nutrient for oral bacteria (mostly streptococci) that metabolize it in a process called fermentation thereby producing acids. If the acids are left in contact with a tooth these acids may cause demineralization and, subsequently, cause tooth decay or dental caries. The main structural and binding material of biofilm is a glucan polymer synthesized by several isoforms of glucosyltransferase (Gtf) enzyme present in certain species of oral bacteria, including mutans group streptococci: Streptococcus mutans, S. sobrinus, S. downei and S. criceti.

Dental caries continues to be one of the most prevalent human diseases in spite of various available prophylactic means. Thus, there is a need to improve oral care and dental health and to decrease tooth decay. Several approaches targeting oral health and decreasing tooth decay have been exhaustively researched for several years. For example US20060029618 provides a vaccine that consists of extracellular proteins from the cariogenic bacteria S. sobrinus and S. mutans used as preventive or therapeutic measures of dental caries when administered intra-nasally, orally or subcutaneously.

Several approaches targeting prevention of biofilm formation in the oral cavity have been explored. For example, WO 2006/60903 provides isolated polypeptides capable of inhibiting S. mutans genetic competence and S. mutans biofilm formation for the treatment and prevention of conditions caused by dental plaque associated

streptococci.

Koga et al in Molecular microbiology and immunobiology of Streptococcus mutans (Cellular, Molecular and Clinical Aspects of Streptococcus mutans, Proc. Int. Conf. (1986) pg 1 1 1 -120) proposes that S. mutans adhere to tooth surfaces by sucrose- independent and sucrose-dependent mechanism. The sucrose-dependent adherence of S. mutans and S. sobrinus can be inhibited using various glucosyltransferase inhibitors, such as deoxynojirimycin, tris(hydroxymethyl)aminomethane, high- molecular-weight plant polyphenols, apigenin, cetylpyridinium chloride, alexidine dihydrochloride and triclosan as reviewed by Bowen and Koo in Biology of Streptococcus mutans-derived glucosyltransferases: role in extracellular matrix formation of cariogenic biofilms (Caries Res 45 (201 1 ), pg 69-86).

Guo et al provides in Treatment of Streptococcus mutans with antisense

oligodeoxyribonucleotides to gtfB mRNA inhibits GtfB expression and function (FEMS Microbial Lett 264 (2006), pg 8-14) phosphorothioate-modified antisense

oligodeoxyribonucleotides targeted to mRNA transcribed from gtfB which encodes synthesis of water-insoluble glucans in S. mutans. Biofilm formation and GtfB activity is reduced after antisense treatment compared to control. However, the biofilm inhibitory capacity elicited by this molecule is not particularly efficient. There is thus a need in the art for novel biofilm inhibitory agents with improved efficacy.

Summary of the Invention

As discussed herein above, there is a need to develop means and methods for improving oral care and decrease tooth decay in particular relating to biofilm forming bacteria in the oral cavity. Accordingly, the present invention provides means and methods to address such needs and interests relating to oral care and dental health, particularly in relation to biofilm-induced oral diseases as dental caries. In a main aspect, the present invention relates to an isolated antisense oligonucleotide (ASO) selected from the group consisting of:

a) an ASO comprising the sequence of SEQ ID NO: 1 or 13

b) a fragment of SEQ ID NO 1 or 13, and

c) an ASO having at least 85% sequence identity to SEQ ID NO 1 or 13,

wherein said ASO or fragment thereof comprises between 8 and 400 nucleotides.

In another aspect the present invention provides an isolated ASO, comprising the sequence according to any of SEQ ID NO: 1 or SEQ ID NO: 13, or parts or fragments or any biologically active variant thereof. Particularly, the isolated ASO may be wherein said ASO is the sequence as specified in SEQ ID NO: 1 or wherein said ASO is the sequence as specified in SEQ ID NO: 13.

In further embodiments, the isolated ASO are wherein said part or fragment thereof is selected from the group consisting of SEQ ID NO: 4-12. Further aspects are wherein the ASO described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof, are for medical and/or veterinary use. Thus, further aspects include wherein an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof, is for use in reducing, preventing or inhibiting biofilm formation, particularly cariogenic biofilm formation. Particularly, said ASO are for use in reducing, preventing and/or inhibiting biofilm formation wherein said biofilm is in the oral cavity.

In a further embodiment the biofilm formation is present on an oral implant

In a further embodiment the antisense oligonucleotide describes herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof, are for use in preventing and/or treating an oral disease or disorder linked to biofilm and plaque formation in the oral cavity.

Even further aspects are wherein an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof, is for use in preventing, inhibiting and/or reducing dental caries.

Further aspects include a composition comprising an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof, and a pharmaceutical acceptable adjuvant and/or carrier. Said composition may in further embodiments be an oral composition.

Said pharmaceutical acceptable carrier may in one embodiment be a cationic polymer, e.g. the TurboFect™ in vivo transfection reagent (US 2010/0041739A1 ).

Further aspects include a pharmaceutical composition comprising an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof and a pharmaceutical acceptable adjuvant and/or carrier. Further aspects include a composition or a pharmaceutical composition comprising an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof for medical and/or veterinary use. Further aspects include a composition or a pharmaceutical composition comprising an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof for use in reducing, preventing or inhibiting biofilm formation. Particularly, the use in reducing, preventing and/or inhibiting biofilm is wherein said biofilm is in the oral cavity.

Further aspects include wherein a composition as described herein or a

pharmaceutical composition as described herein comprising an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof for use in preventing, inhibiting and/or reducing dental caries.

Further aspects include an oral care product comprising an ASO comprising an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof, or a composition as described herein or a pharmaceutical as described herein. Said oral care product may be wherein said oral care product is selected from the group consisting of a dentifrice, such as a tooth paste, a mouth wash, a mouth spray, a mouth rinse, dental floss, a mouth gel, a tooth powder, dental varnish, a prophylaxis paste, a filling, e.g. a dental filling, such as an root canal filling, an impregnated tooth-pick or interdental brush, a lozenge, and a gum. In particular, said oral care product comprising an ASO comprising an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof, a composition or a pharmaceutical composition as described herein may be a dentifrice, such as a tooth paste. Said oral care product comprising an ASO comprising an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof, a composition or a pharmaceutical composition as described herein may further be a mouth wash. Said oral care product comprising an ASO comprising an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof, a composition or a pharmaceutical composition as described herein may further be a being a filling, such as a root canal filling.

Further aspects also include a kit comprising an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof, a composition or a pharmaceutical composition, a container comprising said ASO, and optionally instructions for its use.

Further aspects include a method of inhibiting, reducing and/or preventing biofilm formation on a solid surface or in the oral cavity, said method comprising administering an effective dose of an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof, a composition or a pharmaceutical composition as described herein. A method of treating, reducing and/or preventing dental caries, said method comprising

administering an effective dose of an effective dose of an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof, a composition or a pharmaceutical composition as described herein.

Brief Description of the Drawings

Fig 1 shows the fragment of nucleotide sequence SEQ ID NO: 14, i.e.5'- UCUGUUAAGAUUAAGCAAUGGUCUGCCAAGUACUUUAAUGGGACAAAUAUUUUA GGGCGCGGAGCAGGCUAUGUCUUAAAAGA-3', in the original output of Mfold program on predicting S. mutans gtfB mRNA secondary structure model with the delineated binding site. As seen in this model, the location contains bulge loop which consists of unpaired nucleotides (5'-UAAGCA-3'), pointing out that the selected ASO can be a strong competitor in the formation of heteroduplex. Symbols " " and Ύ mean connection between appropriate nucleotides, and they are used for better representation of bulge and hairpin loops, respectively. The region of gtfB mRNA shown in Fig 1 begins from 3049 nt, and the delineated binding site begins from 3056 nt, that is, the same as in gtfB gene of S. mutans (see Example 1 ). Fig 2 shows optical profile of the glass slides with S. mutans biofilm after 24 h of incubation under different treatments in TH broth containing 1 % sucrose. A - biofilm under treatment with AS01 + TurboFect^™; B - biofilm under treatment with AS02 + TurboFect^™; C - biofilm under treatment with AS03 + TurboFect^™. Magnification, x50. Table 1 also shows the same data with cross-references in Fig 2.

Fig 3 shows optical densities of S. mutans bacteria growing in TH broth without sucrose (A) and with 1 % sucrose (B, C, D) under exposures to nuclease-free water (A, B, C), TurboFect^™ reagent (A, B) or both (B, D), and under treatments with ASOs either alone (C) or in the combination with TurboFect^™ (D) during 24 h of the total incubation time. Symbols:♦, blank;■, untreated bacteria;▲ , nuclease-free water; O,

TurboFect^™; ·, nuclease-free water + TurboFect^™; O, AS01 or AS01 + TurboFect^™; x , AS02 or AS02 + TurboFect^™; *, AS03 or AS03 + TurboFect^™.

Fig 4 shows morphology of the Gram stained S. mutans bacteria after 24 h of incubation under different treatments in TH broth. A - bacteria growing without sucrose; B - bacteria growing with 1 % sucrose; C - bacteria under treatment with AS01 + TurboFect^™ in TH broth with 1 % sucrose; D - bacteria under treatment with AS02 + TurboFect^™ in TH broth with 1 % sucrose; E - bacteria under treatment with AS03 + TurboFect^™ in TH broth with 1 % sucrose. Magnification, x 100 (oil immersion).

Fig 5 shows optical densities of S. mutans bacteria growing in TH broth without sucrose under exposures to nuclease-free water (A, B), TurboFect^™ reagent (A) or both (A, C), and under treatments with ASOs either alone (B) or in the combination with TurboFect^™ (C) during 24 h of the total incubation time. Symbols:♦, blank;■, untreated bacteria; nuclease-free water; O, TurboFect^™; ·, nuclease-free water + TurboFect^™; O, AS01 or AS01 + TurboFect^™; x , AS02 or AS02 + TurboFect^™; * , AS03 or AS03 + TurboFect^™.

Fig 6 Shows a selection of the multiple sequence alignment of the glucosyltransferase genes between various Streptococcus species and strains produced employing the MAFFT online server at The Max Planck Institute for Development Biology. The conserved target region (consisting of 26 nucleotides: 5'- GTTAAGATTAAGCAATGGTCTGCCAA-3' with SEQ ID NO: 16) is delineated in the large rectangular, and the mismatches are delineated in the small rectangles. The indicated Streptococcus species and strains:

ENA|AAN58705|AAN5870_0/1 -4431 - STREPTOCOCCUS MUTANS UA159

GLUCOSYLTRANSFERASE-I; ENA|AAN58706|AAN5870_1/1 -4368 - STREPTOCOCCUS MUTANS UA159 GLUCOSYLTRANSFERASE-SI;

ENA|D88654|D88654.1_2/1 -5684 - STREPTOCOCCUS MUTANS GENE FOR GLUCOSYLTRANSFERASE-I, COMPLETE CDS, CLONE:PYT216;

ENA|D88660|D88660.1_3/1 -5684 - STREPTOCOCCUS MUTANS GENE FOR GLUCOSYLTRANSFERASE-I, COMPLETE CDS, CLONE:PYT223;

ENA|D89977|D89977.1_4/1 -5684 - STREPTOCOCCUS MUTANS GENE FOR GLUCOSYLTRANSFERASE-I, COMPLETE CDS, CLONE:PTH1 ;

ENA|D88657|D88657.1_5/1 -5686 - STREPTOCOCCUS MUTANS GENE FOR GLUCOSYLTRANSFERASE-I, COMPLETE CDS, CLONE:PYT239;

ENA|M17361 |M17361 .1_6/1 -10029 - STREPTOCOCCUS MUTANS

GLUCOSYLTRANSFERASE (GTFB AND GTFC) GENES, COMPLETE CDS;

ENA|D88651 |D88651 .1_7/1 -5684 - STREPTOCOCCUS MUTANS GENE FOR GLUCOSYLTRANSFERASE-I, COMPLETE CDS, CLONE:PSK6;

ENA|AB299801 |AB29980_8/1 -4410 - STREPTOCOCCUS CRICETI GTFI GENE FOR GLUCOSYLTRANSFERASE, COMPLETE CDS; ENA|AB273728|AB27372_9/1 -4930 - STREPTOCOCCUS CRICETI GTFI GENE FOR GLUCOSYLTRANSFERASE, COMPLETE CDS, STRAIN: GTC242; ENA|AB355819|AB35581_10/1 -4602 - STREPTOCOCCUS DENTIROUSETTI GTFI GENE FOR

GLUCOSYLTRANSFERASE-I, COMPLETE CDS; ENA|AB275384|AB27538_1 1/1 - 5423 - STREPTOCOCCUS DENTISUIS GTFI GENE FOR

GLUCOSYLTRANSFERASE, COMPLETE CDS; ENA|AB272987|AB27298_12/1 -4984 - STREPTOCOCCUS ORISUIS GTF GENE FOR GLUCOSYLTRANSFERASE, COMPLETE CDS; ENA|D63570|D63570.1_13/1 -6838 - STREPTOCOCCUS

SOBRINUS GENE FOR GLUCOSYLTRANSFERASE GTF-I, COMPLETE CDS;

ENA|M17391 |M17391.1_14/1 -4995 - STREPTOCOCCUS DOWNEI

GLUCOSYLTRANSFERASE PRECURSOR, GENE, COMPLETE CDS. Detailed Description

Definitions

As used herein, the singular forms "a", "and", and "the" include plural referents unless the context clearly dictates otherwise.

