WO2014110628A1

WO2014110628A1 - Gene and mutations thereof associated with seizure disorders

Info

Publication number: WO2014110628A1
Application number: PCT/AU2014/000028
Authority: WO
Inventors: Leanne Michelle Dibbens; Sarah Elizabeth Heron; Samuel Frank Berkovic; Ingrid Eileen Scheffer
Original assignee: Itek Ventures Pty Ltd; The University Of Melbourne
Priority date: 2013-01-18
Filing date: 2014-01-16
Publication date: 2014-07-24

Abstract

The present invention relates to the detection of seizure disorders such as epilepsy. Specifically, the present invention is directed to the identification of mutations and alterations in the Dishevelled, Egl-10 and Pleckstrin Domain Containing protein 5 (DEPDC5) gene that give rise to such disorders. The present invention enables methods for the diagnosis or prognosis of seizure disorders, and enables use of the DEPDC5 gene and its encoded polypeptide in drug screening assays for the identification of therapeutics for the treatment and/or prevention of such disorders. The present invention also encompasses isolated nucleic acid molecules and polypeptides, and fragments thereof, which have an alteration in the DEPDC5 gene and its encoded polypeptide that gives rise to a seizure disorder phenotype.

Description

„ ·ι ..

GE E AND MUTATIONS THEREOF ASSOCIATED WITH SEIZURE DISORDERS PRIORITY CLAIM

[0001 J This application claims priority from Australian provisional patent application number 2013900208 filed on 18 January 2013, and Australian provisional patent application number 2013903791 filed on 1 October 2013, the contents of which are to be taken as incorporated herein by this reference.

FIELD OF THE INVENTION

[0002] The present invention relates to the Dishevelled, Egl-10 and Piecksirin Domain Containing protein 5 gene (hereinafter "DEPDC5'}, and the Identification of mutations and variations In DEPDC5 that give rise to seizure disorders such as epilepsy, in view of the finding that OEPDC5 plays a role In these disorders, the present invention enables methods for the diagnosis or prognosis of seizure disorders, and enables use of the DEPDC5 gene and Its encoded polypeptide In drug screening assays for the Identification of therapeutics for the treatment and/or prevention of such disorders.

BACKGROUND OF THE INVENTION

[0003] Seizure disorders can be broadly characterised as those disorders which arise when the brain's electrical activity Is periodically disturbed, resulting in some degree of temporary brain dysfunction. Epilepsies constitute a diverse coliection of seizure disorders that affect about 3% of the population at some time in their lives. An epileptic seizure can be defined as an episodic change In behaviour caused by the disordered firing of populations of neurons In the central nervous system. This results i varying degrees of Involuntary muscle contraction and often a loss of consciousness.

[0004] Epilepsy syndromes have been classified into more than 40 distinct types based upon characteristic symptoms, types of seizure, cause, age of onset and Electroencephalography (EEG) patterns (Berg AT et a/, 2010, Ep/eps;a 51 : 676-685). However, the single feature that Is common to all epileptic syndromes Is the persistent increase in neuronal excitability that is both occasionally and unpredictably expressed as a seizure.

[0005] A genetic contribution to the aetiology of epilepsy has been estimated to be present In approximately 40% of affected Individuals. As epileptic seizures may be the end-point of a number of molecular aberrations that ultimately disturb neuronal synchrony, the genetic basis for epilepsy is likely to be heterogeneou There are over 200 endeilan diseases which Include epilepsy as part of the phenotype. In these diseases, seizures are symptomatic of uricSeri tng neuroSogicaS Involvement such as disturbances in brain structure or function in contrast, there are also a number of "pure" epiiepsy syndromes in which epilepsy is the sole manifestation in the affected individuals. These "pure" epiiepsy syndromes (previously termed Idiopathic epilepsies) account for over 60% of all epilepsy cases.

[0006] Idiopathic epilepsies have been further divided Into partial and generalized sub-types Partial (focal or local) epileptic fits arise from localized cortical discharges, so that only certain groups of muscles are Involved and consciousness may be retained. However, In generalized epilepsy, EEG discharge shows no focus such that all subcortical regions of the brain are Involved. Although the observation that generalized epilepsies are frequently Inherited Is understandable, the mechanism by which genetic defects, presumably expressed constftutiveiy in the brain, give rise to partial seizures is less clear

[0007] The majority of Idiopathic epilepsies are focal In origin with seizures emanating from one brain region Indeed, focal epilepsy accounts for more than half of diagnosed epilepsy cases. While genetic epilepsies, Including focal epilepsies, are often non-ieslonal (i.e. affected Individuals have apparent normal brain imaging), examples of structural genetic epilepsies (I.e. affected Individuals have detectable brain lesions) are well recognized The etiology of epiiepsy is unknown in the majority of patients although genetic factors play an Increasing role. For example, genetic linkage studies have Identified the chromosomal location of genes likely causative of various epilepsy syndromes.

[0008] One such "focal" epilepsy Is autosomal dominant Familial Focal Epilepsy with Variable Foci (FFEVF). FFEVF is remarkable since family members have seizures originating from different cortical regions of the brain without apparent brain lessons. FFEVF (OMiM 604364) was Initially described in a large family in which affected family members had electro-clinical seizures arising from different brain cortical regions. Seven further FFEVF families have since been reported. Affected family members have seizures arising from the frontal, temporal, frontal-temporal, parietal and occipital cortical regions. Seizure onset varies from Infancy to adult life. Affected Individuals typically have normal Intellect, although some family members also have intellectual disability, psychiatric features or autism spectrum disorders (ASD). Structural MR! studies are usually unremarkable indicating no apparent brain lesions. Families with FFEVF show an autosomal dominant Inheritance pattern of focal epilepsy with marked intra-farni!ia! variation in severity. However, as for many of the epilepsies, the actual molecular genetic basis of FFEVF has yet to be resolved. [0009] Accordingly, there is a need for the identification of the causative gene(s) for seizure disorders, including epilepsy disorders such as non-ieslonal focal epilepsy and focal epilepsy associated with structural brain lesions and malformations of cortical development Genes involved In these disorders will form the basis of diagnostic and therapeutic applications for patients with the disorders. This will enable proper management of affected Individuals and will avoid over-Investigation and over-treatment of patients

[0010] The discussion of documents, acts, materials, devices, articles and the l ke is Included in this specification solely for the purpose of providing a context for the present Invention. It is not suggested or represented that any or all of these matters formed past of the prior art base or were common general knowledge in the field relevant to the present Invention as It existed before the priority date of each claim of this application.

SUG Y OF THE I VE TIO

[0011] The present Invention is predicated in part on the identification of a causative gene for seizure disorders, including epilepsy. In this regard, the Inventors have identified mutations In the Ofsfteve/ied Egi-10 arid PfeeKsm^:n Domain Containing protein 5 (D£f^:5DC55 gene In individuals with Familial Focal Epilepsy with Variable Foci (FFEVF) as well as in individuals with sporadic focal epilepsies This enables methods for the diagnosis or prognosis of seizure disorders, and enables screening methods based on DEPDC5 for the Identification of potential new therapeutic agents for the treatment of these disorders.

[0012] Accordingly, in a first aspect the present invention provides a method for the diagnosis or prognosis of a seizure disorder In a subject, the method including testing for the presence of an alteration in the DEPDC5 gene In the subject.

[0013] In one embodiment, the presence of an alteration in the DEPDC5 gene in the subject establishes a diagnosis or prognosis which will Indicate a high probability of the disorder in the subject. In one embodiment, the presence of an alteration In the DEPDC5 gene In the subject which Is also present in an affected parent or relative of the subject, establishes a diagnosis or prognosis which will Indicate a very high probability of the disorder In the sublect.

[0014] In a second aspect the present invention provides a method for identifying a subject with an Increased likelihood of having an offspring predisposed to a seizure disorder, the method including testing for the presence of an alteration in the DEPDC5 gene in the subject. [0015] in one embodiment, the presence of an alteration in the DEPDC5 gene in the subject identifies the subject as a subject with an increased likeilhood of having an offspring predisposed to a seizure disorder. In one embodiment, the presence of an alteration In the DEPDCS gene in the subject which Is also present in an affected parent or relative of the subject Identifies the subject as a subject with very high likelihood of having an offspring predisposed to a seizure disorder.

[0016] In some embodiments of the first and second aspects of the Invention, the seizure disorder is epilepsy. In one embodiment, the epilepsy is focal epilepsy, in one embodiment, the focal epilepsy is Familial Focal Epilepsy with Variable Foci (FFEVF).

[0017] In some embodiments of the first and second aspects of the Invention the method Includes performing one or more assays to test for the presence of an alteration In the DEPDC5 gene and to Identify the nature of the alteration.

[0018] in some embodiments of the first and second aspects of the invention the method includes: ( 1) performing one or more assays to test for the presence of an alteration In the DEPDCS gene, and, if the results indicate the presence of an alteration in the DEPDCS gene, (2) performing one or mere assays to identify the nature of the DEPDC6 alteration,

[0019] In some embodiments, the one or more assays are selected from the group consisting of DNA sequencing, DMA hybridisation, high performance liquid chromatography, an e!ectrophoretlc assay, SSCP analysis, RNase protection, DGGE, an enzymatic assay, and an immunoassay,

[0020] In some embodiments of the first and second aspects of the invention the DEPDCS alteration Is a nonsense mutation in DEPOC5.

[0021] In one embodiment, the nonsense mutation is the result of a cytosine (C) to guanine (G) nucleotide substitution at position 21 of the coding sequence of the DS^:>DC5 gene (C.21C--G), said coding sequence of the DEPDCS gene set forth in SEQ ID NO: 121 and represented by GenBank Accession No. MJ3G 1242896.1 . In one embodiment, the coding sequence of DE ^::!DC5 Including the nonsense mutation is set forth in SEQ ID MO: 1. in one embodiment, the nonsense mutation encodes a truncated DEPDC5 polypeptide (p.Tyr?^*) Including the amino acid sequence set forth In SEQ ID NO: 2. [0022] In one embodiment, the nonsense mutation is the result of a cytosine (C) to thymine (T) nucleotide substitution at position 1663 of the coding sequence of the DEPDC5 gene (0.18630—7), said coding sequence of ths DEPDC5 gene set forth in SEQ ID NO: 121 and represented by GenBank Accession No. NIVM301242396.1 . In one embodiment, the coding sequence of DEPDC5 including the nonsense mutation is set forth In SEQ ID NO: 3. in one embodiment, the nonsense mutation encodes a truncated DEPDC5 polypeptide (p.ArgSSSD including the amino acid sequence set forth In SEQ ID NO: 4.

[0023] In one embodiment, the nonsense mutation Is the result o? a guanine (G) to adenine (A) nucleotide substitution at position 410? of the coding sequence of the DEPDCS gene (C.4107G—A), said coding sequence of the DEPDC5 gene set forth in SEQ ID NO: 121 and represented by GenBank Accession No. N JD01242896, 1 . In one embodiment, the coding sequence of DEPDCS Including the nonsense mutation is set forth In SEQ ID NO: 5. in one embodiment, the nonsense mutation encodes a truncated DEPDCS polypeptide (p.Tfp1369*> Including the amino acid sequence set forth In SEQ ID NO: 6,

[0024] In one embodiment, the nonsense mutation is the result o? a cytosine (C) to thymine (T) nucleotide substitution at position 4606 of the coding sequence of the DEPDCS gene (C.4606C— ), said coding sequence of the DEPDCS gene set forth in SEQ ID NO: 121 and represented by GenBank Accession No. N __001242396.1 . In one embodiment, the coding sequence of DEPDCS Including the nonsense mutation Is set forth In SEQ ID NO: 7. in one embodiment, the nonsense mutation encodes a truncated DEPDCS polypeptide ( .Gin 1536*} including the amino acid sequence set forth In SEQ ID NO: 3,

[0025] In one embodiment, the nonsense mutation is the result of a guanine (G) to adenine (A) nucleotide substitution at position 4337 of the coding sequence of the DEPDCS gene (C.4397G—A), said coding sequence of the DEA^DCo gene set forth In SEQ ID NO: 121 and represented by GenBank Accession No. N .001242396.1 . In one embodiment, the coding sequence of DEPDCS including the nonsense mutation Is set forth In SEQ ID NO: 9. in one embodiment, the nonsense mutation encodes a truncated DEPDCS polypeptide (p.Trp1 66*) Including the amino acid sequence set forth In SEQ ID NO: 10.

[0028] In one embodiment, the nonsense mutation is the result of a cytosine (C) to thymine (T) nucleotide substitution at position 1459 of the coding sequence of the DEPDCS gene (c. 1459C-~>7), said coding sequence of the DEPDCS gene set forth in SEQ ID NO: 121 and represented by GenBank Accession No. N J3Q1242396.1 . In one embodiment, the coding sequence of DEPDCS Including the nonsense mutation is set forth In SEQ ID NO: 11. In one embodiment. the nonsense mutation encodes a truncated DEPOCS polypeptide (p.Arg487*) Including the amino acid sequence set forth in SEQ ID NO: 12.

[0027] In one embodiment, the nonsense mutation is the result of a cytosine (C) to thymine (T nucleotide substitution at position 2527 of the coding sequence of the DEPDCS gene (c.2527C-→T}, said coding sequence of the DEPOCS gene set forth in SEQ ID NO: 121 and represented by GenBank Accession No. NMJ3G 1242896.1 , In one embodiment, the coding sequence of DEPDCS including the nonsense mutation is set forth in SEQ ID NO: 18. In one embodiment, the nonsense mutation encodes a truncated DEPDCS polypeptide {p.Arg843*) Including the amino acid sequence set forth In SEQ ID NO: 14.

[0028] In one embodiment, the nonsense mutation Is the result of a cytosine (C) to thymine (I) nucleotide substitution at position 3802 of the coding sequence of the DEPDCS gene (C.38G2C-VT), said coding sequence of the DEPDCS gene set forth in SEQ ID NO: 121 and represented by GenBank Accession No. MJ3G 242896.1 , In one embodiment, the coding sequence of DEPDCS including the nonsense mutation Is set forth in SEQ ID NO: 15. In one embodiment, the nonsense mutation encodes a truncated DEPDCS polypeptide (p.Arg1288*) Including the amino acid sequence set forth in SEQ ID NO: 16.

[0029] In some embodiments of the first and second aspects of the Invention the DEPDCS alteration is a deletion mutation In DEPDCS.

[0030] In one embodiment, the mutation is the result of a deletion of the thymine (T), guanine (G), and thymine (T) nucleotide residues at positions 488-490 of the coding sequence of the DEPDCS gene (c.488-490delTGT), said coding sequence of the DEPDCS gene set forth In SEQ I D NO: 121 and represented by GenBank Accession No. NM_„001242896.1. In one embodiment, the coding sequence of DEPDCS Including the deletion mutation Is set forth In SEQ ID NO: 17. In one embodiment, the deletion mutation encodes a DEPDC6 polypeptide (p.Val163delPhe) Including the amino add sequence set forth In SEQ ID NO: 18.

[0031] In some embodiments of the first and second aspects of the Invention the DEPDCS alteration Is a mlssense mutation in DEPOCS.

[0032] In one embodiment, the missense mutation Is the result of a cytosine (C) to thymine (T) nucleotide substitution at position 331 1 of the coding sequence of the DEPDCS gene (C.3311 C---.T), said coding sequence of the DEPDCS gene set forth in SEQ ID NO: 121 and represented by GenBank Accession No. N JD01242896.1. In one embodiment, the coding sequence of DEPDC5 including the missense mutation Is set forth in SEQ ID NO: 19. in one embodiment, the missense mutation encodes a DEPDC5 polypeptide Including a serine (S) to leucine (L) amino add substitution at amino acid position 1104 (p.Ser l04Leu), said polypeptide including the amino acid sequence set forth in SEQ I D NO: 20,

[0033] In one embodiment, the missense mutation is the result of a adenine (A) to cyiosine (C) nucleotide substitution at position 3217 of the coding sequence of the DEPDC5 gene (c.3217A--→C), said coding sequence of the D£/^::!DC5 gene set forth in SEQ ID MO: 121 and represented by GenBank Accession No. Ν _0ϋ 1242896.1. In one embodiment, the coding sequence of DEPOCS Including the missense mutation is set forth In SEQ ID NO: 21 . In one embodiment, the missense mutation encodes a DEPOCS polypeptide Including a serine (S) to Arginine (R) amino acid substitution at amino acid position 1073 (p.Ser1073Arg}_; said polypeptide including the amino acid sequence set forth In SEQ I D NO: 22.

[0034] In one embodiment, the missense mutation Is the result of a cytosine (C) to thymine (T) nucleotide substitution at position 1355 of the coding sequence of the DEPDCS gene (c.1355C--*T}_: said coding sequence of the DEPDCS gene set forth in SEQ ID NO: 121 and represented by GenBank Accession No. N _...001242896. . In one embodiment, the coding sequence of DEPDC5 Including the missense mutation Is set forth In SEQ ID NO: 23. in one embodiment, the missense mutation encodes a DEPDC5 polypeptide Including an alanine (A) to valine (V) amino acid substitution at amino acid position 452 (p.Ala452Val)_; said polypeptide Including the amino acid sequence set forth In SEQ I D NO: 24.

[0035] In some embodiments of the first and second aspects of the Invention the DEPOCS alteration Is a splice Site mutation In DEPDCS.

[0036] In one embodiment the splice site mutation Is the result of a guanine (G) to adenine (A) nucleotide substitution at position ÷1 of Intron 4 of DEPDCS (c.193+1G--*A; IV$4*1G->A), wherein the DEPDCS gene Is represented by GenBank Accession No. N J301242896 1. in one embodiment, the nucleotide sequence including the splice site mutation Is set forth In SEQ ID NO. 25.

[0037] In one embodiment, the splice site mutation Is the result of a guanine (G) to adenine (A) nucleotide substitution at position +1 of intron 5 of OP QO (c.279-MG- A: IVSS- 1G---.A), wherein the DEPDCS gene Is represented by GenBank Accession No. N _0Q1242896.1. In one embodiment, the nucleotide sequence including the splice site mutation Is set forth in SEQ ID NO: 26. - δ -

[0038] in some embodiments of the first and second aspects of the invention the DEPDC5 alteration is a synonymous mutation,

[0039] in one embodiment, the synonymous mutation is the resuit of a cytosine (C) to thymine (T) nucleotide substitution at position 4512 of the coding sequence of the DEPDC5 gene (α45120-→ϊ}_; said coding sequence of the DEPDC5 gene set forth in SEQ i D NO: 121 and represented by GenBank Accession No, NIV 301242898.1. in one embodiment, the coding sequence of D£f^sDC5 including the synonymous mutation Is set forth in SEQ ID MO: 27,

[0040] in a third aspect, the present Invention provides an isolated nucleic acid molecule Including an alteration In the DEPDC5 gene, wherein said alteration produces a seizure disorder phenotype.

[0041] in one embodiment, the alteration is a nonsense mutation in DEPDC5. In one embodiment, the Isolated nucleic acid molecule Includes the sequence set forth In any one of SEQ ID NOs: 1 , 3, 5, 7, 9, 1 1 , 13 and 15. In one embodiment, the nucleic acid molecule encodes a DEPDC5 polypeptide including the amino acid sequence set forth in any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14 and 16.

[0042] In one embodiment of the third aspect of the invention, the alteration Is a deletion mutation in DEPDC5. In one embodiment, the nucleic acid molecule includes the sequence set forth In SEQ ID NO: 17. in one embodiment, the nucleic acid molecule encodes a DEPDC5 polypeptide Including the amino acid sequence set forth in SEQ ID NO: 8.

[0043] In one embodiment of the third aspect of the Invention, the alteration Is a mlssense mutation in DEPDC5. in one embodiment, the nucleic acid molecule Includes the sequence set forth In any one of SEQ I D NOs: 19, 21 and 23. in one embodiment, the nucleic acid molecule encodes a DEPDC5 polypeptide Including the amino acid sequence set forth In any one of SEQ ID NOs: 20, 22 and 24.

[0044] In one embodiment of the third aspect of the Invention, the alteration Is a spiles site mutation in DEPDCS. in one embodiment, the nucleic acid molecule Includes the sequence set forth In SEQ I D NO: 25 or SEQ ID NO: 26. [0045] In one embodiment of the third aspect of the invention, the alteration is a synonymous mutation In DEPDC5. in one embodiment, the nucleic acid molecule Includes the sequence set forth in SEQ I D NO: 27.

[0046] In a fourth aspect the present invention provides an Isolated nucleic acid molecule including a fragment of the DEPDC5 gene, wherein said nucleic acid molecule Includes a mutation In DEPDC5, said mutation selected from the group consisting of c.21C ~ 5, c.1663C-0\ c.4107G-->A, c.4606C-->7\ c4397G-->A, α 14590--2Γ, c.2527C-->T, C.3802C-O^', c.488-490deiTGT, C.331 1 C--+T, C.3217A--C, c.1355C--*T, c.193+1 G-→A <!VS4+1G-→A), c.279+1G~»A (IV8S+1 G-->A), and c 45l 20· -T wherein the DEPDCS gene is represented by GenBank Accession No. MM...001242896.1 .

[0047] In one embodiment, the nucleic acid molecule Includes a nucleotide sequence at least 95% Identical to at least about 20 contiguous nucleotides of SEQ ID NO: 1 and includes the c.21C-»G mutation. In one embodiment, the nucleic acid molecule includes a nucleotide sequence at least 95% identical to at least about 20 contiguous nucleotides of SEQ ID NO: 3 and includes the c.1683C-→T mutation. In one embodiment, the nucleic acid molecule Includes a nucleotide sequence at least 95% identical to at least about 20 contiguous nucleotides of SEQ ID NO: 5 and includes the c.41Q7G-→A mutation. In one embodiment, the nucleic acid molecule Includes a nucleotide sequence at least 95% Identical to at least about 20 contiguous nucleotides of SEQ ID NO: 7 and Includes the c.4608C--→T mutation. In one embodiment, the nucleic acid molecule includes a nucleotide sequence at least 95% identical to at least about 20 contiguous nucleotides of SEQ ID NO: 9 and Includes the c.43S7G-÷A mutation. In one embodiment the nucleic acid molecule Includes a nucleotide sequence at least 95% Identical to at least about 20 contiguous nucleotides of SEQ ID NO: 11 and Includes the c.14S8C--→T mutation. In one embodiment, the nucleic acid molecule includes a nucleotide sequence at least 95% Identical to at least about 20 contiguous nucleotides of SEQ ID NO: 13 and Includes the c.2527C~ T mutation. In one embodiment, the nucleic acid molecule Includes a nucleotide sequence at least 95% Identical to at least about 20 contiguous nucleotides of SEQ ID NO: 15 and Includes the G.3802C-O^' mutation. In one embodiment, the nucleic acid molecule includes a nucleotide sequence a? least 95%. Identical to at least about 20 contiguous nucleotides of SEQ ID NO: 17 and Includes the c.488- 490delTGT mutation, in one embodiment, the nucleic acid molecule Includes a nucleotide sequence at least 95% Identical to at least about 20 contiguous nucleotides of SEQ I D NO: 19 and Includes the c.331 1 C-~>T mutation In one embodiment the nucleic acid molecule Includes a nucleotide sequence at least 35% identical to at least about 20 contiguous nucleotides of SEQ I D NO: 21 and Includes the c.3217A--*C mutation. In one embodiment, the nucleic acid molecule includes a nucleotide sequence at least 95% identical to at ieast about 20 contiguous nucleotides of SEQ ID NO: 23 and includes the c.1355C-*T mutation. In one embodiment, the nucleic add molecule Includes a nucleotide sequence at Ieast 95% identical to at ieast about 20 contiguous nucleotides of SEQ I D MO: 25 and Includes the C.133+1G--A (!VS4'i- 1 G-→A) mutation. In one embodiment, the nucleic acid molecule includes a nucleotide sequence at Ieast 95% Identical to at Ieast about 20 contiguous nucleotides of SEQ ID MO: 26 and includes the o 27¼* 1G--A (iVS5÷1G→A) mutation. In one embodiment, the nucleic acid molecule includes a nucleotide sequence at Ieast 95% identical to at Ieast about 20 contiguous nucleotides of SEQ I D NO: 2? and Includes the C.4 - 20 T mutation .

