WO2014145768A2

WO2014145768A2 - Use of non-fungal 5' utrs in filamentous fungi

Info

Publication number: WO2014145768A2
Application number: PCT/US2014/030589
Authority: WO
Inventors: Nicholas J. RYDING; Danielle I. BINGER; Thomas D. GOLDMAN
Original assignee: Bp Corporation North America Inc.
Priority date: 2013-03-15
Filing date: 2014-03-17
Publication date: 2014-09-18
Also published as: WO2014145768A3

Abstract

The present disclosure is directed to the use of non- fungal 5' UTRS to enhance recombinant expression in filamentous fungal cells. In certain aspects, the present disclosure provides an expression cassette useful for the expression of polypeptide in filamentous fungal cells. Also provided herein, are vectors and recombinant filamentous fungal cells comprising the expression cassettes of the present disclosure, and methods of making and using the same for recombinant polypeptide expression.

Description

USE OF NON-FUNGAL 5' UTRS IN FILAMENTOUS FUNGI

1. BACKGROUND

[0001] The use of recombinant expression has greatly simplified the production of large quantities of commercially valuable proteins. Currently, there is a varied selection of expression systems from which to choose for the production of any given protein, including prokaryotic and eukaryotic hosts. A variety of gene expression systems have been developed for use with filamentous fungal cells. Many systems produce gene transcripts that encompass exogenous elements, including 5' untranslated regions ("5' UTRs"). The 5' UTR is an untranslated portion of the "transcript," or messenger RNA ("mRNA"), and occurs 5' to the coding sequence, adjacent to the start codon. Various regulatory sequences can occur within the 5' UTR, including sequences that promote or inhibit translation initiation, binding sites for regulatory proteins, riboswitches, and sequences that regulate gene expression and mRNA export. Exogenous 5' UTRs may result in inefficient translation in filamentous fungal cells. Thus, there is a need for expression systems that are economically viable and promote efficient translation in large scale commercial fermentations.

2. SUMMARY

[0002] The present disclosure relates to the use of heterologous 5' UTRs to promote efficient translation of transcripts encoding recombinant polypeptides in filamentous fungi. More particularly, the present disclosure relates to the use of 5' UTRs that are operable in non- fungal cells ("non- fungal 5' UTRs") to drive recombinant polypeptide expression in filamentous fungi. The present disclosure is based, in part, on Applicants' discovery that particular non- fungal 5' UTRs are capable of promoting efficient translation of exogenous transcripts in filamentous fungi such as Trichoderma reesei.

[0003] Thus, the present disclosure provides expression cassettes comprising a mammalian promoter operably linked to a coding sequence for a polypeptide of interest (a "POI"). Mammalian promoters that are suitable for recombinant expression in filamentous fungi include, but are not limited to, the cytomegalovirus (CMV) promoter. Additional promoters suitable for practicing the present invention are described in Section 1.1.1.

[0004] The sequence encoding the POI can be from a prokaryotic {e.g., bacterial), eukaryotic {e.g., plant, filamentous fungal, yeast or mammalian) or viral source. It can optionally include introns. In some embodiments, the polypeptide coding sequence comprises a signal sequence, which directs the POI to be secreted by the filamentous fungal cell. In a specific exemplary embodiment, the polypeptide coding sequence is a polypeptide coding sequence of a Cochliobolus heterostrophus β-glucosidase gene. Further POIs are described in Section 1.1.3.

[0005] In order to achieve robust expression of the POI from the mRNA transcript, the expression cassette preferably includes a sequence that corresponds to a non- fungal 5' untranslated region (5' UTR) in the mRNA resulting from transcription of the expression cassette (for convenience referred to as a "5' UTR" in the expression cassette). A 5' UTR can contain elements for controlling gene expression by way of regulatory elements. It begins at the transcription start site and ends one nucleotide (nt) before the start codon of the coding region. A 5' UTR that is operable in a filamentous fungal cell can be included in the expression cassettes of the disclosure. The source of the 5' UTR can vary provided it is non- fungal in origin and operable in the filamentous fungal cell. In various embodiments, the 5' UTR can be derived from a yeast gene or a filamentous fungal gene. The 5' UTR can be from the same species one other component in the expression cassette (e.g., the promoter or the polypeptide coding sequence), or from a different species than the other component. In a specific embodiment, the 5' UTR is not naturally associated with the CMV promoter. Additional 5' UTRs are described in Section 1.1.2.

[0006] For effective processing of the transcript encoding the POI, the expression cassette further includes a sequence that corresponds to a 3' untranslated region (3' UTR) in the mRNA resulting from transcription of the expression cassette (for convenience referred to as a "3' UTR" in the expression cassette). A 3' UTR minimally includes a polyadenylation signal, which directs cleavage of the transcript followed by the addition of a poly(A) tail that is important for the nuclear export, translation, and stability of mRNA. As with the 5' UTR, the 3' UTR can be derived from a yeast gene or a filamentous fungal gene. Additional 3' UTR are described in Section 1.1.4.

[0007] Accordingly, in certain aspects, as illustrated in FIG. 1, the present disclosure provides expression cassettes comprising, operably linked to 5' and to 3' direction: (1) a mammalian promoter, (2) a 5' UTR (i.e., a sequence coding for a 5' UTR), (3) a coding sequence for a POI, and (4) a 3' UTR (i.e., a coding sequence for a 3' UTR). Each of these components is described below and in the corresponding sub-section of Section 1.1.

[0008] The expression cassettes of the disclosure can encode more than one POI (e.g., a first POI, a second POI, and optionally a third or more POIs). In embodiments where the expression cassette comprises more than one polypeptide coding sequence, the expression cassette can include an internal ribosome binding entry site ("IRES") sequence between the POI coding sequences.

[0009] The present disclosure further provides filamentous fungal cells engineered to contain an expression cassette. Recombinant filamentous fungal cells may be from any species of filamentous fungus. In some embodiments, the filamentous fungal cell is a Trichoderma sp., e.g. Trichoderma reesei. The expression cassette can be extra-genomic or part of the filamentous fungal cell genome. One, several, or all components in an expression cassette can be introduced into a filamentous fungal cell by one or more vectors. Accordingly, the present disclosure also provides vectors comprising expression cassettes or components thereof (e.g., a promoter). The vectors can also include targeting sequences that are capable of directing integration of the expression cassette or expression cassette component into a filamentous cell by homologous recombination. For example, the vector can include a mammalian promoter flanked by sequences corresponding to a filamentous fungal gene encoding a POI such that upon transformation of the vector into a filamentous fungal cell the flanking sequences will direct integration of the promoter sequence into a location of the filamentous fungal genome where it is operably linked to the POI coding sequence and directs recombinant expression of the POI.

[0010] The present disclosure further provides vectors comprising, operably linked in a 5' to 3' direction, a mammalian promoter, a 5' UTR sequence, one or more unique restriction sites, and a 3' UTR. The unique restriction sites facilitate cloning of any POI coding sequence into the vector to generate an expression cassette of the disclosure.

[0011] The vectors are typically capable of autonomous replication in a prokaryotic (e.g., E. coli) and/or eukaryotic (e.g., filamentous fungal) cells and thus contain an origin of replication that is operable in such cells. The vectors preferably include a selectable marker, such as an antibiotic resistance marker or an auxotrophy marker, suitable for selection in prokaryotic or eukaryotic cells.

[0012] Methods of making the recombinant filamentous fungal cells described herein include methods of introducing vectors comprising expression cassettes or components thereof into filamentous fungal cells and, optionally, selecting for filamentous fungal cells whose genomes contain an expression cassette of the disclosure (for example by integration of a entire expression cassette or a portion thereof). Such methods are described in more detail in Section 1.2. [0013] Also provided herein are methods of using the recombinant filamentous fungal cells described herein to produce a POI. Generally, the methods comprise culturing a recombinant filamentous fungal cell comprising an expression cassette of the disclosure under conditions that result in expression of the POI. Optionally, the methods can further include a step of recovering the POI from cell lysates or, where a secreted POI is produced, from the culture medium. The method can further comprise additional protein purification or isolation steps, as described below in Section 1.6.

[0014] The recombinant filamentous fungal cells of the disclosure can be used to produce cellulase compositions. Where the production of cellulase compositions (including whole cellulase compositions and fermentation broths) is desired, the recombinant filamentous fungal cells can be engineered to express as POIs one or more cellulases, hemicellulases and/or accessory proteins. Exemplary cellulases, hemicellulases and/or accessory proteins are described in Section 1.1.3. The cellulase compositions can be used, inter alia, in processes for saccharifying biomass. Additional details of saccharification reactions, and additional applications of the variant β-glucosidase polypeptides, are provided in Section 1.6.

[0015] All publications, patents, patent applications, GenBank sequences, Accession numbers, and ATCC deposits, cited herein are hereby expressly incorporated by reference for all purposes.

3. BRIEF DESCRIPTION OF THE FIGURES

[0016] FIG. 1 provides a schematic drawing of an expression cassette comprising (1) a promoter, (2) a 5' untranslated region (5' UTR), (3) a coding sequence, with or without introns, and (4) a 3 ' untranslated region (3' UTR).

[0017] FIGS. 2A-2C provide schematic drawings of an extra-genomic expression cassette (FIG. 2A), a genomic expression cassette (FIG. 2B), and integration of expression cassette components into the genome of a filamentous fungal cell to generate a genomic expression cassette (FIG. 2C).

[0018] FIG. 3 provides a schematic map of the pGLA-200_hyg vector

[0019] FIGS. 4A-4F provide β-Glucosidase activity assay data.

4. DETAILED DESCRIPTION

[0020] Applicants have discovered that certain non- fungal 5' UTRs can promote efficient translation of transcripts encoding recombinant polypeptides in filamentous fungi. The demonstration that non- fungal 5' UTRs can enable efficient translation of downstream coding sequences improves yield of polypeptides produced from transcripts bearing these sequences, and broadens the choices available for engineering expression constructs for production of heterologous proteins in filamentous fungal hosts. Consequently, provided herein are expression cassettes comprising four components, operably linked in a 5' to 3' direction: a promoter, a 5' UTR, a polypeptide coding sequence, and a 3' untranslated region ("3 ' UTR").

These expression cassettes, described in more detail below, can be transformed into filamentous fungal cells and permit the production and recovery of polypeptides of interest.

Accordingly, the present disclosure provides expression cassettes, vectors comprising expression cassettes or components thereof, filamentous fungal cells bearing expression cassettes, and methods of producing, recovering and purifying polypeptides of interest from the filamentous fungal cells described herein.

1.1. Expression Cassette

[0021] The expression cassette of the present disclosure typically comprises, operably linked in a 5' to 3' direction: (a) a promoter, (b) a 5' UTR, (c) a polypeptide coding sequence, and

(4) a 3 ' UTR, features and examples of which are described further herein below.