As used herein "at least one" is intended to mean one or more, i.e. 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, etc. As used herein the term "antisense effect" means the oligonucleotide's effect which is produced after its binding to the complementary sequence within mRNA, resulting in specific inhibition of the target gene and protein expression.

As used herein antisense oligonucleotides (ASO) means agents that are unmodified or chemically modified single-stranded nucleic acid molecules (usually 15-30 nt in length), which can selectively hybridize to their target complementary sequence within mRNA through Watson-Crick base pairing. Formation of an ASO-mRNA heteroduplexes induces the effects as follows: 1 ) activates RNase H endonuclease or as in bacteria endoribonucleases - RNase III and RNase E - leading to degradation of the bound mRNA, and leaving the ASO intact; 2) causes translational arrest by steric hindrance of ribosomal activity; 3) inhibits mRNA splicing; 4) destabilizes pre-mRNA. Indeed, what effect will occur depends on the ASO chemical composition and location of

hybridization, but the subsequent result is specific down-regulation of the target gene and protein expression.

"Nucleotide sequence", "nucleic acid", "nucleic acid chain" and "nucleic acid sequence" means anything that binds or hybridizes using base pairing including oligomers or polymers having a backbone formed from naturally occurring nucleotides such as DNA (deoxyribonucleic acid) or RNA (ribonucleic acid), and/or nucleic acid analogs comprising nonstandard nucleobases and/or nonstandard backbones, e.g., a peptide nucleic acid (PNA) or locked nucleic acid (LNA), or any derivatized or modified form of a nucleic acid, including modifications to increase stability, binding effectiveness and resistance to nucleases. As used herein, the term "peptide nucleic acid" or "PNA" means a synthetic oligomer or polymer having a polyamide backbone with pendant nucleobases (naturally occurring and modified), including, but not limited to, any of the oligomer or polymer segments referred to or claimed as peptide nucleic acids in, e.g., U.S. Pat. nos. 5,539,082, 5,527,675, 5,623,049, 5,714,331 , 5,718,262, 5,736,336, 5,773,571 , 5,766,855, 5,786,461 , 5,837,459, 5,891 ,625, 5,972,610, 5,986,053, 6,107,470 6,201 ,103,

6,228,982 and 6,357,163, WO96/04000, all of which are herein incorporated by reference or any of the references cited therein. The pendant nucleobase, such as, e.g., a purine or pyrimidine base on PNA may be connected to the backbone via a linker such as, e.g., one of the linkers taught in PCT/US02/30573 or any of the references cited therein. In one embodiment, the PNA has an /V-(2-aminoethyl)-glycine) backbone. PNAs may be synthesized (and optionally labeled) as taught in

PCT/US02/30573 or any of the references cited therein. PNAs hybridize tightly, and with high sequence specificity, with DNA and RNA, because the PNA backbone is uncharged. Thus, short PNA probes may exhibit comparable specificity to longer DNA or RNA probes. PNA probes may also show greater specificity in binding to

complementary DNA or RNA.

As used herein, the term "locked nucleic acid" or "LNA" means an oligomer or polymer comprising at least one or more LNA subunits. As used herein, the term "LNA subunit" means a ribonucleotide containing a methylene bridge that connects the 2'-oxygen of the ribose with the 4'-carbon. See generally, Kurreck in Antisense technologies.

Improvement through novel chemical modifications (Eur J Biochem 270 (2003), pg 1628-1644).

Examples of nucleic acids and nucleic acid analogs for the embodiments herein to be used as ASO in isolated forms also include oligomers and polymers of nucleotide monomers, including double and single stranded deoxyribonucleotides (DNA), ribonucleotides (RNA) including naturally occurring antisense RNA molecules such as microRNAs (miRNAs) and small interfering RNAs (siRNAs) found in eukaryotic cells as well as small antisense RNAs found in prokaryotic cells (bacteria), a-anomeric forms thereof, natural and synthetic analogs thereof, and the like. The nucleic acid chain may be composed entirely of deoxyribonucleotides, ribonucleotides, peptide nucleic acids (PNA), locked nucleic acids (LNA), natural or synthetic analogs thereof such as phosphorodiamidate morpholino and thiophosphoroamidate oligonucleotides, or mixtures thereof. DNA, RNA, or other natural or synthetic nucleic acids as defined herein can be used in the methods and compositions of the invention.

"Sequence identity" as used herein should be understood as the person skilled in the art would understand the term. The determination of percent identity between two sequences can be accomplished using a mathematical algorithm. A preferred, non- limiting example of a mathematical algorithm utilized for the comparison of two sequences is the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264-2268, modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877. Such an algorithm is incorporated into the BLASTN and BLASTP programs of Altschul, et al. (1990) J. Mol. Biol. 215: p. 403-410.

In order to characterize the identity, subject sequences are aligned so that the highest order homology (match) is obtained. Based on these general principles, the "percent identity" of two nucleic acid sequences may be determined using the BLASTN algorithm (Tatiana A. Tatusova, Thomas L. Madden (1999): Blast 2 sequences - a new tool for comparing protein and nucleotide sequences; FEMS Microbiol. Lett. p. 174 247-250), which is available from the National Center for Biotechnology Information (NCBI) web site (http://www.ncbi.nlm.nih.gov), and using the default settings suggested here (i.e. Reward for a match = 1 ; Penalty for a mismatch = -2; Strand option = both strands; Open gap = 5; Extension gap = 2; Penalties gap x_dropoff = 50; Expect = 10; Word size = 1 1 ; Filter on). The BLASTN algorithm determines the % sequence identity in a range of overlap between two aligned nucleotide sequences. Another preferred, non-limiting example of a mathematical algorithm utilized for the comparison of sequences is the CLUSTAL W (1 .7) alignment algorithm (Thompson, J.D., Higgins, D.G. and Gibson, T.J. (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions- specific gap penalties and weight matrix choice. Nucleic Acids Research, 22: p. 4673- 4680.). CLUSTAL W can be used for multiple sequence alignment of DNA sequences. When calculating sequence identities, CLUSTAL W includes any gaps made by the alignment in the length of the reference sequence.

In one embodiment of the invention CLUSTAL X (2.0.12) is used for alignments.

The skilled person will now that different programs exist for alignment of sequences. In one embodiment of the invention nthe program MAFFT is used (Max-Planck Institute for Development Biology http://toolkit.tuebingen.mpg.de/mafft; accessed in March, 2009).

By "pharmaceutically acceptable," such as in the recitation of a "pharmaceutically acceptable carrier" or a "pharmaceutically acceptable adjuvant" is herein intended to mean a material that is not biologically or otherwise undesirable, i.e., the material may be incorporated into a pharmaceutical composition administered to a patient without causing any undesirable biological effects or interacting in a deleterious manner with any of the other components of the composition in which it is contained. Further, adjuvants and carriers in compositions herein are suitable for delivery to the oral cavity without causing any undesirable biological effects or interacting in a deleterious manner. Examples of suitable carriers and adjuvants are given herein and include nuclease-free water, or any reagent which forms compact, stable, positively charged complex with oligonucleotide in order to protect from degradation and facilitate better penetration of oligonucleotide to the bacterial cells, such as TurboFect^™ transfection reagent commercially available (Thermo Fisher Scientific, Fermentas).

As used herein the term "nuclease-free water" means sterile deionized water which is absent from any type of nucleases capable to degrade oligonucleotide.

As used herein the term "cariogenic biofilm" means biofilm consisting of the

polysaccharide matrix composed mostly of water-insoluble glucan and bacteria capable to metabolize dietary carbohydrates (e.g., sucrose) producing organic acids, and thereby leading to the demineralization of tooth hard tissues (enamel, dentin), that is, the tooth decay or dental caries.

As used herein, bacterial cultures are both in vivo and in vitro cultures, if not specified separately what particular type of culture is intended. Said cultures include cultures in suspension and cultures on solid phases, such as glass (example of an in vitro solid phase) or teeth (example of an in vivo solid phase) or any other solid surface in the oral cavity. Glucans

Glucans represent the polysaccharides composed of repeating glucose units which are synthesized from sucrose by the enzymatic action of glucosyltransferases (Gtfs) and can be water-insoluble, water-soluble and partly water-soluble. The glucans serve as a matrix for the biofilm with several functions: 1 ) enhance bacterial adherence and further accumulation on teeth; 2) provide structural integrity and bulk to the biofilm; 3) increase acidogenicity of the biofilm matrix.

S. mutans produces three types of the glucan polymers - water-insoluble glucan with alpha (a)-1 ,3 glucosidic linkages, partly water-soluble glucan containing a mixture of a- 1 ,3 and a-1 ,6 glucosidic linkages as well as water-soluble glucan with a-1 ,6 glucosidic linkages, which are synthesized by GtfB, GtfC and GtfD enzymes, respectively. There are three genes - gtfB, gtfC and gtfD that codes for GtfB, GtfC and GtfD enzymes, accordingly.

The target region sequences of gtfB, gtfC genes and mRNAs in S. mutans (strain UA159) as well as the glucosyltransferase genes and mRNAs in various other S.

mutans strains, S. criceti, S. dentirousetti, S. dentisuis, S. orisuis, S. sobrinus and S. downei are well conserved with only to two mismatched nucleotides in S. sobrinus gtfl, S. downei gtf precursor genes and mRNAs (see figure 6). This decreases the ability for bacteria to use alternate routes for synthesis of water-insoluble glucans that to build up the biofilm structure if the glucosyltransferase route is inhibited.

Antisense oligonucleotide

The present inventors have found that certain antisense oligonucleotides (ASO) are useful for inhibiting formation of biofilm. While the ASOs can have any nucleotide sequence defined herein, the invention in a main aspect concerns an isolated antisense oligonucleotide (ASO) selected from the group consisting of:

a) an ASO comprising the sequence of SEQ ID NO: 1 or 13

b) a fragment of SEQ ID NO 1 or 13, and

c) an ASO having at least 85% sequence identity to SEQ ID NO 1 or 13,

wherein said ASO or fragment thereof comprises between 8 and 400 nucleotides.

In one embodiment the isolated antisense oligonucleotide (ASO) is selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO:13. The antisense oligonucleotides of the present invention leads to inhibition of biofilm formation and thus diseases caused by biofilm formation, e.g., caries, and offers several advantages:

specific and simultaneous suppression of the expressed gtf mRNA in mutans group streptococci (S. mutans, S. sobrinus, S. downei, S. criceti) as well as in

S. dentirousetti, S. dentisuis and S. orisuis;

usage of only one identical ASOs to the same target in different streptococci (S. criceti, S. dentirousetti, S. dentisuis, S. orisuis, S. downei, S. mutans and S. sobrinus) - gtf mRNA covering several species of streptococci;

- local and direct administration of the pharmacological agents to oral cavity in order to maximize treatment effects and minimize systemic side effects.

An antisense oligonucleotide of the present invention is capable of binding

simultaneously to the complementary sequence of both glucosyltransferase B and C mRNAs in Streptococcus mutans, as well as to glucosyltransferase mRNAs in S.

criceti, S. dentirousetti, S. dentisuis, S. orisuis, S. downei, and S. sobrinus. Thereby the production of glucans is suppressed resulting in reduction of the biofilm formation, particularly cariogenic biofilm formation. Moreover, the antisense oligonucleotide prevents the bacterial aggregation and adhesion to solid surface, whereas at the same time it does not decrease the viability of bacteria. In this aspect, the provided antisense oligonucleotide can be used as anti-caries agent that does not considerably affect the existing bacterial ecosystem in mouth.

As revealed above the present invention discloses a novel technique for decreasing, preventing or inhibiting biofilm formation, such as biofilm formation from oral streptococci, e.g., S. criceti, S. dentirousetti, S. dentisuis, S. orisuis, S. downei, and particularly S. mutans biofilm formation, all on solid surfaces, e.g., glass and tooth surfaces. This technique employs administration of the effective dose of antisense oligonucleotides (ASO) to the bacterial culture in order to target and suppress simultaneously the expression of glucosyltransferase mRNAs in oral streptococci, e.g., S. criceti, S. dentirousetti, S. dentisuis, S. orisuis, S. downei, and particularly in S. mutans and S. sobrinus, such as, e.g., gtfB and gtfC glucosyltransferase mRNAs in S. mutans and gtfl mRNA in S. sobrinus, leading to inhibition of both water-insoluble and partly water-soluble glucan polymers production and bacterial cell adherence in S. criceti, S. dentirousetti, S. dentisuis, S. orisuis, S. downei, S. mutans and S. sobrinus cultures thus leading to a decrease, inhibition or prevention of biofilm formation. Said cultures may be in vitro cultures or in vivo cultures, e.g., in the oral cavity on a tooth surface. Said ASOs may be chemically synthesized phosphorothioate-modified oligodeoxyribonucleotides of the sequence corresponding to the nucleotide sequence of SEQ ID NO: 1 for exhibiting antisense effect, as in the Examples, or any of the embodiments of an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12.

In one embodiment the present invention relates to an antisense oligonucleotide capable of binding specifically and simultaneously to glucosyltransferase mRNAs in oral streptococci as outlined above, thereby inhibiting the expression of said glucosyltranferase.