[0048] In some embodiments of the third and fourth aspects of the Invention, the disorder is epilepsy. In one embodiment, the epilepsy is focal epilepsy. In one embodiment, the focal epilepsy is Familial Focal Epilepsy with Variable Foci (FFEVF).

[0G4S] in a fifth aspect, the present Invention provides an Isolated polypeptide, wherein said polypeptide is a DEPDG5 polypeptide Including an alteration, wherein said alteration produces a seizure disorder phenoiype.

[OOSOj In one embodiment, the alteration Is encoded by a nonsense mutation in DEPDC5. In one embodiment, the polypeptide Includes the amino acid sequence set forth In any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14 and 16

[0051] In one embodiment of the fifth aspect ot the Invention, the alteration Is a deletion mutation. In one embodiment, the polypeptide Includes the amino acid sequence set forth In SEQ ID MO: 18

[00S2] In one embodiment of the fifth aspect of the Invention, the alteration Is a mlssense mutation. In one embodiment, the polypeptide Includes the amino acid sequence set forth In any one of SEQ ID NOs: 20, 22 and 24.

[0053] In a sixth aspect, the present Invention provides an isolated polypeptide Including a fragment of the DEPDC5 polypeptide, wherein said polypeptide Includes a mutation In DEPDC5, said mutation selected from the group consisting of p.\/al163delPhe, p.Ser1 104Leu, p.Ser1073Arg, and p.Ala452Val. [0054] in one embodiment, the polypeptide includes an am no acid sequence at least 95% identical to at least about 20 contiguous amino acids of SEQ ID NO: 18 and includes the p,Val163delPhe mutation. In one embodiment, the polypeptide includes an amino add sequence at least 95% Identical to at least about 20 contiguous amino acids of SEQ I D NO: 20 and Includes the p.Ser1104L.eu mutation. In one embodiment, the polypeptide includes an amino acid sequence at least 95% Identical to at least about 20 contiguous amino acids of SEQ ID NO: 22 and includes the ρ Ser1073Arg mutation. In one embodiment, the polypeptide includes an amino acid sequence at least 95% identical to at least about 20 contiguous amino acids of SEQ ID NO: 24 and Includes the p.Ala452Val mutation.

[OOSSj In some embodiments of the fifth and sixth aspects of the invention, the disorder is epslepsy. In one embodiment, the epilepsy Is focal epilepsy. In one embodiment, the focal epilepsy Is Familial Focal Epilepsy with Variable Foci (FFEVF).

[0056] In a seventh aspect, the present Invention provides an isolated cell Including an Isolated nucleic acid molecule according to a third or fourth aspect of the Invention.

[DOST] in an eighth aspect, the present invention provides a genetically modified non-human animal Including a nucleic acid molecule according to a third or fourth aspect of the Invention. In one embodiment, the non-human animal Is selected from the group consisting of a rat, mouse, hamster, guinea pig, rabbit, dog, cat, goat, sheep, pig and non- human primate.

[DOSS] In a ninth aspect, the present invention provides an antibody or fragment thereof which specifically binds to an Isolated polypeptide according to a fifth or sixth aspect of the Invention.

[0QS9] In a tenth aspect, the present Invention provides an antibody or fragment thereof which detects a polypeptide according to a fifth or sixth aspect of the Invention, Is truncated when compared to a wi!d-t pe DEPDC5 polypeptide the sequence of which Is set forth In SEQ I D NO: 122 and represented by GenBank Accession No. NP.J301229825 1 , and wherein said antibody or fragment thereof binds to the truncated region of said polypeptide.

[0080] In an eleventh aspect, the present invention provides a kit for diagnosing or prognoslng a seizure disorder In a subject, or for identifying a subject with an increased likelihood of having an offspring predisposed to a seizure disorder, said kit including one or more components for testing for the presence of an alteration In the DEPDC5 gene in the subject. In one embodiment, the one or more components are selected from the group consisting of: (i) an antibody or fragment thereof which specifically binds to a polypeptide according to a fifth or sixth aspect of the invention. (II) an antibody or fragment thereof which detects a polypeptide according to a fifth or sixth aspect of the Invention, wherein said polypeptide is truncated when compared to a wild-type DEPDCS polypeptide the sequence of whsch Is set forth In SEQ I D NO: 122 and represented by GenBank Accession No. NP_001229825.1 , and wherein said antibody or fragment thereof binds to the truncated region of said polypeptide, and (III) a nucleic acid molecule which specifically hybridises to a nucleic acid molecule according to a third or fourth aspect of the Invention.

BRIEF DESCRIPTION OF THE FIGURES

[0061 J For a further understanding of the aspects and advantages of the present Invention, reference should be made to the following detailed description, taken In conjunction with the accompanying drawings.

[0062] FIGURE 1 -- Pedigrees of large families with Familial Focal Epilepsy with Variable Foci (FFEVF), showing segregation of the DFPOCo mutation within each family, individuals with a mutation In DEPOC5 are Indicated by m/÷ and Individuals tested for mutations and found to be negative are indicated by +/+. Individuals for whom the presence of a mutation was inferred based on its presence in relatives are indicated by (m/+). To maximize confidentiality, genders of family members, proband Identity and alive/deceased status have been removed In pedigree D1.

[0063] FIGURE 2 ··· Pedigrees of smaller families with FFEVF. Individuals with a mutation In DEPDCS are Indicated by m/+ and individuals tested for mutations and found to be negative are Indicated by +/+. Individuals for whom the presence of a mutation was Inferred based on Its presence In relatives are Indicated by (mFH.

[0084] FIGURE 3 - Diagram of the DEPDCS protein showing the position of the mutations found in each family (letter coded) with FFEVF. The positions of a highly evolutionary conserved, but functionally uncharacterlzed, protein domain (yellow box) and the DEP domain (orange box) are a!so indicated.

[0065] FIGURE 4■■- A graph showing the expression of mouse DepdcS in various mouse tissues as determined by quantitative RT-PCR. Gene expression is shown relative to the least abundant tissue (liver) and normalised to the low abundance reference gene L33. PGR products were sequence-verified and --RT and water controls showed no amplification (not shown), confirming specificity of the PGR products The experiment was repeated three times on the same series of cDNA and er or bars represent one standard deviation from the mean. Similar results were obtained using eEF2 as the reference gene.

[0086] FIGURE 5 ·- Images showing DepdcS protein localization in adult mouse brain. Panels A-D show confoca! Images of Immunofluorescence analyses. (A) double immunostatning with DAPI stained nuclei shown In a (blue}_: D19 DEPDC5 antibody (b, green) and a neuron-specific NeuN antibody (c, red). The merged image (d) shows co- localization of DEPDCS with NeuN In neuronal cells. (B) double i rnunostainlng with DAPI stasned nuclei are shown in a (biue), 19 DEPDCS antibody (b, green) and a AP2 antibody (c, red). The merged Image (d) demonstrates the absence of DEPDCS signal In AP2 positive neuronal processes. (C) double Irnmunostalnlng with DAPI stained nuclei are In a (blue) , D 19 DEPDCS antibody (b, green) and a GAD67 antibody (c, red). The merged image (d) demonstrates the absence of DEPDCS signal In GADS? positive cell bodies. (D) double irnmunostalnlng with DAPI stasned nuclei are In blue a (biue) , D19 DEPDCS antibody (b, green) and a GFAP antibody (o, red). The merged Image (4) demonstrates the absence of DEPDCS signal In GFAP-posltlve astrocytes. Scale bars: 10 prn .

[0067] FIGURE S - Images showing DEPDCS protein localization after induction of neuronal differentiation of neurospheres derived from human Induced p!uripotent stem cells of control Individuals. Panels A-D show confoca! Images of Immunofluorescence analyses. (A) double immunosiaining with DAPI stasned nuclei shown In a (blue), D19 DEPDCS antibody (b, green) and a 80X2-specific antibody (c, red). The merged image (d) shows localisation of DEPDC5 in cells labelled with the SOX2 neural precursor marker, (B) double irnmunostalnlng with DAPI stained nuclei are shown in a (blue) , D19 DEPDCS antibody (b, green) and a neuron-specific NeuN antibody (c, red). The merged image (d) shows co- localisation of DEPDCS with NeuN in neuronal cells. (C) double i munostainlng with DAPI stained nuclei are in a (blue), D19 DEPDCS antibody (b, green) and a GFAP-speclfic antibody (c, red). The merged Image (d) demonstrates the absence of DEPDCS signal In cells expressing the astroglial marker GFAP. (D) the fluorescence signal of a series of three cells (a , red arrow) was quantitatively analysed In separate channels (DEPDCS and DAPI), as shown In the histogram (b) . This graphical analysis suggests that DEPDCS Is much more abundant In the cytosol than In the nucleus of neuronal cells derived from human IPS cells. Scale bars: panel A 50 μ , all other Images 20 μ .

[0068] FIGURE 7 - Confoca! images showing that DEPDCS blocking peptide confirms specificity of DepdcS protein localization In adult mouse brain. (A) double immunostainlng with DAP! stained nuclei shown in a (biue), D19 DEPDCS antibody pre-!ncubated with a 5- fold excess of blocking peptide (b, green) and a neuron-specific NeuN antibody (c, red). The merged Image Is In d. The loss of DEPDC5 signal after antibody pre-lncubatlon with the blocking peptide (b, ύ) confirms the DEPDC5 spsclfldty of the D19 antibody In immunofluorescence experiments. (B) the fluorescence signal of a representative cell (a, red arrow) was quantitatively analyzed in separate channels (DEPDC5 and DAPi}, as shown in histogram (b). This graphical analysis suggests that DEPDC5 is more abundant in the cytosol than In the nucleus of neuronal cell bodies i adult mouse brain. Scale bars: panel A 20 μΜ, all other Images 10 μΜ.

[0069] FIGURE 8 ···^■ Western blot analysis of DepdcS protein In mouse neural tissue and DEPDC5 In a human neuroblastoma cell line. Western blot analysis was performed on proteins extracted from (A) a half hemisphere of a FVBN wild type mouse brain and (B) from SH-SY5Y human neuroblastoma cells. In each panel, the lanes labelled C and N represent cytosollc and nuclear fractions, respectively. Membranes labelled as DEPDCS were incubated with the D19 DEPDCS antibody without blocking peptide pre-incubation. Membranes labelled as DEPDCS+BP were Incubated with D19 antibody after pre-lncubatlon with a five-fold excess of blocking peptide. A major 170kD band, corresponding to the longest predicted DEPDCS Isoform was detected In both SH-SY5Y human cells and mouse brain (arrow). This band disappears after competition with blocking peptide. Additional lower molecular weight bands, mostly detected In mouse brain, are only partially competed out by the blocking peptide, so they may be non-specific. Hybridization signal obtained with an antics tubulin antibody is shown as a loading control at the bottom of each lane.

[0070] FIGURE 9■■·■ Pedigrees of focal epilepsy families including affected individuals with ηοπ-!esional and leslonal epilepsy. Individuals who have a DEPDCS mutation are denoted by ml* and those negative for mutations are denoted by +/+. (A) Pedigree o Australian family B having the c.418C~»T (p.Gin140*) alteration. Individual B; li l:2 (bottom left): Coronal T1 Image showing cortical thickening and loss of grey-white differentiation at the bottom of a sulcus In the right middle frontal lobe, individual 8: 111 :8 (bottom right): Coronal T1 Image showing cortical thickening and loss of grey-white differentiation at the bottom of an abnormal sulcus In the right medial superior frontal lobe. (B) Partial pedigree of Family A1 of Figure 1 (truncated from [1]) . Individual A1 :V:8 Axial (left) and sagittal T1 (right) images show cortical thickening and loss of grey-white differentiation Involving the depths of two adjacent abnormal sulci in the left superior frontal lobe. (C) Pedigree of Family I shown in Figure 2. Individual l:IV:1 : Axial T1 Image (upper) shows blurring of grey-white differentiation involving part of the clngulate cortex and left frontal cortex. Coronal T1 Image (lower) shows subtle band heterotopia In the subcortices white matter adjacent to dysplastic cortex in the left frontal lobe,

DETAILED DESCRIPTION OF THE INVENTION

[0071] Nucleotide and polypeptide sequences are referred to herein by a sequence identifier number (SEQ ID NO:}. A summary of the sequence Identifiers Is provided in Table 1. A sequence listing has also been provided at the time of filing this application.

TABLE 1

ary of Sequence Identifiers

Sequence

Description

identifie

SEQ ID NO 1 D£ ^:5DC5 nonsense mutation (c 21C— >G)■--· nucleotide sequence

SEQ ID NO 2 Amino acid sequence encoded by the c,21 C-→G mutation

SEQ ID NO 3 DEPDC5 nonsense mutation (c.1663C-→T) - nucleotide sequence

SEQ ID NO 4 Amino acid sequence encoded by the c.1663C-->T mutation

SEQ ID NO 5 DEPDC5 nonsense mutation (c,4107G~*A) - nucleotide sequence

SEQ ID NO 6 Amino acid sequence encoded by the c.4107G--→A mutation

SEQ ID NO 7 DEPDC5 nonsense mutation ic.46G6C~VT) - nucleotide sequence

SEQ ID NO 8 Amino acid sequence encoded by the c.4606C- ·--·>! mutation

SEQ ID NO 9 DEPDC5 nonsense mutation (c,4397G~*A) - nucleotide sequence

SEQ ID NO 10 Amino acid sequence encoded by the c.4397G--*A mutation

SEQ ID NO 11 QEPDC5 nonsense mutation (c.1459C~»T) - nucleotide sequence

SEQ ID NO 12 Amino acid sequence encoded by the C.1459C---7]^" mutation

SEQ ID NO 13 QEPDC5 nonsense mutation (c.2527C~*T) - nucleotide sequence

_; S Q ID NO 14 Amino acid sequence encoded by the c.2527C-~>T mutation

SEQ ID NO 15 DEPDC5 nonsense mutation (c.3802C-*T) - nucleotide sequence _t SEQ ID NO 16 Amino acid sequence encoded by the c.38G2C→T mutation

t SEQ ID NO 17 DEPDC5 deletion mutation (c.488-490delTGT)^■- nucleotide sequence _k SEQ ID NO 18 Amino acid sequence encoded by the c,488-490de!TGT mutation _t SEQ ID NO 13 DEPDC5 missense mutation (c,331 1 C-→T) - nucleotide sequence

" SEQ ID NO 20 Amino acid sequence encoded by the c.3311C-→T mutation

t SEQ ID NO 21 DEPDC5 missense mutation (C.3217A— >C) - nucleotide sequence

_^ SEQ ID NO 22 Amino acid sequence encoded by the c.321?A-»C mutation

_ SEQ ID NO 23 DEPDC5 missense mutation (c .1355C-→T) - nucleotide sequence

SEQ ID NO 24 Amino acid sequence encoded by the c.1355C~»T mutation

SEQ ID NO 25 _w DEPO 5 splice site mutation {C.193+1G—A; IVS4-MG— A)

k SEQ ID NO- 28 _ DEPOC5 splice site mutation {c.278*1G->A; iV55÷1 G~>A)

SEQ ID O: 27 DEPDC5 synonymous mutation {e.4512C-»T)

k SEQ ID NO: 28 _ Oligonucleotide Primer^■· c.48S-490delTGT screening

SEQ ID NO' 29 _^ Oligonucleotide Primer^■· c.488-490delTGT screening

SEQ ID NO' 30 Oligonucleotide Primer■- e.488-490delTGT screening

SEQ ID NO: 31 HRM Analysis Oligonucleotide Primer - DEPDC5 Exon 2F

SEQ ID NO: 32 _k HRM Analysis Oligonucleotide Primer - DEPDC5 Exon 2R

t SEQ ID NO: 33 _k HRM Analysis Oligonucleotide Primer - DEPDC5 Exon 3F

SEQ ID NO: 34 _k HRM Analysis Oligonucleotide Primer - DEPDC5 Exon 3R

SEQ ID NO: 35 HRM Analysis Oligonucleotide Primer - DEPDC5 Exon 4F Sequence

Description

Iden ifier

SEQ ID NO 36 _k HRM Analysis Oligonucleotide Primer - DEPDC5 Exon 4R

SEQ ID NO 37 HRM Analysis Oligonucleotide Primer - DEPDC5 Exon 5F

SEQ ID NO 38 HRM Analysis Oligonucleotide Primer - DEPDC5 Exon 5R

SEQ ID NO 39 HRM Analysis Oligonucleotide Primer - DEPDGS Exon 6F

SEQ ID NO 40 HRM Analysis Oligonucleotide Primer - DEPDGS Exon 6R

SEQ ID NO 41 HRM Analysis Oligonucleotide Primer - DEPDGS Exon 7F

SEQ ID NO 42 HRM Analysis Oligonucleotide Primer - DEPDGS Exon 7R

SEQ ID NO 43 HRM Analyse Oligonucleotide Primer■-·■ DEPDGS Exon 8F

SEQ ID NO 44 HRM Analysis Oligonucleotide Primer - DEPDGS Exon 8R

SEQ ID NO 45 _L HRM Analysis Oligonucleotide Primer - DEPDGS Exon 9F

SEQ ID NO 48 HRM Analysis Oligonucleotide Primer■-·■ DEPDGS Exon 9R

SEQ ID NO 47 HRM Analysis Oligonucleotide Primer^■-·^■ DEPDGS Exon 10F

SEQ ID NO 48 HRM Analysis Oligonucleotide Primer^■··^■ DEPDC5 Exon 10R

SEQ ID NO 49 HRM Analysis Oligonucleotide Primer^■··^■ DEPDGS Exon 11 F

SEQ ID NO 50 HRM Analysis Oligonucleotide Primer^■-·- DEPDGS Exon 11 R

SEQ ID NO 51 HRM Analysis Oligonucleotide Primer DEPDGS Exon 12F

52 HRM Analysis Oligonucleotide Primer■··■ DEPDGS Exon 12R

SEQ D NO 53 HRM Analysis Oligonucleotide Primer - DEPDGS Exon 13F

SEQ ID NO 54 HRM Analysis Oligonucleotide Primer - DEPDGS Exon 13R

SEQ D NO 55 HRM Analysis Oligonucleotide Primer ~- DEPDGS Exon 14F

SEQ ID NO 56 HRM Analysis Oligonucleotide Primer - DEPDGS Exon 14R

SEQ ID NO 57 HRM Analysis Oligonucleotide Primer - DEPDGS Exon 15F _t SEQ D NO 58 HRM Analysis Oligonucleotide Primer - DEPDGS Exon 15R

_^ SEQ ID NO 59 HRM Analysis Oligonucleotide Primer -- DEPDGS Exon 16F

_ SEQ ID O 60 HRM Analysis Oligonucleotide Primer - DEPDCS Exon 16R SEQ ID NO 61 HRM Analysis Oligonucleotide Primer - DEPDCS Exon 17F

" SEQ ID NO 62 HRM Analysis Oligonucleotide Primer - DEPDCS Exon 17R _t SEQ ID NO 63 HRM Analysis Oligonucleotide Primer - DEPDCS Exon 18F _t SEQ ID NO 64 HRM Analysis Oligonucleotide Primer - DEPDCS Exon 18R _k SEQ ID NO 65 _v HRM Analysis Oligonucleotide Primer - DEPDC5 Exon 19F

^SEQ ID NO 66 _ HRM Analysis Oligonucleotide Primer™ DEPDCS Exon 19R

"^"SEQ ID NO 67 HRM Analysis Oligonucleotide Primer DEPDCS Exon 20F

SEQ ID NO 68 _fc HRM Analysis Oligonucleotide Primer --- DEPDCS Exon 20R _t SEQ ID NO 69 HRM Analysis Oligonucleotide Primer ··· DEPDCS Exon 21 F

SEQ ID NO 70 _v HRM Analysis Oligonucleotide Primer --- DEPDCS Exon 21 R

SEQ ID NO 71 HRM Analysis Oligonucleotide Primer --- DEPDCS Exon 22F

SEQ ID NO 72 _k HRM Analysis Oligonucleotide Prime -·- DEPDCS Exon 22R _k SEQ ID NO- 73 HRM Analysis Oligonucleotide Primer DEPDCS Exon 22aF

SEQ ID NO: 74 HRM Analysis Oligonucleotide Primer - DEPDCS Exon 22aR

SEQ ID NO: 75 _t HRM Analysis Oligonucleotide Primer - DEPDCS Exon 24F _t SEQ ID NO: 76 _t HRM Analysis Oligonucleotide Primer - DEPDCS Exon 24R