1.1.1. Promoter Sequences

[0022] Promoters of the expression cassettes of the disclosure can include any promoter operable in filamentous fungi. The promoters can include any naturally-occurring promoter or variants of naturally-occurring promoters, such as those derived from sources including mammals, fungi, plants, and viruses. Persons of skill in the art will appreciate that promoters can have various strengths and may be subject to different types of regulation, and that these properties can be usefully applied in expression cassettes of the disclosure. For example, a promoter may be strong, weak, constitutive, or inducible. In specific embodiments, a promoter is a strong constitutive promoter.

[0023] Mammalian Promoters: The promoters useful in the expression cassettes described herein can be promoters that are active in mammalian cells. The promoter can be a mammalian promoter, i.e., a promoter that is native to a mammalian genome, or a promoter from a mammalian virus. Collectively they are referred to herein as "mammalian promoters."

[0024] The mammalian promoters preferably have at least 5%, at least 10%, at least 15%, or at least 20% of the activity of a strong constitutive fungal promoter, for example the T. reesei CBHI promoter or the Aspergillus oryzae TAKA amylase promoter. Promoter activity can be assayed by comparing reporter protein (e.g., green fluorescent protein ("GFP")) production by filamentous fungal cells {e.g., T.reesei cells) transformed with a vector (e.g., pW as described in the Examples below) containing the test promoter operably linked to the reporter protein coding sequence (the "test vector") relative to filamentous fungal cells transformed with vector in which the test promoter is substituted with the CBHI promoter (the "control" vector). Reporter protein expression is measured or compared in filamentous fungal cells transformed with the test vector and in filamentous fungal cells transformed with the control vector grown under suitable growth conditions, e.g., in minimal medium containing 2% lactose as described in Murray et al, 2004, Protein Expression and Purification 38:248-257 and Ilmen et al, 1997, Appl. Environmental Microbiol. 63(4): 1298-1306. The promoter of interest is considered to be a strong promoter if reporter protein expression in filamentous fungal cells transformed with the test vector is at least 5%, at least 10%, at least 15%, or at least 20%) the level of reporter expression observed in the filamentous fungal cells transformed with the control vector. A promoter that can be used in accordance with the present disclosure can, in specific embodiments, have at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, or at least 75% the activity of the CBHI promoter in the assay described above.

[0025] Mammalian viral genes are often highly expressed and have a broad host range; therefore sequences encoding mammalian viral genes provide particularly useful promoter sequences. Promoters useful in the expression cassettes provided herein include mammalian viral promoters. Such promoters can be from any family of mammalian virus, including but not limited to viruses belong to one of the Retroviridae, Picornaviridae, Calciviridae, Togaviridae, Flaviridae, Coronaviridae, Rhabdoviridae, Filoviridae, Paramyxoviridae, Orthomyxoviridae, Bungaviridae, Arenaviridae, Reoviridae, Birnaviridae, Hepadnaviridae, Parvoviridae, Papovavi idae, Adenoviridae, Herpesviridae, Polyomaviridae, Poxviridae and Iridoviridae families. In some embodiments, however, the mammalian virus is not a member of the Polyomaviridae family.

[0026] Specific examples of mammalian viral promoters include those derived from the Rous sarcoma virus (RSV) long terminal repeat (LTR) (see, e.g., Yamamoto et al., 1980, Cell 22:787-797), the cytomegalovirus immediate early gene (CMV), the SV40 early promoter (Benoist and Chambon, 1981, Nature 290:304-310), the adenovirus major late promoter, the mouse mammary tumor virus LTR, and the herpes thymidine kinase gene (see, e.g., Wagner et al, 1981, Proc. Natl. Acad. Sci. U.S.A. 78:1441-1445).

[0027] In addition, sequences derived from non-viral genes, such as the promoters of the human β-actin (ACTB) gene, the elongation factor- la (EFl ) gene, the phosphoglycerate kinase (PGK) gene, the ubiquitinC (UbC) gene, and the murine metallotheionin gene, also provide useful promoter sequences. [0028] The presence of an enhancer element (enhancer) will usually increase expression levels. An enhancer is a regulatory DNA sequence that can stimulate transcription up to 1000-fold when linked to homologous or heterologous promoters, with synthesis beginning at the normal RNA start site. Enhancer elements derived from viruses may be particularly useful, because they usually have a broader host range. Examples include the SV40 early gene enhancer (Dijkema et al, 1985, EMBO J. 4:761) and the enhancer/promoters derived from the long terminal repeat (LTR) of the Rous Sarcoma Virus (Gorman et al, 1982, Proc. Natl. Acad. Sci. 79:6777) and from human cytomegalovirus (Boshart et al, 1985, Cell 41 :521). Additionally, some enhancers are regulatable and become active only in the presence of an inducer, such as a hormone or metal ion (Sassone-Corsi and Borelli, 1986, Trends Genet. 2:215; Maniatis et al, 1987, Science 236: 1237).

[0029] Mammalian promoters are disclosed in U.S. Application No. 13/665,609, hereby incorporated by reference in its entirety.

[0030] Fungal Promoters: Promoters that are also useful in the expression cassettes described herein can be promoters that are native to fungal cells, referred to as "fungal promoters."

[0031] Examples of suitable promoters for directing the transcription of the nucleic acid constructs in a filamentous fungal host cell are promoters obtained from the genes for Aspergillus oryzae TAKA amylase, Rhizomucor miehei aspartic proteinase, Aspergillus niger neutral alpha-amylase, Aspergillus niger acid stable alpha-amylase, Aspergillus nigeror Aspergillus awamori glucoamylase (glaA), Rhizomucor miehei lipase, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase, Aspergillus nidulans acetamidase, Fusarium venen twmamyloglucosidase (WO 00/56900), Fusarium venenatum Daria (WO 00/56900), Fusarium venenatum Quinn (WO 00/56900), Fusarium oxysporum trypsin-like protease (WO 96/00787), Trichoderma reesei beta-glucosidase, Trichoderma reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II, Trichoderma reesei endoglucanase I, Trichoderma reesei endoglucanase II, Trichoderma reesei endoglucanase III, Trichoderma reesei endoglucanase IV, Trichoderma reesei endoglucanase V, Trichoderma reesei xylanase I, Trichoderma reesei xylanase II, Trichoderma reesei beta-xylosidase, as well as the NA2-tpi promoter (a hybrid of the promoters from the genes for Aspergillus niger neutral alpha-amylase and Aspergillus oryzae triose phosphate isomerase); and mutant, truncated, and hybrid promoters thereof. [0032] In a yeast host, useful promoters are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae galactokinase (GAL1), Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH1, ADH2/GAP), Saccharomyces cerevisiae triose phosphate isomerase (TP I), Saccharomyces cerevisiae metallothionein (CUP1), and Saccharomyces cerevisiae 3- phosphoglycerate kinase. Other useful promoters for yeast host cells are described by Romanos et al, 1992, Yeast 8: 423-488.

[0033] Plant Promoters: The promoters useful in the expression cassettes described herein are promoters that are active in plants. The promoter can be a plant promoter, i.e., a promoter that is native to a plant genome, or a promoter from a plant virus. Collectively they are referred to herein as "plant promoters."

[0034] The plant promoters are preferably strong constitutive promoters, e.g., promoters that have at least 5%, at least 10%, at least 15%, or at least 20% of the activity of the T. reesei CBHI promoter in a filamentous fungus such as T. reesei. Promoter activity can be assayed by comparing reporter protein {e.g., green fluorescent protein ("GFP")) production by filamentous fungal cells {e.g., T. reesei cells) transformed with a vector {e.g., pW as described in the Examples below) containing the test promoter operably linked to the reporter protein coding sequence (the "test vector") relative to filamentous fungal cells transformed with vector in which the test promoter is substituted with the CBHI promoter (the "control" vector). Reporter protein expression is measured or compared in filamentous fungal cells transformed with the test vector and in filamentous fungal cells transformed with the control vector grown under suitable growth conditions, e.g., in minimal medium containing 2% lactose as described in Murray et al., 2004, Protein Expression and Purification 38:248-257 and Ilmen et al, 1997, Appl. Environmental Microbiol. 63(4): 1298-1306. The promoter of interest is considered to be a strong promoter if reporter protein expression in filamentous fungal cells transformed with the test vector is at least 5%, at least 10%, at least 15%, or at least 20% the level of reporter expression observed in the filamentous fungal cells transformed with the control vector. A promoter that can be used in accordance with the present disclosure can, in specific embodiments, have at least 5%, at least 10%, at least 15%, or at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, or at least 75% the activity of the CBHI promoter in the assay described above. [0035] Plant promoter may be from a monocotyledonous or a dicotyledonous plant. Numerous plant promoters are known, including promoters from such plants as potato, rice, corn, wheat, tobacco or barley.

[0036] Promoters useful in the expression cassettes provided herein also include plant viral promoters. Such promoters can be from any family of plant virus, including but not limited to viruses belong to one of the Caulimoviridae, Geminiviridae, Reoviridae, Rhabdoviridae, Virgaviridae, Alphaflexiviridae, Potyviridae, Betaflexiviridae, Closteroviridae, Tymoviridae, Luteoviridae, Tombusviridae, Sobemoviruses, Neopviruses, Secoviridae and Bromoviridae families.

[0037] The promoter, whether from a plant or a plant virus, is preferably constitutively active. Exemplary constitutive promoters include the cauliflower mosaic virus (CaMV) 35S promoter (Odell et al, 1985, Nature 313:810-812); Arabidopsis At6669 promoter, maize Ubi 1 (Christensen et al, 1992, Plant Sol. Biol. 18:675-689); rice actin (McElroy et al, 1990, Plant Cell 2: 163-171); pEMU (Last et al, 1991, Theor. Appl. Genet. 81 :581-588); and Synthetic Super MAS (Ni et al, 1995, The Plant Journal 7: 661-76), the CaMV 19S promoter; Commelina yellow mottle virus ("CoYMV") promoter; Figwort Mosaic Virus (FMV) promoter (Richins et al, 1987, Nucleic Acids Res. 20:8451); cassava vein mosaic virus (CsVMV) promoter; Strawberry Vein Banding Virus transcript promoter (Wang et al. , 2000, Virus Genes 20:1 1-17; Genbank X97304); and Mirabilis Mosaic Caulimovirus full- length transcript promoter (U.S. Patent No. 6,420,547; Dey and Maiti, 1999, Transgenics 3:61-70). Other constitutive promoters include those in U.S. Pat. Nos. 5,659,026, 5,608,149; 5,608,144; 5,604,121 ; 5,569,597;5,466,785; 5,399,680; 5,268,463; 5,608,142; and 7,906,705.

[0038] In preferred embodiments, the constitutive promoter is a CaMV 35S promoter (see, e.g., Accession no. S51061, Cooke et al, 1990, Plant Mol. Biol. 14 (3), 391-405), including the enhanced CaMV 35S promoter (see, for example U.S. Patent No. 5,106,739)).