According to the present invention an antisense oligonucleotide of interest consists of naturally occurring RNA and/or DNA, and/or nucleic acid analogs thereof.

Oligonucleotides are chains of nucleotides, which are composed of three parts: a phosphate backbone, a pucker-shaped pentose sugar, either ribose or deoxyribose, and one of five nucleobases. A nucleic acid analogue may have any of these altered. Typically the nucleic acid analogues confer, among other things, different base pairing and base stacking properties. Examples include universal bases, which can pair with all four canon bases, and phosphate-sugar backbone analogues such as PNA, which affect the properties of the chain (PNA can even form a triple helix). Artificial nucleic acids include peptide nucleic acid (PNA), Morpholino (also known as PMO) and locked nucleic acid (LNA), as well as glycol nucleic acid (GNA) and threose nucleic acid (TNA). Each of these is distinguished from naturally occurring DNA or RNA by changes to the backbone of the molecule.

An antisense oligonucleotide according to the invention may differ at one or more nucleotide positions from SEQ ID NO: 1 , 13 or 2-14. In one embodiment the antisense oligonucleotide differs from SEQ ID NO: 1 or 13 at up to four positions, such as at up to three positions, such as at up to two positions, such as at one position.

In one embodiment one nucleotide of SEQ ID NO: 1 or 13 has been exchanged with another nucleotide placed at the same position in SEQ ID NO: 1 or 13. In another embodiment two nucleotides of SEQ ID NO: 1 or 13 have been exchanged with two other nucleotides placed at the same positions in SEQ ID NO: 1 or 13. In another embodiment three nucleotides of SEQ ID NO: 1 or 13 have been exchanged with three other nucleotides placed at the same positions in SEQ ID NO: 1 or 13. In another embodiment four nucleotides of SEQ ID NO: 1 or 13 have been exchanged with four other nucleotides placed at the same positions in SEQ ID NO: 1 or 13.

In particular, the ASO as described herein comprises the sequences according to any of SEQ ID NO: 1 or 13 or parts or fragments thereof according to SEQ ID NO: 4-12.

Thus, for example, the ASO as given herein may be wherein said ASO is the sequence as specified in SEQ ID No 1 , or parts or fragments thereof. Parts or fragments thereof are in one embodiment 16, 17, 18 nucleotides in length from either 5'-end or 3'-end of the 19 nucleotide sequence. Thus, the ASO based on SEQ ID NO: 1 may further be parts or fragments thereof selected from the group consisting of:

5'-CAGACCATTGCTTAATCT-3' (SEQ ID NO: 4)

5 '-AG AC C ATTG CTTAATCT-3 ' (SEQ ID NO: 5)

5 -GACCATTGCTTAATCT-3' (SEQ ID NO: 6)

5'-G CAG ACCATTG CTTAATC-3 ' (SEQ ID NO: 7)

5 -GCAGACCATTGCTTAAT-3' (SEQ ID NO: 8)

5 -GCAGACCATTGCTTAA-3' (SEQ ID NO: 9)

5 -CAGACCATTGCTTAATC-3' (SEQ ID NO: 10)

5 -AGACCATTGCTTAATC-3' (SEQ ID NO: 1 1 )

5 -CAGACCATTGCTTAAT-3' (SEQ ID NO: 12)

The AS01 with SEQ ID NO: 1 is derived from the SEQ ID NO: 13, which is 100% complementary to the region of 26 nt in S. mutans gtfB, S. mutans gtfC, S. criceti gtfl, S. dentirousetti gtfl, S. dentisuis gtfl and S. orisuis gtf genes, and also with two mismatched nucleotides in S. downei gtf precursor and S. sobrinus gtfl genes (see Example 1 ). The AS01 is optimized to 19 nucleotides according to thermodynamical features to target S. mutans gtfB and gtfC, S. sobrinus gtfl mRNAs. Subsequently, the SEQ ID NO: 4-12 are derived from SEQ ID NO: 1. The AS01 with SEQ ID NO: 1 is derived from the SEQ ID NO: 13 and it is composed of 19 nt: 5 -TTG- GCAGACCATTGCTTAATCT-TAAC-3' (underlined and see Example 1 ).

Consequently, any fragment shorter than 26 nt sequence derivative from SEQ ID NO: 13 that also covers and fits in the delineated herein region of 19 nt, can provide the antisense effect as well and is part of the embodiments of this invention useful in all the means and methods described herein in all its embodiments.

In another embodiment of the present invention the antisense oligonucleotide is longer than 26 nt. Thus, in one embodiment of the present invention the antisense

oligonucleotide is at most 400 nucleotides long, such as at most 300 nucleotides long, such as at most 200 nucleotides long, such as at most 100 nucleotides long, such as at most 50 nucleotides long, such as at most 30 nucleotides long.

In one embodiment of the present invention the antisense oligonucleotide is at most 19 nucleotides long.

In another embodiment of the present invention the antisense oligonucleotides has a length between 5-400 nucleotides, such as between 6-400 nucleotides, such as between 7-400 nucleotides, such as between 8-400 nucleotides, such as between 9- 400 nucleotides, such as between 10-400 nucleotides, such as between 8-350 nucleotides, such as between 8-300 nucleotides, such as between 8-250 nucleotides, such as between 9-200 nucleotides, such as between 10-150 nucleotides, such as between 1 1 -300 nucleotides, such as between 8-100 nucleotides, such as between 8- 200 nucleotides, such as between 15-50 nucleotides, such as between 18-30 nucleotides, such as between 4-500 nucleotides, such as between 10-50 nucleotides, such as between 8-200 nucleotides, such as between 7-300 nucleotides, such as between 12-30 nucleotides, such as between 13-30 nucleotides, such as between 14- 30 nucleotides, such as between 15-35 nucleotides, such as between 16-38

nucleotides, such as between 8-40 nucleotides, such as between 9-29 nucleotides, such as between 30-400 nucleotides, such as between 50-400 nucleotides, such as between 100-400 nucleotides, such as between 200-400 nucleotides, such as between 300-400 nucleotides.

In a preferred embodiment of the present invention the antisense oligonucleotides has a length between 10-30 nucleotides, such as between 19-26 nucleotides.

Said isolated ASO herein may be isolated from a natural or native source as in a purified restriction digest, produced synthetically e.g., chemically synthesized or produced by recombinant or genetic engineering or polymerisation and amplification techniques such as e.g., polymerase chain reaction (PCR) and PCR amplification or in any other artificial way. The ASO may also be prepared by a process known in the art or any other method described herein in accordance with the present invention.

The ASO of the present invention as described herein may be anything that binds or hybridizes using base pairing including oligomers or polymers having a backbone formed from naturally occurring nucleotides and/or nucleic acid analogs comprising nonstandard nucleobases and/or nonstandard backbones e.g., a peptide nucleic acid (PNA) or locked nucleic acid (LNA), or any derivatized form of a nucleic acid, as exemplified herein. The ASO may also contain partial, such as 10, 20, 30, 40, 50, 60, 70, 80 or even 90% naturally occurring nucleotides and the rest, thus e.g., 90, 80, 70, 60, 50, 40, 30, 20, or even 10%, being nucleic acid analogues comprising non-standard nucleobases and/or nonstandard backbones as exemplified herein by PNA, LNA or any derivatized form of nucleic acid. The ASO may further be chemically modified. Such modifications may be phosphorothioate-modified oligodeoxyribonucleotides as exemplified herein. All of the sequences given herein may be chemically synthesized phosphorothioate-modified oligodeoxyribonucleotides.

Thus, specific embodiments are wherein the ASO exemplified with SEQ ID NO:s herein, such as SEQ ID NO: 1 , 13 or parts or fragments thereof such as 4, 5, 6, 7, 8, 9, 10, 1 1 or 12 and variants thereof are made of natural occurring nucleotides as described herein, such as e.g., deoxyribonucleic acids or ribonucleic acids.

Further embodiments are wherein the ASO exemplified with SEQ ID NO:s herein, such as SEQ ID NO: 1 , 13 or parts or fragments thereof such as 4, 5, 6, 7, 8, 9, 10, 1 1 or 12 and variants thereof are made of nucleotides wherein at least one of the phosphate bonds in the nucleic acids is modified into a phosphorothioate bond, e.g., for deoxyribonucleic acids or ribonucleic acids.

Phosphorothioates oligonucleotides are a variant of normal DNA in which one of the nonbridging oxygens is replaced by a sulfur. The sulfurization of the inter-nucleotide bond dramatically reduces the action of endo- and exonucleases including 5' to 3' and 3' to 5' DNA pol 1 exonuclease, nucleases S1 and P1 , RNases, serum nucleases and snake venom phosphodiesterase. In addition, the potential for crossing a lipid bilayer increases. Thus, even further embodiments are wherein the ASO exemplified with SEQ IDs herein, such as SEQ ID NO: 1 , 13 or parts or fragments thereof such as 4, 5, 6, 7, 8, 9,

10, 1 1 or 12 and variants thereof are made of nucleotides wherein at least one of the nucleotides of said ASO has a base modified to enhance binding properties and/or decreases or reduces the action of endo- and exonucleases including 5' to 3' and 3' to 5' DNA pol 1 exonuclease, nucleases S1 and P1 , RNases, serum nucleases and snake venom phosphodiesterase.

In one embodiment the present invention relates to biologically active variants of the antisense oligonucleotides mentioned herein above.

Biologically active variants within the scope of the invention in one embodiment include antisense oligonucleotides with nucleotide sequences having at least 85 per cent sequence identity to an antisense oligonucleotide having a sequence selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO:

1 1 , SEQ ID NO: 12, SEQ ID NO: 13 and SEQ ID NO: 14. More preferably the sequence identity is at least 90%, more preferably at least 95%, more preferably at least 97%, more preferably at least 99% sequence identity to an antisense oligonucleotide having a sequence selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ I D NO: 6, SEQ I D NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 1 1 , SEQ ID NO: 12, SEQ ID NO: 13 and SEQ ID NO: 14. In one embodiment an antisense oligonucleotide according to the invention has at least 85% sequence identity to SEQ ID NO: 1 .

In another embodiment an antisense oligonucleotide according to the invention has at least 85% sequence identity to SEQ ID NO: 13.

A preferred biological activity of an antisense oligonucleotide variant according to the invention is the ability to elicit substantially the same response as demonstrated for SEQ ID NO: 1 in the assay described in the Example 2.

By substantially the same response in the assay is intended that the antisense oligonucleotide variant by its specific binding is leading to at least 10% of the inhibition of both water-insoluble and partly water-soluble glucan polymers production and bacterial cell adherence in S. criceti, S. dentirousetti, S. dentisuis, S. orisuis, S. downei, S. mutans and/or S. sobrinus cultures as obtained by SEQ ID NO: 1 binding, thus leading to a decrease, inhibition or prevention of biofilm formation obtained.

More preferably, an antisense oligonucleotide variant according to the invention has the ability to generate at least 20%, more preferably at least 30%, more preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90% of the inhibition of both water- insoluble and partly water-soluble glucan polymers production and bacterial cell adherence in S. criceti, S. dentirousetti, S. dentisuis, S. orisuis, S. downei, S. mutans and/or S. sobrinus cultures as obtained by SEQ ID NO: 1 binding.

Measuring glucans may be done as described in Example 2 where profilometry results clearly show that bacterial adherence to glass surfaces are significantly reduced by the test AS01 molecule described herein. The decrease in biofilm formation indirectly indicates a reduction of glucan polymer synthesis since glucans are essential for biofilm formation and no glucans leads to no biofilm formation. However, glucan concentration in bacterial cell cultures are also measurable using other methods described by Guo et al in Treatment of Streptococcus mutans with antisense oligodeoxyribonucleotides to gtfB mRNA inhibits GtfB expression and function (FEMS Microbial Lett 264 (2006), pg 8-14) and Masuko et al in Carbohydrate analysis by a phenol-sulfuric acid method in microplate format (Anal Biochem 339 (2005) pg 69-72). Another aspect of this invention provides means to use only one type of nucleotide sequence of the ASOs in an effective amount for inhibiting the synthesis of both water- insoluble and partly water-soluble glucans in S. mutans encoded by gtfB and gtfC genes, and in S. criceti, S. dentirousetti, S. dentisuis, S. orisuis, S. downei, and S. sobrinus. The technique allows administration of ASO to the bacterial culture at effective concentration in order to cover two targets - gtfB and gtfC mRNAs in S.

mutans at the same time as well as glucosyltransferase mRNAs in S. criceti, S.

dentirousetti, S. dentisuis, S. orisuis, S. downei, and S. sobrinus. These target sequences are well conserved, and therefore it decreases the ability for bacteria to use alternate routes for synthesis of water-insoluble glucans that to build up the biofilm structure. Used ASOs may be chemically synthesized phosphorothioate-modified oligodeoxyribonucleotides of the sequence corresponding to the nucleotide sequence of SEQ ID NO: 1 for exhibiting antisense effect, or be any of the other embodiments disclosed herein, i.e. an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12. In one embodiment of the present invention antisense oligonucleotide variants as described herein above are used.

The shorter sequences (SEQ ID NO: 4-12) have the same arrangement of nucleotides (nt) as in the AS01 with SEQ ID NO: 1 . Therefore they are complementary to the determined target region within gtfB and gtfC of S. mutans as well as gtfl of S. sobrinus in terms of the genes and mRNAs. On the basis of thermodynamical features (the same as with AS01 ), these shorter fragments can also form heteroduplex with the determined region. Importantly, they are complementary and cover the bulge loop with unpaired nucleotides in the gtfB mRNA of S. mutans as it is delineated in Fig 1.