SEQ ID NO: 77 _k HRM Analysis Oligonucleotide Primer - DEPDCS Exon 25F

SEQ ID NO: 78 _t HRM Analysis Oligonucleotide Primer - DEPDCS Exon 25R

SEQ ID NO: 79 HRM Analysis Oligonucleotide Primer - DEPDCS Exon 26F

SEQ ID NO: 80 HRM Analysis Oligonucleotide Primer - DEPDGS Exon 26R

SEQ ID NO: 81 HRM Analysis Oligonucleotide Primer - DEPDCS Exon 26s F

SEQ ID NO: 82 HRM Analysis Oligonucleotide Primer - DEPDCS Exon 26aR

SEQ ID NO: 83 HRM Analysis Oligonucleotide Primer - DEPDCS Exon 27F

SEQ ID NO: 84 HRM Analysis Oligonucleotide Primer - DEPDCS Exon 27R Sequence

Description

Iden ifier

SEQ ID NO 85 _k HRM Analysis Oligonucleotide Primer - DEPDC5 Exon 28F

SEQ ID NO 86 HRM Analysis Oligonucleotide Primer - DEPDC5 Exon 28R

SEQ ID NO 87 HRM Analysis Oligonucleotide Primer - DEPDC5 Exon 29F

SEQ ID NO 88 HRM Analysis Oligonucleotide Primer - DEPDGS Exon 29R

SEQ ID NO 89 HRM Analysis Oligonucleotide Primer - DEPDGS Exon 30F

SEQ ID NO 90 HRM Analysis Oligonucleotide Primer - DEPDGS Exon 30R

SEQ ID NO 91 HRM Analysis Oligonucleotide Primer ~ DEPDGS Exon 31 F

SEQ ID NO 92 HRM Analyse Oligonucleotide Primer■-·■ DEPDGS Exon 31 R

SEQ ID NO 93 HRM Analysis Oligonucleotide Primer - DEPDGS Exon 32F

SEQ ID NO 94 _L HRM Analysis Oligonucleotide Primer - DEPDGS Exon 32R

SEQ ID NO 95 HRM Analysis Oligonucleotide Primer■-·■ DEPDGS Exon 33F

SEQ ID NO 96 HRM Analysis Oligonucleotide Primer^■-·^■ DEPDGS Exon 33R

SEQ ID NO 97 HRM Analysis Oligonucleotide Primer^■··^■ DEPDC5 Exon 33aF

SEQ ID NO 98 HRM Analysis Oligonucleotide Primer^■··^■ DEPDGS Exon 33aR

SEQ ID NO 99 HRM Analysis Oligonucleotide Primer^■-·- DEPDGS Exon 34F

SEQ ID NO 100 HRM Analysis Oligonucleotide Primer DEPDGS Exon 34R

101 HRM Analysis Oligonucleotide Primer■··■ DEPDGS Exon 35 F

SEQ D NO 102 HR Analysis Oligonucleotide Primer - DEPDGS Exon 35R

SEQ ID NO 03 HRM Analysis Oligonucleotide Primer - DEPDGS Exon 36F

SEQ D NO 104 HRM Analysis Oligonucleotide Primer - DEPDGS Exon 36R

SEQ ID NO 105 HRM Analysis Oligonucleotide Primer - DEPDGS Exon 37F

SEQ ID NO 06 HRM Analysis Oligonucleotide Primer - DEPDGS Exon 37R

t SEQ D NO 107 HRM Analysis Oligonucleotide Primer - DEPDGS Exon 38F

_^ SEQ ID NO 108 HRM Analysis Oligonucleotide Primer - DEPDCS Exon 38R

_ SEQ ID O I DS HRM Analysis Oligonucleotide Primer - DEPDCS Exon 39F

SEQ ID NO 110 HRM Analysis Oligonucleotide Primer - DEPDCS Exon 39R

" SEQ D NO 11 1 HRM Analysis Oligonucleotide Primer - DEPDCS Exon 40F

t SEQ ID NO 112 HRM Analysis Oligonucleotide Primer - DEPDCS Exon 40R

t SEQ ID NO 1 13 HRM Analysis Oligonucleotide Primer DEPDCS Exon 41 F

k SEQ ID NO 1 14 _v HRM Analysis Oligonucleotide Primer - DEPDCS Exon 41 R

^SEQ ID NO 1 15 _ HRM Analysis Oligonucleotide Primer DEPDCS Exon 42F

"^"SEQ ID NO l ie HRM Analysis Oligonucleotide Primer DEPDCS Exon 42R

SEQ ID NO 117 Oligonucleotide Primer - mouse DepdcS Quantitative RT-PCR _t SEQ ID NO 118 Oligonucleotide Primer - mouse OepcfcS quantitative RT-PCR

SEQ ID NO 119 _ Oligonucleotide Primer ·-- mouse L38 quantitative RT-PCR

SEQ ID NO 120 Oligonucleotide Primer ·-- mouse L38 quantitative RT-PCR

SEQ ID NO 121 _k Wild-type DEPDCS nucleotide sequence - NMJ»1242896.1 _t SEQ ID NO- 122 _k Wild-type DEPDCS amino acid sequence - NPJ301229825.1 _t SEQ ID NO: 123 DEPDCS nonsense mutation (c.418C-→T) - nucleotide sequence

SEQ ID NO: 124 Amino acid sequence encoded by the c.418C→T mutation

[0072] As indicated above, the inventors have Identified a gene mutated in seizure disorders. Specifically, through the analysis of Individuals from families with focal epilepsy, the present inventors have Identified mutations In the DEPDCS gene that result In. or have the potential to result in, changes to the encoded DEPDCS polypeptide. [0073] information relating to the DEPDC5 gene can be found in the GenBank database of the National Center for Biotechnology information (www.ncbi.nlm.nlh.gov). For example, the Gene ID number for human DEPDC5 Is 9681 , and the content of this GenBank record Is incorporated herein by reference. As used herein, "DEPDC5^:: Is to be understood to refer to a gene that encodes a protein containing an 80 amino acid Dishevelled, Egi-10 and Pleckstrin (DEP) homology domain found In proteins Involved In G protein signalling and membrane targeting. The DEPDC5 gene Is also found in a number of other species, Including chimpanzee, baboon, mouse, rat, zebrafish, horse, cow, and yeast. Indeed, between the higher order species, the DEPDC5 protein is highly conserved suggesting that it carries out important, conserved functions.

[0074] The human DEPDC5 gene encodes at least five isoform variants, the mRNA and amino acid sequences of which are represented by GenBank Accession Numbers ...014662.3 and NP....Q5S477.1 (variant 1), N ..001007188.2 and NR...001007189.1 (variant 2), N ..Q0113602S.2 and NP...001129501 1 (variant 3), NM_ 001242896.1 and N P. 001229825. 1 (variant 4), and NM_ 001242897.1 and P_ 00122S826.1 (variant 5). For the purposes of the present specification, and in particular for the purposes of referencing the DEPDC5 mutations identified and described herein, the mRNA and amino acid sequences of variant 4 of DEPDC5 will be referred to.

[0075] Further details regarding the DEPDCS qene In human and other species can be found at the UnlGene portal of the NCBI ( e. Lin-Gene Ms. 435022 ·^■ http://www.ncbl. nlm, nih.gov/UniGene/clust. cgi?ORG==Hs&CiD==435022S<ALLPROT==1).

Alternatively, details of the nucleotide and amino acid sequence for DEPDC5 can be accessed from the UnlProt database {www.uniprot.ong} wherein the UnlProt ID for human DEPDC5 is 075140 (variants 1 , 2, 3 and 5), and B8EGNS (variant 4). The contents of the UnlGene and UnlProt records are Incorporated herein by reference,

[0078] It Is to be made clear that reference herein to DEPDC5, Includes a reference to Its naturally-occurring variants. In this regard, a "variant" of DEPDC5 may exhibit a nucleic acid or an amino acid sequence that Is at least 80% Identical, at least 90% Identical, at least 95% identical, at least 98% Identical, at least 99% identical, or at least 99.9% Identical to native DEPOC5. In ome embodiments, a variant of DEPDC5 is expected to retain native biological activity or a substantia! equivalent thereof.

[0077] The present Inventors have Identified fifteen different DEPDC5 mutations In families with focal epilepsies, Including In individuals with or without detectable brain lesions. Furthermore, the Inventors have also identified a de novo mutation In DEPDC5 In an individual with sporadic focal seizures. Collectively, the mutations Include the following:

■· nine nonsense mutations, namely C.21C--.G. p.TyrT* (as represented by SEQ I D NOs: 1 and 2), c.1883C—T, p.ArySSS^* (as represented by SEQ ID NOs: 3 and 4), c.4107G'->A, p.Trp1389* (as represented by SEQ ID NOs: 5 and 6), s.4606C-→T, p.Gln1S38* (as represented by SEQ ID NOs: 7 and 8), c.43S7G~~»A, p.Trp14SS* (as represented by SEQ ID NOs: 9 and 10), c.1459C-→T, p.Arg487* (as represented by SEQ I D NOs: 11 and 12), c.2527C--» , p.Arg843* (as represented by SEQ ID NOs: 13 and 14), c.3802C-→T, p„Arg12S8* (as represented by SEQ I D NOs: 15 and 16), and c„418C-→T, p.Gln140* (as represented by SEQ ID NOs: 123 and 124):

^■· one deletion mutation, namely c.488«490dteiTGT, p.Va!183d@IPhe (as represented by SEQ ID NOs: 17 and 18);

- three rnlssense mutations, namely c.3311C~*T, p.Ser1104Leu (as represented by SEQ ID NOs: 19 and 20), c.3217A-»C, p.Ser1073Arg (as represented by SEQ ID NOs: 21 and 22; and C.1355C—T, p,Ala452Va (as represented by SEQ I D NOs: 23 and 24)

- two splice site mutations, namely c.193+1G-*A; IVS4+1G-»A and o.2?S+1 G--»A; iVS5÷1G-»A (as represented by SEQ ID NOs; 25 and 26); and

·· one synonymous mutation, namely c.4512C~»T (as represented by SEQ I D NO.

27).

[0Q7S] As indicated above, wild-type D£/¾)C5 nucleotide and amino acid sequences are encompassed In GenBank Accession Numbers N _ 001242896.1 and NP_0G1229825.1 , respectively, and are set forth In SEQ ID NOs: 121 and 122, respectively (see Table 1 for an explanation).

[0079] Therefore, the present Invention enables methods for the diagnosis or prognosis of seizure disorders, such as non-leslonai and lesional epilepsy (Including focal epilepsy), based on testing for the presence of alterations/mutations In DEPDC5, including those Identified above.

[0080] Accordingly, In a first aspect the present invention provides a method for the diagnosis or prognosis of a seizure disorder In a subject, the method including testing for the presence of an alteration In the DEPDCS gene in the subject.

[0081] As used herein the word "diagnosis" refers to distinguishing or identifying a disease, disorder or condition or distinguishing or Identifying a subject having a particular disease, disorder or condition. The term ^"prognosis" as used herein refers to a prediction of the probable outcome that an alteration will have with respect to the development of a particular disease, disorder or condition, in this instance, the disease, disorder or condition is a seizure disorder.

[0082] Whilst the present invention has been described in the context of a human "subject", the invention is not limited so. Therefore, as used herein, the term "subject" should be taken to refer to any animal (e.g., a mammal), including, but not limited to humans, non-human primates, dogs, cats, horses, cattis, sheep, deer, pigs, rodents, and any other animal known to display seizure disorders. Therefore, whilst human DEPDC5 nucleotide and amino acid sequences have been referred to herein, it should be appreciated that the methods of the present invention are not limited to humans. Details of associated DEPOCo nucleic add and amino acid sequences for different species may be readily accessed from the GenBank (yyww.ncbi.nlm.nlh.gov) and UniProi (www.uniprot.org) databases as described above.

[0083] As used herein, the term "seizure disorder" is taken to refer to those disorders which arise when the brain's electrical activity Is periodically disturbed, resulting In some degree of temporary brain dysfunction. Examples of seizure disorders include, but are not limited to, the epilepsies (including focal epilepsies) Focal epilepsies may include, but are not limited to, temporal lobe epilepsy, nocturnal frontal lobe epilepsy, frontal lobe epilepsy, frortto- temporal lobe epilepsy, parietal epilepsy, occipital epilepsy, multi-focal epilepsy. The majority of epilepsies are focal in that seizures emanate from one brain region. However, In certain circumstances, as Is the case In autosomal dominant Familial Focal Epilepsy with Variable Foci (FFEVF), affected individuals have seizures originating from different cortical regions of the brain.

[0084] As Indicated above, genetic epilepsies, Including focal epilepsies, are often norv leslonal. However, examples of iesionai epilepsies, i.e. structural genetic epilepsies (those associated with detectable brain lesions) are well recognized. In this regard, the term "non- Iesionai epilepsy" as used In the present specification refers to an epilepsy In which the affected individual does not have a detectable malformation or structural abnormality of the brain. Similarly, the term "Iesionai epilepsy" as used in the present specification refers to an epilepsy in which the affected individual does have a detectable malformation or structural abnormality of the brain. Accordingly, an individual with "non-leslonal focal epilepsy" will not have any detectable malformation or structural abnormality of their brain, and an individual with "Iesionai focal epilepsy" will have a detectable malformation or structural abnormality of their brain. A subject may be screened for a malformation or structural abnormality of their brain using techniques such as magnetic resonance Imaging (MR!), functional RI, computed tomography (CT) scanning, positron emission tomography (PET) and angiography.

[008S] The terms "alteration" or "mutation" in DE/^CS as used herein are taken to be synonymous. That is, an "alteration" or a "mutation" in DEPDC5 is reference to a change In the nucleotide or amino acid sequence of DEPDC5 compared to the nucleotide or amino acid sequence of wild-type DEPDC5, or to the nucleotide or amino acid sequence of DEPDC5 In an individual who does not suffer from a seizure disorder. As Indicated above, the nucleotide and amino acid sequences of wild-type DEPDC5 are represented by Gen Bank Accession Numbers NM .001242896.1 and NP_ 001229825.1 , respectively, and are set forth in SEQ I D Os: 121 and 122, respectively.

[0086] With respect to a change in the nucleotide sequence of DEPDC5, the change may not only occur in the nucleotide residues coding for the DEPDC5 polypeptide, but may occur In genomic nucleotide sequence which is associated with the coding region. Such genomic nucleotide sequence Includes regulatory regions (e.g. promoter regions), Introns, untranslated regions and other functional and/or non-functional sequence regions associated with the coding region.

[0087] As described in detail below, of the large FFEVF families screened for alterations In the D;^::P C5 gene, 7 of S (87%) families that were screened had a mutation in DEPDC5. Accordingly, in one embodiment, the presence of an alteration In the DEPDC5 gene establishes a diagnosis or prognosis which will indicate a high probability of the disorder In the subject.

[DOBS] Through the analysis of families with seizure disorders, the present inventors have found that the presence of a DEPDC5 alteration in a subject Is also found in affected relatives of the subject. Accordingly, In some embodiments of the first aspect of the invention, an alteration In the DEPDC5 gene In the subject which Is also present in an affected parent or relative of the subject, establishes a diagnosis or prognosis which will Indicate a very high probability of the disorder In the subject

[0Q8S] Furthermore, the Identification of a D£ ^;¾3C5 alteration In a subject that has previously been clinically diagnosed with a probable or possible seizure disorder increases the likelihood that the subject has that disorde Still further, with respect to epilepsy (and in particular focal epilepsies and FFEVF), clinical information that may be used to suggest a diagnosis of these epilepsies may be ruled out through failure to identify a DEPDC5 alteration. This Information 1$ Important for initiating the correct treatment regimen for a subject and avoids unnecessary testing and associated trauma to the subject

[0090] The inheritance of mutations In the DEPDC5 gene enables the screening of subjects to determine their genetic carrier status. A subject that Is a genetic carrier of a disease, disorder or condition is a subject that has inherited a genetic trait or mutation, but who either does not display that trait or show symptoms of the disease, disorder or condition, or has been unaware that they have manifested symptoms of the disease, disorder or condition in the past. The subject is however, able to pass the genetic trait or mutation onto their offspring, who may then develop the disease, disorder or condition. Determining carrier staus Is useful for example for couples who are contemplating having children.

[0091] Accordingly, In a second aspect the present Invention provides a method fo Identifying a subject with an Increased likelihood of having an offspring predisposed to a seizure disorder, the method including testing for the presence of an alteration in the DEPDCS gene in the subject. It follows that presence of an alteration In the DEPDC5 gene In the subject identifies the subject as a subject with an Increased likelihood of having an offspring predisposed to a seizure disorder. Furthermore, the presence of an alteration in the DEPDC5 gene In the subject which Is also present In an affected parent or relative of the subject identifies the subject as a subject with very high likelihood of having an offspring predisposed to a seizure disorder.

[0092] The nature of the alterations in the DEPDC5 gene may encompass all forms of gene sequence variations Including deletions, insertions, rearrangements and point mutations In the coding and non-coding regions (such as the promoter, Introns or untranslated regions). Deletions may be of the entire gene or only a portion of the gene, whereas point mutations and insertions may result In the Introduction of stop codons, frameshlfts or ammo acid substitutions. A frameshlft In the DEPOC5 gene may lead to the translation of a truncated DEPDC5 polypeptide, which may or may not be unstable, or may result In little or no translation of DEPDC5 protein at all Point mutations occurring In the regulatory regions of DEPDCS, such as In the promoter, may lead io loss or a decrease of expression of DEPDCS mRNA or may abolish proper mRNA processing leading to a decrease In mRNA stability or translation efficiency.

[0093] In some embodiments of the aforementioned aspects of the present invention, the method Includes performing one or more assays to test for the presence of an alteration in the DEPDC5 gene and to Identify the nature of the alteration. [0094] In some embodiments, the method includes performing one or more assays to test for the presence of an alteration in the DEPOC5 gene; and. If the results Indicate the presence of an alteration In the DEPDC5 gene, performing one or more assays to Identify the nature of the D£/^:5DC5 alteration.

[0095] In some embodiments, the presence of an alteration In the DEFDC5 gene in the subject Is determined from an analysis of a biological sample taken from the subject. The term "sample" is meant to include biological samples such as cells (including those present In blood or cheek), tissues (Including tissue biopsy, surgical specimen or autopsy materia!), exosomes, and bodily fluids. "Bodily fluids" may Include, but are not limited to, blood, serum, plasma, saiiva. cerebral spinal fluid, pleural fluid, tears, lactal duct fluid, lymph, sputum, urine, amniotic fluid, and semen. A sample may include a bodily fluid that is "acellular." An "acellular bodily fluid" includes less than about 1 % (w w) whole cellular material. Plasma or serum is an example of an acellular bodily fluid. In addition, prenatal testing can be accomplished by testing fetal cells, placental cells or amniotic fluid.

[00SS] In some embodiments, nucleic acid or protein is first isolated from the sample before testing for the presence of an alteration in the DEPDC5 gene. The nucleic acid (DNA or RNA) or protein may be isolated from the sample according to any methods well known to those of skill In the art, for example see Green !VIR and Sambrook J, o/eco/ar Cloning: A Laboratory Manual (4th edition;, Cold Spring Harbor Laboratory Press, 2012.

[0097] As would be understood by a person skilled in the art, there exist a number of assay systems that can be used to test for the presence of DEPDC5 alterations and to determine the nature of the alterations, and the invention is not limited by the examples that are provided below.

[0098] For example. In one embodiment an assay system employed may rely on the analysis of DEPDCS nucleic acid In a sample taken from a subject In comparison to wild-type DEPDC5 nucleic acid In some embodiments, genomic DNA may be used for the analysis and may be obtained from a number of sources as described above. The genomic DNA may be Isolated and used directly far an assay or may be amplified by the polymerase chain reaction (PGR) prior to analysis. Similarly, mRNA or cDNA may also be used, with or without PGR amplification.

[0099] In one embodiment, a nucleic acid hybridisation assay may be employed. One such assay may look at a series of Southern blots of DNA that has been digested with one or more restriction enzymes. Each blot may contain a series of digested DNA samples from normal individuals and a series of digested DNA samples from one or more subjects being tested. Samples displaying hybridisation fragments that differ in length from normal DNA when probed with sequences near or including the DEPDC5 gene will Indicate a possible DEPDC5 mutation, if restriction enzymes that produce very large restriction fragments are used then pulsed field gel electrophoresis (PFGE) may be employed.

[0100] Hybridisation assays that are specific for a DEPDC5 gene exon may also be employed. This type of probe-based assay will utilise at least one probe which specifically and selectively hybridises to an exon of the DEPDC5 gene In its wild-type form. Thus, the lack of formation of a duplex nucleic acid hybrid containing the nucleic acid probe Is Indicative of the presence of mutation in the gene. Because of the high specificity of probe- based tests, any negative result is highly Indicative of the presence of a mutation however further Investigational assays should be employed to Identify the nature of the mutation, as set out further below.

[01 1] A DEPDC5 exon specific probe used for the above-mentioned assay may be derived from: (1 ) PGR amplification of each exon of the DEPDC5 gene using intron specific primers flanking each exon, (2) cDNA probes specific for each exon; or (3) a series of oligonucleotides that collectively represent an exon under Investigation. The genomic structure of the DEPDC5 gene can be found in the GenBank records referred to above or at the AceVlew entry for DEPDC5 at the National Center for Biotechnology Information ; hh 7/v./w v ncbi ni nlr Qov/! :;;8:Res&&rchA\oemb y/av c ;¾!! Aumsn¾: )EPDC5)

[0102] In a further embodiment, an assay to analyse rseterodup!ex formation may be employed. By mixing denatured wild-type DEPDC5 DNA with a DNA sample from a subject, any change in the DEPDC5 sequence between the two samples will lead to the formation of a mixed population of heteroduplexes and homoduplexes during reanneallng of the DNA. Analysis of this mixed population can be achieved through the use of such techniques as high performance liquid chromatography (HFH.C), which is performed unde partially denaturing temperatures. In this manner, heteroduplexes will elute from the HPLC column earlier than the homoduplexes because of their reduced melting temperature.

[0103] In a further embodiment, subject nucleic acid samples may be used In eiectrophoretic-based assays For example electrophoretic assays that determine DEPDCS fragment length differences may be employed. Fragments of genomic DNA from a subject to be tested are amplified with DEPDCS gene Intron specific primers. The amplified regions of the gene therefore include the exon of interest, the splice site junction at the exon/lntron boundaries, and a short portion of intron at either end of the amplification product. The amplification products may be run on an electrophoresis size-separation gel and the lengths of the amplified fragments are compared to known and expected standard lengths from the wild-type gene to determine If an insertion or deletion mutation Is found In the patient sample. This procedure can advantageously be used in a "multiplexed" format, In which primers for a plurality of exons are co-amplified, and evaluated simultaneously on a single electrophoretlc gel. This Is made possible by careful selection of the primers for each exon. The amplified fragments spanning each exon are designed to be of different sizes and therefore distinguishable on an electrophoresis/slze separation gel. The use of this technique has the advantage of detecting both normal and mutant alleles in heterozygous Individuals.

[0104] Additional electrophoretlc assays may be employed. These may Include the single- stranded conformational polymorphism (SSCP) procedure (Orita et s/., 1989, Proc. Nati Acad. Sci. USA, 86: 2756-70). As mentioned above, fragments of subject genomic DNA are PCR amplified with DEPDCS gene Intron specific primers such that Individual exons of the gene are amplified and may be analysed Individually. Exon-speclflc PGR products are then subjected to electrophoresis on non-denaturing poiyacr lamicte gels such that DNA fragments migrate through the gel based on their conformation as dictated by their sequence composition. Exon- specific fragments that vary in sequence from wild-type sequence will have a different secondary structure conformation and therefore migrate differently through the gel. Aberrantly migrating PCR products In patient samples are Indicative of an alteration in the exon and should be analysed further in assays such as DNA sequencing to identify the nature of the alteration.

[DIGS] Additional electrophoretlc assays that may be employed Include RNase protection assays (Finkelsteln et a/., 1990, Gen ics 7: 167-172; Kinsxler &t a/ , 1991 Saer>ce 251. 1366-1370} and denaturing gradient gel electrophoresis (DGGE)(Wariell of a/.. 1990. Nucleic Acids Res. 18: 2699-2705; Sheffield et a/., 1989, Proc. Nati. Acad Sci. USA 86: 232-236). RNase protection involves cleavage of a mutant polynucleotide Into two or more smaller fragments whereas DGGE detects differences In migration rates of mutant sequences compared to wild-type sequences, using a denaturing gradient gel.

[01 OS] In the RNase protection assay a labelled riboprobe which Is complementary to the wild-type DEPDCS gene coding sequence is hybridised with either mRNA or DNA Isoiated from the subject and subsequently digested with the enzyme R ase A which Is able to detect some mismatches In a duplex RNA structure. If a mismatch Is detected by RNase A, it cleaves at the site of the mismatch. Therefore, when the annealed RNA preparation is separated on an electrophoretlc gel matrix, if a mismatch has been detected and cleaved by RNase A, an RNA product wil! tse seen which Is smaller than the fuii length duplex RNA for the liboprobe and the RNA or D A. The ri aprobe need not be the full length of the m NA or gene under Investigation but can be a segment of either. If the riboprobe comprises only a segment of the mRNA or gene, It will be desirable to use a number of these probes to screen the whole mRNA sequence for mismatches.