[0039] Plant promoters are disclosed in U.S. Application No. 13/665,462, hereby incorporated by reference in its entirety.

[0040] Other Viral Promoters: In some embodiments, various other viral promoters are useful in expression cassettes of the disclosure. Such viral promoters are known in the art and include, without limitation, the long terminal repeat promoter of the Moloney murine leukemia virus, the long terminal repeat promoter of the Rous sarcoma virus (RSV), and the adenoviral El A promoter. 1.1.2. 5' UTRs

[0041] Expression cassettes of the present disclosure further comprise, operably linked at the 3' end of the promoter, a sequence that corresponds to a non- fungal 5' untranslated region (5' UTR) in the mRNA resulting from transcription of the expression cassette that is operable in filamentous fungi (for convenience referred to as a "5' UTR" in the expression cassette). The 5' UTR can comprise a transcription start site and other features that increase transcription or translation, such as a ribosome binding site.

[0042] The 5' UTRs for use in the expression cassettes of the present disclosure can be derived from any non-fungal source, including from a plant gene, a plant virus gene, a mammalian gene, a mammalian virus gene, or a gene encoding the polypeptide of interest.

The 5' UTR can comprise a nucleotide sequence corresponding to all of a fragment of a 5'

UTR from a non- fungal gene. The 5' UTR can comprise a nucleotide sequence corresponding to all or a fragment of the 5' UTR of a gene encoding a first polypeptide coding sequence of the expression cassette. The 5' UTR of the expression cassette can be from the same or from a different species as the promoter. In some embodiments, the 5'

UTR is from a different species as the promoter. In some embodiments, the 5' UTR is not a plant 5' UTR. In some embodiments, the 5' UTR is not a mammalian 5' UTR.

[0043] The 5' UTR of the expression cassette can suitably include a nucleotide sequence corresponding to all or a fragment of a 5' UTR from a non- fungal gene. In some embodiments, the 5' UTR is derived from a non- fungal homolog of a highly expressed gene in filamentous fungi that is conserved in non-fungal eukaryotic cells. Examples of such genes in T. reesei include, but are not limited to, genes encoding Elongation Factor Tu;

Hsp70; WD40; Glyceraldehyde 3-phosphate dehydrogenase; Thioredoxin; ATP synthase;

Actin; Calreticulin; E1-E2 ATPase; Thiamine pyrophosphate enzyme; Elongation Factor 5 A;

Ubiquitin; Ribosomal Protein S3A; Thi4; Thi5; Histone; Hsp90; NAD(P) Transhydrogenase;

Glutamine Synthetase; Aconitase; Elongation Factor 1 ; Ribosomal Protein S13/S18; RRM1 ;

Ubiquitin; Thioredoxin; ATPase; and Acetohydroxy acid isomeroreductase.

[0044] The 5' UTR can range in length, from about 30 nucleotides to about 500 nucleotides.

In various aspects, the 5' UTR is about 30 nucleotides, about 40 nucleotides, about 50 nucleotides, about 60 nucleotides, about 70 nucleotides, about 80 nucleotides, about 90 nucleotides, about 100 nucleotides, about 125 nucleotides, about 150 nucleotides, about 200 nucleotides, about 250 nucleotides, about 300 nucleotides, about 350 nucleotides, about 400 nucleotides, about 450 nucleotides, or about 500 nucleotides in length, or any range between any pair of the foregoing values. In some embodiments, the 5' UTR is in the range of about 30 nucleotides to about 130 nucleotides, for example about 60-70 nucleotides, about 50-80 nucleotides, about 40-90 nucleotides, or about 30-100 nucleotides in length.

[0045] Typically, the 5' nucleotides utilized in the expression cassettes of the disclosure include those adjacent to, typically immediately upstream of, the start codon of the non- fungal genes from which the 5' UTRs are derived.

[0046] The 5' UTRs of the disclosure are typically selected to drive gene expression of a reporter gene such as β-glucosidase (e.g., the Cochliobolus heterstrophus β-glucosidase described in Example 2 below) at least 2-fold over background β-glucosidase in a fungal transformant, preferably at least 2-fold over background β-glucosidase. In specific embodiment, the 5' UTRs of the disclosure are typically selected to drive gene expression of a reporter gene by at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold or at least 10-fold over background reporter gene expression. Background reporter gene expression can be assessed in tranformed fungal cells that contain a corresponding expression cassette that lacks the 5' UTR sequence.

[0047] Species from which a non- fungal 5'UTR can be obtained include any member of kingdoms Animalia, Amoebae, Plantae, Chromalveolata, Rhizaria, or Excavata, including, but not limited to, members of the phyla Euglenozoa, Percolozoa, Loukozoa, Metamonada, Cercozoa, Heterokontophyta, Haptophyta, Cryptophyta, Alveolata, Apicomplexa, Chromerida, Ciliophora, Dinoflagellata, Retaria, Foraminifera, and Radiolaria. In specific embodiments, the non- fungal 5' UTR is obtained from the species Dictyostelium purpureum, Daphnia pulex, Ostreococcus RCC809, Aureococcus anophagefferens, or Arabidopsis lyrata.

[0048] In exemplary embodiments, the 5' UTR comprises a nucleotide sequence corresponding to a fragment of the 5' UTR of an Elongation Factor Tu gene of Dictyostelium purpureum, Daphnia pulex, Ostreococcus RCC809, Aureococcus anophagefferens, or Arabidopsis lyrata, for example, a 30-nucleotide, 40-nucleotide, 50-nucleotide, 60- nucleotide, a 75 -nucleotide, a 100-nucleotide, 150-nucleotide, or a 200-nucleotide fragment of an Elongation Factor Tu gene, or a fragment ranging or any range between any pair of the foregoing values in length (e.g., 30-100 nucleotides).

[0049] In exemplary embodiments, the 5' UTR comprises a nucleotide sequence corresponding to a fragment of the 5' UTR of an Hsp70 gene of Dictyostelium purpureum, Daphnia pulex, Ostreococcus RCC809, Aureococcus anophagefferens, or Arabidopsis lyrata, for example, a 30-nucleotide, 40-nucleotide, 50-nucleotide, 60-nucleotide, a 75 -nucleotide, a 100-nucleotide, 150-nucleotide, or a 200-nucleotide fragment of an Hsp70 gene, or a fragment ranging or any range between any pair of the foregoing values in length (e.g., 30- 100 nucleotides).

[0050] In exemplary embodiments, the 5' UTR comprises a nucleotide sequence corresponding to a fragment of the 5' UTR of an WD40 gene of Dictyostelium purpureum, Daphnia pulex, Ostreococcus RCC809, Aureococcus anophagefferens, or Arabidopsis lyrata, for example, a 30-nucleotide, 40-nucleotide, 50-nucleotide, 60-nucleotide, a 75-nucleotide, a 100-nucleotide, 150-nucleotide, or a 200-nucleotide fragment of a WD40 gene, or a fragment ranging or any range between any pair of the foregoing values in length {e.g., 30-100 nucleotides).

[0051] In exemplary embodiments, the 5' UTR comprises a nucleotide sequence corresponding to a fragment of the 5' UTR of an Glyceraldehyde 3 -phosphate dehydrogenase gene of Dictyostelium purpureum, Daphnia pulex, Ostreococcus RCC809, Aureococcus anophagefferens, or Arabidopsis lyrata, for example, a 30-nucleotide, 40-nucleotide, 50- nucleotide, 60-nucleotide, a 75-nucleotide, a 100-nucleotide, 150-nucleotide, or a 200- nucleotide fragment of a Glyceraldehyde 3-phosphate dehydrogenase gene, or a fragment ranging or any range between any pair of the foregoing values in length {e.g., 30-100 nucleotides).

[0052] In exemplary embodiments, the 5' UTR comprises a nucleotide sequence corresponding to a fragment of the 5' UTR of a Thioredoxin gene of Dictyostelium purpureum, Daphnia pulex, Ostreococcus RCC809, Aureococcus anophagefferens, or Arabidopsis lyrata, for example, a 30-nucleotide, 40-nucleotide, 50-nucleotide, 60- nucleotide, a 75-nucleotide, a 100-nucleotide, 150-nucleotide, or a 200-nucleotide fragment of a Thioredoxin gene, or a fragment ranging or any range between any pair of the foregoing values in length (e.g., 30-100 nucleotides).

[0053] In exemplary embodiments, the 5' UTR comprises a nucleotide sequence corresponding to a fragment of the 5' UTR of an ATP synthase gene of Dictyostelium purpureum, Daphnia pulex, Ostreococcus RCC809, Aureococcus anophagefferens, or Arabidopsis lyrata, for example, a 30-nucleotide, 40-nucleotide, 50-nucleotide, 60- nucleotide, a 75-nucleotide, a 100-nucleotide, 150-nucleotide, or a 200-nucleotide fragment of an ATP synthase gene, or a fragment ranging or any range between any pair of the foregoing values in length (e.g., 30-100 nucleotides).

[0054] In exemplary embodiments, the 5' UTR comprises a nucleotide sequence corresponding to a fragment of the 5' UTR of an Actin gene of Dictyostelium purpureum, Daphnia pulex, Ostreococcus RCC809, Aureococcus anophagefferens, or Arabidopsis lyrata, for example, for example, a 30-nucleotide, 40-nucleotide, 50-nucleotide, 60-nucleotide, a 75- nucleotide, a 100-nucleotide, 150-nucleotide, or a 200-nucleotide fragment of an Actin gene, or a fragment ranging or any range between any pair of the foregoing values in length {e.g., 30-100 nucleotides).

[0055] In exemplary embodiments, the 5' UTR comprises a nucleotide sequence corresponding to a fragment of the 5' UTR of a Calreticulin gene of Dictyostelium purpureum, Daphnia pulex, Ostreococcus RCC809, Aureococcus anophagefferens, or Arabidopsis lyrata, for example, a 30-nucleotide, 40-nucleotide, 50-nucleotide, 60- nucleotide, a 75 -nucleotide, a 100-nucleotide, 150-nucleotide, or a 200-nucleotide fragment of a Calreticulin gene, or a fragment ranging or any range between any pair of the foregoing values in length {e.g., 30-100 nucleotides).

[0056] In exemplary embodiments, the 5' UTR comprises a nucleotide sequence corresponding to a fragment of the 5' UTR of an E1-E2 ATPase gene of Dictyostelium purpureum, Daphnia pulex, Ostreococcus RCC809, Aureococcus anophagefferens, or Arabidopsis lyrata, ffor example, a 30-nucleotide, 40-nucleotide, 50-nucleotide, 60- nucleotide, a 75 -nucleotide, a 100-nucleotide, 150-nucleotide, or a 200-nucleotide fragment of an E1-E2 ATPase gene, or a fragment ranging or any range between any pair of the foregoing values in length {e.g., 30-100 nucleotides).