Similarly, the longer sequence (SEQ ID NO: 13) can form heteroduplex with the determined region, and it is complementary and cover the bulge loop with unpaired nucleotides in the gtfB mRNA of S. mutans as it is delineated in Fig 1. Moreover, numerous investigations in vitro and in vivo conditions presented in the literature demonstrate that the ASOs as short as 8 nt or as long as 30 nt of the same nucleotide arrangement exhibit the antisense effect, and even ASOs with one mismatched nucleotide also provide a substantial antisense effect (see references: Hamel et al in

Inhibition of gene expression by anti-sense C-5 propyne oligonucleotides detected by a reporter enzyme (Biochem J 339 (1999), pg 547-553); Wagner et al in Potent and selective inhibition of gene expression by an antisense heptanucleotide (Nat Biotechnol 14 (1996), pg 840-844); Fakler et al in Short antisense oligonucleotide-mediated inhibition is strongly dependent on oligo length and concentration but almost independent of location of the target sequence (J Biol Chem 269 (1994), pg 16187- 16194); Woolf et al in Specificity of antisense oligonucleotides in vivo (Proc Natl Acad Sci USA 89 (1992), pg 7305-7309)). The ASO herein may in further embodiments be modified in different ways. Fully phosphorothioate-modified oligodeoxyribonucleotides as shown in Example 2 may be used as ASO in different embodiments. Such phosphorothioate-modified

oligodeoxyribonucleotides differ from unmodified oligodeoxyribonucleotides in that one of the non-bridging oxygen atoms in the phosphodiester linkage is replaced by a sulfur atom. The phosphorothioate-modified oligodeoxyribonucleotides may be chemically synthesized f.ex. at the Metabion International AG (Germany) using an automated DNA synthesizer and phosphoramidite method under the standard protocols known in the art, e.g., in G. Zon, Oligonucleoside Phosphorothioates, Ed., S. Agrawal, Protocols for Oligonucleotides and Analogs: Synthesis and Properties (Methods Mol Biol 20 (1993), pg 165-189, Humana Press Inc., Totowa, NJ); Guzaev, Reactivity of 3H-1 ,2,4- diathiazole-3-thiones and 3H-1 ,2-dithiole-3-thiones as sulfurizing agents for oligonucleotide synthesis (Tetrahedron Lett 52 (201 1 ), pg 434-437); Sanghvi, A status update of modified oligonucleotides for chemotherapeutics applications (Curr Protoc Nucleic Acid Chem Suppl. 46 (201 1 ), Unit 4.1.1 -4.1 .22).

Briefly, such a synthesis consists of four-step synthetic cycles. The synthetic cycle of phosphorothioate-modified oligodeoxynbonucleotides begins with de-blocking of nucleoside attached to a solid support (glass or polystyrene bead) via the 3'-position. This first step is called detritylation, and it is intended to remove the acid-labile dimethoxytrityl-protecting group from the 5'-hydroxyl group of the support-bound nucleoside by an acid solution of dichloroacetic acid solution in dichloromethane or toluene. It is followed by the second step - coupling of the 5'-hydroxyl group of nucleoside with an incoming phosphoramidite reagent activated with 1 H-tetrazole or 4,5-dicyanoimidazole. The resultant 3', 5'-internucleoside phosphite linkage is subjected to sulfurization (the third step) with Λ/,Λ/,Λ/'Λ/'-tetraethylthiuram disulfide to give a thiono phosphotriester linkage. Alternatively, the sulfurization can be carried out using other reagents, for instance, phenylacetyl sulfide with 3-picoline, 3H-1 ,2- benzodithiol-3-one-1 ,1 -dioxide (Beaucage Reagent) or /V,/V-dimethyl-/V'-(3-thioxo-3/-/- 1 ,2,4-dithazol-5-yl)methanimidamide. During the fourth step - capping of the unreacted 5'-hydroxyl group of nucleoside is achieved with acetic anhydride and N- methylimidazole/2,6-lutidine/acetonitrile. This four-step synthesis cycle results in the addition of a single DNA base, and it is repeated until the full-length sequence is constructed. After completion of the synthesis cycles, the oligodeoxyribonucleotide remains attached to the support with all of the protecting groups intact. Therefore, in order to cleave and deprotect these base labile groups (e.g., cyanoethyl group on the phosphate triester), the solid support is treated with a solution of triethylamine in acetonitrile, and then with ammonium hydroxide. Afterwards, the solid-support is removed by filtration and the oligodeoxynbonucleotides are collected after evaporation of the ammonium hydroxide. Finally, the synthesized phosphorothioate-modified oligodeoxyribonucleotides undergo purification employing high-performance liquid chromatography (HPLC), desalting and lyophilization.

Vehicle

The ASO herein may be delivered to S. criceti, S. dentirousetti, S. dentisuis, S. orisuis, S. downei, S. mutans and S. sobrinus bacteria more effectively using a vehicle. Said vehicle may be transfection reagents or carriers and are known in the art. The skilled person will thus know the meaning of the word "transfection reagent" and "carrier" and will know how to use them. Also the person skilled in the art will know that in the antisense technology the words "carrier" and "transfection reagent" have the same meaning and are thus interchangeable. In particular, the combination of all the embodiments of ASO with carrier or transfection reagent composed of cationic polymer such as TurboFect^™ (Thermo Fisher Scientific, Fermentas) may be used in order to enhance the ASO uptake by bacteria and to effectively improve the inhibition of biofilm formation in S. criceti, S. dentirousetti, S. dentisuis, S. orisuis, S. downei, S. mutans and S. sobrinus cultures. Thus, in one particular embodiment, the ASO is SEQ ID NO: 1 which is a chemically synthesized phosphorothioate-modified

oligodeoxyribonucleotides used to inhibit biofilm formation on a solid surface such as glass or a tooth by exerting its antisense effect, or any ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or biologically active variants thereof as described in the section "antisense oligonucleotide".

Other vehicles to be used for all the embodiments of ASO as described herein for delivery to eukaryotic and prokaryotic cells represent various chemical substances that can form complexes with the "naked" oligonucleotides in order to protect them from degradation and to improve their penetration into the cells. These substances include, but not limited to, calcium salts (e.g., calcium phosphate, calcium chloride), cationic lipids (e.g., /V-(2,3-dioleyloxypropyl) N, N, /V-trimethylammonium chloride,

dioleoylphosphatidylethanolamine, cholesterol), cationic polymers (e.g.,

diethylaminoethyl dextran, polyethyleneimine, chitosan, cyclodextrin, polyamidoamine dendrimer, polypropylenimine dendrimer), cell penetrating peptides (peptides usually less than 30 amino acids; e.g., penetratin) and different types of nanoparticles as described by D. Liu et al in Chemical Methods for DNA Delivery, Ed., W. C. Heiser, Volume 1 of Gene Delivery to Mammalian Cells (Methods Mol Biol 245 (2004), pg 3-23, Humana Press Inc., Totowa, NJ); Zhu and Mahato in Lipid and polymeric carrier- mediated nucleic acid delivery (Expert Opin Drug Deliv 7 (2010), pg 1209-1226); Bai et al in Antisense antibiotics: a brief review of novel target discovery and delivery (Curr Drug Discov Technol 7 (2010), pg 76-85); Yu et al in Targeted delivery systems for oligonucleotide therapeutics (AAPS J 1 1 (2009), pg 195-203); Aalinkeel et al in

Quantum rods as nanocarriers of gene therapy (Drug Deliv 19 (2012), pg 220-231 ). All of these transfection reagents, with the exception of calcium phosphate which forms calcium-phosphate-DNA precipitates, function in a similar fashion - they form complexes with oligonucleotides via electrostatic interaction between negatively charged oligonucleotide molecules and positively charged reagent molecules. Since such complexes maintain positive charge, therefore they can bind to the negatively charged eukaryotic cell plasma membrane or bacterial cell wall, and can be taken up by the cells. The most widely used transfection reagents for the delivery of ASOs to bacterial cells are cationic polymers and cell penetrating peptides, which is usable for all the embodiments of the ASO herein as well. It is important to note that cell penetrating peptides are capable to enter into the cells not just through the electrostatic interaction but also by forming transient pores in the cellular plasma membrane. Guo et al in Treatment of Streptococcus mutans with antisense oligodeoxyribonucleotides to gtfB mRNA inhibits GtfB expression and function ( EMS Microbial Lett 264 (2006), pg 8-14) describes the efficient delivery of phosphorothioate-modified ASOs to S. mutans bacteria using a cationic polymer - So-Fast^™ (Taiyangma). In one embodiment of the present invention the commercially available transfection reagent - TurboFect^™ (Thermo Fisher Scientific, Fermentas) are used. TurboFect™ is composed of cationic polymer for delivery of the test ASO with SEQ ID NO: 1 to S. mutans bacteria, demonstrating its efficiency in our experiments (see Example 2).

In another embodiment of the present invention, a cationic polymer with properties similar to TurboFect™ is used.

Methods of treatment

The present invention in all its embodiments provides means and methods for inhibition of the biofilm formation on solid surfaces without considerably affecting viability of S. criceti, S. dentirousetti, S. dentisuis, S. orisuis, S. downei, S. mutans and S. sobrinus bacteria. These means and methods enable administration of ASO, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 and any biologically active variant thereof as described in the section "antisense oligonucleotide", to the bacterial culture using an effective concentration in order to decrease S. criceti, S. dentirousetti, S. dentisuis, S. orisuis, S. downei, S. mutans and S. sobrinus aggregation, adhesion and biofilm formation but with no bacteriostatic or bacteriocidic effects as clearly demonstrated with S. mutans in Fig 5. In another embodiment of the present invention the ASOs as described in the section "antisense oligonucleotide" is thus used for the oral health care without significant impact on the complex bacterial ecosystem in mouth. In one embodiment the ASO of SEQ ID NO: 1 is used. In another embodiment an ASO selected from the group consisting of SEQ ID NO: 1 , 13 and fragments thereof according to SEQ ID NO: 4-12 is used. As it is clearly seen in Examples 2-4 and Table 1 , Fig 2, Fig, 3, Fig 4, Fig 5 an effective concentration of the AS01 decreases S. mutans aggregation, adhesion and biofilm formation but with no bacteriostatic and bacteriocidic effects. Thus, the means and methods herein provides that any ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12, decreases S. criceti, S.

dentirousetti, S. dentisuis, S. orisuis, S. downei, S. mutans and S. sobrinus

aggregation, adhesion and biofilm formation but with no bacteriostatic or bacteriocidic effects.

Biofilms forms on any surface in the oral cavity and accumulation of biofilm can induce disease with time. By the same mechanism, biofilm form on dental implants and acccumulation can cause peri-implantitis that can lead to loss of implant. Biofilm formed on filling materials as composites, amalgam, gold, titanium, glass ionomers, ceramics etc., and can contribute to biofilm formation on adjacent tooth surfaces and cause caries, or if near gingival margin, gingivitis and periodontitis. By the same mechanism, biofilm form on dentures and accumulation can cause mucositis. In one embodiment of the present invention the ASOs as described in the section "antisense oligonucleotide" is used in the treatment and/or prevention of periodontal diseases and disorders linked to biofilm formation in the oral cavity. According to the invention such periodontal diseases and disorder linked to biofilm and plaque formation in the oral cavity such as for example caries, gingivitis, periodontitis, mucositis, peri- implantitis, Candida, prosthetic stomatitis, and endodontic infections as a consequence of caries (biofilms are also formed in root canals).

In all aspects pointed out herein, the present invention provides a novel approach to control and prevent dental caries in a mammal, such as in man, horse, cow, pig, sheep, camel, dog or cat, using the ASOs with sequence corresponding to the nucleotide sequence of SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or biologically active variants thereof for delivering antisense effect to

glucosyltransferases of S. criceti, S. dentirousetti, S. dentisuis, S. orisuis, S. downei, S. mutans and S. sobrinus. This approach renders a tool for inhibition of cariogenic biofilm formation on solid surfaces. An ASO as described herein in the section "antisense oligonucleotide", e.g. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 can be included in formulations of mouth rinses, toothpastes, oral sprays, etc., importantly providing only local and topical, but not systemic effect to a mammal, such as in man, horse, cow, sheep, pig, camel, dog or cat.

Specifically, the antisense oligonucleotides disclosed herein, i.e. an ASO as described herein in the section "antisense oligonucleotide", is capable of binding simultaneously to the complementary sequence of both glucosyltransferase B and C mRNAs in Streptococcus mutans , as well as to gucosyltransferase mRNAs in S. criceti, S.

dentirousetti, S. dentisuis, S. orisuis, S. downei, and S. sobr/^'nt/s.Thereby the production of glucans is suppressed resulting in reduction of the biofilm formation, particularly cariogenic biofilm formation. Moreover, the antisense oligonucleotide prevents the bacterial aggregation and adhesion to solid surface, whereas at the same time it does not decrease the viability of bacteria. In this aspect, the provided antisense oligonucleotide can be used as anti-caries agent that does not considerably affect the existing bacterial ecosystem in mouth.