[0107] In a further embodiment, enzymatic based assays may be used in the methods of the invention. Such assays Include the use of Si nuclease, ribonuclease, T4 endonuclease VII , MutS ( odrich, 19S1 , Ann. Rev. Genet 25: 229^»253), Cleavase and utY. In the MutS assay, the protein binds only to sequences that contain a nucleotide mismatch in a heteroduplex between mutant and wild-type sequences.

[0108] In instances where a seizure disorder Is associated with abnormal expression of the DEfOCS gene, alternative assays are required, Firstly, a normal or standard profile for OEPDC5 expression Is established. This may be accomplished by combining body fluids or cell extracts taken from normal subjects, with a sequence, or a fragment thereof, encoding the DEPDC5 gene, under conditions suitable for hybridisation or amplification. Standard hybridisation may be quantified by comparing the values obtained from normal subjects with values from an experiment In which a known amount of a substantially purified polynucleotide is used. Another method to Identify a normal or standard profile for expression is through quantitative RT^'-PCR studies. RNA isolated from body ceils of a normal subject is reverse transcribed and real-time PCR using oligonucleotides specific for DEPDC5 Is conducted to establish a normal level of expression of the gene. Standard values obtained In both these examples may be compared with values obtained from samples from patients who are symptomatic for the disorder. Deviation from standard values is used to establish the presence of the disorder.

[0109] Methods for measuring the expression level of a gene are generally known In the art. Techniques may Include, but are not limited to, Northern blotting, RNA in situ hybridisation, reverse-transcrlptase PCR (RT-PCR), real-time (quantitative) RT-PCR, microarrays, or "tag based" technologies such as SAGE (serial analysis of gene expression}. Microarrays and SAGE may be used to simultaneously quantltate the expression of more than one gene. Primers or probes may be designed based on nucleotide sequence of the DEPDC5 gene. Methodology similar to that disclosed in Paik ef a/., 2004 (NEJM 351 (27): 2817-2826) or Anderson ef a/., 2010 (A Mo/. D/ag/?osf/cs 12(5): 568-575) may be used to measure the expression of the DEPDC5 gene. Many methods are also disclosed In standard molecular biology text books such as Green MR and Sam brook J, Molecular Cloning: A Laboratory Manual (4th edition), Cold Spring Harbor Laboratory Press, 2012.

[0110] With respect to RT-PCR, the first step is typically the isolation of total RNA from a sample obtained from the subject under investigation Messenger RNA (mRNA) may be subsequently purified from the total RNA sample. The total RNA sample (or purified mRNA) is then reverse transcribed Into cDNA using a suitable reverse transcriptase. The reverse transcription step is typically primed using ollgo-dT primers, random hexamers, or primers specific fo the DEPDC5 gene, depending on the RNA template. The cDNA derived from the reverse transcription reaction then serves as a template for a typical PGR reaction. In this regard, two oligonucleotide PGR primers specific for the DEPDC5 g¾ne are used to generate a PGR product. A third oligonucleotide, or probe, designed to detect a nucleotide sequence located between the other two PGR primers is also used in the PGR reaction The probe Is non-extendlbie by the Tag DNA polymerase enzyme used in the PGR reaction, and Is labelled with a reporter fluorescent dye and a quencher fluorescent dye. Any laser-Induced emission from the reporter dye Is quenched by the quenching dye when the t o dyes are located close together, as they are on the probe. During the PGR amplification reaction, the Tag DNA polymerase enzyme cleaves the probe in a template-dependent manner. The resultant probe fragments disassociate In solution, and signal from the released reporter dye Is freed from the quenching effect of the second fluorophore. One molecule of reporter dye Is liberated for each new molecule synthesized, and detection of the unquenched reporter dye provides the basis for quantitative interpretation of the data.

[0111] in real-time RT-PC the amount of product formed, and the timing at which the product is formed, in the PGR reaction correlates with the amount of starting template. RT- PCR product will accumulate quicker in a sample having an increased level of mRNA compared to a standard or "normal" sample. Real-time RT-PCR measures either the fluorescence of DNA Intercalating dyes such as Sybr Green Into the synthesized PGR product, or can measure PGR product accumulation through a dual-labelled fluorigenlc probe (I.e. TaqMan probe). The progression of the RT-PCR reaction can be monitored using PGR machines such as the Applied Biosysiems' Prism 7000 or the Roche LlghtCycler which measure product accumulation in real-time. Real-time RT-PCR is compatible both with quantitative competitive PGR and with quantitative comparative PGR. The former uses an Infernal competitor for each target sequence for normalization, while the latter uses a normalization gene contained within the sample, or a housekeeping gene for RT-PCR. [0112] The production and application of roicroarrays for measuring the level of expression of the DEPDCS gene may be used and are weii known in the art. in general, in a mlcroarray, a nucleotide sequence (for example an oligonucleotide, a cDNA, or genomic DNA) representing a portion, or ail, of the DEPDCS gene occupies a known location on a substrate. A nucleic acid target sample (for example total RNA or mRNA) obtained from a subject of interest Is then hybridized to the mlcroarray and the amount of target nucleic acid hybridized to each probe on the array is quantified and compared to the hybridisation which occurs to a standard or "normal" sample. One exemplary quantifying method Is to use confocal microscope and fluorescent labels. The Affymetrix GeneChip™ Array system (Affyrnetrlx, Santa Clara, Calif.) and the Atlas™ Human cDNA Expression Array system are particularly suitable for quantifying the hybridization; however, It will be apparent to those of skill In the art that any similar systems or other effectively equivalent detection methods can also be used. Fluorescently labelled cDNA probes may also represent the nucleic acid target sample. Such probes can be generated through Incorporation of fluorescent nucleotides during reverse transcription of total RNA or mRNA extracted from a sample of the subject to be tested. Labelled cDNA probes applied to the mlcroarray will hybridize with specificity to the equivalent spot of DNA on the array. Quantitation of hybridization of each arrayed element allows for assessment of corresponding mRNA abundance in the sample compared to the abundance observed in a standard or "normal" sample. With dual colour fluorescence, separately labelled cDNA probes generated from two sources of RNA are hybridized pairwise to the array. The relative abundance of the transcripts from the two sources corresponding to the DEPDCS gene is thus determined simultaneously. Such methods have been shown to have the sensitivity required to detect at least approximately two-fold differences In the expression levels.

[0113] The most definitive assay to identify the presence of an alteration In the DEPDCS gene, and/or to identify the nature of the mutation is DNA sequencing. Comparison of the wild-type nucleotide sequence of DEPOCo with the DEPDCS nucleotide sequence from a subject to be tested provides both high specificity and high sensitivity. The general methodology employed Involves amplifying (for example with PGR) DNA fragments of the DEPDCS gene from subject DNA as described above, combining the amplified DNA with a sequencing primer which may be the same as or different from the amplification primers; extending the sequencing primer in the presence of normal nucleotide (A, C, G, and T) and a chain-terminating nucleotide, such as a dideoxynucleotide, which prevents further extension of the primer once Incorporated; and analyzing the product for the length of the extended fragments obtained. [0114] While such methods, which are based on the original dideoxysequencing method disclosed by Sanger et a/, 1977 (Proc. Natl. Acad. ScL USA 74: 5483-5467} are useful in the present Invention, the final assay Is not limited to such methods. For example, other methods for determining the sequence of the DEPDC5 gene may also be employed. Sequencing platforms include the Roche 454 sequencer, the !iiumtna Genome Analyzer II and the Applied Biosystems SOLID. Alternative sequencing methods Include those described by axam and Gilbert, 1977 (Proc. Natl. Acad. So. USA 74: 560-564) and variations of the dldaoxy method and methods which do not rely on ctoain- terminating nucleotides at all such as that disclosed In US Patent No. 4,871 ,903, which is Incorporated herein by reference. Other alternative methods Include Pyrosequenclng (Pyrosequencing, Westboroug , Mass.), protocols for which can be found in Alderborn er a/, 2000 {Genome Res. 10: 1249- 1265). Sequencing by dldeoxy chain termination method can be performed using Thermo Sequenase (Amersham Pharmacia, Piscataway, J), Sequenase reagents from US Bioc emicals or Sequathemi sequencing kit (Epicenter Technologies, Madison, Wis.}. Sequencing may also be carried out by the "RR dRhodamin© Terminator Cycle Sequencing Kit" from PE Applied Biosystems (product no. 403044, elterstadt, Germany), Taq DyeDeoxy™ Terminator Cycle Sequencing kit and method (Perkin-Eimer/ Applied Biosystems) in two directions using an Applied Biosystems Model 373 A DNA or in the presence of dye terminators CEQ™ Dye Terminator Cycle Sequencing Kit, (Beekman 608000). Any sequence differences (other than benign polymorphisms) In exons of a test subject when compared to that of the wild-type sequence indicate a potential disease- causing mutation.

[0115] Another DNA sequencing-based approach that can be utilized to Identify the presence of an alteration In the DEPDC5 gene, and/or to identify the nature of the mutation, Is exorne sequencing . In this method, the coding regions of the entire genome of the subject are captured, amplified, and then sequenced ~ as opposed to just sequencing the coding regions of the DEPDC5 gene. Exome sequencing can be performed using standard techniques as would bs know In the art. Furthermore, commercial kits are available to conduct exo e sequencing, fo example the SureSelect Human All Exon 50 Mb kit from Agilent Technologies (Santa Clara, CA, USA). Once the exome of a subject has been captured and amplified, fragments are sequenced using techniques as outlined above.

[01 I S] In one embodiment an assay system employed may be the analysis of DEPDC5 polypeptide obtained from a subject protein sample In comparison to wild-type DEPDC5 polypeptide. For example, any differences In the electrophoretlc mobility of a mutant DEPDC5 polypeptide compared to wild-type DEPDC5 can be exploited as the basis for Identifying a mutated DEPDC5 polypeptide Such an approach will be particularly useful In Identifying mutants In which charge substitutions are present, or In which Insertions, deletions, truncations or substitutions have resulted in a significant change In the electrophoretic migration of the resultant protein. Antibodies (or fragments thereof) may also be useful in Identifying mutant DEPDCS polypeptide, particularly if the antibody (or fragment thereof) can specifically hybridise to the mutant DEPDCS polypeptide and not to the wild-type DEPDCS polypeptide Alternatively, an antibody (or fragment thereof) which detects the presence of a truncated DEPDCS polypeptide may be one that binds to the truncated region so that it In effect only recognises and binds to the wild-type DEPDCS polypeptide. In other embodiments, differences in the proteolytic cleavage patterns of normal and mutant DEPDCS polypeptide may be determined, or differences in molar ratios of the various amino acid residues may be determined. Amino add sequence determination may also be used to compare a DEPDCS polypeptide obtained from a subject sample to wiid-type DEPDCS polypeptide.

[01 I T] As Indicated above, the Inventors have identified 16 specific mutations in the DEPDCS gene that are causative for seizure disorders (familial and sporadic focal epilepsies). As described above, these include nine nonsense mutations (c.21 C-->G, C.1663G-T, C 107G -A. c.4606C→T, C.4397G— A, c.14S9C→T, c.2527C→T, C.3802C-- and c.418C~*T) each of which leads to the Introduction of a stop codon In the transcribed sequence and ultimate translation of a truncated DEPDCS polypeptide, one deletion mutation (c.48S-490delTGT) causing the deletion of a single amino add from the encoded DEPDCS polypeptide, three nilssense mutations (c.3311C-→T, c.3217A-→C, and C.1355C-H ), two splice site mutations (c.193÷1G-*A; IVS4+1 G-→A and c.279+1G-→A; iVS5+1G-*A), and one synonymous mutation (e.4512C™-s ). Accordingly, In one embodiment of the first and second aspects of the invention, these specific mutations may form the basis of assays which test for the presence of only these mutations In subjects.

[0118] The assays referred to above may be used to test for the presence of these 16 mutations In subjects. However, additional assays may also be employed given that the nature of the mutation Is known. Assays which are based on a known DEPDCS mutation include those which utilise allele-speclflc primers and probes, for example PCR-based approaches that use oligonucleotide primers which specifically bind to the DEPDCS mutation being tested for. Such oligonucleotides which detect single nucleotide variations In target sequences may be referred to by such terms as "allele-speclflc probes", or "allele-speclflc primers". The design and use of allele-speclflc probes for detecting known sequence variations (In this Instance In DEPDCS) Is described in, for example, Mutation Detection A Practical Approach, ed. Cotton et a/. Oxford University Press, 19SS; Saiki et a/., 1986 (Nature, 324: 163-166); EP23S726; and WO 89/11548. In one example, a probe or primer may be designed to hybridize to a segment of DEPDC5 target DMA such that the mutation site in DEPDC5 ailgns with either the 5' most end or ins 3' mast end of the probs or primer. In some assays, the amplification may include a labeled primer, thereby allowing detection of the amplification product of that primer, in one example, the amplification may include a multiplicity of labeled primers: typically, such primers are dlstlnguishabiy labeled, allowing the simultaneous detection of multiple amplification products.

[0119] in one type of PCR- ased assay, an allele-speclflc primer hybridizes to a region on a target DEPDC5 nucleic acid molecule that overlaps with the mutation site and only primes amplification of an allelic form to which the primer exhibits perfect complementarity (Gibbs, 1989. Nu lei-: Acd ¾s 17:2427-2448). Typically, the primer's 3^!-most nucleotide is aligned with and complementary to the mutation site of the DEPDC5 target nucleic acid molecule. This primer Is used in conjunction with a second primer that hybridizes at a distal site. Amplification proceeds from the two primers, producing a detectable product thai Indicates which allelic form Is present In the test sample. A control Is usually performed with a second pair of primers, one of which shows a single base mismatch at the mutation site and the other of which exhibits perfect complementarity to a distal site. The single-base mismatch prevents amplification or substantially reduces amplification efficiency, so that either no detectable product Is formed or It Is formed In lower amounts or at a slower pace. The method generally works most effectively when the mismatch is at the S'-most position of the oligonucleotide (i.e. the 3'-most position of the oligonucleotide aligns with the target mutation position) because this position Is most destabilizing to elongation from the primer (see for example WO 93/22456}. A person skilled In the art would readily be able to design allele- specific primer sequences for detecting the DEPDC5 mutations referred to above, or any other DEPDCS mutation identified in the future.

[0120] In one example, a primer contains a sequence substantially complementary to a segment of a mutation-containing target DEPDCS nucleic acid molecule except that the primer has a mismatched nucleotide In one of the three nucleotide positions at the S'-most end of the primer, such that the mismatched nucleotide does not base pair with a particular allele at the mutation site. The mismatched nucleotide in the primer can be the first, second or the third nucleotide from the last nucleotide at the S'-most position of the primer. In some examples, primers and/or probes are labeled with detectable labels [0121] in an alternative approach, tagged allele specific primer pairs cars be used to detect a known mutation in DEPDC5 (Strom et aL , 2005 Ger?ei. ed 7:633-63). in one example, two tagged allsle-spedfic primers overlap the mutation site In the target DMA; however, only the correctly hybridized pnmerfs) will be extended to generate a labeled produces). A non- complernentary primer will not be extended or labeled due to the 3' mismatched base. The labeled extended product can be detected based on the detectable label. The tagged extended primers can also be captured on a solid support such as beads that are coupled to anti-tag sequences. The Immobilized extended primer product can be detected by commercially available means such as Lurninex 100 Lab AP™ (Lumtnex Corporation, Austin IX).

[0122] Assays which detect previously identified DEPDC5 polypeptide mutations, including those listed herein, are also known in the art. For example, detection of mutant DEPDC5 polypeptide in a protein population obtained from a sample of the subject could be by resolution of the proteins by SDS poiyacrylamlde gel electrophoresis (SDS PAGE), followed by staining the proteins with suitable stain for example, Coomassle Blue. DEPDC5 polypeptide with and without a mutation can be differentiated from each other and also from other proteins based on their molecular weight and migration on SDS PAGE.

[0123] Detection of the presence of known mutations In a DEPDC5 polypeptide can also be accomplished using, for example, antibodies, aptamers, ligands substrates, other proteins or protein fragments, other protein-binding agents, or mass spectrometry analysis of fragments. Preferably, protein detection agents are specific for a mutated DEPDC5 polypeptide and can therefore discriminate between a mutated protein and the wild-type protein or another variant form. This can generally be accomplished by, for example, selecting or designing detection agents that bind to the region of a protein that differs between the variant and wild-type protein.

[0124] One preferred agent for detecting a mutated DEPDCS polypeptide Is an antibody capable of specifically binding to the mutated DEPDCS polypeptide. Antibodies that are capable of distinguishing between wild-type and mutated DEPDCS polypeptide may be created by any suitable method known In the art (see below). The antibodies may be monoclonal or polyclonal antibodies, single chain or double chain, chimeric or humanized antibodies, or fragments of said antibodies (i .e. portions of immunoglobulin molecules containing the antigen binding regions of DEPDCS). [0125] Antibodies, or fragments thereof, useful for detecting the presence of a truncated DEPDC5 polypeptide identified by the inventors (i.e. p,Tyr7*. p.Arg555*_; p.Trp13e8*, p.Gln1536^*, p.Trp1466*, p.Arg487^*, p.Arg843^* p.Arg1268^* and p.Gfnl40*) may be those that recognise and bind to the region of the polypeptide that is deisted so that it in effect ihey only recognise and bind to the wild- type DEPDC5 polypeptide.

[0126] In vitro methods for detection of a known DEPDC5 polypeptide mutation also Include, for example, enzyme linked immunosorbent assays (ELISAs), radioimmunoassays (RIA), Western blots, immunoprecipitations, immunofluorescence, and protein arrays/chips (e.g. , arrays of antibodies or aptarners) For further Information regarding Immunoassays and related protein detection methods, see Current Protocols In Immunology, John Wiley & Sons, N.Y; and Hage, 1 S99, Ana/. Che/??. 15; 71 (12): 294R-304 . Additional methods of defecting amino acid variants include, but are not limited to, altered elecirop oretic mobility (e.g. , 2- dimensiona! electrophoresis), altered tryptic peptide digest, altered HEXA activity in cell- based or cell-free assay, alteration in ligand or antibody-binding pattern, and altered isoelectric point,

[0127] DEPDC5 polypeptide with and without a mutation can be differentiated from each other and from other proteins by Western blot analysis. Methods of Western blot are well known In the art and are described for example in Burnette, 1981 (Ana/. BiQch@mM 2 (2): 195-203). Briefly, protein is extracted from a sample obtained from a subject using standard techniques and Is then subjected to SDS PAGE. The protein sample will include DEPDC5 polypeptide. Following gel electrophoresis, proteins in the protein sample are transferred to a nitrocellulose or polyvinyl idene fluoride (PVDF) membrane. The membrane Is blocked with a suitable blocking agent to prevent subsequent non-specific binding of antibody to the membrane. Suitable blocking agents include bovine serum albumin and non-fat dry milk. After blocking and several washes with a suitable buffer, antibodies that specifically bind to the DEPDC5 mutation being tested, antibodies that recognise and bind to a region of the DEPDC5 polypeptide that Is deleted, and/or antibodies thai specifically bind to wild-type DEPDC5 are allowed to bind to the protein sample of Interest that has been transferred to the membrane. Following the binding of primary antibody to the membrane, excess antibodies are washed away with a suitable buffer. A suitable sscondary antibody that is able to bind to the primary antibody Is then applied, the sscondary antibody being deteciab!y labeled. Excess secondary antibody is then washed sway with a suitable buffer and the detectable label of the secondary antibody is detected. Detection of the detectable label of the secondary antibody indicates the presence of the protein of interest - mutant or wild- type. If primary antibodies specific for a particular mutant DEPDC5 polypeptide are used, then the mutant polypeptide Is Identified.

[0128] A variety of additional assays for measuring the presence of a mutant DEPDC5 polypeptide can also be used. Such assays include dissociation-enhanced lanthanide fuoro immune assay (DELFIA)}, proteomics techniques, surface plasmon resonance, ehemliurnlnescence, fluorescent polarization, phosphorescence, immunohlstoehe nlstry, matrix-assisted laser dasorptlon/lonlzation mass spectrometry ( ALDI-IVIS), as described In WO 2009/004576 (including surface enhanced laser desorptlon/ionlzation mass spectrometry (8ELDI- S), especially surface-enhanced affinity capture (SEAC), surface- enhanced need desorptlon (SEND) or surface-enhanced photo label attachment and release (SEPAR)), matrix-assisted laser desorptlon/ nization time-of-flight ( ALDi-TOF) mass spectrometry, rnioOcytometry, rrsicroarray, microscopy, fluorescence activated cell sorting (FACS), and flow cytometry.

[0129] On the basis of the range of assays available to test for mutations in DEPDC5, In a further embodiment there Is provided a method for testing a subject for a seizure disorder- associated mutation, such as a focal epilepsy-associated mutation, in the DEPDCS gene Including the steps of:

(1) quantitatively amplifying, from a sample obtained from the subject, at least one exon of the DEPDCS gene using primers complementary to intron regions flanking each ampllned exon;

(2) comparing the length of the amplification products for each amplified οκοη to the length of the amplification products obtained when a wild-type DEPOC5 gene Is amplified using the same primers,

wherein differences in length between an amplified sample exon and the corresponding amplified wild-type exon reflect the occurrence of a truncating mutation in the sample DE DC5 gene.

[0130] In one embodiment, the method further includes determining the nucleic acid sequence of the truncating mutation.

[0131] In further embodiment there is provided a method for testing a subject for a seizure disorder-associated mutation, such as a focal epilepsy-associated mutation, In the DEPDCS gene Including the steps of: (1) quantitatively amplifying, from a sample obtained from the subject, at least one exon of the DEPDC5 gene using primers complementary to intron regions flanking each amplified exon;

(2) hybridising the fragments from (1 ) with fragments produced by amplification of the same exon In a wild-type DEPDC5 gene,

wherein an amplified exon from the subject that either does not hybridise to a corresponding wtid-type fragment or forms a mismatched hetsrodup!sx therewith reflects the occurrence of a mutation In the amplified exon.

[0132] in one embodiment, the method further Includes determining the nucleic acid sequence of the mutated exon,

[0133] Primers complementary to Intron regions flanking each exon of the DEPDC5 gene can be designed and syntheslsed according to standard methodology as would be known in the art. The genomic DNA sequence encompassing the DEPDC5 gene is readily available In sequence databases, including the RefSeq genomic database at the NCBI. For example, a search of this database using the DEPDC5 mRNA sequence identifies a number of chromosome 22 genomic con igs comprising the genomic sequence encompassing the DEPDC5 gene (e.g. those represented by GenBank Accession Numbers NCJ318833.1 , NW_ 004078112.1 N 001838745.1 and NT_011520.12).

[0134] As indicated above, the present inventors have determined that the DEPDC5 gene is associated with seizure disorders. Including focal epilepsies (both leslonal and non-!esionai), through the Identification of mutations In the DEPDC5 gene.