[0057] In exemplary embodiments, the 5' UTR comprises a nucleotide sequence corresponding to a fragment of the 5' UTR of an Thiamine pyrophosphate enzyme gene of Dictyostelium purpureum, Daphnia pulex, Ostreococcus RCC809, Aureococcus anophagefferens, or Arabidopsis lyrata, for example, a 30-nucleotide, 40-nucleotide, 50- nucleotide, 60-nucleotide, a 75-nucleotide, a 100-nucleotide, 150-nucleotide, or a 200- nucleotide fragment of a Thiamine pyrophosphate enzyme gene, or a fragment ranging or any range between any pair of the foregoing values in length {e.g., 30-100 nucleotides).

[0058] In exemplary embodiments, the 5' UTR comprises a nucleotide sequence corresponding to a fragment of the 5' UTR of an Elongation Factor 5 A gene of Dictyostelium purpureum, Daphnia pulex, Ostreococcus RCC809, Aureococcus anophagefferens, or Arabidopsis lyrata, a 30-nucleotide, 40-nucleotide, 50-nucleotide, 60-nucleotide, 75- nucleotide, a 100-nucleotide, 150-nucleotide, or a 200-nucleotide fragment of an Elongation Factor 5A gene, or a fragment ranging or any range between any pair of the foregoing values in length {e.g., 30-100 nucleotides). [0059] In exemplary embodiments, the 5' UTR comprises a nucleotide sequence corresponding to a fragment of the 5' UTR of a Ubiquitin gene of Dictyostelium purpureum, Daphnia pulex, Ostreococcus RCC809, Aureococcus anophagefferens, or Arabidopsis lyrata, for example, a 30-nucleotide, 40-nucleotide, 50-nucleotide, 60-nucleotide, a 75-nucleotide, a 100-nucleotide, 150-nucleotide, or a 200-nucleotide fragment of a Ubiquitin gene, or a fragment ranging or any range between any pair of the foregoing values in length {e.g., 30- 100 nucleotides).

[0060] In exemplary embodiments, the 5' UTR comprises a nucleotide sequence corresponding to a fragment of the 5' UTR of a Ribosomal Protein S3Ae gene of Dictyostelium purpureum, Daphnia pulex, Ostreococcus RCC809, Aureococcus anophagefferens, or Arabidopsis lyrata, for example, a 30-nucleotide, 40-nucleotide, 50- nucleotide, 60-nucleotide, a 75-nucleotide, a 100-nucleotide, 150-nucleotide, or a 200- nucleotide fragment of a Ribosomal Protein S3Ae gene, or a fragment ranging or any range between any pair of the foregoing values in length (e.g., 30-100 nucleotides).

[0061] In exemplary embodiments, the 5' UTR comprises a nucleotide sequence corresponding to a fragment of the 5' UTR of a Thi4 gene of Dictyostelium purpureum, Daphnia pulex, Ostreococcus RCC809, Aureococcus anophagefferens, or Arabidopsis lyrata, for example, a 30-nucleotide, 40-nucleotide, 50-nucleotide, 60-nucleotide, a 75-nucleotide, a 100-nucleotide, 150-nucleotide, or a 200-nucleotide fragment of a Thi4 gene, or a fragment ranging or any range between any pair of the foregoing values in length {e.g., 30-100 nucleotides).

[0062] In exemplary embodiments, the 5' UTR comprises a nucleotide sequence corresponding to a fragment of the 5' UTR of a Thi5 gene of Dictyostelium purpureum, Daphnia pulex, Ostreococcus RCC809, Aureococcus anophagefferens, or Arabidopsis lyrata, for example, a 30-nucleotide, 40-nucleotide, 50-nucleotide, 60-nucleotide, a 75-nucleotide, a 100-nucleotide, 150-nucleotide, or a 200-nucleotide fragment of a Thi5 gene, or a fragment ranging or any range between any pair of the foregoing values in length (e.g., 30-100 nucleotides).

[0063] In exemplary embodiments, the 5' UTR comprises a nucleotide sequence corresponding to a fragment of the 5' UTR of a histone gene of Dictyostelium purpureum, Daphnia pulex, Ostreococcus RCC809, Aureococcus anophagefferens, or Arabidopsis lyrata, ffor example, a 30-nucleotide, 40-nucleotide, 50-nucleotide, 60-nucleotide, a 75-nucleotide, a 100-nucleotide, 150-nucleotide, or a 200-nucleotide fragment of a histone gene, or a fragment ranging or any range between any pair of the foregoing values in length (e.g., 30-100 nucleotides).

[0064] In exemplary embodiments, the 5' UTR comprises a nucleotide sequence corresponding to a fragment of the 5' UTR of a Hsp90 gene of Dictyostelium purpureum, Daphnia pulex, Ostreococcus RCC809, Aureococcus anophagefferens, or Arabidopsis lyrata, for example, a 30-nucleotide, 40-nucleotide, 50-nucleotide, 60-nucleotide, a 75-nucleotide, a 100-nucleotide, 150-nucleotide, or a 200-nucleotide fragment of a Hsp90 gene, or a fragment ranging or any range between any pair of the foregoing values in length {e.g., 30-100 nucleotides).

[0065] In exemplary embodiments, the 5' UTR comprises a nucleotide sequence corresponding to a fragment of the 5' UTR of a NAD(P) Transhydrogenase gene of Dictyostelium purpureum, Daphnia pulex, Ostreococcus RCC809, Aureococcus anophagefferens, or Arabidopsis lyrata, for example, a 30-nucleotide, 40-nucleotide, 50- nucleotide, 60-nucleotide, a 75-nucleotide, a 100-nucleotide, 150-nucleotide, or a 200- nucleotide fragment of a NAD(P) Transhydrogenase gene, or a fragment ranging or any range between any pair of the foregoing values in length (e.g., 30-100 nucleotides).

[0066] In exemplary embodiments, the 5' UTR comprises a nucleotide sequence corresponding to a fragment of the 5' UTR of a Glutamine Synthetase gene of Dictyostelium purpureum, Daphnia pulex, Ostreococcus RCC809, Aureococcus anophagefferens, or Arabidopsis lyrata, for example, for example, a 30-nucleotide, 40-nucleotide, 50-nucleotide, 60-nucleotide, a 75-nucleotide, a 100-nucleotide, 150-nucleotide, or a 200-nucleotide fragment of a Glutamine Synthetase gene, or a fragment ranging or any range between any pair of the foregoing values in length (e.g., 30-100 nucleotides).

[0067] In exemplary embodiments, the 5' UTR comprises a nucleotide sequence corresponding to a fragment of the 5' UTR of an Aconitase gene of Dictyostelium purpureum, Daphnia pulex, Ostreococcus RCC809, Aureococcus anophagefferens, or Arabidopsis lyrata, for example, a 30-nucleotide, 40-nucleotide, 50-nucleotide, 60- nucleotide, a 75-nucleotide, a 100-nucleotide, 150-nucleotide, or a 200-nucleotide fragment of an Aconitase gene, or a fragment ranging or any range between any pair of the foregoing values in length (e.g., 30-100 nucleotides).

[0068] In exemplary embodiments, the 5' UTR comprises a nucleotide sequence corresponding to a fragment of the 5 ' UTR of an Elongation Factor 1 gene of Dictyostelium purpureum, Daphnia pulex, Ostreococcus RCC809, Aureococcus anophagefferens, or Arabidopsis lyrata, for example, a 30-nucleotide, 40-nucleotide, 50-nucleotide, 60- nucleotide, a 75 -nucleotide, a 100-nucleotide, 150-nucleotide, or a 200-nucleotide fragment of an Elongation Factor 1 gene, or a fragment ranging or any range between any pair of the foregoing values in length {e.g., 30-100 nucleotides).

[0069] In exemplary embodiments, the 5' UTR comprises a nucleotide sequence corresponding to a fragment of the 5' UTR of a Ribosomal Protein S13/S18 gene of Dictyostelium purpureum, Daphnia pulex, Ostreococcus RCC809, Aureococcus anophagefferens, or Arabidopsis lyrata, for example, a 30-nucleotide, 40-nucleotide, 50- nucleotide, 60-nucleotide, a 75-nucleotide, a 100-nucleotide, 150-nucleotide, or a 200- nucleotide fragment of a Ribosomal Protein S13/S18 gene, or a fragment ranging or any range between any pair of the foregoing values in length {e.g., 30-100 nucleotides).

[0070] In exemplary embodiments, the 5' UTR comprises a nucleotide sequence corresponding to a fragment of the 5' UTR of a RRM1 gene of Dictyostelium purpureum, Daphnia pulex, Ostreococcus RCC809, Aureococcus anophagefferens, or Arabidopsis lyrata, for example, a 30-nucleotide, 40-nucleotide, 50-nucleotide, 60-nucleotide, a 75-nucleotide, a 100-nucleotide, 150-nucleotide, or a 200-nucleotide fragment of a RRM1 gene, or a fragment ranging or any range between any pair of the foregoing values in length {e.g., 30-100 nucleotides).

[0071] In exemplary embodiments, the 5' UTR comprises a nucleotide sequence corresponding to a fragment of the 5' UTR of a Thioredoxin gene of Dictyostelium purpureum, Daphnia pulex, Ostreococcus RCC809, Aureococcus anophagefferens, or Arabidopsis lyrata, for example, a 30-nucleotide, 40-nucleotide, 50-nucleotide, 60- nucleotide, a 75-nucleotide, a 100-nucleotide, 150-nucleotide, or a 200-nucleotide fragment of a Thioredoxin gene, or a fragment ranging or any range between any pair of the foregoing values in length {e.g., 30-100 nucleotides).

[0072] In exemplary embodiments, the 5' UTR comprises a nucleotide sequence corresponding to a fragment of the 5' UTR of an Acetohydroxy acid isomeroreductase gene of Dictyostelium purpureum, Daphnia pulex, Ostreococcus RCC809, Aureococcus anophagefferens, or Arabidopsis lyrata, for example, a 30-nucleotide, 40-nucleotide, 50- nucleotide, 60-nucleotide, a 75-nucleotide, a 100-nucleotide, 150-nucleotide, or a 200- nucleotide fragment of an Acetohydroxy acid isomeroreductase gene, or a fragment ranging or any range between any pair of the foregoing values in length {e.g., 30-100 nucleotides). [0073] The 5' UTR sequence employed in the expression constructs of the disclosure need not be identical to the wild type non- fungal 5' UTR sequence, but may vary as long as 5'

UTR functionality is retained or improved. Typically, the 5' UTR comprises a nucleotide sequence having at least 70%, least 75%, at least 80%, at least 85%, at least 90%, at least

95%), at least 96%, at least 97%, at least 98% or at least 99% sequence identity to one or more of the foregoing fragments. In some embodiments, the 5' UTR of the expression cassette comprises a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%,

97%, 98%, or 99% sequence identity to any one of SEQ ID NOS: 4-67.