It is thus an object of the present invention to provide means and methods to specifically inhibit biofilm formation in the oral cavity. This is performed by providing an antisense oligonucleotide molecule as described in the section "antisense

oligonucleotide" that inhibits glucan production within the selected mutans group streptococci preferably colonizing humans, i.e., S. mutans and S. sobrinus, by simultaneously targeting the gtf mRNA with one type of antisense oligonucleotide (ASO) molecule only. By "one type of antisense oligonucleotide molecule" it is herein intended to mean that one or more molecules with one type of oligonucleotide sequence only is provided and not a mixture of different antisense oligonucleotide molecules with different sequences. The molecule is, however, provided in several identical copies in an amount effective in its context. The present invention provides some few sequences of antisense oligonucleotides that have proven to work, herein denoted as ASO. Said antisense oligonucleotide sequences (ASO) will thus reduce biofilm formation in the selected mutans group of streptococci, but not reduce the number of bacteria per se, thus not affecting the micro-flora and ecosystem in the oral cavity as such. The reduction of biofilm thickness will not only reduce the acid production, but also make the thin biofilm more accessible for neutralizing salivary components.

In one embodiment of the present invention antisense oligonucleotide molecules as described in the section "antisense oligonucleotide" is provided in a mixture comprising different antisense oligonucleotides. The different antisense oligonucleotides in such a mixture should possess different targets within the selected mRNA, and they should not be complementary to each other.

Accordingly, the present invention provides a method of inhibiting, reducing or preventing biofilm formation on a solid surface f.ex. in vitro or in vivo, if in vivo the solid surface is in the oral cavity, such as a tooth, said method comprising administering an effective dose of an ASO as described herein above in the section "antisense oligonucleotide" in a composition or a pharmaceutical composition as described herein.

Also dislosed is a method of treating, reducing or preventing dental caries, said method comprising administering an effective dose of an effective dose of an ASO as described herein in the section "antisense oligonucleotide", in a composition or a pharmaceutical composition as described herein.

Thus, a further object of the present invention is to provide simultaneous targeting corresponding site of glucosyltransferase mRNA in S. mutans and S. sobrinus, as well as in S. criceti, S. dentirousetti, S. dentisuis, S. orisuis, and S. downei, with the ASO sequence 5 -GCAGACCATTGCTTAATCT-3', i.e. SEQ ID NO: 1 , which leads to complete or partial inhibition of the water-insoluble glucan production and biofilm formation. More examples are SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 and any of the biologically active variants as described in the section "antisense oligonucleotide".

Thus, one object of the present invention is to provide an isolated oligonucleotide sequence, e.g., an antisense oligonucleotide sequence (ASO) wherein said sequence, i.e. the ASO sequence, is capable of inhibiting biofilm formation in S. mutans and S. sobrinus, as well as in S. criceti, S. dentirousetti, S. dentisuis, S. orisuis, and S.

downei. One further object is to provide an isolated antisense oligonucleotide sequence (ASO) capable of inhibiting glucan production in S. mutans and S. sobrinus, as well as in S. criceti, S. dentirousetti, S. dentisuis, S. orisuis, and S. downei. In particular, the ASO capable of inhibiting biofilm formation in S. mutans and S. sobrinus, as well as in S. criceti, S. dentirousetti, S. dentisuis, S. orisuis, and S. downei, is also capable of inhibiting glucan production in S. mutans and S. sobrinus, as well as in S. criceti, S. dentirousetti, S. dentisuis, S. orisuis, and S. downei. Thus, by inhibiting the glucan production in S. mutans and S. sobrinus as well as in S. criceti, S. dentirousetti, S. dentisuis, S. orisuis, and S. downei by using the ASO as described herein leads to complete or partial inhibition of the water-insoluble glucan production and biofilm formation.

Further, the glucan production within the selected mutans group streptococci preferably colonizing humans i.e., S. mutans and S. sobrinus, as well as in S. criceti, S.

dentirousetti, S. dentisuis, S. orisuis, and S. downei. is inhibited by simultaneously targeting the gtf mRNA with one antisense oligonucleotide sequence (ASO). In particular, where the gtf mRNA is targeted with ASO described herein S. mutans gtfB gene, herein also indicated as gtfl gene, S. mutans gtfC gene, herein also indicated as gtfSI gene, and S. sobrinus gtfl gene is included. Medical and veterinary use

A further object of the present invention is to provide ASO as described herein for medical and/or veterinary use. Thus, the ASO as described herein, i.e. the ASO sequence, is capable of inhibiting biofilm, particularly oral biofilm formation, such as biofilm formation from oral streptococci, e.g., S. criceti, S. dentirousetti, S. dentisuis, S. orisuis, S. downei, and particularly in S. mutans and S. sobrinus. , the ASO exemplified with SEQ IDs herein, such as SEQ ID NO: 1 , 13 or parts or fragments thereof such as 4, 5, 6, 7, 8, 9, 10, 1 1 or 12 and variants thereof as described in the section "antisense oligonucleotide", e.g. chemically synthesized phosphorothioate-modified oligodeoxyribonucleotides, are in a further object provided for medical and/or veterinary use.

Thus, in one aspect, the ASO described herein is for use in reducing, preventing and inhibiting biofilm formation, particularly cariogenic biofilm, on a solid surface such as glass or a tooth, caused by oral streptococci as described above. Further aspects are uses of the ASO described herein in the preparation of a medicament for reducing, preventing and inhibiting biofilm formation in the oral cavity of a mammal such as man, cat, dog, horse, camel, pig or sheep, on a solid surface such as glass or on a tooth. Said biofilm may be in the oral cavity, such as a tooth or on any solid surface of, e.g., a device to be used in the oral cavity such as a surface on a dental prosthesis. Further aspects include a method of inhibiting, reducing or preventing biofilm formation on a solid surface or in the oral cavity, said method comprising administering an effective dose of an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section "antisense oligonucleotide", a composition or a pharmaceutical composition as described herein.

In one embodiment of the present invention the ASOs as described in the section "antisense oligonucleotide" is used in the treatment and/or prevention of periodontal diseases and disorders linked to biofilm formation in the oral cavity.

In a further aspect, the ASO described herein is for use in preventing, inhibiting and reducing dental caries. Further aspects are uses of the ASO as described herein in the preparation of a medicament for preventing, reducing or inhibiting dental caries as well as a method of treating, reducing or preventing dental caries, said method comprising administering an effective dose of an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section "antisense oligonucleotide", a composition or a pharmaceutical composition as described herein. In still a further aspect, an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 and any biologically active variant thereof as described in the section "antisense oligonucleotide" is for use in improving dental health. Further aspects are uses of the ASO as described herein in the preparation of a medicament for improving dental health as well as a method of improving dental health, said method comprising administering an effective dose of an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section "antisense oligonucleotide", a composition or a pharmaceutical composition as described herein. As used herein, "dental health" is intended relate to dental decay and periodontal diseases such as caries, all dependent on biofilm formation, such as cariogenic biofilm formation, in the oral cavity. Thus improvement of dental health includes full or partial reduction, prevention and inhibition of dental decay and reduced periodontal diseases such as, e.g., caries.

A further object of the present invention is to provide a composition comprising an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section

"antisense oligonucleotide", and a pharmaceutical acceptable adjuvant and/or carrier. Pharmaceutical acceptable adjuvants and/or carriers for compositions administered to the oral cavity are known in the art and further exemplified herein in the section "Vehicle", all useful in the compositions mentioned herein. Particularly, the composition according to the invention be may an oral composition. Still, a further objective of the present invention is to provide a pharmaceutical composition comprising an ASO according to any of the embodiments described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section "antisense oligonucleotide" and a pharmaceutical acceptable adjuvant and/or carrier.

The composition or a pharmaceutical composition as described herein according to the present invention comprising an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section "antisense oligonucleotide" are all for medical use and/or veterinary use. A composition or a pharmaceutical composition as described herein according to the present invention comprising an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section "antisense oligonucleotide" may further comprise a carrier. Carriers are commonly water, aqueous humectant, and/or aqueous alcohol mixtures of a consistency appropriate for the selected mode of administration of the composition, e.g., as a paste, gel, tablet, lozenge, syrup, rinse, and so forth. Carriers for oral compositions according to the present invention include all known in the art. Further embodiments of a composition or a pharmaceutical composition are in a lyophilized (dry) form. Such lyophilized dry forms may be combined with a dry carrier, for instance, lactose, which is widely used in pharmaceutics. Prior to use, the dry composition or dry pharmaceutical composition will be mixed with appropriate diluent. This may be done in f.ex. a specially designed multi-chamber device, and then immediately after mixing, administered to oral cavity, for example, in the form of oral spray, solution or paste.

Orally acceptable carriers include the usual components of toothpastes, tooth powders, prophylaxis pastes, mouth rinses, lozenges, gums and the like, and are more fully described hereinafter. Selection of specific carrier components is dependent on the desired product form, including dentifrices, rinses, gels, and confectionaries.

In various embodiments, the orally acceptable dentifrice carrier used to prepare a composition or a pharmaceutical composition as described herein, both that, of course may be oral, comprises a water-phase. As recognized by one of skill in the art, compositions, such as oral compositions, also including pharmaceutical compositions herein of the present invention optionally include other materials, such as for example, viscosity modifiers, diluents, surface active agents, such as surfactants, emulsifiers, and foam modulators, pH modifying agents, abrasives, humectants, emollients, and moisturizers, mouth feel agents, sweetening agents, flavor agents, colorants, preservatives and combinations thereof. It is understood that while general attributes of each of the above categories of materials may differ, there may be some common attributes and any given material may serve multiple purposes within two or more of such categories of materials. Preferably, such carrier materials are selected for compatibility with the particles, as well as with other ingredients of the composition. In the case of mouth washes, sprays, or rinses, orally acceptable carriers typically comprise an aqueous phase comprising water or a water and alcohol mixture. Further, in various embodiments, the oral carrier comprises a humectant and/or a surfactant. Generally, the weight ratio of water to alcohol is in the range of from about 1 :1 to about 20:1 , preferably from about 3:1 to 10:1 and more preferably about from 4:1 to about 6:1 . The total amount of water-alcohol mixture in this type of preparation is typically in the range of from about 70 to about 99.9% of the preparation. In various embodiments, the alcohol is typically ethanol or isopropanol. The pH of such liquid and other preparations of the invention is generally in the range of from about 4.5 to about 10, which can be achieved and/or maintained with a pH control agent (acid or base) and/or a buffer such as sodium citrate, benzoate, carbonate, or bicarbonate, disodium hydrogen phosphate, or sodium dihydrogen phosphate.

In the case of, e.g., lozenges, tablets, and beads, an orally acceptable carrier can be a non-cariogenic, solid water-soluble polyhydric alcohol (polyol) such as mannitol, xylitol, sorbitol, malitol, hydrogenated starch hydrozylate, hydrogenated glucose,

hydrogenated disaccharides or hydrogenated polysaccharides, in an amount of about 85 to about 95% of the total composition. Emulsifiers such as glycerin, and tableting lubricants, in minor amounts of about 0.1 to 5%, may be incorporated into the tablet, bead or lozenge formulation to facilitate the preparation of the tablet beads and lozenges. In the case of dentifrices including toothpowders, toothpastes (dental creams), and gels, an orally acceptable carrier may comprise water and humectant typically in an amount ranging from about 10% to about 80% of the oral composition. Effective doses of ASO to bacteria are known in the art (see e.g., Guo et al in

Treatment of Streptococcus mutans with antisense oligodeoxyribonucleotides to gtfB mRNA inhibits GtfB expression and function (FEMS Microbial Lett 264 (2006), pg 8- 14); Dufour et al in Zoocin A facilitates the entry of antisense constructs into

Streptococcus mutans (FEMS Microbial Lett 317 (201 1 ) pg 93-99); Rasmussen et al in Hitting bacteria at the heart of the central dogma: sequence-specific inhibition (Microb Cell Fact (2007) 6:24). The effective dose of ASO according to the invention, i.e. SEQ ID NO: 1 , 4, 5, 6, 7, 8, 9, 10, 1 1 , 12 or 13 or any biologically active variant thereof as described in the section "antisense oligonucleotide", is found to be about the same, i.e. about what is known for other ASOs in the art, i.e. about 10 μΜ, and such as about 1 μΜ, 5 μΜ, 10 μΜ, 20 μΜ, 30 μΜ, 40 μΜ or even about 50 μΜ. One particular embodiment of effective dose of ASO according to the invention, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12, is about 6 micrograms per 1 ml of medium or about 10 μΜ that inhibits S. mutans biofilm formation. Further examples are:

1 ) A mouth wash: A regular bottle of mouth wash contains 250 ml of liquid,

therefore the amount of ASO in such a bottle should be 1.5 mg. A person who performs mouth rinse usually uses 20 ml of the liquid (mouth wash) per one procedure. Consequently, this amount of 20 ml should contain 120 μg of the ASO.

2) An oral spray: Similarly to mouth wash, an oral spray should also contain

approximately 1 -1 .5 mg of the ASO per bottle, taking into consideration that the bottle has capacity of 200-250 ml.

3) A toothpaste: For the toothpaste, the amount of ASO should be in a range from 450 μg to 750 μg per tube, taking into consideration that regular tubes of toothpaste contain the paste in a range from 75 ml to 125 ml.