[0135] Accordingly, in a third aspect the present provides an isolated nucleic acid molecule Including an alteration in the DEPDC5 gene, wherein said alteration produces a seizure disorder phenotype. In soma embodiments, the alteration Is a nonsense mutation, a deletion mutation, a mlssense mutation, a splice site mutation or a synonymous mutation In DEPDC5. For example, In some embodiments the mutation may be one of c.21C-*G, c.1663C-»T, c.4107G-÷A, C.4606C--T, C.4397G— A, c.1459C-→T, c.2527C-~>T, c.3802C-→T, C.418C— *T, c.488-490delTGT, c.331 1 C→T, c 3217A >C c.1355C~→ c, 193-M G→A (IVS4*-1G-→A), c.279-i-1G"→A (!VS5- 1 G»"*7A), and c.4512C-*T, as described In detail above. In this regard, the nucleic acid molecule Includes the sequence set forth in one of SEQ ID NOs: 1 , 3, 5, 7, 9, 11 , 13, 15, 123, 17, I S, 21 , 23, 25, 26 and 27, respectively. [0136] The present Invention also contemplates a nucleic acid fragment of SEQ ID NOs: 1 3. 5, 7, 9, 1 1 , 13, 5, 123, 17, 19, 21 , 23, 25, 26 and 27, provided the fragment Includes the relevant DEPDC5 alteration. A nucleic add fragment may Include at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 33%, at least 94%, at least 95%, at least 36%, at least 97%, at least 98%, at least 99%, or 100% nucleotide sequence Identity to one of SEQ I D NOs: 1 , 3, 5, 7, 9, 11 , 13, 15, 123, 17, 19, 21 , 23, 25, 26 and 27, and contains the relevant alteration. The nucleic acid fragment may ba of any length provided It Includes at least about 20 contiguous nucleotides of one of SEQ ID NOs: 1 , 3, 5, 7, 9, 11 , 13, 15, 123, 17, 19, 21 23, 25, 26 and 27.

[0137] Accordingly, In a fourth aspect the present invention provides an isolated nucleic acid molecule Including a fragment of the DEPDC5 gene, wherein said nucleic acid molecule Includes an alteration In DEPDCS, said alteration selected from the group consisting of C.21C-* G, c.1663C→T, c.4107G→A, c.4606C→T, c.4397G→A, c.14S9C→T, c.2527C→T,

C.3502C T C.418C-* T, c.488-490de!TGT_: c.3311 C-→T, c3217A-→C, C.1355C—T, c.193+1G-→A (iVS4+ 1 G-A), c.279+1 G-→A (iVS5+ 1 G--A), and c.4512C-~>T.

[0138] In some embodiments, the nucleic acid molecule Includes: (1 ) a nucleotide sequence at least 95% Identical to at least about 20 contiguous nucleotides of SEQ ID NO: 1 and Includes the c.21C-→G alteration: (2) a nucleotide sequence at least 95% Identical to at least about 20 contiguous nucleotides of SEQ I D NO: 3 and Includes the C.1663C— »T alteration: (3) a nucleotide sequence at least 95% Identical to at least about 20 contiguous nucleotides of SEQ I D NO: 5 and Includes the c.4107G-->A alteration: (4) a nucleotide sequence at least 95% Identscal to at least about 20 contiguous nucleotides of SEQ ID NO: 7 and Includes the C.48Q6C-+T alteration: (5) a nucleotide sequence at least 95% identical to at least about 20 contiguous nucleotides of SEQ ID NO: 9 and includes the c.4397G-»A alteration, (6) a nucleotide sequence at least 95% Identical to at least about 20 contiguous nucleotides of SEQ ID NO: 1 1 and Includes the c.14590—1 alteration: (7); a nucleotide sequence at least 95% identical to at least about 20 contiguous nucleotides of SEQ ID NO: 13 and Includes the c.2S27C-»T alteration, (8) a nucleotide sequence at least 95% Identical to at least about 20 contiguous nucleotides of SEQ ID NO: 15 and Includes the c,3302C→T alteration; (9) a nucleotide sequence at least 95% Identical to at least about 20 contiguous nucleotides of SEQ ID NO: 123 and Includes the c.418C-→T alteration: ( 10) a nucleotide sequence at least 95% Identical to at least about 20 contiguous nucleotides of SEQ ID HO: 17 and Includes the c.488~430delTG7 alteration; (1 1) a nucleotide sequence at least 95% Identical to at least about 20 contiguous nucleotides of SEQ ID NO: 19 and Includes the C.33110-O^" alteration; (12) a nucleotide sequence at least 95% identical to at least about 20 contiguous nucleotides of SEQ ID NO: 21 and includes the c.3217A-→C alteration, (13) a nucleotide sequence at least 95% Identical to at least about 20 contiguous nucleotides of SEQ ID NO: 23 and includes the c.1355C--*T alteration; ( 14s a nucleotide sequence at least 95% Identical to at least about 20 contiguous nucleotides of SEQ ID NO: 25 and includes the c.193+1G→A (!VS4*1G~»A) alteration, (15) a nucleotide sequence at least 95% identical to at least about 20 contiguous nucleotides of SEQ ID NO: 28 and Includes the c.279 1G-~>A (IVS5+ 1G~*A) alteration: and (16) a nucleotide sequence at least 95% Identical to at least about 20 contiguous nucleotides of SEQ ID NO: 27 and indudes the c.4512C-->T alteration.

[0139] Any one or more of these DEPDC5 fragments may be used In the aforementioned assays for testing for the presence of the alteration in the DEPDCS gene of a subject under investigation.

[0140] In a fifth aspect, the present Invention provides an Isolated polypeptide, wherein said polypeptide is a DEPDC5 polypeptide Including an alteration, wherein said alteration produces a seizure disorder phenotype. in some embodiments, the alteration Is encoded by a nonsense mutation in DEPDCS, is a deletion mutation In 0£/³DC5, or Is an amino acsd substitution (mlssense) mutation in DEPDCS. For example, In some embodiments the mutation may be one of p,Tyr7* p.ArgSSS*, p.Trp1369C p.Gln1536*, p.Trp1466*, p,Arg487, p.Arg843*, p.Arg1268T p.Gln140*, p.Val163delPhe, p.Serl 104Leu, p.Ser1073Arg, and p.Ala452Val, as described in detail above. In this regard, the polypeptide Includes the sequence set forth In one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 124, 18, 20, 22 and 24, respectively.

[0141] The present invention also contemplates a polypeptide fragment of SEQ ID NOs: 18, 20, 22 and 24, provided the fragment Includes the relevant DEPDCS alteration. A polypeptide fragment may Include at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91 %. at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% amino acid sequence Identity to one of SEQ I D NOs: 18, 20, 22 and 24, and contains the relevant alteration. The polypeptide fragment may be of any length provided It Includes at least about 20 contiguous amino acid residues of one of SEQ ID NOs: 18, 20, 22 and 24.

[0142] Accordingly, in a sixth aspect the present Invention provides an Isolated polypeptide Including a fragment of the DEPDCS polypeptide, wherein said polypeptide Includes an alteration in DEPDC5, said alteration selected from the group consisting of p.\/al163delPhe, p.Ser1 1G Leu, p.Ser1073Arg, and p.Ala452Val.

[0143] In some embodiments, the polypeptide includes: (1) an amino acid sequence at least 95% Identical to at least about 20 contiguous amino acids of SEQ ID NO: 18 and Includes the p.Val163delPhe alteration (2) an amino acid sequence that is at least 95% identical to SEQ ID NO: 20 and Includes the p.Serl 1 G4L.su alteration; (3) an amino acid sequence thai is at least 95% identical to SEQ I D NO: 22 and Includes the p.Ser1073Arg alteration, and (4) an amino acid sequence that Is at least 95% identical to SEQ ID NO: 24 and includes the p Ala462Val alteration.

[0144] The present invention also provides for the production of genetically modified (knockout, knock-In and transgenic), non-human animal models including the nucleic acid molecules of the invention. Accordingly, in another aspect the present Invention provides a genetically modified non-human animal including a nucleic acid molecule according to the third or fourth aspects of the invention. Genetically modified animals are useful for the study of DEPDC5 gene function, to study the mechanisms by which the DEPDC5 mutations of the Invention give rise to seizure disorders, to study the effects of the DEPDC5 mutations on tissue development, for the screening of candidate pharmaceutical compounds, for the creation of explanted mammalian cell cultures which express the mutants, and for the evaluation of potential therapeutic interventions.

[0145] Animal species which are suitable for use In the animal models of the present invention Include, but are not limited to, rats, mice, hamsters, guinea pigs, rabbits, dogs, cats, goats, sheep, pigs, and non-human primates such as monkeys and chimpanzees. For Initial studies, genetically modified mice and rats are highly desirable due to the relative ease in generating knock-in, knock-out or transgenics of these animals, their ease of maintenance and their shorter life spans. For certain studies, transgenic yeast or invertebrates may be suitable and preferred because they allow for rapid screening and provide for much easier handling For longer term studies, non-human primates may be desired due to their similarity with humans.

[014S] To create an animal model of a mutant DEPDCS gene of the present Invention several methods can be employed. These Include, but are not limited to, generation of a specific DEPDC5 mutation In a homologous animal gene, Insertion of a mutant human DEPDC5 gene and/or a humanized animal DEPDC5 gene by homologous recombination, insertion of a mutant human DEPDC5 gene as genomic or minlgene cDNA constructs using wild type, mutant or artificial promoter elements, or Insertion of artificially modified fragments of the endogenous gene by homologous recombination. The modifications include Insertion of mutant stop codons, the deletion of DMA sequences, or the Inclusion of recombination elements (lox p sites) recognized by enzymes such as Cre recomb!nase.

[0147] To create transgenic mice In order to study gain of gene function in vivo_; any mutant of the Invention can be Inserted Into a mouse germ line using standard techniques such as oocyte microinjection. Gain of gsns function can mean the over-expression of a gene and Its protein product, or the genetic complementation of a mutation of the gene under Investigation. For oocyte Injection, one or more copies of the mutant gene can be Inserted Into the pronucleus of a jusi-fertlllzed mouse oocyte. This oocyte is then reimpianfed into a pseudo-pregnant foster mother. The live- born mice can then be screened for integrants using analysis of tail DNA for the presence of the relevant human gene sequence. The transgene can be either a complete genomic sequence injected as a YAC, BAG, PAC or other chromosome DNA fragment, a cDNA with either the natural promoter or a heterologous promoter, or a inlgene containing the whole coding region and other elements found to be necessary for optimum expression.

[0148] To generate knock-out mice or knock-in mice, gene targeting through homologous recombination In mouse embryonic stem (ES) cells may be applied. Knock-out mice are generated to study loss of gene function in vivo (for example to study the effects of the truncating mutations) while knock-in mice allow the study of gain of function or to study the effect of specific gene mutations. Knock-in mice are similar to transgenic mice however the integration site and copy number are defined in the former.

[0149] For knock-out mouse generation, gene targeting vectors can be designed such that they disrupt (knock-out) the protein coding sequence of the DEPDC5 gene In the mouse genome. This disruption Is typically mediated by homologous recombination (Joyner, 2000, Gene Targeting : A Practical Approach. Oxford University Press) In murine embryonic stem cells or can be mediated by other technologies such as sI NA vectors that target the relevant gene (Kunath et a/. , 2003, /Vafore Biotechnoi. 21 : 559-561). Knock-out animals will include a functional disruption of the DEPDC5 gene such that the gene does not express a biologically active product. It can be substantially deficient In at least one functional activity coded for by the gene. Expression of the polypeptide encoded by the gene can be substantially absent (i.e. essentially undetectable amounts are made) or may be deficient in activity such as where only a portion of the gene product Is produced. In contrast, knock-in mice can be produced whereby a gene targeting vector containing the mutant DEPDCS gene can Integrate Into a defined genetic locus In the mouse genome. For both applications, homologous recombination Is catalysed by specific DNA repair enzymes that recognise homologous DNA sequences and exchange them via double crossover.

[0150] Gene targeting vectors are usually Introduced Into ES cells using elec roporation. ES cell Integrants are then Isolated via an antibiotic resistance gene present on the targeting vector and ars subsequently gsnotypsd to Identify those ES cell clones in which the gens under investigation has Integrated Into the locus of Interest. The appropriate ES ceils are then transmitted through the germilne to produce a novel mouse strain.

[0151] in Instances where gene ablation results In early embryonic lethality, conditional gene targeting may be employed. This allows genes to be deleted in a temporally and spatially controlled fashion As above, appropriate ES cells are transmitted through the germ!ine to produce a novel mouse strain, however the actual deletion of the gene Is performed in the adult mouse In a tissue specific or time controlled manner. Conditional gene targeting Is most commonly achieved by use of the cre/lox system. The enzyme ere Is able to recognise the 34 base pair ioxP sequence such that loxP flanked (or floxed) DNA Is recognised and excised by ere. T issue specific ore expression in transgenic mice enables the generation of tissue specific knock-out mice by mating gene targeted floxed mice with ere transgenic mice. Knock-out can be conducted in every tissue (Schwenk et a/, , 1995, NuciBic Acids Res, 23: 5080-5081 } using the "delete" mouse or using transgenic mice with an Inducible ere gene (such as those with tetracycline Inducible ere genes), or knock-out can be tissue specific for example through the use of the C D 19 -ere mouse (Fdckert ei a/. , 1997, Nucleic Acids Res. 25: 1317- 1318).

[0152] Once knock-In animals have been produced they can subsequently be used to study the extent and mechanisms of disease, and can be used for testing the effects that a change In genetic background has on the phenot p® of the animal. This can be achieved In mice for Instance by crossing a knock- in mouse of the Invention with a mouse comprising a different genetic background, for example that of the DBA/2 J, C3H/HeJ or Fringe strains.

[0153] Using methods well known In the art, a mutant DEPDC5 polypeptide of the present invention may be used to produce antibodies specific for the mutant polypeptide or to screen libraries of pharmaceutical agents to Identify those that bind the mutant polypeptide. Furthermore, an antibody which specifically binds to a mutant DEPDC5 polypeptide of the Invention may be used directly as an antagonist or modulator, or Indirectly as a targeting or delivery mechanism for bringing a pharmaceutical agent to cells or tissues that express the mutant polypeptide.

[0154] Accordingly, in another aspect the present invention provides an antibody or fragment thereof which specifically binds to a polypeptide according to a fifth or sixth aspect of the invention.

[0155] Furthermore, in another aspect, the present invention provides an antibody or fragment thereof which detects a polypeptide according to a fifth or sixth aspect of the Invention, wherein said polypeptide Is truncated when compared to a wild-type DEPDCS polypeptide the sequence of which Is set forth in SEQ I D NO: 122 and represented by GenBank Accession No NPJX31229825.1 and wherein said antibody or fragment thereof binds to the truncated region of said polypeptide.

[DI SS] Such antibodies contemplated by this aspect of the invention may include, but are not limited to, polyclonal, monoclonal, chimeric, and single chain antibodies as would be understood by the person skilled In the art. For the production of antibodies, various hosts Including rabbits, rats, goats, mice, humans, and others may be immunized by injection with a mutant polypeptide as described or with any fragment or oligopeptide thereof which has Immunogenic properties. Various adjuvants may be used to Increase immunological response and Include, but are not limited to, Freund's, mineral gels such as aluminum hydroxide, and surface-active substances such as iysolecithln. Adjuvants used In humans include BCG (bacilli Calmet e-Guer tn) and Corynebacterium parvum.

[0157] It is preferred that the DEPDCS oligopeptides, peptides, or fragments used to Induce antibodies to the mutant DEPDCS polypeptides of the invention have an amino acid sequence consisting of at least 5 amino acids, and, more preferably, of at least 10 amino acids, it Is also preferable that these oligopeptides, peptides, or fragments are identical to a portion of the amino acid sequence of the natural protein and contain the entire amino acid sequence of a small, naturally occurring molecule. Short stretches of amino acids from polypeptides of ihe present Invention may be fused with those of another protein, such as KLH, and antibodies to the chimeric molecule may be produced,

[0158] Monoclonal antibodies to a mutant DEPDCS polypeptide of the invention may be prepared using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These Include, but are not limited to, the hybrldoma technique, the human B-cell hybrldoma technique, and the EBV-hybrldo a technique (for example, see Kohler si a/., 1975, Nature 256: 495-497: ozbor et a/., 1985, J. Immunol. Methods 81 :31-42; Cote et a/. , 1985. Proc. Natl. Acad. Sd. USA 80: 2026-2030; and Cote et a/., 1984, Mo/. Ce// B/oc7;em, 62: 109-120).

[0159] Antibodies may also be produced by inducing in vivo production in the lymphocyte population or by screening immunoglobulin libraries or panels of highly specific binding reagents as disclosed in the literature (for example, see Orlandl et ai. 198S. Proc. Nail. Acad. $ci. USA 86: 3833-3837: and Winter and Ostein, 1991 , /Vaiiifs 349: 293-299).

[0160] Antibody fragments which contain specific binding sites for a mutant DEPDC5 polypeptide of the invention may also be generated. For example, such fragments Include, F(ab')2 fragments produced by pepsin digestion of the antibody molecule and Fab fragments generated by reducing the disulfide bridges of the F(ab')2 fragments. Alternatively, Fab expression libraries may be constructed to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity (for example, see Huse et ai, 1989, Science 246: 1275-1281 ).

[0161] Various Immunoassays may be used for screening to Identify antibodies having the desired specificity. Numerous protocols for competitive binding or im unoradiometnc assays using either polyclonal or monoclonal antibodies with established specificities are well known In the art. Such Immunoassays typically Involve the measurement of complex formation between a protein and its specific antibody. A two-site, monoclonal-based Immunoassay utilizing antibodies reactive to two non-Interfering epitopes is preferred, but a competitive binding assay may also be employed.

[0162] Havsng established a link between the DEPDC5 gene and seizure disorders, the present invention enables therapeutic applications for such disorders. For example, a mutant DEPDC5 polypeptide, including a DEPDC5 polypeptide mutation Identified by the Inventors, may be used to produce antibodies specific for the mutant polypeptide (as described above) or to screen libraries of pharmaceutical agents to identify those that bind the mutant polypeptide (see below).

[0163] In one embodiment, an antibody, which specifically binds to a mutant of the Invention, may be used directly as an antagonist or modulator, or Indirectly as a targeting or delivery mechanism for bringing a pharmaceutical agent to cells or tissues that express the mutant polypeptide.

[0184J The Identification of DEPDC5 as a gene Involved In seizure disorders enables methods for treating such disorders, including epilepsy (for example !esional and norv leslonal focal epilepsies). Restoration of functional DEPDC5 gene expression or functional DEPDC5 polypeptide may be of therapeutic benefit. Accordingly, a further aspect of the present Invention relates to restoring functional DEPDCS gens and/or protein expression. Numerous methods exist for restoring gene and protein expression For example, a vector expressing the wild-type DEPDCS nucleic acid may be administered to a subject In need of such treatment. Many methods for introducing vectors Into cells or tissues are available each equally suitable for use in viva, in vitro, and ex vivo. For ex viva therapy, vectors may be Introduced Into stem cells taken from the patient and clonally propagated for autologous transplant back into that same patient. Delivery by transfection, by liposome Injections, or by polycatlonlc amino polymers may be achieved using methods which are well known in the art.

[0185] A further aspect of the invention relates to treating a seizure disorder, including epilepsy (for example lesional and non-!esiona! focal epilepsy), by silencing of the mutant DEPDCS gene in an affected subject. One approach comprises administering a DMA molecule which is the complement (antlsense) of a mutant DEFOC5 nucleic acid, including a complement of any one of the DEPDCS nucleic acid mutants Identified by the inventors, and which is, or encodes for, an RNA molecule that hybndizes with m NA encoded by the mutant DEPDC5, to a subject In need of such treatment.

[0166] Typically, a vector expressing the complement (antlsense) of the mutant DEPDCS nucleic acid may be administered to a subject In need of such treatnient, Methods for introducing vectors Into cells or tissues are described above.

[0167] Additional antlsense or gene-targeted silencing strategies may include, but are not limited to, the use of antlsense oligonucleotides, injection of antlsense RNA, transfection of antlsense RNA expression vectors, and the use of RNA interference (RNAI) or short interfering As (si RNA). Still further, catalytic nucleic add molecules such as DMAzymes and rlbozymes may be used for gene silencing These molecules function by cleaving their target mRNA molecule rather than merely binding to It as In traditional antlsense approaches.

[DISS] According to still another aspect of the Invention, a mutant DEPDCS nucleic acid or polypeptide, including the specific DEPDC5 nucleic acid and polypeptide mutations Identified by the Inventors, as well as cells expressing these, are useful for the screening of candidate pharmaceutical agents, particularly those for the treatment of seizure disorders such as epilepsy. [0169] Agents that can be screened in accordance with the invention include, but are not limited to peptides (such as soluble peptides), phosphopeptides and smalf organic or Inorganic molecules (such as natural product or synthetic chemical libraries and peptldomimetlcs}.

[0170] In one embodiment, a screening assay may include a cell-based assay utilising sukaryotlc or prokaryotic host cells that are stably transformed with recombinant molecules expressing mutant DEPDCS polypeptide, in competitive binding assays. Binding assays (e.g. ELISA-based or competition-based assays) will measure the formation of complexes between a specific mutant DEPDC5 polypeptide, and the agent being tested, or will measure the degree to which an agent being tested will inhibit or restore the formation of a complex between a specific mutant DEPDCS polypeptide, and Its interactor or llgand. A change in activity may be observed i these assays by using standard methods including spectrophotometries, fiuorimetric, calorimetric or chemi-!uminescent means preferably providing for the automation or partial automation of the detecting step (e.g. by a microplate reader or use of a flow cytometer).

[0171] Nort cell-based assays may aiso be used for Identifying agents that can inhibit or restore binding between a mutant DEPDCS polypeptide, including those mutants identified by the Inventors, and their Interactors. Such assays are known in the art and Include for example AlphaScreen technology (PerkinElmer Life Sciences, MA, USA). This application relies on the use of beads such that each interaction partner is bound to a separate bead via an antibody. Interaction of each partner will bring the beads into proximity, such that Iaser excitation Initiates a number of chemical reactions ultimately leading to fluorophores emitting a light signal. Candidate agents that inhibit the binding of the mutant with lis Interactor will result In loss of light emission, while candidate agents that restore the binding of the mutant with Its interactor will result In positive light emission. These assays ultimately enable Identification and Isolation of the candidate agents.

[0172] High-throughput drug screening techniques may also employ methods as described In WO84/03564 and Plrogova e; a/., 201 1 iCurr. Phar . Biotechnoi 12: 1 1 17-1127), amongst others. For example, efficient technologies such as combinatorial chemistry, hlghthroughpuf screening (NTS), virtual screening, de novo design and structure- based drug design are relevant to the present invention as they may provide an efficient means for Identifying candidate therapeutics As a more specific example, small peptide test agents synthesised on a solid substrate can be assayed for mutant polypeptide binding. Bound mutant DEPDCS polypeptide is then detected by methods well known in the art In a variation of this technique, purified mutant DEPDC5 polypeptides can be coated directly onto plates to Identify interacting test agents.

[0173] The Invention also contemplates the use of competition drug screening assays in which neutralizing antibodies capable of specifically binding a mutant DEPDC5 polypeptide compete with a test agent for binding thereto. In this manner, the antibodies can be used to detect the presencs of any peptide that shares one or mors anflgsnlc determinants of the rn utant.