1.1.3. Polypeptide Coding Sequence

[0074] The expression cassettes described herein are intended to allow expression of any polypeptide of interest ("POI") in filamentous fungal cells. As such, the identity of the polypeptide coding sequence is not limited to any particular type of polypeptide or to polypeptides from any particular source. It can be eukaryotic or prokaryotic. The polypeptide coding sequence can be from a gene native to the recombinant filamentous fungal cell into which the expression cassette is intended to be introduced (e.g., from a filamentous fungus such as Trichoderma reesei or Aspergillus niger) or heterologous to the recombinant filamentous fungal cell into which the expression cassette is intended to be introduced (e.g., from a plant, animal, virus, or non-filamentous fungus).

[0075] The POI coding sequence can encode an enzyme such as a carbohydrase, such as a liquefying and saccharifying a-amylase, an alkaline a-amylase, a β-amylase, a cellulase; a dextranase, an a-glucosidase, an a-galactosidase, a glucoamylase, a hemicellulase, a pentosanase, a xylanase, an invertase, a lactase, a naringanase, a pectinase or a pullulanase; a protease such as an acid protease, an alkali protease, bromelain, ficin, a neutral protease, papain, pepsin, a peptidase, rennet, rennin, chymosin, subtilisin, thermolysin, an aspartic proteinase, or trypsin; a lipase or esterase, such as a triglyceridase, a phospholipase, acyl transferase, a pregastric esterase, a phosphatase, a phytase, an amidase, an iminoacylase, a glutaminase, a lysozyme, or a penicillin acylase; an isomerase such as glucose isomerase; an oxidoreductases, e.g., an amino acid oxidase, a catalase, a chloroperoxidase, a glucose oxidase, a hydroxysteroid dehydrogenase or a peroxidase; a lyase such as a acetolactate decarboxylase, an aspartic β-decarboxylase, a fumarese or a histadase; a transferase such as cyclodextrin glycosyltransferase; or a ligase, for example.

[0076] In particular embodiments, the enzyme is an aminopeptidase, a carboxypeptidase, a chitinase, a cutinase, a deoxyribonuclease, an a-galactosidase, a β-galactosidase, a β-glucosidase, a laccase, a mannosidase, a mutanase, a pectinolytic enzyme, a polyphenoloxidase, ribonuclease or transglutaminase.

[0077] In other particular embodiments, the enzyme is an a-amylase, a cellulase; an a- glucosidase, an a-galactosidase, a glucoamylase, a hemicellulase, a xylanase, a pectinase, a pullulanase; an acid protease, an alkali protease, an aspartic proteinase, a lipase, a cutinase or a phytase.

[0078] In certain aspects, the POI is a cellulase another protein useful in a cellulotyic reaction, for example a hemicellulase or an accessory polypeptide. Cellulases are known in the art as enzymes that hydrolyze cellulose (P-l,4-glucan or β D-glucosidic linkages) resulting in the formation of glucose, cellobiose, cellooligosaccharides, and the like. Cellulase enzymes have been traditionally divided into three major classes: endoglucanases ("EG"), exoglucanases or cellobiohydrolases (EC 3.2.1.91) ("CBH") and β-glucosidases (EC 3.2.1.21) ("BG") (Knowles et al, 1987, TIBTECH 5:255-261 ; Schulein, 1988, Methods in Enzymology 160(25):234-243). Accessory proteins

[0079] Endoglucanases : Endoglucanases break internal bonds and disrupt the crystalline structure of cellulose, exposing individual cellulose polysaccharide chains ("glucans"). Endoglucanases include polypeptides classified as Enzyme Commission no. ("EC") 3.2.1.4) or which are capable of catalyzing the endohydrolysis of l,4-P-D-glucosidic linkages in cellulose, lichenin or cereal β-D-glucans. Enzyme Commission numbering is a numerical classification scheme for enzymes.

[0080] Examples of suitable bacterial endoglucanases include, but are not limited to, Acidothermus cellulolyticus endoglucanase (WO 91/05039; WO 93/15186; U.S. Pat. No. 5,275,944; WO 96/02551 ; U.S. Pat. No. 5,536,655, WO 00/70031, WO 05/093050); Thermobifida fusca endoglucanase III (WO 05/093050); and Thermobifida fusca endoglucanase V (WO 05/093050).

[0081] Examples of suitable fungal endoglucanases include, but are not limited to, Trichoderma reesei endoglucanase I (Penttila et al, 1986, Gene 45: 253-263; GenBank accession no. Ml 5665); Trichoderma reesei endoglucanase II (Saloheimo et al, 1988, Gene 63: 11-22; GenBank accession no. M19373); Trichoderma reesei endoglucanase III (Okada et al, 1988, Appl. Environ. Microbiol. 64: 555-563; GenBank accession no. AB003694); Trichoderma reesei endoglucanase IV (Saloheimo et al, 1997, Eur. J. Biochem. 249: 584- 591 ; GenBank accession no. Yl 1113); and Trichoderma reesei endoglucanase V (Saloheimo et al, 1994, Molecular Microbiology 13: 219-228; GenBank accession no. Z33381); Aspergillus aculeatus endoglucanase (Ooi et al, 1990, Nucleic Acids Research 18: 5884); Aspergillus kawachii endoglucanase (Sakamoto et al, 1995, Current Genetics 27: 435-439); Chrysosporium sp. CI endoglucanase (U.S. Pat. No. 6,573,086; GenPept accession no. AAQ38150); Corynascus heterothallicus endoglucanase (U.S. Pat. No. 6,855,531 ; GenPept accession no. AAY00844); Erwinia carotovara endoglucanase (Saarilahti et al, 1990, Gene 90: 9-14); Fusarium oxysporum endoglucanase (GenBank accession no. L29381); Humicola grisea var. thermoidea endoglucanase (GenBank accession no. AB003107); Melanocarpus albomyces endoglucanase (GenBank accession no. MAL515703); Neurospora crassa endoglucanase (GenBank accession no. XM.sub.—324477); Piromyces equi endoglucanase (Eberhardt et al, 2000, Microbiology 146: 1999-2008; GenPept accession no. CAB92325); Rhizopus oryzae endoglucanase (Moriya et al, 2003, J. Bacteriology 185: 1749-1756; GenBank accession nos. AB047927, AB056667, and AB056668); and Thielavia terrestris endoglucanase (WO 2004/053039; EMBL accession no. CQ827970).

[0082] Cellobiohydrolases : Cellobiohydrolases incrementally shorten the glucan molecules, releasing mainly cellobiose units (a water-soluble -l,4-linked dimer of glucose) as well as glucose, cellotriose, and cellotetraose. Cellobiohydrolases include polypeptides classified as EC 3.2.1.91 or which are capable of catalyzing the hydrolysis of 1,4-β-ϋ- glucosidic linkages in cellulose or cellotetraose, releasing cellobiose from the ends of the chains. Exemplary cellobiohydrolases include Trichoderma reesei cellobiohydrolase I (CEL7A) (Shoemaker et al, 1983, Biotechnology (N.Y.) 1 : 691-696); Trichoderma reesei cellobiohydrolase II (CEL6A) (Teeri et al, 1987, Gene 51 : 43-52); Chrysosporium lucknowense CEL7 cellobiohydrolase (WO 2001/79507); Myceliophthora thermophila CEL7 (WO 2003/000941); and Thielavia terrestris cellobiohydrolase (WO 2006/074435).

[0083] β-Glucosidases: β-Glucosidases split cellobiose into glucose monomers, β- glucosidases include polypeptides classified as EC 3.2.1.21 or which are capable of catalyzing the hydrolysis of terminal, non-reducing β-D-glucose residues with release of β-D- glucose. Exemplary β-glucosidases can be obtained from Cochliobolus heterostrophus (SEQ ID NO:34), Aspergillus oryzae (WO 2002/095014), Aspergillus fumigatus (WO 2005/047499), Penicillium brasilianum {e.g., Penicillium brasilianum strain IBT 20888) (WO 2007/019442), Aspergillus niger (Dan et al, 2000, J. Biol. Chem. 275: 4973-4980), Aspergillus aculeatus (Kawaguchi et al, 1996, Gene 173: 287-288), Penicillium funiculosum (WO 2004/078919), S. pombe (Wood et al, 2002, Nature 415: 871-880), T. reesei (e.g., β- glucosidase 1 (U.S. Patent No. 6,022,725), β-glucosidase 3 (U.S. Patent No.6,982,159), β- glucosidase 4 (U.S. Patent No. 7,045,332), β-glucosidase 5 (US Patent No. 7,005,289), β- glucosidase 6 (U.S. Publication No. 20060258554), or β-glucosidase 7 (U.S. Publication No. 20060258554)).

[0084] Hemicellulases: A POI can be any class of hemicellulase, including an endoxylanase, a β-xylosidase, an a-L-arabionofuranosidase, an a-D-glucuronidase, an acetyl xylan esterase, a feruloyl esterase, a coumaroyl esterase, an a-galactosidase, a a- galactosidase, a β-mannanase or a β-mannosidase.

[0085] Endoxylanases suitable as POIs include any polypeptide classified EC 3.2.1.8 or which is capable of catalyzing the endohydrolysis of l,4^-D-xylosidic linkages in xylans. Endoxylanases also include polypeptides classified as EC 3.2.1.136 or which are capable of hydrolyzing 1,4 xylosidic linkages in glucuronoarabinoxylans.

[0086] β-xylosidases include any polypeptide classified as EC 3.2.1.37 or which is capable of catalyzing the hydrolysis of l,4^-D-xylans to remove successive D-xylose residues from the non-reducing termini, β-xylosidases may also hydrolyze xylobiose.

[0087] a -L-arabinofuranosidases include any polypeptide classified as EC 3.2.1.55 or which is capable of acting on a-L-arabinofuranosides, a-L-arabinans containing (1,2) and/or (1,3)- and/or (l,5)-linkages, arabinoxylans or arabinogalactans.

[0088] a-D-glucuronidases include any polypeptide classified as EC 3.2.1.139 or which is capable of catalyzing a reaction of the following form: a-D-glucuronoside+H(2)0=an alcohol+D-glucuronate. a-D-glucuronidases may also hydrolyse 4-O-methylated glucoronic acid, which can also be present as a substituent in xylans. α-D-glucuronidases also include polypeptides classified as EC 3.2.1.131 or which are capable of catalying the hydrolysis of a- 1 ,2-(4-0-methyl)glucuronosyl links.

[0089] Acetyl xylan esterases include any polypeptide classified as EC 3.1.1.72 or which is capable of catalyzing the deacetylation of xylans and xylo-oligosaccharides. Acetyl xylan esterases may catalyze the hydrolysis of acetyl groups from polymeric xylan, acetylated xylose, acetylated glucose, a-napthyl acetate or p-nitrophenyl acetate but, typically, not from triacetylglycerol. Acetyl xylan esterases typically do not act on acetylated mannan or pectin.