An effective doses of ASO with SEQ ID NO: 1 , 4, 5, 6, 7, 8, 9, 10, 1 1 , 12 or 13 or any biologically active variant thereof as described in the section "antisense

oligonucleotide" would fall in the range of 10 μΜ, 20 μΜ, 30 μΜ, 40 μΜ and 50 μΜ effective for the most oral streptococci, e.g., S. criceti, S. dentirousetti, S. dentisuis, S. orisuis, S. downei, S. mutans and S. sobrinus, as it is determined for the

phosphorothioate-modified ASOs used by Dufour et al in Zoocin A facilitates the entry of antisense constructs into Streptococcus mutans (FEMS Microbial Lett 317 (201 1 ) pg 93-99).

The compositions and pharmaceutical compositions described herein comprising ASO of the invention, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section "antisense oligonucleotide", can be prepared by known methods for the preparation of pharmaceutically acceptable compositions which can be administered to patients, particularly to the oral cavity, and such that an effective quantity of the antisense nucleic acid molecule, i.e. ASO, is combined in a mixture with a pharmaceutically acceptable carrier, adjuvant of other vehicle. Suitable carriers are described, for example in Remington's Pharmaceutical Sciences (Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, Pa., USA). Carriers include saline and D5W (5% dextrose in water). Excipients include additives such as a buffer, solubilizer, suspending agent, emulsifying agent, viscosity controlling agent, flavor, lactose filler, antioxidant, preservative or dye.

On this basis, the pharmaceutical compositions could include an active ASO molecule in association with one or more pharmaceutically acceptable carriers, adjuvants or diluents, and contained in buffered solutions with a suitable pH and isoosmotic with the physiological fluids. The pharmaceutical carrier will depend on the intended route of administration, i.e. if it is e.g., a mouth wash, a dental filling, a tooth paste or dental floss. The methods of combining the ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section "antisense oligonucleotide" with the carriers of adjuvants or combining them with diluents are well known to those skilled in the art. The compositions may also contain further additives such as antioxidants, buffers, and solutes which render the formulation isotonic in the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents depending on the route of delivery or administration to the oral cavity. The composition may further include a targeting agent for the transport of the active compound to specified sites.

The pharmaceutical compositions of the present invention may be manufactured in a manner that is itself known, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.

Pharmaceutical compositions for use in accordance with an ASO of the present invention, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section "antisense oligonucleotide" thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active compounds, i.e. the ASO according to the invention, into preparations which can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen to the oral cavity, i.e. in solution, in a gel, on a stick or brush, or in a gum or capsules.

For oral administration, an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section "antisense oligonucleotide" can be formulated readily by combining the ASO with pharmaceutically acceptable carriers well known in the art. Such carriers enable the ASO of the invention, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section "antisense oligonucleotide" to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a patient to be treated. Pharmaceutical preparations for oral use can be obtained by solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, manitol, or sorbitol, or cellulose preparations such as, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropyl methyl cellulose, sodium carboxymethyl cellulose, and/or polyvinylpyrrolidone. If desired, disintegrating agents may be added, such as the cross- linked polyvinylpyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.

A further object of the present invention is to provide a composition or a pharmaceutical composition comprising the ASO of the invention, i.e. SEQ ID NO: 1 , 4, 5, 6, 7, 8, 9, 10, 1 1 , 12 or 13 or any biologically active variant thereof as described in the section

"antisense oligonucleotide" as described herein for medical and/or veterinary use, as well as for administration in methods of treatment as described herein in more detail.

The therapeutically effective dosage of the pharmaceutical compositions according to the invention comprising an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section "antisense oligonucleotide" will depend on the type and severity of the harmful biofilm, e.g., cariogenic biofilm, dental caries or amount of biofilm producing bacteria in the oral cavity and whether the composition or

pharmaceutical composition comprises a further active ingredient such as an antibiotic. Generally, the therapeutically effective dose is the minimal amount sufficient for controlling biofilm formation and which is not toxic to the human or animal treated. Methods for determining effective dosages and toxicity are known in the art and may include f.ex. evaluation of the ASOs dosages by taking a samples of saliva and samples from dental plaque and then measuring remaining amount of ASOs within these samples after certain periods of time by, e.g., HPLC analysis. Examples of how this is done are given in for instance, the study model reported by Naumova et al in Fluoride bioavailability in saliva and plaque (BMC Oral Health (2012), 12:3). Examples of evaluation of possible retention and absorption of ASOs, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section "antisense oligonucleotide", by oral mucosa, specially designed absorbent discs can be applied in different soft-tissue areas of mouth, as it is described by Zero et al in Studies of fluoride retention by oral soft tissues after the application of home-use topical fluorides (J Dent Res 71 (1992), pg 1546-1552), and then measuring the retained amount of ASOs, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section "antisense oligonucleotide" using HPLC technique.

Thus, in further aspects, a composition or a pharmaceutical composition according to the invention and as described herein is for use in reducing, preventing and inhibiting biofilm formation. Further aspects are uses of the compositions or pharmaceutical compositions as described herein in the preparation of a medicament for reducing, preventing and inhibiting biofilm formation. Further aspects are methods of inhibiting, reducing and preventing biofilm formation in the oral cavity, said method comprising administering an effective dose of the ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section "antisense oligonucleotide", compositions or pharmaceutical compositions of the invention as described herein comprising an ASO, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section "antisense

oligonucleotide". Said biofilm may be in the oral cavity or on any device to be used in the oral cavity such as a dental prosthesis and implants. A typical implant consists of a titanium screw (resembling a tooth root) with a roughened or smooth surface. The majority of dental implants are made out of commercially pure titanium, which is available in 4 grades depending upon the amount of carbon and iron contained. More recently grade 5 titanium has increased in use. Today most implants are still made out of commercially pure titanium (grades 1 to 4) but some implant systems are fabricated out of grade 5 titanium. Implant surfaces may be modified by plasma spraying, anodizing, etching, or sandblasting to increase the surface area and osteointegration potential of the implant.

In one embodiment of the present invention a dental prosthesis and implant on which biofilm formation is inhibited, reduced and/or prevented is selected from the group implant systems consisting of: Nobel Biocare, Dentsply Astratec, Dentsply Ankylos, Straumann, Biomed 3i, and Southern Implant.

In further aspects, a composition or a pharmaceutical composition according to the invention comprising an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section "antisense oligonucleotide" and as described herein is for use in preventing, inhibiting or reducing dental caries. Further aspects are uses of the compositions or pharmaceutical compositions as described herein in the preparation of a medicament for use in preventing, inhibiting and reducing dental caries. Further aspects are methods of inhibiting, reducing or preventing dental caries in the oral cavity, said method comprising administering an effective dose of an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section "antisense oligonucleotide", compositions or pharmaceutical compositions of the invention as described herein. In still further aspects, a composition or a pharmaceutical composition according to the invention and as described herein comprising an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section "antisense oligonucleotide" is for use in improving dental health. Further aspects are uses of the compositions or

pharmaceutical compositions as described herein comprising an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section "antisense oligonucleotide" in the preparation of a medicament for use in improving dental health. Further aspects are methods of improving dental health in the oral cavity, said method comprising administering an effective dose of the ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section "antisense oligonucleotide", compositions or pharmaceutical compositions of the invention as described herein.

An orally acceptable composition or pharmaceutical composition an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section "antisense

oligonucleotide" is applied to the oral cavity by contacting oral surface(s) with the composition or pharmaceutical compositions described herein, comprising the ASO of the invention an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section "antisense oligonucleotide". In an embodiment, ASO, preferably in a composition or pharmaceutical composition is introduced into the oral cavity, either during or after cleansing of oral surfaces, can remain resident upon cleansed oral surfaces to prevent, inhibit or reduce biofilm formation, e.g., plaque formation, and the like.

An oral care product

Further objects of the present invention provides an oral care product comprising an ASO as described herein or a composition as described herein or a pharmaceutical composition as described herein, all comprising an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section "antisense oligonucleotide".

Said oral care product may be selected from the group consisting of a dentifrice, such as a tooth paste, a mouth wash, a mouth spray, a mouth rinse or a dental prosthesis rinse, dental floss, a mouth gel, dental varnish, a tooth powder, a prophylaxis paste, a filling, e.g., a dental filling, such as an root canal filling, an impregnated tooth-pick or interdental brush, a lozenge, and a gum.

As revealed above, the oral care product may be a dentifrice (e.g., paste, gel, powder, or liquid dentifrice), prophylaxis paste, dental paint, lozenge, chewing gum, or other abrasive, detergent, or cleansing composition capable, either alone or in combination with the action of an applicator, of removing deposits, such as plaque, from teeth and/or from oral soft tissues. Similar solid, semi-solid, and liquid formats may be useful for other topical and for systemic uses, e.g., as well as tablets, capsules, ointments, creams, pre-gels, lavages, surgical site washes, parenteral solutions and suspension, and suppositories. Compositions and pharmaceutical compositions according to the invention comprising an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section "antisense oligonucleotide" may be used in the oral care product and may also be formulated as industrial or consumer product paints, sprays, cleansers, dips, rinses, and the like. Alternatively, a topical or oral composition comprising an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section "antisense

oligonucleotide", compositions or pharmaceutical compositions herein may be designed as a post-cleansing treatment composition or post-cleansing pharmaceutical treatment composition, such as a liquid-gel, slurry, or suspension mouthwash or mouth rinse. In oral, topical, and systemic somatic uses, said compositions will respectively comprise orally, topically, or systemically acceptable substances. Such substances include a solid, semi-solid, or liquid carrier, and may optionally include one or more: other active ingredients, e.g., antibacterial agents (e.g., a water-insoluble non-cationic antibacterial agent, such as triclosan), antioxidants, pharmaceuticals, vitamins, fluoride sources, nutraceuticals, and the like; excipients and inert ingredients, e.g., humectants, gelling agents, thickeners, solvents, diluents, binders, fillers, plasticizers, anti-caking agents, disintegrants, gums, emollients, oleochemicals, colorants, flavorants, odorants, pH adjusting agents (acids, bases), buffers, surfactants, emulsifiers, suspending agents, enzymes, coatings (e.g., enteric, acrylic, or carbohydrate or cellulosic coatings), chelants, preservatives, and the like. Representative examples of such well- known additives are described, e.g., in U.S. Patent Application 2006/0141073 to Worrell et al.; US2006/0140881 to Xu et al.; and US 2008/0187501 to Boyd et al.; as well as in L. V. Allen Jr., The Art, Science, and Technology of Pharmaceutical

Compounding (2d ed., 2003); J. G. Hardman et al., Goodman & Gilman's The

Pharmacological Basis of Therapeutics (10.sup.th ed., 2001 ); and R. C. Rowe et al., Handbook of Pharmaceutical Excipients (4.sup.th ed., 2003); all of which are hereby incorporated by reference in their entirety. In one aspect a dentifrice, such as a tooth paste, is provided comprising an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section "antisense oligonucleotide" or a composition as described herein or a pharmaceutical composition as described herein. Thus, said dentifrice may comprise the ASO sequence of the invention, e.g. an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12or any biologically active variant thereof as described in the section "antisense oligonucleotide", capable of inhibiting biofilm formation in S. criceti, S. dentirousetti, S. dentisuis, S. orisuis, S. downei, S. mutans and S. sobrinus, an isolated antisense oligonucleotide sequence (ASO) capable of inhibiting glucan production in S. criceti, S. dentirousetti, S. dentisuis, S. orisuis, S. downei, S. mutans and S. sobrinus, or the ASO capable of inhibiting biofilm formation in S. criceti, S. dentirousetti, S. dentisuis, S. orisuis, S. downei, S. mutans and S. sobrinus also capable of inhibiting glucan production in S. criceti, S. dentirousetti, S. dentisuis, S. orisuis, S. downei, S. mutans and S. sobrinus, the ASO of the invention, e.g. an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section

"antisense oligonucleotide". In one further aspect, a mouth wash is provided comprising an ASO described herein or a composition as described herein or a pharmaceutical composition as described herein, all comprising the ASO of the invention, e.g. an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section "antisense

oligonucleotide". Thus, said mouth wash may in one embodiment comprise one of said ASO sequence, capable of inhibiting biofilm formation, such as cariogenic biofilm formation in S. criceti, S. dentirousetti, S. dentisuis, S. orisuis, S. downei, S. mutans and S. sobrinus. In another embodiment of the present invention, the mouth wash may comprise an isolated antisense oligonucleotide sequence (ASO), e.g., the ASO of the invention exemplified with an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section "antisense oligonucleotide" capable of inhibiting glucan production in S. criceti, S. dentirousetti, S. dentisuis, S. orisuis, S. downei, S. mutans and S. sobrinus. In another embodiment the mouth rinse may comprise the ASO capable of inhibiting biofilm formation, such as cariogenic biofilm formation, in S. criceti, S. dentirousetti, S. dentisuis, S. orisuis, S. downei, S. mutans and S. sobrinus, also capable of inhibiting glucan production in S. criceti, S. dentirousetti, S. dentisuis, S. orisuis, S. downei, S. mutans and S. sobrinus, the ASO exemplified with SEQ IDs herein, such as the ASO of the invention, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4- 12 SEQ ID or fragments or variants of said sequences as described in the section "antisense oligonucleotide". In a preferred embodiment the oral care product is selected from the group consisting of: dentrifice, mouth wash, mouth rinse and mouth spray.