[0174] A mutant DEPDC5 polypeptide, Including those mutants identified by the Inventors, may also be used for screening agents developed as a result of combinatorial library technology. This provides a way to test a large number of different substances for their ability to modulate activity of a polypeptide An agent identified as a modulator of polypeptide function may be peptide or non-peptide In nature, Mon-peptida "small molecules" are often preferred for many in vivo pharmaceutical applications. In addition, a mimic or mimetic of the substance may be designed for pharmaceutical use. The design of rnlmetics based on a known pharmaceutically active compound (dead" compound) Is a common approach to the development of novel pharmaceuticals. This Is often desirable where the original active agent Is difficult or expensive to syntheslse or where It provides an unsuitable method of administration. In the design of a mimetic, particular parts of the original active agent that are Important in determining the target property are identified. These parts or residues constituting the active region of the agent are known as Its pharmacophore. Once found, the pharmacophore structure Is modelled according to its physical properties using data from a range of sources including x-ray diffraction data and NMR. A template molecule Is then selected onto which chemical groups which mimic the pharmacophore can be added. The selection can be made such that the mimetic is easy to syntheslse, Is likely to be pharmacologically acceptable, does not degrade in vivo and retains the biological activity of the lead compound. Further optimisation or modification can be carried out to select one or more final ml etics useful for in vivo or clinical testing.

[0175] Another alternative method for drug screening relies on structure -based rational drug design. Determination of the three dimensional structure of a mutant DEPDC5 polypeptide, including those mutants Identified by the Inventors, allows for structure-based drug design to identify biologically active lead compounds.

[0178] Three dimensional structural models can be generated by a number of applications, some of which Include experimental models such as x-ray crystallography and NMR and/or from in siiico studies of structural databases such as the Protein Databank (PDB). in addition, three dimensional structural models can be determined using a number of known protein structure prediction techniques based on the primary sequences of the polypeptides (e.g. SYBYL - Tripos Associated, St, Louis, MO), cfe novo protein structure design programs (e.g. MODELER ··-· MSI Inc., San Diego, CA, or MOE -··^■ Chemical Computing Group, Montreal, Canada) or ao initio methods (e.g. see US Patent Numbers 5331573 and 5579250).

[0177] Once the three dimensional structure of a polypeptide has been determined, structure-based drug discovery techniques can be employed fa design blologlcally-aciive agents based on these three dimensional structures. Such techniques are known In the art and Include examples such as DOCK (University of California, San Francssco) or AUTODOCK (Scripps Research Institute, La Jolia, California). A computational docking protocol will identify the active site or sites that are deemed important for protein activity based on a predicted protein model. Molecular databases, such as the Available Chemicals Directory (ACD) are then screened for molecules that complement the protein model.

[D17S] Using methods such as these, potential clinical drug candidates can be identified and computationally ranked In order to reduce the time and expense associated with typical "wet lab" drug screening methodologies. The control response for the above referenced screening methodologies may Include a baseline response detected in said cell or animal without exposure to the test agent or, alternatively, the control response may be a response following exposure to the test agent In cells or animals Including a normal or wild-type complete DEPDC5 coding sequence. The test agents or drug candidates may be selected from known and novel compounds, complexes and other substances which may, for example, be sourced from private or publicly accessible agent libraries (e.g . the Queensland Compound Library (Griffith University, Nathan, QLD, Australia) and the Molecular Libraries Small Molecule Repository (N!H Molecular Libraries, Bethesda, MD, USA). The test agent may therefore comprise a protein, polypeptide or peptide (e.g. a recombinant^ expressed DEPDC5 gene, protein or polypeptide, or a functional fragment or functional variant thereof), or a mimetic thereof (Including so-called synthetic nucleic acid mimics, peptolds and relro- inverso peptides), but more preferably comprises a small organic molecule and especially one which complies or substantially complies with Lipinskl's Rule of Five for ^"druglikeness" (Lipinski, CA sf a/. , 2001 , Adv. Drug. Dei. Rev. 48: 3-28). The test agent may also be selected on the basis of structural analysis of known or novel compounds or may otherwise be designed following the further structural analysis of DEPDCS binding sites. [0179] Agents identified through screening procedures as described above, and which are based on the use of a mutant DEPDC5 nucleic acid molecule or polypeptide, including those mutants Identified by the Inventors, farm a part of the present Invention, as do pharmaceutical compositions containing these and a pharmaceutically acceptable carrier.

[0180] The present Invention also provides a kit that can be used to perform the methods of the first or second aspects of the invention. For example, the kit may contain, in an amount sufficient for at least one assay, hybridization assay probes, amplification primers, and/or antibodies, which are specific for wild-type and mutant DEPDC5 nucleic acids or DEPDCS polypeptides. These components have been described in detail above. Typically, the kit will also Include Instructions recorded In a tangible form (e.g. contained on paper or an electronic medium) for using the packaged probes, primers, and/or antibodies in a detection assay for determining the presence of a mutant DEPDCS nucleic acid or mutant DEPDCS polypeptide in a test sample.

[0181] Accordingly, in a further aspect, the present invention provides a kit for diagnosing or prognosing a seizure disorder In a subject, or for Identifying a subject with an Increased likelihood of having an offspring predisposed to a seizure disorder, said kit including one or more components for testing for the presence of an alteration in the EPDC5 gene In the subject,

[0182] In one embodiment, the one or more components are selected from the group consisting of; (i) an antibody or fragment thereof which specifically binds to a polypeptide according to a fifth or sixth aspect of the Invention; (II) an antibody or fragment thereof which detects a polypeptide according to a fifth or sixth aspect of the invention, wherein said polypeptide Is truncated when compared to a wild-type DEPDCS polypeptide the sequence of which is set forth in SEQ I D NO: 122 and represented by GenBank Accession No. P.001229825.1 , and wherein said antibody or fragment thereof binds to the truncated region of said polypeptide; and (III) a nucleic acid molecule which specifically hybridises to a nucleic acid molecule according to a third or fourth aspect of the Invention.

[0183] The various components of the kit may be provided in a variety of forms. For example, the required enzymes, the nucleotide triphosphates, the probes, primers, and/or antibodies may be provided as a lyophiiized reagent. These lyophlllzed reagents may be ore- mixed before lyophllization so that when reconstituted they form a complete mixture with the proper ratio of each of the components ready for use in the assay. In addition, the kit may contain a reconst!tuf!on reagent for reconstituting the lyophlllzed reagents of the kit. [0184] In one example, the kit may include at least three lyophllized oligonucleotides, Including a primer pair to PGR amplify a portion of DEPDC5 nucleic acid, and a detectably labeled probe capable of hybridizing to the generated ampiicon. In some kits, at least three lyophlllzed oligonucleotides are the primers for amplification of at least a portion of DEPDC5 nucleic acid by semi-nested PGR.

[0185] Some kits may further include a solid support for anchoring the nucleic aad of interest on the solid support. The target nucleic acid may be anchored to the solid support directly or indirectly through a capture probe anchored to the solid support and capable of hybridizing to the nucleic acid of Interest. Examples of such solid supports Include, but are not limited, to beads, mlcropartlc!es (for example, gold and other nano particles), microarray, micro eiis, and muitiwei! plates. The so!id surface may include a first member of a binding pair and the capture probe or the target nucleic acid may Include a second member of the binding pair. Binding of the binding pair members will anchor the capture probe or the target nucleic acid to the solid surface. Examples of such binding pairs Include but are not limited to bloiln/streptavldin, hormone/receptor, ilgand/receptor, and antigen/antibody.

[0188] in other kits, lyophiiized antibodies against DEPDC5 wild-type and mutant polypeptide may be provided. In some kits a primary/secondary antibody pair may be provided. Some kits may further Include a solid support for anchoring the DEPDC5 wild-type and mutant polypeptides. Such anchoring of the DEPDCS wild-type and mutant polypeptides may be through b!ot!n/streptav!d!n and antigen/antibody interactions as described above.

[0187] Typical packaging materials may Include solid matrices such as glass, plastic, paper, foil, micro-particles and the like, capable of holding within fixed limits hybridization assay probes, and/or amplification primers. Thus, for example, the packaging materials can include glass vials used to contain sub-milligram (e.g. picogram or nanogram) quantities of a contemplated probe, primer or antibody, or they can be microttter plate wells to which probes, primers, or antibodies have been operatlvely affixed, i.e. linked so as to be capable of participating In an amplification and/or detection methods.

[0188] The kit may Include instructions indicating the reagents and/or concentrations of reagents and at least one assay method parameter which might be, for example, the relative amounts of reagents to use per amount of sample. In addition, such specifics as maintenance, time periods, temperature, and buffer conditions may also be included. [0189] The term "about" as used In the specification means approximately or nearly and In the context of a numerical value or range set forth herein Is meant to encompass variations of «·/- 10% or less, +/- 5% or less, ÷/·· 1 % or less, or -r/- 0.1% or less of and from the numerical value or range recited or claimed.

[0190] Finally, reference is made to standard textbooks of molecular biology that contain methods for carrying out basic techniques encompassed by the present Inventio See, for example, Green MR and Sambrook J, Molecular Cianing: A Laboratory Manual (4th edition), Cold Spring Harbor Laboratory Press. 2012.

[0191] it will be apparent to the person skilled In the art that while the Invention has been described In some detail for the purposes of clarity and understanding, various modifications and alterations to the embodiments and methods described herein may be made without departing from the scope of the Inventive concept disclosed in this specification.

[0192] The invention Is further illustrated i the following examples. The examples are for the purpose of describing particular embodiments only and are not Intended to be limiting with respect to the above description

EXAMPLE 1

identification of a Causative Gene for Seizure Disorders

[0193] The following study was conducted with the aim to identify genes causative for seizure disorders. Families (and subjects therein) with epilepsy (focal epilepsy, Including FFEVF) formed the basis of the study.

Patients and Controls

[0194] Written consent was obtained from participants. The study was approved by local research ethics committees. Patients were recruited from epilepsy clinics, private practices and by referral to the present epilepsy genetics research program. Individuals underwent phenotyplng using a validated seizure questionnaire (Reutens, DC et a/., 1992, £ //eps/a 33: 1065-1071 ). All medical records, EEG and neuroimaging data were obtained where available. Australian control samples were from anonymous blood donors.

Exome Sequencing, Validation of Variants and tation Screening

[DISS] Individuals from Australian family A1 and Dutch family D1 (Figure 1) were Independently exome sequenced In the Princess Alexandra Hospital, Brisbane, Australia and the Leiden Genome Technology Centre (LGTC), Leiden, The Netherlands. The coding sequences were enriched using the SureSelect Human All Exon 50Mb kit (Agilent Technologies, Santa Clara, CA) Following sequence capture and amplification, fragments wars sequenced using SOUD v4 instrument (Applied Biosystems, Carlsbad, CA) in Australia and using the HlSeq2000 platform from lilumlns at LGTC. Sequence reads were aligned to the UCSC Genome Browser hg19 reference sequence using BWA (Li H and Durbtn R, 2009, S/o/ri or/?)ai/cs 25: 1754- 1760). Sequence variants were reported with SA tools and annotated using SeatileSeq (http://snp.gs.washington.©du S©attieSeqAnnoiaSon/). Chromosome 22 linkage interval variants between 022S? ^'/63 (chr22:26, 148,651) and 0223 ?¾> (chr22:31 ,639,700} were extracted from the annotation file. Variants reported in dbSNP and intrortic and Intergenic variants were filtered.

[0196] Mutation analysis of the open reading frame of DEPDC5 was performed by High- Resolution Melting (HR ) analysis using LightSoanner® (Idaho Technology, Sail Lake City, UT, USA) . Sequence variants were validated and family members analysed for mutations by Sanger sequencing. Control DNA was analysed for each mutation by HRM analysis. DE 3DCS primer sequences used for the H RM analysis are set out in Table 2. RCR conditions used for HRM screening were 1 x HlghRes elt masterrnlx (TrendBio, Victoria, Australia), 250 n each primer, 20 ng template In a 10 pi reaction volume. PGR cycling conditions were 95°C for 5 mm, 45 cycles of 95 ^'C for 30 sec then an Anneal for 30 sec, 95*C for 30 sec, 25 A, for 30 sec, and then reactions were held at 4°C until analysis was conducted. Annealing temperatures for each exon were as follows: Exon 2 - 67^':'C; Exons 3- 15 ·- 63"C (+5% DMSO for exon 7); Exon 16 -- 69^i!C, Exons 17 20a - 63"C; Exon 21 - 62^,JC: Exons 22-24 ^■■ 63 C. Exon 25 ·· 69°C; Exon 26 - 63°C ; Exsn 26a ^■· 65 C. Exons 27- 20 ^■· 63°C; Exon 30 - 6S'C; Exon 31 - 65^UC; Exon 32 - 70'C; Exons 33 and 33a ·^■ 63'C; Exon 34^■■ 65 C_: Exons 35 and 36 - 69^CC; Exon 37 ^■- 65 C (÷5% DMSO); Exon 38 - 63"C, Exon 39 - 65 C, Exon 40 ·^■ 63 'C; Exon 41 ·· 65 C" and Exon 42^■· 70 C

Detection of DEPDC5 p.VaS1S3d@iP ® Mut o by Alieie Specific PCR

[0197] To screen for the DEPDC5 mutation p,Val163delPhe, two Identical allele specific PCR primers were designed except for the last 3^* nucleotide: the primer 5'- GTTTTATTTCAGGTGGTT-3^: (SEQ I D NO: 28) was used to detect mutated alleles while the primer 5'-GTTTTATTTCAGGTGGTG-3^: (SEQ I D NO: 29) was used to detect wild-type alleles. These forward primers were used with the reverse primer 5^'- C IT AG CA GTT CAAT C AGC - 3' (SEQ I D NO: 30), to give a 1 17bp PCR product. PCR was performed with HotStarTaq Pius Master Mix Kit (Qlagen Benelux B.V., Venlo, Netherlands). TABLE 2

Ex n Forward Primer (5'-3') Reverse Primer (S'-3'}

2 CTGACATTCCAACCTTTTCG CAGAACCTCAGGCAACTTAC

(SEQ ID NO: 31) (SEQ ID NO: 32)

3 TA C GTGT AC CT A ATG A GTGTTT AACAGTGAATTGCCCAG

(SEQ ID NO: 33} (SEQ ID NO: 34)

4 G G AGTT ACTG TTC ACG GT TACAGTTTCTGAGGCAGTAAATA (SEQ ID NO: 35) (SEQ ID NO: 36}

5 CAAAATATGTTATCTGAGCCA GAAGGGTGCTTATTCCAA

(SEQ ID NO: 37} (SEQ ID NO: 38}

6 TA AAGTGT GG C AAAGTAATGTC TAAACAGGGATTATTCACATAATGG „ (SEQ ID NO: 39} (SEQ ID NO: 40}

7 TCTCCCTCCCTCCCTCTCTCTA AGTTACTGCACAGATAAGGCAAG

(SEQ ID NO: 41) _ {SEQ ID NO: 42)

8 CATGTATTGGTTTCATGTAAGAC GACTTAGCCATAATAGTATGGAG (SEQ ID NO: 43} (SEQ ID NO: 44)

9 GAACTGAAACTGTATATGGC CTTAGCAGTTACAATCAGC

(SEQ ID NO. 45) (SEQ ID NO: 46)

10 GATTGTTCTCATGTTCTCATC GTAATGTTTAGATAATGAGAGTTAG (SEQ ID NO: 47} (SEQ D NO: 48)

11 TG AA C AAACTTCA ACCCT GGGAAGCTTAACAAAAACAT

(SEQ ID NO: 49) (SEQ ID NO: 50}

2 CCTGAACTACATACTCCG TTTAAGTTAGGAAAGAAACAACTAAT (SEQ ID NO: 51 } (SEQ ID NO: 52)

13 AGCTGCTCAATATCCATTT CCTACACTTCCTTTCCC

t (SEQ ID NO: 53) (SEQ ID NO: 54}

14 AGTTCATGTTTCATGAGATGTT ACATAGCCATGTGGTAGG

(SEQ ID NO: 55) SEQ ID NO: 56}

15 GCTGTAACATCATTATTGTGGAA AACATGTGGAGACAGGG

t (SEQ ID NO: 57} (SEQ ID NO: 58}

16 TGTCTCTGCCATTCCCT ACTCCAACTGGCCTTTAGTA

(SEQ ID NO: 59) , (SEQ ID NO: 60}

17 TGTAGCTTATCTGTGCTCT ACGCTTATCACCTACTATTG

(SEQ ID NO: 61} (SEQ ID NO: 62)

18 AAAGGGAATTTAGATTAATGACTC AGATAAGACTGGACCACATA

(SEQ ID NO: 83) (SEQ ID NO: 64}

13 TTTCTAGCGAAGGAAGGAGTG AGCCAGCTGACTCTCTTT

(SEQ ID NO: 65} (SEQ ID NO: 66)

20 CAGGCATGTGTTTGAAATGTAT AACTTCAGGTTTTCCTACACAAT „ (SEQ ID NO: 67) (SEQ ID NO: 68}

21 CTCGCTTGATGGTAACT CCACTATATTAAGAAAGATGTCC (SEQ ID NO: 69} i SEQ ID NO: 70}

22 TTTCACTGTGGTTCTGTGGTTT AGCTCCTAGTCCAAGGCT

(SEQ D NO: 71} (SEQ ID NO: 72}

22a GAAATCACTTTAGGTGTTAGC GGATCGATTGAGTCCAGGAG

(SEQ ID NO: 73) (SEQ ID NO: 74}

24 AAAGAGGTGATGATCTACATT ATCTAAACATCCCAACTCTAT

(SEQ ID NO: 75} (SEQ ID NO: 76)

25 TTTGCAGAGTGAGCCTTC CCCACACTCCCTGTCTAC

(SEQ ID NO: 77) (SEQ ID NO: 73}

26 CTGTTACGTGAGGGAGTTG CCAAGGCAAGTGCCTTT

(SEQ ID NO: 79} (SEQ ID NO: 80) Εχοη Forward Primer (S'-S⁵ Reverse Primer (β^»-3')

26a GGTGACCACATGTACCTTT CGAAGCCAAGTGCCTTT

(SEQ ID NO: SI) _t (SEQ iD NO: 32)

27 AAGCATCTGTATGAGCAAT CTTCCACATACACAGTAGAAG

(SEQ iD NO: 83} (SEQ ID NO: 84)

28 CTGTTATAGGAATGAGCTTCAA GCCATAATTCAGGACAATAACT

(SEQ iD NO: 85) (SEQ ID NO: 86)

29 GGCAGGAATTTGTCTCTAAC CCAAGGATGCAAAGATGG

{SEQ iD NO: 87} (SEQ ID NO: 88)

30 TCTC ACCACC ACCCT GTGTT TCTCACACCAGGCGCACT

(SEQ iD NO: 89) (SEQ ID NO: 30}

31 GAG CG C A CTTG G CTG AT CTCAGGGCTGTCAAGGT

(SEQ iD NO: 31} (SEQ ID NO: 92)

32 TGAGCAAGCTGCTGTCAT CACAGAACAGCTCCCTGCTA

(SEQ iD NO: 93} (SEQ ID NO: 94)

33 CTGTGTTTTCCTGTCAGTTATT CTCCCCAGGAACATGAG

(BEQ iD NO: 95} (SEQ iD NO: 96)

33a CCACTGGTACACATTCCGTT AACAGAAGGCCAGCTCAT

{SEQ iD NO: 97) (SEQ ID NO: 98}

34 ACTGCATACGTGCCATCTT CTTCTGGGAACCTTCCAACCCTA

(SEQ iD NO: 99) _t (SEQ ID NO: 100}

35 ATGGGGCACACACATCC GGACCTAAGCAAACAGCTCTAT

(SEQ iD NO: 101 ) (SEQ ID NO: 102)

36 CCTCTCTGCAGGAATTTCAGAGT CTGTGGGCAACCGCATT

k (SEQ iD NO: 103) (SEQ ID NO: 104}

37 GTTGAGTACTCCTTCTCTCCC ACACCCTCAGACCTTGT

(SEQ iD NO: 105) (SEQ ID NO: 106}

38 TCTTCTTCATCCCACTCCTTT CACTGTGAGGTGAGCCAA

(SEQ iD NO: 107) (SEQ ID NO: 108}

39 TGTTTGAAAGAACTTGGAGAT GGTCTTA CTG GTTG A G AC A

(SEQ iD NO: 109) (SEQ ID NO: 1 10)

40 TGATCACAACCCAATATTTATTC CTGATTTCCTTCCCACTC

(SEQ iD NO: 111 } (SEQ ID NO: 112)

41 AACTAAGGAGGCGCTGATT AGGAAAGGGATGTGGACC

(SEQ iD NO: 113} {SEQ ID NO: 1 14}

42 CTGGTGGCTGCCACACA CAGTGGCTCACCCACCT

(SEQ iD NO: 115) (SEQ ID NO: 1 16)

Quantitative RT-PC Analyst of ^ouse DepdeS

[DISS] RNA was extracted using Trizol from various tissues of a P90 mouse as well as a pool of 11 .5 pc heads, a P4 brain and a P240 brain. One rng of each RNA sample was reverse transcribed using A ESI High Capacity RNA-cDNA kit (Life Technologies, Carlsbad, USA). Quantitative PGR was performed using ABI Fast SYBR Master Mix (Life Technologies, Carlsbad, USA) on ABI 7500 SiepOnePlus (Life Technologies, CA, USA) Primer sequences and lengths of amplified products were: DepdcS (I 09bp) 5'- TGGGGACAAACCCCGTGCAG--3' (SEQ ID NO: 1 1 ?) and CAT6CGGTCTGAGCG6TGGC-3¹ (SEQ I D NO: 118) , L38 (71 bp} 5'- GCGTCGCCATGCCTCGGAAA-3' (SEQ ID NO: 1 19) and 5'- CTTGGCATCCTTCCGCCGGG-3' (SEQ I D NO: 120). DepcfcS expression was normalised to L38. a low abundance reference gene with stable expression levels across multiple tissues (Kouadjo KE et al, 2007, BMC Genomics 22: 12?) and expressed as relative quantity (RQ) using ABI software (Life Technologies).

Immunofluorescence analysis of DepdcS In mouse brain

[0199] Adult FVB/N mice (12-weeks-ol ) were anesthetized with Avsrtin (i.p.) and transcartilally perfused with PBS followed by 4% paraformaldehyde (PFA) n 0.1 IVI phosphate buffer. Brain was Isolated and left in 4% PFA for 2 hours followed by 20% sucrose for 24 hours. Eighteen urn sagittal cryostai sections were mounted on superfrostS⁾ plus (IVtenzel-Glaser, Braunschweig, Germany) slides. D19 rabbit polyclonal antibody (Santa Cruz Biotechnology, Heidelberg, Germany, sc-86116) was raised against a peptide mapping near the N-terminal portion of the longest Isoform of human DEPDC5. Frozen brain sections were washed with PBS and then Incubated in blocking solution containing 5% donkey serum with 0.3% Triton X 100 for 2 hrs at room temperature followed by primary antibodies overnight at 4°C Primary antibodies Included D19, and mouse monoclonal antibodies against NeuN (Neuronal Nuclei; Merck Mllllpore, Overljse, Belgium), to detect mature neurons, GAD87 (Glutamic Acid Decarboxylase 67 kD isoform; Merck Mlllipore, Overiise, Belgium) to detect GABAerglc neurons, and GFAP (Glial Fibrillary Acidic Protein; Sigma- Aldrich, Bomem, Belgium) to detect astrocytes. Secondary antibodies were Alexa Fluor 488 donkey anti-rabbit and anti-mouse IgG conjugated with fluorescent dye Cy3. Tissues were washed and incubated with DAPI {4\6-diamidtnc~2-phenyiindofe) to stain cell nuclei and mounted with fiuorSave(Merck Mlllipore, Overijse, Belgium). Controls Included no primary antibody and, for D19, pre-lncubatlon with a blocking (neutralizing) peptide for 2 hrs at room temperature.