[0090] Feruloyl esterases include any polypeptide classified as EC 3.1.1.73 or which is capable of catalyzing a reaction of the form: feruloyl-saccharide+H₂0=ferulate+saccharide. The saccharide may be, for example, an oligosaccharide or a polysaccharide. A feruloyl esterase may catalyze the hydrolysis of the 4-hydroxy-3-methoxycinnamoyl (feruloyl) group from an esterified sugar, which is usually arabinose in natural substrates, while p-nitrophenol acetate and methyl ferulate are typically poorer substrates. Feruloyl esterase are sometimes considered hemicellulase accessory enzymes, since they may help xylanases and pectinases to break down plant cell wall hemicellulose and pectin.

[0091] Coumaroyl esterases include any polypeptide classified as EC 3.1.1.73 or which is capable of catalyzing a reaction of the form: coumaroyl- saccharide+H(2)0=coumarate+saccharide. The saccharide may be, for example, an oligosaccharide or a polysaccharide. Because some coumaroyl esterases are classified as EC 3.1.1.73 they may also be referred to as feruloyl esterases.

[0092] a-galactosidases include any polypeptide classified as EC 3.2.1.22 or which is capable of catalyzing the hydrolysis of terminal, non-reducing a-D-galactose residues in a-D- galactosides, including galactose oligosaccharides, galactomannans, galactans and arabinogalactans. a-galactosidases may also be capable of hydrolyzing a-D-fucosides.

[0093] β-galactosidases include any polypeptide classified as EC 3.2.1.23 or which is capable of catalyzing the hydrolysis of terminal non-reducing β-D-galactose residues in β-D- galactosides. β-galactosidases may also be capable of hydrolyzing a-L-arabinosides.

[0094] β-mannanases include any polypeptide classified as EC 3.2.1.78 or which is capable of catalyzing the random hydrolysis of l,4^-D-mannosidic linkages in mannans, galactomannans and glucomannans.

[0095] β-mannosidases include any polypeptide classified as EC 3.2.1.25 or which is capable of catalyzing the hydrolysis of terminal, non-reducing β-D-mannose residues in β-D- manno sides.

[0096] Suitable hemicellulases include T. reesei a-arabinofuranosidase I (ABF1 ), a- arabinofuranosidase II (ABF2), a-arabinofuranosidase III (ABF3), a-galactosidase I (AGL1), a-galactosidase II (AGL2), a-galactosidase III (AGL3), acetyl xylan esterase I (AXE1 ), acetyl xylan esterase III (AXE3), endoglucanase VI (EG6), endoglucanase VIII (EG8), a- glucuronidase I (GLRl ), β-mannanase (MANl ), polygalacturonase (PEC2), xylanase I (XYN1 ), xylanase II (XYN2), xylanase III (XYN3), and β-xylosidase (BXL1).

[0097] Accessory Polypeptides: Accessory polypeptides are present in cellulase preparations that aid in the enzymatic digestion of cellulose (see, e.g., WO 2009/026722 and Harris et al, 2010, Biochemistry, 49:3305-3316). In some embodiments, the accessory polypeptide is an expansin or swollenin-like protein. Expansins are implicated in loosening of the cell wall structure during plant cell growth (see, e.g., Salheimo et al., 2002, Eur. J. Biochem., 269:4202-4211). Expansins have been proposed to disrupt hydrogen bonding between cellulose and other cell wall polysaccharides without having hydrolytic activity. In this way, they are thought to allow the sliding of cellulose fibers and enlargement of the cell wall. Swollenin, an expansin-like protein, contains an N-terminal Carbohydrate Binding Module Family 1 domain (CBD) and a C-terminal expansin-like domain. In some embodiments, an expansin-like protein and/or swollenin-like protein comprises one or both of such domains and/or disrupts the structure of cell walls (e.g., disrupting cellulose structure), optionally without producing detectable amounts of reducing sugars. Other types of accessory proteins include cellulose integrating proteins, scaffoldins and/or a scaffoldin-like proteins (e.g., CipA or CipC from Clostridium thermocellum or Clostridium cellulolyticum respectively). Other exemplary accessory proteins are cellulose induced proteins and/or modulating proteins (e.g., as encoded by cipl or cip2 gene and/or similar genes from Trichoderma reesei; see e.g., Foreman et al, 2003, J. Biol. Chem., 278:31988-31997.

[0098] The POI coding sequence of an expression cassette of the disclosure can also encode a therapeutic polypeptide (i.e., a polypeptide having a therapeutic biological activity). Examples of suitable therapeutic polypeptides include: erythropoietin, cytokines such as interferon-a, interferon-β, interferon-γ, interferon-o, and granulocyte-CSF, GM-CSF, coagulation factors such as factor VIII, factor IX, and human protein C, antithrombin III, thrombin, soluble IgE receptor a-chain, IgG, IgG fragments, IgG fusions, IgM, IgA, interleukins, urokinase, chymase, and urea trypsin inhibitor, IGF-binding protein, epidermal growth factor, growth hormone-releasing factor, annexin V fusion protein, angiostatin, vascular endothelial growth factor-2, myeloid progenitor inhibitory factor- 1, osteoprotegerin, a- 1 -antitrypsin, a-feto proteins, DNase II, kringle 3 of human plasminogen, glucocerebrosidase, TNF binding protein 1, follicle stimulating hormone, cytotoxic T lymphocyte associated antigen 4-Ig, transmembrane activator and calcium modulator and cyclophilin ligand, soluble TNF receptor Fc fusion, glucagon like protein 1 and IL-2 receptor agonist. Antibodies, e.g., monoclonal antibodies (including but not limited to chimeric and humanized antibodies), are of particular interest.

[0099] In a further embodiment, the POI coding sequence can encode a reporter polypeptide. Such reporter polypeptides may be optically detectable or colorigenic, for example. In this embodiment, the polypeptide may be a β-galactosidase (lacZ), β-glucuronidase (GUS), luciferase, alkaline phosphatase, nopaline synthase (NOS), chloramphenicol acetyltransferase (CAT), horseradish peroxidase (HRP) or a fluorescent protein green, e.g., green fluorescent protein (GFP), or a derivative thereof. [0100] Where the POI coding sequence is from a eukaryotic gene, the polypeptide coding sequence can, but need not, include introns which can be spliced out during post- transcriptional processing of the transcript in the cell.

[0101] For some applications, it may be desirable for the polypeptide produced to be secreted by the filamentous fungal cell. For such application, the POI coding sequence can include, or be engineered to include, a signal sequence encoding a leader peptide that directs the POI to the filamentous fungal cell's secretory pathway. The signal sequence, when present, is in an appropriate translation reading frame with the mature POI coding sequence. Accordingly, the POI coding sequence can further encode a signal sequence operably linked to the N-terminus of the POI, where the signal sequence contains a sequence of amino acids that directs the POI to the secretory system of the recombinant filamentous fungal cell, resulting in secretion of the mature POI from the recombinant filamentous fungal cell into the medium in which the recombinant filamentous fungal cell is growing. The signal sequence is cleaved from the fusion protein prior to secretion of the mature POI. The signal sequence employed can be endogenous or non-endogenous to the POI and/or the recombinant filamentous fungal cell. Preferably, the signal sequence is a signal sequence that facilitates protein secretion from a filamentous fungal (e.g., Trichoderma or Aspergillus) cell and can be the signal sequence of a protein that is known to be highly secreted from filamentous fungi. Such signal sequences include, but are not limited to: the signal sequence of cellobiohydrolase I, cellobiohydrolase II, endoglucanase I, endoglucanase II, endoglucanase III, a-amylase, aspartyl proteases, glucoamylase, mannanase, glycosidase and barley endopeptidase B (see Saarelainen, 1997, Appl. Environ. Microbiol. 63:4938-4940), for example. Specific examples include the signal sequence from Aspergillus oryzae TAKA a-amylase, Aspergillus niger neutral a-amylase, Aspergillus niger glucoamylase, Rhizomucor miehei aspartic proteinase, Humicola insolens cellulase, and Humicola lanuginosa lipase. Other examples of signal sequences are those originating from the a- factor gene of a yeast (e.g., Saccharomyces, Kluyveromyces and Hansenula) or a Bacillus a-amylase. In certain embodiments, therefore, the POI coding sequence includes a sequence encoding a signal sequence, yielding a POI in the form of a polypeptide comprising an N-terminal signal sequence for secretion of the protein from the recombinant filamentous fungal cell.

[0102] In certain embodiments, the POI coding sequence can encode a fusion protein. In addition to POIs comprising signal sequences as described above, the fusion protein can further contain a "carrier protein," which is a portion of a protein that is endogenous to and highly secreted by the filamentous fungal cell. Suitable carrier proteins include those of Trichoderma reesei mannanase I (Man5A, or MANI), Trichoderma reesei cellobiohydrolase II (Cel6A, or CBHII) (see, e.g., Paloheimo et al, 2003, Appl. Environ. Microbiol. 69(12): 7073-7082) or Trichoderma reesei cellobiohydrolase I (CBHI). In one embodiment, the carrier protein is a truncated Trichoderma reesei CBHI protein that includes the CBHI core region and part of the CBHI linker region. An expression cassette of the disclosure can therefore include a coding sequence for a fusion protein containing, from the N-terminus to C-terminus, a signal sequence, a carrier protein and a POI in operable linkage.

[0103] In certain embodiments, the POI coding sequence can be codon optimized for expression of the protein in a particular filamentous fungal cell. Since codon usage tables listing the usage of each codon in many cells are known in the art (see, e.g., Nakamura et al., 2000, Nucl. Acids Res. 28:292) or readily derivable, such coding sequence can be readily designed.

[0104] The expression cassettes described herein comprise at least a first polypeptide coding sequence encoding a first polypeptide, but may optionally comprise second, third, fourth, etc. polypeptide coding sequences encoding second, third, fourth, etc. polypeptides.

1.1.4. 3' Untranslated Region (V UTR)

[0105] Expression cassettes of the present disclosure further comprise, operably linked at the

3 ' end of the first, and any optional additional, polypeptide coding sequence, a sequence that corresponds to a 3 ' untranslated region (3 ' UTR) in the mRNA resulting from transcription of the expression cassette (for convenience referred to as a "3' UTR" in the expression cassette).

The 3 ' UTR of the expression cassette comprises at least a polyadenylation signal, directing cleavage and polyadenylation of the transcript. The 3' UTR can optionally comprise other features important for nuclear export, translation, and/or stability of the mRNA, such as for example, a termination signal.