In one further aspect, a filling, such as a root canal filling, is provided comprising an ASO described herein or a composition as described herein or a pharmaceutical composition as described herein all comprising an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section "antisense oligonucleotide" . Thus, said filling, such as a root canal filling may comprise said ASO sequence, capable of inhibiting biofilm formation, such as cariogenic biofilm formation in S. criceti, S.

dentirousetti, S. dentisuis, S. orisuis, S. downei, S. mutans and S. sobrinus, an isolated antisense oligonucleotide sequence (ASO) capable of inhibiting glucan production in S. criceti, S. dentirousetti, S. dentisuis, S. orisuis, S. downei, S. mutans and S. sobrinus. In another embodiment the root canal filling may comprise the ASO capable of inhibiting biofilm formation in S. criceti, S. dentirousetti, S. dentisuis, S. orisuis, S.

downei, S. mutans and S. sobrinus also capable of inhibiting glucan production in S. criceti, S. dentirousetti, S. dentisuis, S. orisuis, S. downei, S. mutans and S. sobrinus, the ASO exemplified with an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section "antisense oligonucleotide".

A kit

A further objective of the present invention provides a kit for inhibiting, reducing or preventing biofilm formation, particularly cariogenic biofilm formation, comprising: - an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section "antisense oligonucleotide";

- or a composition as described herein or a pharmaceutical composition as described herein all comprising an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section "antisense oligonucleotide";

- and a container comprising said ASO, composition or pharmaceutical composition;

- and optionally instructions for its use.

Still a further objective of the present invention provides a kit for inhibiting, reducing or preventing dental caries comprising:

- an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section "antisense oligonucleotide";

- or a composition as described herein or a pharmaceutical composition as described herein;

- and a container comprising said ASO i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section "antisense oligonucleotide", composition or pharmaceutical composition;

- and optionally instructions for its use.

Still a further objective of the present invention provides a kit for improving dental health comprising:

- an ASO described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section "antisense oligonucleotide";

- and a container all comprising said ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section "antisense oligonucleotide", composition or pharmaceutical composition;

- and optionally instructions for its use. Said kits may further comprise the ASO sequences described herein, e.g., SEQ ID NO: 1 , 4, 5, 6, 7, 8, 9, 10, 1 1 , 12 or 13 capable of inhibiting biofilm formation in S. criceti, S. dentirousetti, S. dentisuis, S. orisuis, S. downei, S. mutans and S. sobrinus, an isolated antisense oligonucleotide sequence (ASO) capable of inhibiting glucan production in S. criceti, S. dentirousetti, S. dentisuis, S. orisuis, S. downei, S. mutans and S. sobrinus, or the ASO capable of inhibiting biofilm formation in S. criceti, S. dentirousetti, S.

dentisuis, S. orisuis, S. downei, S. mutans and S. sobrinus also capable of inhibiting glucan production in S. criceti, S. dentirousetti, S. dentisuis, S. orisuis, S. downei, S. mutans and S. sobrinus, the ASO exemplified with SEQ IDs herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12.

Further, said kits may include suitable control samples (i.e. reference samples), and/or positive or negative control samples. In some embodiments, a kit may further include instructional materials disclosing, for example, means of use of the an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section "antisense oligonucleotide" or means of use for a particular reagent. The instructional materials may be written, in an electronic form (e.g., computer diskette or compact disk) or may be visual (e.g., video files). The kits may also include additional components to facilitate the particular application for which the kit is designed. Thus, for example, the kit can include buffers and other reagents routinely used for the practice of a particular disclosed method. Such kits and appropriate contents are well known to those of skill in the art.

The kit may further comprise, in an amount sufficient for at least use, preferably several uses, an ASO as described herein, i.e. SEQ ID NO: 1 , 13 or fragments thereof according to SEQ ID NO: 4-12 or any biologically active variant thereof as described in the section "antisense oligonucleotide", composition or pharmaceutical composition according to the invention as a separately packaged reagent.

Instructions for use of the packaged reagent are also typically included. Such instructions typically include a tangible expression describing reagent concentrations or the relative amounts of reagent and sample to be mixed, maintenance time periods for reagent/sample admixtures, temperature, buffer conditions and the like. Certain kit embodiments can include a carrier means, such as a box, a bag, a satchel, plastic carton (such as moulded plastic or other clear packaging), wrapper (such as, a sealed or sealable plastic, paper, or metallic wrapper), or other container.

In some examples, kit components will be enclosed in a single packaging unit, such as a box or other container, which packaging unit may have compartments into which one or more components of the kit can be placed. In other examples, a kit includes a one or more containers, for instance, vials, tubes, and the like that can retain.

Other kit embodiments include, for instance, syringes, cotton swabs, or latex gloves, which may be useful for handling, collecting and/or processing a biological sample. Kits may also optionally contain droppers, syringes, and the like. Still other kit embodiments may include disposal means for discarding used or no longer needed items (such as subject samples, etc.). Such disposal means can include, without limitation, containers that are capable of containing leakage from discarded materials, such as plastic, metal or other impermeable bags, boxes or containers.

Non-limiting examples which embody certain aspects of the invention will now be described.

Examples

Example 1 - Determination of the Antisense Oligonucleotide Sequence for Glucosyltransferase

Bioinformatical Methods and Results

In order to select the appropriate ASO sequence, at first the conserved homologous regions among the gtf genes of oral streptococci were identified. For this purpose, it was primarily conducted a comparative analysis of amino acid sequences between S. mutans GtfB protein and other Gtf proteins present in oral streptococci. S. mutans (strain UA159, Bratthall serotype c, ATCC no. 700610) genome is completely sequenced, and the sequences are deposited in GenBank database at the National Center for Biotechnology Information (NCBI). Therefore, using S. mutans (strain UA159) GtfB protein as a query sequence, the BLAST (Basic Local Alignment Search Tool) search of homologs among all known proteins have been performed (BLAST service is available at http://blast.ncbi.nlm.nih.gov/Blast.cgi; accessed in March, 2009). In consequence, it was revealed that S. mutans (strain UA159) GtfB protein features high identity to the GtfC protein from S. mutans (strain UA159) as well as other Gtf (i.e. Gtfl) proteins from S. criceti, S. dentirousetti, S. dentisuis, S. downei and S. sobrinus responsible for the generation of water-insoluble glucans. Eventually, sequences of these proteins were collected and multiple sequence alignment produced employing MAFFT online server at the Max-Planck Institute for Development Biology

(http://toolkit.tuebingen.mpg.de/mafft; accessed in March, 2009). Applying such approach, it was determined a region of conserved amino acid sequence within the GtfB protein of S. mutans (strain UA159) that possesses 100% homology to the appropriate fragments in S. mutans (strain UA159) GtfC, S. criceti Gtfl, S. dentirousetti Gtfl, S. dentisuis Gtfl and S. orisuis Gtf proteins. The respective coding segment for this region in S. mutans (strain UA159) gtfB gene contains the following sequence of

26 nt: 5 -GTTAAGATTAAGCAATGGTCTGCCAA-3', i.e. SEQ ID NO: 16. As in the case of comparative amino acid sequence analysis, this segment of S. mutans (strain UA159) gtfB gene has also 100% homologous fragments in S. mutans (strain UA159) gtfC, S. criceti gtfl, S. dentirousetti gtfl, S. dentisuis gtfl and S. orisuis gtf genes.

Additionally, it was also found a highly similar sequence with only two mismatched nucleotides in S. downei gtf precursor and S. sobrinus gtfl genes. On the basis of best priming analysis (Primer3 service was used at http://frodo.wi.mit.edu/ primer3/input.htm in order to analyze thermodynamics and other peculiarities of the heteroduplex forming; accessed in March, 2009), a complementary sequence of 19 nt was picked out for the above indicated coding region:

5 -AGATTAAGCAATGGTCTGC-3' (sequence of the coding region) [SEQ ID NO: 17]

3 -TCTAATTCGTTACCAGACG-5' (complementary sequence) [SEQ ID NO: 1 ]

In accordance with this, for the further outlined experiments, we propose to use antisense oligonucleotide of the following sequence:

5'-G CAG AC CATTG CTTAATCT-3 ' [SEQ ID NO: 1 ]

The exact locations of this segment in the gtf genes of S. mutans (strain UA159) and S. sobrinus (strain SL1 ) along with the data linked to the GenBank of NCBI are presented below: 1 . In S. mutans (strain UA159) gtfB (herein indicated as gtfl) gene, it begins from 3056 nt:

GenBank accession no. gb | AE014133.1 |

Streptococcus mutans UA159, complete genome

Length=2030921

Features in this part of subject sequence:

glucosyltransferase-I

Query 1 GCAGACCATTGCTTAATCT 19 [SEQ ID NO: 1]

I I I I I I I I I I I I I I I I I I I

Sbjct 954167 GCAGACCATTGCTTAATCT 954149 [SEQ ID NO: 1]

In S. mutans (strain UA159) gtfC (herein indicated as gtfSI) gene, it starts from 3134 nt:

GenBank accession no. gb | AE014133.1 |

Streptococcus mutans UA159, complete genome

Length=2030921

Features in this part of subject sequence:

glucosyltransferase-SI

Query 1 GCAGACCATTGCTTAATCT 19 [SEQ ID NO:

1]

I I I I I I I I I I I I I I I I I I I

Sbjct 958871 GCAGACCATTGCTTAATCT 958853 [SEQ ID NO:

1]

In S. sobrinus (strain SL1 ) gtfl gene, it begins from 3047 nt:

GenBank accession no. dbj | D63570.1 |

Streptococcus sobrinus gene for glucosyltransferase GTF-I, complete cds

Length=6838

Query 1 GCAGACCATTGCTTAATCT 19 [SEQ ID NO:

1]

I I I I I I I I I I I I I I I I I I

Sbjct 4079 GCAGACCATTGTTTAATCT 4061 [SEQ ID NO: 15]

Mismatch in SEQ ID NO: 1 is underlined.

Based on the above findings, there was an anticipated inhibitory effect of the selected ASO for glucosyltransferase mRNA expression in S. sobrinus because of just one mismatched nucleotide which is present approximately in the middle of sequence. The chosen ASO has a single 100% homology with the region located in the 19th chromosome of human genome (GenBank accession no. NT_01 1295). This segment does not code for any product, and it is distant from the known coding regions: 32771 bp at 5' side and 5128 bp at 3' side

(http://www.ncbi.nlm.nih.gov/nuccore/29801560?report=gbwithparts&from=6384440&to =6396733; accessed in March, 2009).

Modeling of S. mutans gtfB mRNA secondary structure was carried out using the Mfold program at the Rensselaer bioinformatics web server (http://www.bioinfo.rpi.edu/ applications/mfold; accessed in March, 2009) in order to assess binding site for the selected ASO. Consequently, one hundred models of the mRNA secondary structure were generated and the most reliable structural motif around the ASO deduced (Fig 1 ).

Example 2 - Antisense Oligonucleotide Treatment Effects on Biofilm Formation in S. mutans Cultures

Laboratory Methods and Results

S. mutans strain UA159 (Bratthall serotype c), that is available through the American Type Culture Collection (ATCC no. 700610), was cultured in Todd Hewitt (TH) broth (Difco) anaerobically at 37 °C in 95% N₂ and 5% C0₂ for 24 h. The culture purity was checked on Mitis salivarius agar (Difco) and Columbia blood agar (E&O Laboratories). Afterwards, the optical density (OD) of bacterial culture was adjusted to 0.2 at 630 nm using microplate reader spectrophotometer (Dynex MRX).

Prior to inoculation of the bacteria, 24-well flat-bottomed polystyrene cell culture plates (Sarstedt) were filled with the TH broth. Then, three phosphorothioate-modified oligodeoxyribonucleotides of the different sequences were added to the plate wells at the final concentration of 10 μΜ either alone or in combination with the transfection reagent - TurboFect^™:

1 . The AS01 , comprising of the sequence: 5 -GCAGACCATTGCTTAATCT-3' (SEQ ID NO: 1 ), which served as a test molecule.

2. The AS02, comprising of the sequence: 5 -ACGCACTTTCTTGTCCAT-3' (SEQ ID NO: 2), which served as a positive control molecule because it has been proven to be efficient in the downregulation of S. mutans gtfB gene expression as reported by Guo et al in Treatment of Streptococcus mutans with antisense oligodeoxyribonucleotides to gtfB mRNA inhibits GtfB expression and function (FEMS Microbial Lett 264 (2006), pg 8-14).

3. The AS03, comprising of the sequence: 5 -ACTCGTATGCTACAGCTAT-3' (SEQ ID NO: 3), which served as a negative control molecule and differed from the test molecule by scrambling the nucleotide sequence. Originally, these ASOs were synthesized at the Metabion International AG (Germany) as full phosphorothioate oligodeoxyribonucleotides using 1 μηηοΙ synthesis scale and HPLC purification. Before experiments, the lyophilized ASOs were dissolved in sterile nuclease-free distilled water (Thermo Fisher Scientific, Fermentas) in order to get stock solutions with the final concentration of 100 μΜ. Where needed, the ASOs were combined with TurboFect^™ reagent and prepared according to the manufacturer's protocol by using 2 μΙ of the reagent for 1 μg of the oligonucleotide DNA.