Immunofluorescence Analysis of DEPDC5 In Human Neural Cells Derived from Induced Pfuripotent Stem (IPS) Cells

[0200] Skin fibroblasts from healthy volunteers were reprogrammed to generate Induced p!unpotent stem (IPS) cells using the Thomson protocol (Yu J et a/„ 2007, Science 318: 191 - 1920} and validated using standard criteria (unpublished data). For neural Induction, IPS cell colonies were treated with Noggin for 14 days as described previously (Dottori M and Pera F, 2008, efftods Mo/. S;o/., 438: 19-30) and then mechanically transferred and cultured In NBN (Neurobasal media A*B27*N2) rnedsa In the presence of FGF-2 and EGF (Peproiech, London, UK: both 20 ng/ L), which allowed the formation of neurospheres containing neural precursors. To detect DEPDC5 sub-cellular localization In human neural precursors, neurospheres were plated on matrlgel (BD Biosciences) coated glass covers!ips overnight and fixed with 4% paraformaldehyde. Triton X-1 GG permeablllzed cultures were Incubated with rabbit polyclonal DEPDC5 antibody D19 (Santa Cruz Biotechnology) and with an anti-SOX2 (Merck Millipore) antibody. Staining was achieved with Atexa Fluor 488 donkey anti-rabbit !gG and anti-mouse SgG secondary antibodies conjugated with fluorescent dye Cy3. For neuronal differentiation, neurospheres were plated on faminin coated glass coverslips in NBN media without proliferating factors. To promote neuronal differentiation, BDNF and NT3 (both l OOng/rnL; Peprotech) were added in differentiating media and cultured for 4 weeks. To detect DEPDC5 in differentiated cells, Immunofluorescence was performed on paraformaldehyde fixed and trlton permeablllzed cultures. Mature neurons were labelled using NeuN (Merck Miiiipore) and astrocytes were labelled using GFAP (Sigma-Aldrich). The signal was obtained using secondary antibodies as described above DA PI was used to stain cell nuclei. Slides were mounted with fluorSave. The Immunofluorescence signal for both mouse and human samples was visualized by a laser scanning confocal microscope (LSIV1 510 META Zeiss, Munich, Germany) and exported Trf images from ISM were assembled in Adobe Illustrator. Fluorescence intensity values obtained during profile analysis were exported and histograms were generated using Sigmaplot 12.

Protein Extraction from dult ouse Brain

[0201] One FVBN wild type mouse was sacrificed by cervical dislocation and the brain promptly transferred to cold PBS containing protease Inhibitors Only one hemisphere of the brain was used for protein extraction according to a protocol adapted from VVItcher M ef a/. , 2003 (B/oori 102: 237-245). Freshly Isolated brain tissue was finely minced on Ice in 1 ml of hypotonic buffer (10 mM Tns-CI pH7.3, 5 mM gC io mM KCi, 0.1 m EDTA, 300 m!VI sucrose, 0.5 mM dithtothreitoi, plus protease inhibitor cocktail). NP-40 was added to a final concentration of 0.125%. The lysate was triturated through a 20G needle 25 times, Incubated for 1 mln on ice and centrlfuged briefly at low speed at 4'G in order to pellet the remaining pieces. The supernatant was collected and centrlfuged at 4000g for 5 mln. The supernatant (cytoplasmic fraction) was collected and the pellet (nuclei) washed once with hypotonic buffer, dissolved In hypertonic buffer (20 mM Tr!s-HC! pH7.8, 5 mM MgC¾, 320 mM KCI, 2 mM EDTA, 25% glycerol, 0.5 mM dlthlothreltol, plus protease Inhibitor cocktail) and incubated for 15 minutes on ice. The lysate was centrlfuged at 16000g for 10 minutes and supernatant collected (nuclear fraction).

[0202] Similarly, proteins were Isolated from 8H--SY5Y human neuroblastoma cells. Cells were lysed in 100 pi hypotonic buffer and incubated for 10 minutes on ice. After NP40 addition, Iysates were vortexed. The suspension was centrlfuged at 4000g for 5 minutes at 4^"C and the supernatant (cytoplasmic fraction) collected, while pellets (nuclei) were washed once with hypotonic buffer. Nuclei were lysed in 50 μΐ of hypertonic buffer for 10 minutes, cen rifuged at 16000g for 10 minutes and the supernatant collected (nuclear fraction).

SDS-PAGE and Western B totting

[0203] Proteins were quantified by BGA assay (Pierce) and 40 protein per lane was separated on a 7% scrylamlde gel at 40mA per gel. Proteins were transferred to 0.45 urn nitrocellulose membranes at a constant voltage of 100V for 2 hours at 4"C in transfer buffer supplemented with 0.25% SDS. DEPDC5 antibody (D19, Santa Cruz Biotechnology, Tebu- bio, Boechout, Belgium) diluted 1 :500, was Incubated overnight at 4"C after a 2- hour preincubation at RT with or without the D19 blocking peptide S~t!rnes more concentrated than the D19 antibody. otubulin antlbody(Sigma), diluted 1 :7000, was Incubated overnight at 4°C. Rabbit and mouse secondary antibodies (IRDye® secondary antibodies, LI--COR), diluted 1 :15000. were Incubated for 1 hour at RT in the dark. Each step was followed by 4x5 minutes washes alternating PBS-0.1 % Tween20 and PBS buffers. Fluorescent signal was detected using an Odyssey Infrared Imaging System (L!-COR; Westburg).

Confocai Laser Scanning Microscopy

[0204] A LS 510 NIC) mufttphoton confocai microscope fitted on an Axtovert 200 inverted microscope equipped with OApochrornat 40x/1 .2 N.A. and 63x/1.2 N.A. water immersion objectives (Zeiss, Jena, Germany) was used for visualizing immunohistochemtstry analyses. The 488 nm excitation wavelength of the Argon/2 laser, a main dichroic HFT 488 and a band-pass emission filter (BP500-550nm) were used for selective detection of the green fiuorochrome. The 543nm excitation wavelength of the HeNel laser, a main dichroic HFT 488/543/633 and a long-pass emission filter (LP560nm) were used for selective detection of the red fiuorochrome. The nuclear stain DAPI was excited In muitiphotonic mode at 760 nm with a Mai Tai tunable broad-band laser (Spectra-Physics, Darmstad, Germany) and detected using a main dichroic HFT KP650 and a band-pass emission filter (BP435-485nm). Optical sections, 1 urn thick, 1024 x 1024 pixels, were collected sequentially for each fiuorochrome.

[0205] To Identify the genetic cause of focal epilepsy, Including FFEVF exo e sequencing was applied to one Australian (A1) and one Dutch family (D1 ) previously mapped to chromosome 22q12. A novel heterozygous nonsense mutation In D/s/vei e/teof Egl~10 and Piecksirin Domain Containing protein 5 (DE;^:iDC5) was Identified in each family: c 21C-→G, p.Tyr7* In Family A1 ; C.1663C--.T, p ArgS55^* in Family D1 . The DEPDC5 mutations were prioritized for validation and follow-up analyses. Subsequent Sanger sequencing of DEPDC5 (GenBank Accession Number NIVM3Q1242896) In affected members of six additional families showing linkage to 22q122 revealed DEPDC5 mutations in five families (see Figure 1). Nonsense mutations were present in two families (c.4107G-→A; ρ 7Yp1369^÷ (Family SI ) and C.4606C---.T; p.Gin1536* (Family S2) while the same amino acsd deletion mutation (c.488- 4S0delTGT; Val 163delPhei was found In three French Canadian families (Families FC1 _; FC2 and FC3). Haplotype and genealogical analyses were compatible with a shared ancestor for these three families (unpublished data). A single synonymous alteration In DEPDC5 (C.4512C— »T) was also found in Family D1 which has not previously been reported In dbS P. The clinical and genetic data ot the seven large FFEVF families in which mutations were detected is shown In Table 3.

[020SJ Of the eight large families with FFEVF. only one family (Family A) did not reveal a DEP C5 mutation. Each detected ΰ£;¾)05 mutation segregated with the FFEVF phenotype In the respective family (Figure 1) and was absent i both dbSNP135 and an irvhouse exome sequencing database of 710 chromosomes (data not shown). The Identification of mutations in seven of eight 22q-!!nked FFEVF families firmly establishes DEPOC as the major gene for this disorder.

[0207] The Inventors postulated that DEPDC5 may also contribute to non-lesional focal epilepsy in families that were too small to clinically diagnose FFEVF The Inventors scanned DEPDC5 for sequence variation by high-resolution melt curve analysis In 82 unrelated probands from families with at least two individuals with focal epilepsy without a detectable structural aetiology. Ten of 82 (12 2%) probands had a DEPDC5 mutation showing that mutations In DEPDC5 are an important cause of familial focal epilepsy. The pedigrees of the ten small families In which OEPDC5 mutations were Identified are shown In Figure 2 and the clinical and genetic data of these families Is shown In Table 4.

[0208] The syndrome of FFEVF could not be confidently diagnosed In these smaller families due to the low numbers of affected individuals and the pedigrees being too small to demonstrate clear autosomal dominant inheritance. The identification of a DEPDC5 mutation in these smaller families enables a molecular diagnosis of FFEVF. In the ten small families, six additional nonsense or splice site mutations and three mlssense mutations (Ser1104Leu, Ser1073Arg_; Ala452Val) were Identified, with one nonsense mutation (p.Trp1466^*) found In two unrelated families (Table 4). All mutations were absent i bSNP 135 and an In-house exo e variant database (710 chromosomes), consistent with likely pathogenicity. TABLE 3

epilepsy, FLE ~ frontal lobe epilepsy, FTLE ~ fnanto-temp raf lobe epilepsy, TLE ~ temporal lobe epilepsy, OLE ~ occipital lobe epilepsy, PLE - parieial lobe epilepsy, ASD = Autism Spectrum Disorder, ID - intellectual Disability. TABLE 4

Disorder, ID ~ intellectual Disability.

[0209] The change Ser1 104Leu is present in the 1000 Genomes database with a minor allele frequency of 0.002 which raises uncertainty as to its pathogenicity, although approximately 2% o? the general population has epilepsy,

[0210] The penetrance of mutations in DEPDC5 associated with FFEVF was estimated at 66% (89/105) In the seven large families (Figure 1). This ranged from 50% in family S2 to 82% In family A1 including one Individual with ASD who had not had seizures (Table 2). The majority o? the DEPDC5 mutations detected encode premature termination codons suggesting that hapsolnsufflciency is the likely mechanism underlying pathogenesis. One patient in the DECI PHER database has a deletion encompassing fifteen genes Including DEPDCS but no phenotype was reported (Firth HV et a!., 200S, Am J. Hun . Genet., 84: 524- 533} implying that hsmszygoslty for D£ ^:sDC5 shows incomplete penetrance. One proband, for whom parentage was confirmed, had a de novo nonsense mutation (p.Arg1268*) (Figure 2), Implicating DEPDC5 as a contributor to sporadic as well as to familial focal epilepsies, it remains to be determined how prevalent DEPDC5 mutations are in large cohorts of sporadic non-iesicnai focal epilepsy. Temporal lobe epilepsy and frontal iobe epilepsy were the most common phenotypes In the families, accounting for over 70% of affected Individuals. Parietal and occipital epilepsies were Infrequent. Rarely multifocal epilepsies and epileptic spasms were observed (Table 2). The mean age of seizure onset with DEPDC5 mutations was 12.5 years (median 1 1 years, range 6 weeks - 52 years). Of note, there were seven families that included affected Individuals who did not have a DEPDC5 mutation. As the focal epilepsy phenotypss seen In FFEVF are common, this may simply reflect ascertainment bias in family studies. Mutations in the ion channel subunit genes CHRNA4, CHRNB2 and CHRNA2 collectively account for approximately a tenth of cases of the rare focal epilepsy syndrome, autosomal dominant nocturnal frontal lobe epilepsy (ADNFLE). Mutations In the potassium channel KCNT1 gene have recently been shown to contribute to a severe form of ADNFLE. Mutations In LGI1, which encodes the synaptic protein leucine-rich glioma Inactivated 1 , underlie approximately half of the cases of another rare focal epilepsy syndrome, autosomal dominant epilepsy with auditory features. Here, we add to the understanding of the molecular basis of autosomal dominant focal epilepsies by identifying the involvement of DEPDC5,

[0211] Importantly, mutations in DEPDC5 account for 12% of cases of familial focal epilepsy suggesting that It is a highly relevant gene to the common clinical population with norv lesional frontal and temporal iobe epilepsy and a positive family history, DEPDC5 encodes a full length 1603 amino acid protein (GenBank Accession Number PJX51229825.1) of unknown function with ortnologs found In species as divergent as Anopheles gambiae (mosquito). DEPDC5 contains an 80 amino acid Dishevelled, Egl-10 and Pieckstrin (DEP) homology domain (Figure 3} found in proteins involved in G protein signalling and membrane targeting. Proteins containing DEP domains mediate a broad range of cellular functions Including signalling in platelets and neutrophils and Writ signalling Interestingly, the Wnt- signal!ing pathway plays an Important role In several aspects of neuronal circuit formation, Including neuronal polarity, axon guidance, synapse formation, and synaptic plasticity. The biological role of DEPDCS and elucidation of how its perturbation leads to focal seizures are yet to be determined.

[0212] The occurrence of seizures originating from different brain regions within families Is an Intriguing feature of FFEVF. Although the reason for this variability within families Is not yet known, there are precedents for marked phenotyplc variability In other monogenic epilepsies. The syndrome of familial partial epilepsy with pericentral spikes has been reported in a single large family and also features focal epilepsies with variable onset. Another example Is the familial epilepsy syndrome of genetic epilepsy with febrile seizures plus In which sodium channel gene mutations can cause generalised or focal epilepsies and are associated with ID and ASD in some individuals. The presence of ASD and I D In the families of the present Invention suggests a shared pathogenic mechanism for epilepsy and other neuropsych!atr!c disorders as also observed with other genetic variants Including recurrent copy number variants at 15q13.3.

[0213] The expression of DEPDC5 was analysed in mouse and human brain tissues. Mouse DepcfcS transcripts were detected by quantitative RT-PCR at low levels In all brain regions analysed (Figure 4) and were detected throughout brain development: in mid-gestation embryonic head (l l .Sdpc), neonatal brain (P4) and whole adult brain (P240). Immunofluorescence analyses in mouse brain showed that DepdcS Is expressed In neurons, Identified on the basis of their morphology and NeuN staining, and Is absent in non-neuronai cells, Including astrocytes (Figure 5) . GABAergic Interneurons, identified by glutamic acid decarboxylase (Gad67) staining, also expressed DepdcS. immunofluorescence is localised in the c tosol of the neuronal ceil body, and is mostly perinuclear in location, with little or no extension Into neuronal processes. This subcellular localization was confirmed by Immunofluorescence In human neurospheres derived from Induced piuripotent stern (IPS) cells from control individuals (Figure 6), as well as in mouse brain (Figure 7} and SH-SY5Y human neuroblastoma cell protein extracts by Western blot analysis (Figure 8). The localization of DEPDC5 In neurons and Its homology to proteins Involved In G protein signalling pathways suggest a role In neuronal signal transduction.

[0214] The present study has identified £PDC5 mutations In seven large families with FFEVF, approximately 12% of smaller families with focal epilepsy and a cfe novo mutation In a patient with focal epilepsy. This finding establishes DEPDC5 mutations as the most common known cause of familial focal epilepsy. The identification of DEPDCS as the gene for FFEVF significantly advances our understanding of the pathogenesis of epilepsy by Implicating another new gene pathway. Apart from enabling diagnosis of FFEVF through molecular testing, strategies may now be devised to Improve prognosis through tailored treatment targeting OEPC 5

EXAMPLE 2

[021 S] Following on from the study in Example 1 , further individuals with focal epilepsy (including those having lesional epilepsy) were screened for mutations In DEPDCS. Patients and Controls

[021 S] Informed written consent was obtained from participants or from parents or legal guardians In the case of minors or those ith Intellectual disability. The study was approved by the Human Research Ethics Committees of Austin Health (H2007/02981 ) and collaborating centers. Patients were derived from an Australian family of Greek origin (Family B In Figure 9A), comprising six individuals with focal epilepsy; five with frontal lobe epilepsy (FLE) and one with unclassified focal seizures One had intellectual disability and psychosis and his sibling had recurrent psychosis from 21 years (see Table 5). Two individuals had a bottom of the sulcus dysplasia (BOSD) diagnosed by Magnetic Resonance I maging (M i). Cortical thickening was associated with loss of grey-white differentiation at the bottom of the sulcus in the right middle frontal lobe in individual B: l l l:2 and sn the right medial superior frontal iobe in individual B:l ll :8 (Figure 1A). Individuals underwent electrocllnicai phenotyping using a validated seizure questionnaire (Reutens, DC a/. , 1892, Epi/eps/a 33: 1065-1071 ). All medical records, EEG and neuroimaging data were obtained where available. Australian control samples were from anonymous blood donors.

M RI Studies

[0217] Magnetic Resonance I maging (MRI) was performed for 5 of the 6 affected males in Family B referred to above, Including 3 Tesla Imaging In one. Five members of Family A 1 of Example 1 (see Figure 1 and Figure 9B) underwent high-resolution 3 Tesla MRI studies. A newly affected member of Italian family I (l : l\/: 1) of Example 1 (see Figure 2 and Figure 9C) had a routine 1ST MRI study. M RI scans were reviewed systematically with evaluation or the cerebellum, brainstem, ventricles, hippocampi, white matter signal and morphology, midline structures, deep grey and cortex. Sulcal and gyral patterns were reviewed.

Whole Exome Sequencing and High Resolution Melting (HRM) Curve Analysis

[0218] VVhole exome sequencing (WES) and HRM curve analysis was performed as described above In Example 1. WES was performed on two members of Family B. e u s

[0219] Exome sequencing and mutation analysis of Individuals B: !il :2 and B: l ll :8 from Family B Identified a heterozygous nonsense mutation, c.418C→T: p.Gln140* In DEPDC5. This mutation was present in all affected individuals studied In the family and three obligate carriers. T his nonsense mutation Is absent in variant databases, and as it is near the N- terminus the mutation Is predicted to be deleterious. Taken together with the phenotypic segregation, the data supports pathogenicity.

[0220] The Identification of a DEPDC5 mutation In Individuals with cortical malformations led to a re-study of available members of the original FFEVF family (Family A1 In Figure 1 and Figure 9B) having the DEPDCS nonsense mutation c.21 C~*G; p.Tyr7^* identified in Example 1. 3T MRI of five affected members of Family A1 led to the Identification of focal cortical dysplasia In the proband (A1 :V:3). A BOSD was observed in the depths of two adjacent sulci in the left superior frontal lobe (Figure 9B). This abnormality had not been Identified on 1.5T imaging despite comprehensive evaluation for epilepsy surgery. MR I studies of the remaining 4 individuals were normal.

[0221] in a family of Italian origin (Family I of Figure 2 and Figure 9C), a 6 year old child of the proband (l:IV: 1) developed frontal lobe seizures at 4 years and was shown to have the familial DEPDCS splice site mutation c.279*1G~»A Identified In Example 1. On R I analysis a unilateral subtle band heterotopia was identified within the subcortical white matter adjacent to dysplastlc cortex In the left frontal lobe In this individual (Figure SC). Blurring of the grey-white matter junction involving part of the cingulate cortex and left frontal cortex was also seen. The location of the malformations was congruent with the EEG and clinical localisation of the seizures (see Table 5) suggesting that the malformations were the likely source of the epilepsy,

[0222] This study shows that some cases of focal epilepsy due to mutation of DEPDCS have focal cortical malformations while symptomatic relatives who carry the same mutation do not have a detectable structural change on high resolution Imaging (Figure 9). This observation of ieslonal and non-lesional cases was found In three families with DEPDC5 mutations. The malformations varied from focal cortical dysplasia to subtle hand heterotopia with the predominant pattern being BOSD. BOSD is a variety of type II focal cortical dysplasia In which the dysplastlc features are maximal at the depth of a sulcus tapering to a normal gyral crown (Blumcke I ef aL 2011 , £p;/eps/a 52: 158-174, and Barkovich AJ ef a/._: 2012, Brain 135: 1348-1369). The characteristic features on MR I are thickening of cortex, blurring of grey-white junction and subcortical signal abnormality often extending to the ventricle as the transmantle sign (Besson P ef a/., 2008, Sr¾m 131 : 3246-3255: Hofman PA et aL , 2011 AJR Am, J, Roentgenol. 196: 881-885; and Colombo N ef a/. , 2012, A/ei roraalo/ogy 54: 1065- 1077), BOSD usually represents focal cortical dysplasia type IIB although pathological confirmation In our cases is lacking (Blumcke I ef a/. , 2011 , supra).

[0223] These observations reveal a shared genetic etiology for Ieslonal and non-!esiona! focal epilepsies, disorders that were previously regarded as unrelated. The families In which members have structural brain abnormalities observed to date all carry severely mutated DEPDC5 alleles such as early nonsense mutations and splice site mutations. Accordingly, routine screening for mutations in DEPDC5 should be considered for individuals with suspected non-lesional focal epilepsy as well as for Individuals having lesi nai focal epilepsy,

[0224] The mechanisms by which focal epilepsies arise in people with DEPDC5 mutations without apparent brain lesions remain to be elucidated. Recognition of subtle dysgenesis is limited by the resolution of current Imaging technology and these individuals may ultimately be shown to have similar but mora subtle malformations of cortical development that correlate with the localization of their focal epilepsy.

EXAMPLE 3

[0225] To determine the effect that a particular DEPDC5 mutation has on protein function, and ultimately cell function, a range of methods will be employed. One of those methods Includes the production of a genetically modified animal, such as a genetically modified mouse, that harbours the particular DEPDC5 mutation being analysed, Methods for the production of genetically modified animals Is described In detail above.

[0226] Those skilled In the art will appreciate that the invention described herein Is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The Invention also includes all of the steps, features, compositions and compounds referred to, or indicated in this specification, individually or collectively, and any and all combinations of any two or more of the steps or features.

[0227] Future patent applications may be filed in Australia or overseas on the basis of the present application, for example by claiming priority from the present application, by claiming a divisional status and/or by claiming a continuation status, it Is to be understood that the following provisional claims are provided by way of example only, and are not Intended to limit the scope of what may be claimed In any such future application. Furthermore, the claims should not be considered to limit the understanding of (or exclude other understandings of) the invention Inherent In the present disclosure. Features may be added to or omitted from the provisional claims at a later date, so as to further define the Invention,

Claims

1 , A method for the diagnosis or prognosis of a seizure disorder in a subject; the method including testing for the presence of an alteration In the DEPOCS gens in the subject.

2. The method according to claim 1 wherein the presence of an alteration in the OEROC5 gene In the subject establishes a diagnosis or prognosis which will Indicate a high probability of the disorder in the subject

3 The method according to ciaim 2, wherein the presence of an alteration In the DEPDC5 gene In the subject which Is also present In an affected parent or relative of the subject establishes a diagnosis or prognosis which will Indicate a very high probability of the disorder in the subject.