[0106] The 3' UTR can range in length from about 50 nucleotides to about 2000 or nucleotides or longer. In some embodiments, the 5' UTR is about 50 nucleotides, about 100 nucleotides, about 150 nucleotides, about 200 nucleotides, about 250 nucleotides, about 300 nucleotides, about 350 nucleotides, about 400 nucleotides, about 450 nucleotides, about 500 nucleotides, about 600 nucleotides, about 700 nucleotides, about 800 nucleotides, about 900 nucleotides, about 1000 nucleotides, or about 2000 nucleotides in length or more.

[0107] Suitable 3' UTRs for use in the expression cassettes of the present disclosure can be derived from any number of sources, including from a plant gene, a plant virus gene, a yeast gene, a filamentous fungal, gene, or a gene encoding the polypeptide of interest. The 3 ' UTR can comprise a nucleotide sequence corresponding to all or a fragment of a 3 'UTR from a plant gene, a plant viral gene, a yeast gene or a filamentous fungal gene. The 3 ' UTR can comprise a nucleotide sequence corresponding to all or a fragment of the 3' UTR of a gene encoding a first, second, or further polypeptide coding sequence of the expression cassette. The 3' UTR can be from the same or a different species as one other component in the expression cassette (e.g., the promoter or the polypeptide coding sequence). The 3' UTR can be from the same species as the filamentous fungal cell in which the expression construct is intended to operate.

[0108] The 3' UTR of an expression cassette of the disclosure may also suitably be derived from a plant gene or a plant viral gene, for example a gene native to a virus belonging to one of the Caulimoviridae, Geminiviridae, Reoviridae, Rhabdoviridae, Virgaviridae, Alphaflexiviridae, Potyviridae, Betaflexiviridae, Closteroviridae, Tymoviridae, Luteoviridae, Tombusviridae, Sobemoviruses, Neopviruses, Secoviridae and Bromoviridae families. In some embodiments, the 3' UTR comprises a nucleotide sequence corresponding to all or a fragment of a 3' UTR from a Caulimoviridae virus. In specific embodiments, the 3' UTR comprises a nucleotide sequence corresponding to all or a fragment of a CaMV 35S transcript 3 'UTR.

[0109] The 3' UTR of an expression cassette of the disclosure may also suitably be derived from a mammalian gene or a mammalian viral gene, for example a gene native to a virus belonging to one of the viruses belong to one of the Retroviridae, Picornaviridae, Calciviridae, Togaviridae, Flaviridae, Coronaviridae, Rhabdoviridae, Filoviridae, Paramyxoviridae, Or thorny xoviridae, Bungaviridae, Arenaviridae, Reoviridae, Birnaviridae, Hepadnaviridae, Parvoviridae, Papovaviridae, Adenoviridae, Herpesviridae, Polyomaviridae, Poxviridae and Iridoviridae families.

[0110] The 3' UTR of an expression cassette of the disclosure may also suitably be derived from a filamentous fungal gene. Where the 3' UTR is derived from a filamentous fungal gene, it may be from a gene native to the filamentous fungal species in which the expression construct is intended to operate. Exemplary filamental fungal species the 3 ' UTR comprises a nucleotide sequence corresponding to all or a fragment of a gene native to a Aspergillus, Trichoderma, Chrysosporium, Cephalosporium, Neurospora, Podospora, Endothia, Cochiobolus, Pyricularia, Rhizomucor, Hansenula, Humicola, Mucor, Tolypocladium, Fusarium, Penicillium, Talaromyces, Emericella, Hypocrea, Acremonium, Aureobasidium, Beauveria, Cephalosporium, Ceriporiopsis, Chaetomium, Paecilomyces, Claviceps, Cryptococcus, Cyathus, Gilocladium, Magnaporthe, Myceliophthora, Myrothecium, Phanerochaete, Paecilomyces, Rhizopus, Schizophylum, Stagonospora, Thermomyces, Thermoascus, Thielavia, Trichophyton, Trametes, and Pleurotus species.

[0111] Species of filamentous fungi from which the 3' UTR can be derived include Aspergillus awamori, Aspergillus fumigatus, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Chrysosporium lucknowense, Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, Fusarium venenatum, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Neurospora intermedia, Penicillium purpurogenum, Penicillium canescens, Penicillium solitum, Penicillium funiculosum, Phanerochaete chrysosporium, Phlebia radiate, Pleurotus eryngii, Thielavia terrestris, Trichoderma harzianum, Trichoderma longibrachiatum, Trichoderma reesei, and Trichoderma viride.

[0112] In a specific embodiment, the 3' UTR comprises a nucleotide sequence corresponding to all or a fragment of the 3' UTR from a gene native to Trichoderma reesei, such as the Trichoderma reesei CBHI, cbh2, egll, egl2, egl5, xlnl and xln2 genes. In an exemplary embodiment, the 3 ' UTR comprises a nucleotide sequence corresponding to a fragment of the 3' UTR of the glyceraldehyde-3 -phosphate dehydrogenase (gpd) gene of Trichoderma reesei. In another exemplary embodiment, the 3 ' UTR comprises the nucleotide sequence of all or a fragment of the 3' UTR of a gene encoding CBHI.

[0113] In other exemplary embodiments, the 3' UTR comprises a nucleotide sequence corresponding to all or a fragment of the 3 'UTR from an Aspergillus niger or Aspergillus awamori glucoamylase gene (Nunberg et al, 1984, Mol. Cell. Biol. 4:2306-2315 and Boel et al., 1984, EMBO Journal, 3: 1097-1102), an Aspergillus nidulans anthranilate synthase gene, an Aspergillus oryzae TAKA amylase gene, or the Aspergillus nidulans trpc gene (Punt et al. , 1987, Gene 56:117-124).

[0114] In yet other exemplary embodiments, the 3' UTR comprises the nucleotide sequence corresponding to all or a fragment of a 3 ' UTR from a Cochliobolus species, e.g., Cochliobolus heterostrophus. In a specific embodiment, the 3' UTR comprises the nucleotide sequence of all or a fragment of the 3' UTR of a Cochliobolus heterostrophus gene encoding β-glucosidase.

[0115] In a specific embodiment, the 3' UTR comprises the nucleotide sequence of SEQ ID

NO:5. Suitable 3' UTRs can comprise a nucleotide sequence having at least 70%, 75%, 80%,

85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO:5.

1.2. Methods Of Making Expression Cassettes

[0116] Techniques for the manipulation of nucleic acids, including techniques for the synthesis, isolation, cloning, detection, and identification are well known in the art and are well described in the scientific and patent literature. See, e.g., Sambrook et al, eds.,

Molecular Cloning: A Laboratory Manual (2nd Ed.), Vols. 1-3, Cold Spring Harbor

Laboratory (1989); Ausubel et al, eds., Current Protocols in Molecular Biology, John Wiley

& Sons, Inc., New York (1997); Tijssen, ed., Laboratory Techniques in Biochemistry and

Molecular Biology: Hybridization With Nucleic Acid Probes, Part I. Theory and Nucleic

Acid Preparation, Elsevier, N.Y. (1993). Nucleic acids comprising the expression cassettes described herein or components thereof include isolated, synthetic, and recombinant nucleic acids.

[0117] Expression cassettes and components thereof can readily be made and manipulated from a variety of sources, either by cloning from genomic or complementary DNA, e.g., by using the well-known polymerase chain reaction (PCR). See, for example, Innis et al, 1990,

PCR Protocols: A Guide to Methods and Application, Academic Press, New York.

Expression cassettes and components thereof can also be made by chemical synthesis, as described in, e.g., Adams, 1983, J. Am. Chem. Soc. 105:661 ; Belousov, 1997, Nucleic Acids

Res. 25:3440-3444; Frenkel, 1995, Free Radic. Biol. Med. 19:373-380; Blommers, 1994,

Biochemistry 33:7886-7896; Narang, 1979, Meth. Enzymol. 68:90; Brown,1979, Meth.

Enzymol. 68: 109; Beaucage, 1981, Tetra. Lett. 22:1859; U.S. Patent No. 4,458,066.

[0118] The promoter, 5' UTR and 3' UTR of an expression cassette of the disclosure be operably linked in a vector. The vector can also include the POI coding sequence, or one or more convenient restriction sites between the 5' UTR and 3' UTR sequences to allow for insertion or substitution of the POI coding sequence. The procedures used to ligate the components described herein to construct the recombinant expression vectors are well known to one skilled in the art (see, e.g., Sambrook et al, eds., Molecular Cloning: A Laboratory

Manual (2nd Ed.), Vols. 1-3, Cold Spring Harbor Laboratory (1989)). As will be described further below, vectors comprising expression cassettes described herein typically contain features making them suitable for introduction into filamentous fungal cells. 1.3. Recombinant Filamentous Fungal Cells

[0119] The expression cassettes described herein are usefully expressed in filamentous fungal cells suited to the production of one or more polypeptides of interest. Accordingly, the present disclosure provides recombinant filamentous fungal cells comprising expression cassettes of the disclosure and methods of introducing expression cassettes into filamentous fungal cells.

[0120] Suitable filamentous fungal cells include all filamentous forms of the subdivision Eumycotina (see, Alexopoulos, C. J. (1962), INTRODUCTORY MYCOLOGY, Wiley, New York). These fungi are characterized by a vegetative mycelium with a cell wall composed of chitin, cellulose, and other complex polysaccharides. The filamentous fungal cell can be from a fungus belonging to any species of Aspergillus, Trichoderma, Chrysosporium, Cephalosporium, Neurospora, Podospora, Endothia, Cochiobolus, Pyricularia, Rhizomucor, Hansenula, Humicola, Mucor, Tolypocladium, Fusarium, Penicillium, Talaromyces, Emericella, Hypocrea, Acremonium, Aureobasidium, Beauveria, Cephalosporium, Ceriporiopsis, Chaetomium, Paecilomyces, Claviceps, Cryptococcus, Cyathus, Gilocladium, Magnaporthe, Myceliophthora, Myrothecium, Phanerochaete, Paecilomyces, Rhizopus, Schizophylum, Stagonospora, Thermomyces, Thermoascus, Thielavia, Trichophyton, Trametes, and Pleurotus. More preferably, the recombinant cell is a Trichoderma sp. {e.g., Trichoderma reesei), Penicillium sp., Humicola sp. (e.g., Humicola insolens); Aspergillus sp. (e.g., Aspergillus niger), Chrysosporium sp., Fusarium sp., or Hypocrea sp. Suitable cells can also include cells of various anamorph and teleomorph forms of these filamentous fungal genera.

[0121] Exemplary filamentous fungal species include but are not limited to Aspergillus awamori, Aspergillus fumigatus, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Chrysosporium lucknowense, Fusarium bactridioides, Fusarium cerealis, Fusarium croohvellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, Fusarium venenatum, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Neurospora intermedia, Penicillium purpurogenum, Penicillium canescens, Penicillium solitum, Penicillium funiculosum, Phanerochaete chrysosporium, Phlebia radiate, Pleurotus eryngii, Thielavia terrestris, Trichoderma harzianum, Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride.