After the addition of ASOs, the plate wells were inoculated with S. mutans culture at the final dilution of 1 :100. Immediately, the sterile glass slides of 1 mm thickness cut from standard microscope slides (76 * 26 mm; Thermo Fisher Scientific) were vertically inserted into wells, and the plates were incubated anaerobically at 37 °C for additional 2 h. Afterwards, a sterile solution of sucrose was added to the appropriate wells at the final concentration of 1 %, and the plates were incubated anaerobically at 37 °C in 95% N₂ and 5% C0₂ for another 22 h. In this experiment, the final volume of liquid per well was 1 ml, the wells without bacterial cells were used as blank controls, and the untreated S. mutans cells and cells treated only with nuclease-free water or

TurboFect^™ reagent served as experimental controls.

Following 24 h of the total incubation time, the glass slides were removed from wells, dried and further used for the analysis of S. mutans biofilm by MicroXAM^™ (ADE Phase Shift) optical profilometer. There were performed 5 measurements (every

measurement area of 200 * 260 μηη) per slide halfway from bottom to top of the visible biofilm employing 50X objective with zoom factor 0.625. In addition, a Gaussian filter (size 50 x 50 μηη) was selected to remove errors of form and waviness. Several important biofilm surface's roughness parameters were evaluated: S_t - maximum difference between peak height and valleys, S_a - average difference between peak height and valleys, S_dr - total surface area (if all roughness was stretched out) according to Wennenberg and Albrektsson in Suggested guidelines for the topographic evaluation of implant surfaces (Int J Oral Maxillofac Implants 15 (2000), pg 331 -344). These roughness parameters reflect a maturity of the biofilm formation, that is, the amount of adherent bacteria and microcolonies. Statistical significance of the roughness parameters was evaluated using one-way ANOVA with Tukey's all pairs comparison. A value less than 0.05 was considered statistically significant. Analysis of the glass slides' surfaces with S. mutans biofilm applying optical profilometry revealed that the presence of 1 % sucrose in TH broth significantly increased surface roughness parameters S_a and S_t in comparison to the clean glass surface therein used as a reference (p < 0.05) (Table 1 ). In this respect, it shows that 1 % sucrose stimulated attachment of the bacteria to glass surface and biofilm formation (Table 1 ). However, the test AS01 molecule (SEQ ID NO: 1 ) with

TurboFect^™ reagent considerably prevented biofilm formation on the glass surface despite the presence of 1 % sucrose (p = 0.06 for parameter S_a). Importantly, this effect was significant versus the bacteria exposed to the AS02 (SEQ ID NO: 2) and AS03 (SEQ ID NO: 3) in combination with TurboFect^™ reagent (p < 0.05 for the parameters S_a and S_dr) as seen in Table 1 and Fig 2A, B, C. On the basis of these results, it can be concluded that the test AS01 molecule (SEQ ID NO: 1 ) effectively decreases S.

mutans adherence and biofilm formation on solid surface in vitro conditions.

TABLE 1 - Surface parameters of glass slides with S. mutans biofilm

Treatments S_a Mm S_t Mm S_dr % Ref to

Fig 2

Clean glass slide (reference) 0.01 (0.00) 0.92 (0.53) 0.05 (0.02)

Untreated bacteria without sucrose 0.13 (0.03) 2.34 (1.12) 1 .91 (1.38)

Untreated bacteria + sucrose 0.13 (0.04) 8.44 (4.03) 1 .57 (0.95)

Untreated bacteria + sucrose + 0.05 (0.03) 3.80 (2.25) 0.57 (0.40) nuclease-free water + TurboFect^™

Bacteria + sucrose + AS01 0.27 (0.01 ) 7.27 (1.91 ) 10.09 (0.90)

Bacteria + sucrose + AS02 0.45 (0.04) 13.03 18.60 (2.24)

(1 .93)

Bacteria + sucrose + AS03 0.14 (0.05) 5.74 (2.62) 1 .1 1 (0.71 ) Bacteria + sucrose + AS01 + 0.07 (0.04) 6.94 (5.81 ) 0.99 (1.37) Fig

TurboFect^™ 2A

Bacteria + sucrose + AS02 + 0.31 (0.02) 7.99 (1.67) 10.08 (1 .13) Fig

TurboFect^™ 2B

Bacteria + sucrose + AS03 + 0.31 (0.02) 7.18 (0.64) 9.19 (0.82) Fig

TurboFect^™ 2C

Table 1 shows surface parameters of glass slides with S. mutans biofilm after 24 h of incubation under different treatments. Data are expressed as the mean of 5

measurements, and the standard deviation is presented in parentheses.

Example 3 - Antisense Oligonucleotide Treatment Effects on the Formation of Bacterial Aggregates in S. mutans Cultures Laboratory Methods and Results

The experimental design and conditions were the same as described in Example 2, except that the inoculated 24-well plates did not contain glass slides. The bacterial aggregation was monitored spectrophotometrically every 3 h interval after addition of sucrose until the time point of 14 h, and then at the time point of 24 h. For this purpose, the OD of taken samples was measured at 630 nm employing microplate reader spectrophotometer (Dynex MRX). At the end of experiment (after 24 h of the total incubation time), the samples were taken from plate wells in order to evaluate morphologically S. mutans cells and bacterial aggregation applying Gram staining and light microscopy with Leica DM500 microscope.

Spectrophotometric monitoring of the bacterial cultures in the plate wells revealed that addition of sucrose resulted in a substantial increase of OD at the time points of 14 h and 24 h as compared to the bacteria growing without sucrose (Fig 3A and B). It is an indication that 1 % sucrose caused the formation of bacterial aggregates because of glucan production. Neither the presence of nuclease-free water nor TurboFect^™ reagent affected considerably this process (Fig 3B). However, treatments of bacteria with the test AS01 molecule (SEQ ID NO: 1 ) either alone or combined with TurboFect^™ reagent decreased the OD approximately 1.5-fold in comparison to the untreated bacteria at the time point of 24 h, pointing out the less formation of bacterial aggregates (Fig 3C and D). This effect of the test AS01 molecule (SEQ ID NO: 1 ) was further confirmed by Gram staining of the taken samples at the time point of 24 h. As seen in Fig 4B and C, the presence of test AS01 molecule (SEQ ID NO: 1 ) suppressed the formation of bacterial aggregates as well as reduced the elongation of bacterial chains (more separate bacterial cells were observed) in comparison with the untreated bacteria. In contrast, neither AS02 (SEQ ID NO: 2) nor AS03 (SEQ ID NO: 3) molecules exhibited such effect on the bacteria growing in TH broth with 1 % sucrose (Fig 3C and D; Fig 4D and E). Therefore, in accordance with these results, it can be concluded that the test AS01 molecule (SEQ ID NO: 1 ) reduces aggregation of S. mutans bacteria in the presence of 1 % sucrose and even decreases the elongation of bacterial chains, indicating the suppressed production of glucans.

Example 4 - Antisense Oligonucleotide Treatment Effects on the Viability of S. mutans bacteria

Laboratory Methods and Results

The experimental design and conditions were the same as described in Example 2, except the inoculated 24-well plates did not contain glass slides and sucrose was absent in the TH broth. The bacterial growth was monitored spectrophotometrically every 3 h interval after initial 2 h of incubation until the time point of 14 h, and then at the time point of 24 h. For this purpose, the OD of taken samples was measured at 630 nm employing microplate reader spectrophotometer (Dynex MRX).

Spectrophotometric monitoring of the bacterial cultures in the plate wells revealed that the presence of nuclease-free water and TurboFect^™ reagent did not affect the normal bacterial growth during 24 h of the total incubation time (Fig 5A). The treatments of bacteria with the AS01 (SEQ ID NO: 1 ), AS02 (SEQ ID NO: 2) and AS03 (SEQ ID NO: 3) molecules either alone or in combination with TurboFect^™ reagent only slightly reduced the bacterial growth curves (ODs) as compared to the untreated bacteria (Fig 5B and C). From this data, it can be concluded that neither of the used ASOs considerably inhibits S. mutans growth, and therefore did not suppress the bacterial viability. Example 5 - Clinical use of the ASO of the invention for preventing biofilm formation on oral implants

The ASO of the present invention is useful for preventing biofilm formation on the surface of an oral implant. In the present example, it is described how the ASO is applied and how it prevents biofilm formation on the surface of a titanium dental implant. A patient presents inflammation in the tissue surrounding an implant

(mucositis). The inflammation is caused by a bacterial biofilm formation on the implant surface. The surface covered by the biofilm is not accessible using a conventional toothbrush. The dentist thus ordinates treated of the patient as follows: After professional mechanical cleaning of the implant surface, ASO is administered using a mouth-rinse twice daily, which prevents biofilm build-up as described herein above. The clinical outcome is that less biofilm is formed and the tissue inflammation diminishes and eventually disappears. After one to two weeks of ASO use, a healthy non-inflamed mucosa is clinically diagnosed. It is concluded that the ASO solution effectively reaches all surfaces and thus prevents biofilm formation in a more efficient way than regular brushing.

Claims

1 . An isolated antisense oligonucleotide (ASO), selected from the group

consisting of:

i a) an ASO comprising the sequence of SEQ ID NO: 1 or 13

b) a fragment of SEQ ID NO 1 or 13, and

c) an ASO having at least 85% sequence identity to SEQ ID NO: 1 or 13, wherein said ASO or fragment thereof comprises between 8 and 400 nucleotides.

2. The isolated antisense oligonucleotide (ASO) according to claim 1 , wherein said isolated antisense oligonucleotide (ASO) is selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO:13.

The isolated ASO according to any of the preceding claims, wherein said ASO or fragment thereof comprises at most 300 nucleotides, such as at most 200 nucleotides, such as at most 100 nucleotides, such as at most 50 nucleotides, such as at most 30 nucleotides, such as at most 20 nucleotides.

4. The isolated ASO according to any one of the preceding claims, wherein said

ASO or fragment thereof comprises at most 26 nucleotides.

5. The isolated ASO according to any one of the preceding claims, wherein said ASO or fragment thereof comprises at most 19 nucleotides.

6. The isolated ASO according to any one of the preceding claims, wherein said ASO has at least 85% sequence identity to SEQ ID NO 1 .

7. The isolated ASO according to claim 1 , wherein one, two, three or four

nucleotides of SEQ ID NO 1 have been altered to one, two, three or four other nucleotides.

8. The isolated ASO according to claim 1 , wherein said ASO is the sequence as specified in SEQ ID NO:1 .

9. The isolated ASO according to claim 1 , wherein said ASO has at least 85% sequence identity to SEQ ID NO 13.

10. The isolated ASO according to claim 1 , wherein one, two, three or four

nucleotides of SEQ ID NO 13 have been altered to one, two, three or four other nucleotides.

1 1 . The isolated ASO according to claim 1 , wherein said ASO is the sequence as specified in SEQ ID NO: 13.

12. The isolated ASO according to claim 1 , wherein said fragment is selected from the group consisting of SEQ ID NO: 4, 5, 6, 7, 8, 9, 10, 1 1 and 12.

13. The isolated ASO according to any of the preceding claims, wherein said ASO is conjugated to a cell penetrating peptide.

14. An isolated ASO according to any one of the preceding claims for medical and/or veterinary use.

15. An isolated ASO according to any one of claims 1 -13 for use in reducing, preventing or inhibiting biofilm formation.

16. The isolated ASO according to claim 15, wherein said biofilm is present on and/or in an oral implant.

17. The isolated ASO according to claim 16, wherein said oral implant is selected from the group consisting of Nobel Biocare, Dentsply Astratec, Dentsply Ankylos, Straumann, Biomed 3i, and Southern Implant or any other suitable oral implant.

18. The isolated ASO according to any one of claims 1 -13 for use in preventing and/or treating an oral disease or disorder linked to biofilm and/or plaque formation in the oral cavity.

19. The isolated ASO according to any one of claims 1 -13 for use in preventing, inhibiting and/or reducing dental caries.

20. A composition comprising an ASO according to any one of claims 1 -13 and a pharmaceutically acceptable adjuvant and/or carrier.

21 . The composition according to claim 20, wherein the pharmaceutically

acceptable carrier is a cationic polymer.

22. The composition according to claim 21 , wherein the cationic polymer is the TurboFect™ reagent.

23. The composition according to claim 20, formulated as an oral composition.

24. The composition according to any one of claims 20-23 wherein the

composition is a pharmaceutical composition.

25. A composition according to any one of claims 20-24 for use in preventing, inhibiting or reducing dental caries.

26. An oral care product comprising an ASO according to any one of claims 1 -13 or a composition according to any one of claims 20-24.

27. The oral care product according to claim 26, wherein said oral care product is selected from the group consisting of a dentifrice, such as a tooth paste, a mouth wash, a mouth spray, a mouth rinse, dental floss, a mouth gel, a tooth powder, a prophylaxis paste, dental varnish, a filling, e.g. a dental filling such as an root canal filling, a lozenge, and a gum.

28. The oral care product according to claim 27, wherein said oral care product is selected from the group consisting of dentrifice, mouth wash, mouth rinse and mouth spray.

29. The oral care product according to any one of claims 26-28, wherein said oral care product is a combination of any one of said oral care products.

30. A kit comprising an ASO according to any one of claims 1 -13 or a

composition according to any one of claims 20-24, a container comprising said ASO, and optionally instructions for its use.