4. A method for identifying a subject with an Increased likelihood of having en offspring predisposed to a seizure disorder, the method Including testing for the presence of an alteration In the DEPDC5 gene In the subject.

5. The method according to claim 4, wherein the presence of an alteration In the DEPDC5 gene In the subject identifies the subject as a subject with an Increased likelihood of having an offspring predisposed to a seizure disorder.

6. The method according to claim 5, wherein the presence of an alteration in the DEPDC5 gene In the subject which Is also present in an affected parent or relative of the subject Identifies the subject as a subject with very high likelihood of having an offspring predisposed to a seizure disorder.

7. The method according to any one of claims 1 to 6, wherein the disorder is epilepsy.

8. The method according to claim 7, wherein the epilepsy Is focal epilepsy.

9. The method according to claim 8, wherein the focal epilepsy Is Familial Focal Epilepsy with Variable Foci (FFEVF).

10. The method according to any one of claims 1 to 9, wherein the method Includes performing one or more assays to test for the presence of an alteration in the DEPDCS gene and to identify the nature of the alteration.

11 . The method of any one of claims 1 to 10, including:

(1) performing one or more assays to test for the presence of an alteration in the DEPDCS gene; and, if the results indicate the presence o? an alteration In the DEPDCS gene,

(2) performing one or more assays to identify the nature of the DEPDCS alteration.

12. The method according to claim 10 or claim 1 1 , wherein the one or more assays are selected from the group consisting of DMA sequencing, DNA hybridisation, high performance liquid chromatography, an electrophoretlc assay, 8SCP analysis, RNase protection, DGGE, an enzymatic assay, and an immunoassay,

13. The method according to any one of claims 1 to 12, wherein the DEPDCS alteration is a nonsense mutation In DEPDCS.

14. The method according to claim 13, wherein the nonsense mutation is the result of a cytoslne I to guanine (G) nucleotide substitution at position 21 of the coding sequence of the DEPDCS gene (c.21 C-- G), said coding sequence of the DEPDCS gene set forth in SEQ I D NO: 121 and represented by GenBank Accession No. NM_0Q 242896.1

15. The method according to claim 14, wherein the coding sequence of DEPDCS including the nonsense mutation Is set forth In SEQ ID NO: 1

16. The method according to claim 14 or claim 15, wherein the nonsense mutation encodes a truncated DEPDC5 polypeptide {p.TyrT*) Including the amino acid sequence set forth in SEQ ID NO: 2.

17. The method according to claim 13, wherein the nonsense mutation Is the result of a cytoslne I to thymine (T) nucleotide substitution at position 1663 of the coding sequence of the DEPDCS gene (c.1663C^»→T), said coding sequence of the DEPDCS gene set forth In SEQ ID NO' 121 and represented by GenBank Accession No. N ..001242896.1 .

18. The method according to claim 15, wherein the coding sequence of D£i^:sDCS including the nonsense mutation is set forth in SEQ ID NO: 3.

19. The method according to cSaim 17 or claim 18, wherein the nonsense mutation encodes a truncated DEPDC5 poiypeptide (p.Arg555*) including the amino acid sequence set forth in SEQ I D NO: 4.

20. The method according to claim 13, wherein the nonsense mutation Is the result of a guanine (G) to adenine (A) nucleotide substitution at position 4107 of the coding sequence of the ΩΞ-PDC'i gene (c.4107G~÷A}, said coding sequence of the ::· :: ^;¾ ¾ gene set forth In SEQ ID O: 121 and represented by GenBank Accession No, M_ 001242896, 1 .

21 . The method according to claim 20, wherein the coding sequence of DEPDC5 Including the nonsense mutation is set forth In SEQ ID NO: 5.

22. The method according to claim 20 or claim 21 , wherein the nonsense mutation encodes a truncated DEPDC5 polypeptide {p.Trp1369*) including the amino acid sequence set forth in SEQ I D NO: 6.

23. The method according to claim 13, wherein the nonsense mutation is the result of a cytoslne I to thymine (I) nucleotide substitution at position 4606 of the coding sequence of the DEPDC5 gene (C.4806C---T), said coding sequence of the DEPDC5 gene set forth In SEQ ID NO: 121 and represented by GenBank Accession No, ...001242896, 1 .

24. The method according to claim 23, wherein the coding sequence of DEPDC5 including the nonsense mutation Is set forth In SEQ ID NO: 7,

25. The method according to claim 23 or claim 24, wherein the nonsense mutation encodes a truncated DEPDC5 polypeptide {p.Gln1536Q including the amino add sequence set forth In SEQ I D NO: 8.

26. The method according to claim 13, wherein the nonsense mutation Is the result of a guanine (G) to adenine (A) nucleotide substitution at position 4397 of the coding sequence of the DEPDC5 gene (c.4397G~→A), said coding sequence of the DEPDC5 gene set forth In SEQ ID NO: 121 and represented by GenBank Accession No. NM .001242396.1 .

27. The method according to claim 26, wherein the coding sequence of DEPDCS Including the nonsense mutation is set forth in SEQ ID NO: 9.

28. The method according to cSaim 26 or claim 27, wherein the nonsense mutation encodes a truncated DEPDC5 polypeptide (p.Trp1 66*) including the amino acid sequence set forth in SEQ !D NO: 10.

29. The method according to claim 13, wherein the nonsense mutation Is the result ot a cytosine I to thymine (T) nucleotide substitution at position 1459 of the coding sequence of the u:::PD05 gens (c.1459C~-*T), said coding sequence of the L-EPuCo gene set forth in SEQ ID O: 121 and represented by GenBank Accession No, M_ 001242896, 1 .

30. The method according to claim 29, wherein the coding sequence of DEPDC5 Including the nonsense mutation Is set forth In SEQ ID NO: 11.

31. The method according to claim 29 or claim 30, wherein the nonsense mutation encodes a truncated DEPDC5 polypeptide (p.Arg487^'y) including the amino acid sequence set forth in SEQ I D NO: 12.

32. The method according to claim 13, wherein the nonsense mutation is the result of a cytosine I to thymine (I) nucleotide substitution at position 2527 of the coding sequence of the OEPDC5 gene (C.2527C---T), said coding sequence of the D£POCS gene set forth In SEQ ID NO: 121 and represented by GenBank Accession No, ...001242896, .

33. The method according to claim 32, wherein the coding sequence of DEPDC5 including the nonsense mutation Is set forth In SEQ ID NO: 13.

34. The method according to claim 32 or claim 33, wherein the nonsense mutation encodes a truncated DEPDC5 polypeptide (p.Arg843^*) Including the amino acid sequence set forth In SEQ I D NO: 14.

35. The method according to claim 13, wherein the nonsense mutation Is the result of a cytosine I to thymine (T) nucleotide substitution at position 3802 of the coding sequence of the DEPDC5 gene (c.3302C-*T), said coding sequence of the DEPDC5 gene set forth In SEQ ID NO: 121 and represented by GenBank Accession No. NM .001242896.1 .

36. The method according to claim 35, wherein the coding sequence of D£/°DCS Including the nonsense mutation Is set forth In SEQ ID NO: 15.

37. The method according to cSaim 35 or claim 36, wherein the nonsense mutation encodes a truncated DEPDC5 polypeptide (p.Arg1268^*) including the amino acid sequence set forth in SEQ I D NO: 16.

38. The method according to any one of claims 1 to 12, wherein the DEPDCS alteration is a deletion mutation in DEPDC5.

39. The method according to claim 38, wherein the mutation is the result of a deletion of the thymine (T), guanine (Gs, and thymine (T) nucleotide residues at positions 488-490 of the coding sequence of the DEPDCS gene (c.4S8~490delTGT), said coding sequence of the DEPDC5 gene set forth in SEQ ID NO: 121 and represented by GenBank Accession No. NMJ3G1242896.1.

40. The method according to claim 39, wherein the coding sequence of DEPDC5 including the deletion mutation Is set forth in SEQ ID NO: 17.

41. The method according to claim 39 or claim 40, wherein the deletion mutation encodes a DEPDCS polypeptide (p,Vai163delPhe) including the amino acid sequence set forth In SEQ ID NO. 18.

42. The method according to any one of claims 1 to 12, wherein the DEPDCS alteration is a mlssense mutation in DEPDC5.

43. The method according to claim 42, wherein the mlssense mutation Is the result of a cytoslne i to thymine (T) nucleotide substitution at position 3311 of the coding sequence of the DEPDCS gene (c.331 1C-*T), said coding sequence of the DEPDCS gene set forth In SEQ ID NO. 121 and represented by GenBank Accession No. N ...001242896.1 ,

44. The method according to claim 43, wherein the coding sequence of DEPDCS including the mlssense mutation is set forth In SEQ I D NO: 19.

45. The method according to claim 43 or claim 44, wherein the mlssense mutation encodes a DEPDCS polypeptide including a serine (S) to leucine (L) amino acid substitution at amino acid position 1 104 (p.Serl 1G4Leu), said polypeptide including the amino acid sequence set forth in SEQ ID NO: 20.

46. The method according to ciaim 42, wherein the missense mutation is the result of a adenine (A) to cytosine (C) nucleotide substitution at position 3217 of the coding sequence of the DEPDC5 gene ic.321?A-*C), said coding sequence of the DEPDC5 gene set forth in SEQ ID NO: 121 and represented by GenBank Accession No. N jD01242896.1 .

47. The method according to claim 46. wherein the coding sequence of D£ ^:;!DC5 including the missense mutation is set forth in SEQ I D NO: 21.

48. The method according to claim 46 or ciaim 47, wherein the missense mutation encodes a DEPDCS polypeptide including a serine (S) to Arginine I amino acid substitution at amino acid position 1073 (p.Ser1Q73Arg), said polypeptide including the amino acid sequence set forth In SEQ ID NO: 22.

49. The method according to claim 42. wherein the missense mutation is the result of a cytosine I to thymine (T) nucleotide substitution at position 1355 of the coding sequence of the DEPDCS gene (c.1355C-*T), said coding sequence of the DEPDCS gene set forth in SEQ ID NO: 121 and represented by GenBank Accession No. N ..001242896.1 .

50. The method according to claim 49, wherein the coding sequence of DEPDCS Including the missense mutation is set forth In SEQ I D HO: 23.

51. The method according to claim 49 or claim 50, wherein the missense mutation encodes a DEPDC5 polypeptide including an alanine (A) to valine (V) amino acid substitution at amino acid position 452 (p.Ala452Val) _; said polypeptide Including the amino acid sequence set forth in SEQ ID NO: 24.

52. The method according to any one of claims 1 to 12, wherein the DEPDCS alteration is a splice site mutation.

53. The method according to claim 52, wherein the splice site mutation Is the result of a guanine (G) to adenine (A) nucleotide substitution at position + 1 of Intron 4 of DEPDCS (c.193 -1 G→A: iVS4*-1G-→A}_; wherein the DPPDC gene Is represented by GenBank Accession Ho. N _, .001242896.1.

54. The method according to claim 52 or claim 53, wherein the nucleotide sequence Including the splice site mutation Is set forth in SEQ ID NO: 25.

55. The method according to claim 52, wherein the splice site mutation is the result of a guanine (G) to adenine (A) nucleotide substitution at position *1 of intron 5 of DEPDC5 (c.279*1G~»A; iVS5*1G~>.A}_! wherein the DEPDC5 gene Is represented by GenBank Accession No. NMJ3G1242896.1.

56. The method according to claim 52 or claim 55, wherein the nucleotide sequence including the splice sits mutation Is set forth in SEQ ID NO: 26.

57. The method according to any one of claims 1 to 12, wherein the DEPDC5 alteration is a synonymous mutation.

58. The method according to claim 57, wherein the synonymous mutation Is the result of a cytosirse I to thymine (T) nucleotide substitution at position 4512 of the coding sequence of the DEPDC5 gene {c.4512C~»T), said coding sequence of the DEPDC5 gene set forth in SEQ ID NO' 121 and represented by GenBank Accession No. N ..001242896.1 .

59. The method according to claim 57 or claim 58, wherein the coding sequence of DEPDC5 including the synonymous mutation is set forth in SEQ ID NO: 27.

60. An Isolated nucleic acid molecule Including an alteration In the OEPDC5 gene, wherein said alteration produces a seizure disorder phenotype.

61. The isolated nucleic acid molecule according to claim 60, wherein the alteration ss a nonsense mutation in DEPOC5.

62. The Isolated nucleic acid molecule according to claim 60 or claim 61 , wherein the nucleic acid molecule includes the sequence set forth In any one of SEQ ID NOs: 1 3, 5, 7, 9, 11 , 13 and 15.

53. The Isolated nucleic acid molecule according to claim 62, wherein the nucleic acid molecule encodes a DEPDC5 polypeptide including the amino acid sequence set forth In any one of SEQ ID NOs: 2, 4 6, 8, 10, 12, 14 and 16.

64. The Isolated nucleic acid molecule according to claim 60, wherein the alteration Is a deletion mutation In DEPDC5.

65. The isolated nucieic acid molecule according to claim 60 or claim 64, wherein the nucie c acid moiecuie includes the sequence set forth in SEQ ID NO: 17

66. The isolated nucleic acid molecule according to claim 65, wherein the nucleic acid molecule encodes a DEPDC5 polypeptide Including the amino acid sequence set forth In SEQ ID NO: 18.

87, The Isolated nucleic acid molecule according to claim 60, wherein the alteration is a m!ssense mutation in DEPDC5.

88. The Isolated nucleic add molecule according to claim 60 or claim 67, wherein ihe nucleic acid molecule includes the sequence set forth in any one of SEQ ID NGs: 19, 21 and 23.

69. The isolated nucleic acid molecule according to claim 68, wherein the nucleic acid molecule encodes a DEPDC5 polypeptide including the amino acid sequence set forth In any one of SEQ ID NOs: 20, 22 and 24.

70. The isolated nucieic acid molecule according to claim 60, wherein the alteration is a splice site mutation in DERDC5.

71. The isolated nucieic acid molecule according to claim 60 or claim 70, wherein the nucleic acid molecule includes the sequence set forth in SEQ ID HO: 25 or SEQ ID O: 26.

72. The Isolated nucleic acid molecule according to claim 60, wherein the alteration is a synonymous mutation In DEPDC5.

73. The Isolated nucleic add molecule according to claim 60 or claim 72, wherein the nucleic acid molecule includes the sequence set forth in SEQ ID NO: 27.

74. An Isolated nucleic acid molecule including a fragment of the DEPDC5 gene, wherein said nucleic acid molecule Includes a mutation in DEPDC5, said mutation selected from the group consisting of c.21C--»G, c · 6030-71. c 410?G --·Α. c.46G6C-->T, c,4397G-→A, o 1469Q T c.2527C-→T_: c.8802C-→T, c.488-490dslTGT, c331 1C~*T, c.3217A-→C, c.1355C-~>T, c.193+1G-*A (!VS4+1G— A), c.279+1G-»A <iVS5+1G--A), and c.4512C~->T, wherein the EPDC5 gene is represented by GenBank Accession No. NM.J301242896.1 .

75. The isolated nucleic acid molecule according to claim 74, wherein said nucleic acid molecule includes a nucleotide sequence at least 95% identical to at least about 20 contiguous nucleotides of SEQ ID NO: 1 and Includes the c,21C-→G mutation.

76. The isolated nucleic acid molecule according to claim 74, wherein said nucleic acid molecule includes a nucleotide sequence at least SS% Identical to at least about 20 contiguous nucleotides of SEQ ID NO: 3 and includes the c.1663C-*T mutation.

77. The isolated nucleic acid molecule according to claim 74, wherein said nucleic acid molecule Includes a nucleotide sequence at least 95% Identical to at least about 20 contiguous nucleotides of SEQ ID NO: 5 and includes the c.4107G-→A mutation.

78. The isolated nucleic acid molecule according to claim 74, wherein said nucleic acid molecule includes a nucleotide sequence at least 95% identical to at least about 20 contiguous nucleotides of SEQ ID NO: 7 and includes the c.4606C-*T mutation.

79. The isolated nucleic acid molecule according to claim 74, wherein said nucleic acid molecule Includes a nucleotide sequence at least 95% identical to at least about 20 contiguous nucleotides of SEQ ID NO: 9 and includes the c.4397G→A mutation.

80. The isolated nucleic acid molecule according to claim 74, wherein said nucleic acid molecule includes a nucleotide sequence at least 95% Identical to at least about 20 contiguous nucleotides of SEQ ID NO; 1 1 and Includes the C.1459C-+T mutation.

81. The Isolated nucleic acid molecule according to claim 74, wherein said nucleic acid molecule Includes a nucleotide sequence at least 95% Identical to at least about 20 contiguous nucleotides of SEQ ID NO: 13 and includes the c.252?C~»T mutation.

82. The isolated nucleic acid molecule according to claim 74, wherein said nucleic acid molecule includes a nucleotide sequence at least 95% Identical to at least about 20 contiguous nucleotides of SEQ ID NO: 15 and Includes the c.3802C~÷T mutation.

83. The Isolated nucleic acid molecule according to claim 74, wherein said nucleic acid molecule includes a nucleotide sequence at least 95% identical to at least about 20 contiguous nucleotides of SEQ ID NO: 17 and includes the c,488-490delTGT mutation.

84. The Isolated nucleic acid molecule according to claim 74, wherein said nucleic acid molecule includes a nucleotide sequence at least 95% Identical to at least about 20 contiguous nucleotides of SEQ ID NO: IS and Includes the c.331 1C~>T mutation.

85. The isolated nucleic acid molecule according to claim 74, wherein said nucleic acid molecule Includes a nucleotide sequence at least SS% identical to at least about 20 contiguous nucleotides of SEQ ID NO: 21 and Includes the c.3217A-→C mutation.

86. The isolated nucleic acid molecule according to claim 74, wherein said nucleic acid molecule includes a nucleotide sequence at least 95% identical to at least about 20 contiguous nucleotides of SEQ ID NO: 23 and Includes the c.1355C-→T mutation.

87. The Isolated nucleic acid molecule according to claim 74, wherein said nucleic acid molecule includes a nucleotide sequence at least 95% identical to at least about 20 contiguous nucleotides of SEQ ID NO: 25 and Includes the C.1 S3+1 G—A (!VS + 1G→A) mutation.

88. The Isolated nucleic acid molecule according to claim 74, wherein said nucleic acid molecule includes a nucleotide sequence at least 95% identical to at least about 20 contiguous nucleotides of SEQ ID NO: 26 and includes the c.279*1G~*A (IVS5+1G-+A) mutation.

89. The isolated nucleic acid molecule according to claim 74, wherein said nucleic acid molecule Includes a nucleotide sequence at least 95% identical to at least about 20 contiguous nucleotides of SEQ ID NO: 27 and includes the C.4512C-+T mutation.

90. The isolated nucleic acid molecule according to any one of claims 60 to 89, wherein the disorder Is epilepsy.

91. The isolated nucleic acid molecule according to claim 90, wherein the epilepsy Is focal epilepsy.

92. The Isolated nucleic acid molecule according to claim 91 , wherein the focal epilepsy is Familial Focal Epilepsy with Variable Foa (FFEVF).

93. An Isolated polypeptide, wherein said polypeptide Is a DEPDC5 polypeptide including an alteration, wherein said alteration produces a seizure disorder phenotype.

94. The Isolated polypeptide according to claim 93, wherein the alteration Is encoded by a nonsense mutation In DEPDC5.

95. The Isolated polypeptide according to claim 93 or claim 94, wherein the polypeptide includes the amino acid sequence set forth In any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14 and 16.

96. The isolated polypeptide according to claim 93, wherein the alteration is a deletion mutation.

97. The Isolated polypeptide according to claim 93 or claim 96, wherein the polypeptide Includes the amino acid sequence set forth In SEQ ID NO: 18.

98. The Isolated polypeptide according to claim 93, wherein the alteration is a missense mutation.

99. The isolated polypeptide according to claim 93 or claim 98, wherein the polypeptide includes the amino acid sequence set forth In any one of SEQ ID NOs: 20, 22 and 24

100. An Isolated polypeptide Including a fragment of the DEPDC5 polypeptide, wherein said polypeptide includes a mutation In DEPDC5, said mutation selected from the group consisting of p,Yai163delPhe, p.SerT104Leu, p.Ser1G73Arg. and p.Ala4S2Val

101 . The Isolated polypeptide according to claim 100, wherein said polypeptide Includes an amino acid sequence at Ieast 95% Identical to at Ieast about 20 contiguous amino acids of SEQ ID NO: 18 and Includes the p.Val163delPhe mutation.

102. The isolated polypeptide according to claim 100, wherein said polypeptide inciudes an amino acid sequence at Ieast 95% Identical to at least about 20 contiguous amino acids of SEQ ID NO: 20 and Includes the p.Serl 104Leu mutation.

103. The Isolated polypeptide according to claim 100, wherein said polypeptide Includes an amino acid sequence at Ieast 95% Identical to at Ieast about 20 contiguous amino acids of SEQ ID NO: 22 and includes the p.Ser 073Arg mutation.

104. The Isolated polypeptide according to claim 100, wherein said polypeptide includes an amino acid sequence at Ieast 95% Identical to at Ieast about 20 contiguous amino acids of SEQ ID NO: 24 and Includes the p.Aia452Vai mutation.

105. The Isolated polypeptide according to any one of claims 93 to 104, wherein the disorder Is epilepsy.

106. The isolated polypeptide according to claim 105, wherein the epilepsy Is focal epilepsy.

107. The isolated polypeptide according to claim 106, wherein the focal epilepsy is Familial Focal Epilepsy with Variable Foci (FFEVF).

108 An Isolated cell including an isolated nucleic acid molecule according to any one of claims 60 to 92.

109. A genetically modified non- human animal Including an Isolated nucleic aad molecule according to any one of claims 60 to 92. 10. The genetically modified non-human animal according to claim 109, wherein the animal is selected from the group consisting of a rat, mouse, hamster, guinea pig, rabbit, dog, cat goat, sheep, pig and non-human primate

111 . An antibody or fragment thereof which specifically binds to an Isolated polypeptide according to any one of claims 96 to 104.

112. An antibody or fragment thereof which detects a polypeptide according to claim 94 or claim 95, wherein said polypeptide Is truncated when compared to a wild-type DEPDC5 polypeptide the sequence of which Is set forth In SEQ I D NO; "122 and represented by GenBank Accession No, NPJ3Q 1229825,1 , and wherein said antibody or fragment thereof binds to the truncated region of said polypeptide,

113. A kit for diagnosing or prognoslng a seizure disorder In a subject, or for Identifying a subject with an increased likelihood of having an offspring predisposed to a seizure disorder, said kit including one or more components for testing for the presence of an alteration In the DEPDC5 gene In the subject.

114. The kit according to claim 113, wherein said one or more components are selected from the group consisting of:

(i) an antibody or fragment thereof which specifically binds to an isolated polypeptide according to any one of claims 98 to 104;

(ii) an antibody or fragment thereof which detects a polypeptide according to claim 94 or claim 95, wherein said polypeptide is truncated when compared to a wild-type DEPDC5 polypeptide the sequence of which is set forth In SEQ ID NO: 122 and represented by GenBank Accession No. NPJ301229825.1 , and wherein said antibody or fragment thereof binds to the truncated region of said polypeptide; and

(iii) a nucleic acid molecule which specifically hybridises to an isolated nucleic acid molecule according to any one of claims 60 to 92.