[0122] Recombinant filamentous fungal cells comprise an expression cassette as described above in Section 1.1. The expression cassette can be extra-genomic or integrated into the host's genome. FIG. 2 A provides a schematic of a recombinant filamentous fungal cell containing an extra-genomic expression cassette. As depicted, the recombinant filamentous fungal cell (5) carrying a vector comprising an expression cassette (6), the expression cassette comprising a promoter (1), a 5' UTR (2), a polypeptide coding sequence (3), and a 3' UTR (4). The expression cassette is not integrated into the chromosome (7) of the recombinant filamentous fungal cell (5). FIG. 2B provides a schematic of a recombinant filamentous fungal cell containing a genomic expression cassette. As depicted the recombinant filamentous fungal cell (5') comprises an expression cassette (6'), which is integrated into the chromosome (7') of the recombinant filamentous fungal cell (5').

[0123] The recombinant filamentous fungal cell of FIG. 2B can be generated by introducing and integrating a complete expression cassette into the host chromosome. Alternatively, the recombinant filamentous fungal cell of FIG. 2B may be generated by introducing subset of the components of the expression cassette into the chromosome in such a way and in a location so as to recapitulate a complete expression cassette within the host chromosome. For example, as depicted in FIG. 2C, a vector (8) comprising a promoter (1), a 5' UTR (2), a sequence of a polypeptide coding region homologous to that of a native fungal cell gene (4'), and a sequence homologous to from a region upstream of the native fungal cell gene (9), can be integrated by homologous recombination at a location upstream (on the 5' end) of the native gene comprising a 3' UTR in the chromosome (7') of a filamentous fungal cell to generate a complete expression cassette as depicted in FIG. 2B. In another example, a suitable promoter may be integrated upstream of the 5' UTR of a native gene in the chromosome. Other combinations are also possible, provided that a genomic expression cassette comprising all four components in the results.

[0124] Suitable methods for introducing expression cassettes, as well as methods for integrating expression cassettes into the filamentous fungal cell genome are described in further detail below.

1.4. Vectors

[0125] The filamentous fungal cells of the present disclosure are engineered to comprise an expression cassette, resulting in recombinant or engineered filamentous fungal cells.

Expression cassettes, or components thereof, can be introduced into filamentous fungal cells by way of suitable vectors. The choice of the vector will typically depend on the compatibility of the vector with the into which the vector is to be introduced (e.g., a filamentous fungal cell or a host cell, such as a bacterial cell, useful for propagating or amplifying the vector), whether autonomous replication of the vector inside the filamentous fungal cell and/or integration of the vector into the filamentous fungal cell genome is desired. The vector can be a viral vector, a phage, a phagemid, a cosmid, a fosmid, a bacteriophage, an artificial chromosome, a cloning vector, an expression vector, a shuttle vector, a plasmid (linear or closed circular), or the like. Vectors can include chromosomal, non-chromosomal and synthetic DNA sequences. Large numbers of suitable vectors are known to those of skill in the art, and are commercially available. Low copy number or high copy number vectors may be employed. Examples of suitable expression and integration vectors are provided in Sambrook et αί, eds., Molecular Cloning: A Laboratory Manual (2nd Ed.), Vols. 1-3, Cold Spring Harbor Laboratory (1989), and Ausubel et αί, eds., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York (1997), and van den Hondel et cil. (1991) in Bennett and Lasure (Eds.) MORE GENE MANIPULATIONS IN FUNGI, Academic Press pp. 396-428 and U.S. Patent No. 5,874,276. Reference is also made to the Filamentous Fungal Genetics Stock Center Catalogue of Strains (FGSC, <www.fgsc.net>) for a list of vectors. Particularly useful vectors include vectors obtained from commercial sources, such as Invitrogen and Promega. Specific vectors suitable for use in filamentous fungal cells include vectors such as pFB6, pBR322, pUC18, pUClOO, pDON™201, pDONR™221, pENTR™, pGEM®3Z and pGEM®4Z.

[0126] For some applications, it may be desirable for the expression cassette, or components thereof, to be maintained as extra-genomic elements. For such applications, suitable vectors comprising an expression cassette or components are preferably capable of autonomously replicating in a cell, independent of chromosomal replication. Accordingly, in some embodiments, the vector comprises an origin of replication enabling it to replicate autonomously in a cell, such as in a filamentous fungal cell.

[0127] For many applications, it is desirable to have a tool for selecting recombinant cells containing the vector. Thus, in some embodiments, the vector comprises a selectable marker. A selectable marker is a gene the product of which provides a selectable trait, e.g., antibiotic, biocide or viral resistance, resistance to heavy metals, or prototrophy in auxotrophs. Selectable markers useful in vectors for transformation of various filamentous fungal strains are known in the art. See, e.g., Finkelstein, chapter 6 in BIOTECHNOLOGY OF FILAMENTOUS FUNGI, Finkelstein et al. Eds. Butterworth-Heinemann, Boston, Mass.

(1992), Chap. 6.; and Kinghorn et al. (1992) APPLIED MOLECULAR GENETICS OF

FILAMENTOUS FUNGI, Blackie Academic and Professional, Chapman and Hall, London).

Examples of selectable markers which confer antimicrobial resistance include hygromycin and phleomycin. Further exemplary selectable markers include, but are not limited to, amdS

(acetamidase), argB (ornithine carbamoyltransferase), bar (phosphinothricin acetyltransferase), hph (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG

(orotidine-5'-phosphate decarboxylase), sC (sulfate adenyltransferase), pyr4 (orotidine-5'- monophosphate decarboxylase) and trpC (anthranilate synthase). As a specific example, the amdS gene, allows transformed cells to grow on acetamide as a nitrogen source. See, e.g.,

Kelley et al, 1985, EMBO J. 4:475-479 and Penttila et al, 1987, Gene 61 : 155-164. Other specific examples of selectable markers include amdS and pyrG genes of Aspergillus nidulans or Aspergillus oryzae and the bar gene of Streptomyces hygroscopicus.

1.5. Methods of Making Recombinant Filamentous Fungal Cells

[0128] Recombinant fungal cells as provided herein, are generated by introducing one or more components of an expression cassette into a suitable filamentous fungal cell. Numerous techniques for introducing nucleic acids into cells, including filamentous fungal cells are known. Nucleic acids may be introduced into the cells using any of a variety of techniques, including transformation, transfection, transduction, viral infection, gene guns, or Ti- mediated gene transfer. Particular methods include calcium phosphate transfection, DEAE-

Dextran mediated transfection, lipofection, or electroporation (Davis, L., Dibner, M., Battey,

I., Basic Methods in Molecular Biology, (1986)). General transformation techniques are known in the art {See, e.g., Ausubel et al, eds., Current Protocols in Molecular Biology, John

Wiley & Sons, Inc., New York (1997); and Sambrook et al, eds., Molecular Cloning: A

Laboratory Manual (2nd Ed.), Vols. 1-3, Cold Spring Harbor Laboratory (1989), and

Campbell et al, 1989, Curr. Genet. 16:53-56).

[0129] Suitable procedures for transformation of various filamentous fungal strains have been described. See e.g., EP 238 023 and Yelton et al, 1984, Proceedings of the National

Academy of Sciences USA 81 : 1470-1474 for descriptions of transformation in Aspergillus host strains. Reference is also made to Cao et al, 2000, Sci. 9:991-1001 and EP 238 023 for transformation of Aspergillus strains and WO96/00787 for transformation of Fusarium strains. See also, U.S. Patent No. 6,022,725; U.S. Patent No. 6,268,328; Harkki et al, 1991,

Enzyme Microb. Technol. 13:227-233; Harkki et al, 1989, Bio Technol. 7:596-603; EP

244,234; EP 215,594; and Nevalainen et al, "The Molecular Biology of Trichoderma and its Application to the Expression of Both Homologous and Heterologous Genes", in MOLECULAR INDUSTRIAL MYCOLOGY, Eds. Leong and Berka, Marcel Dekker Inc., NY (1992) pp. 129-148), for transformation of, and heterologous polypeptide expression, in Trichoderma.

[0130] In many instances, the introduction of an expression vector into a filamentous fungal cell can involve a process consisting of protoplast formation, transformation of the protoplasts, and regeneration of the strain wall according to methods known in the art. See, e.g., U.S. Patent No. 7,723,079, Campbell et al, 1989, Curr. Genet. 16:53-56, and Examples below.

[0131] In some instances, it is desirable to generate a recombinant filamentous fungal cell in which the expression cassette is integrated in the filamentous fungal genome, as described above. Numerous methods of integrating DNA into filamentous fungal chromosomes are known in the art. Integration of a vector, or portion thereof, into the chromosome of a filamentous fungal cell can be carried out by homologous recombination, non-homologous recombination, or transposition. For applications where site-specific integration is desirable, such as when an expression cassette is generated in the fungal cell genome by operably linking components of an expression cassette to a native gene within the fungal cell's chromosome, vectors typically include targeting sequences that are highly homologous to the sequence flanking the desired site of integration for example as described in Section 1.3.

Vectors can include homologous sequence ranging in length from 100 to 1,500 nucleotides, preferably 400 to 1,500 nucleotides, and most preferably 800 to 1,500 nucleotides.

1.6. Use of Recombinant Filamentous Fungal Cells

[0132] The recombinant filamentous fungal cells described herein are useful for producing polypeptides of interest. Accordingly, the present disclosure provides methods for producing a polypeptide of interest, comprising culturing a recombinant filamentous fungal cell under conditions that result in expression of the polypeptide of interest. Optionally, the method further comprises additional steps, which can include recovering the polypeptide and purifying the polypeptide.

[0133] Suitable filamentous fungal cell culture conditions and culture media are well known in the art. Culture conditions, such as temperature, pH and the like, will be apparent to those skilled in the art. The cultivation takes place in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art. Suitable media are available from commercial suppliers or may be prepared according to published compositions {e.g., in catalogues of the American Type Culture Collection). Cell culture media in general are set forth in Atlas and Parks (eds.), 1993, The Handbook of Microbiological Media, CRC Press, Boca Raton, FL, which is incorporated herein by reference. For recombinant expression in filamentous fungal cells, the cells are cultured in a standard medium containing physiological salts and nutrients, such as described in Pourquie et al, 1988, Biochemistry and Genetics of Cellulose Degradation, Aubert et al, eds. Academic Press, pp. 71-86; and Ilmen et al, 1997, Appl. Environ. Microbiol. 63:1298-1306. Culture conditions are also standard, e.g., cultures are incubated at 28°C in shaker cultures or fermenters until desired levels of polypeptide expression are achieved. Where an inducible promoter is used, the inducing agent, e.g., a sugar, metal salt or antibiotics, is added to the medium at a concentration effective to induce polypeptide expression.

[0134] Recombinant filamentous fungal cells may be cultured by shake flask cultivation, small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) in laboratory or industrial fermentors performed in a suitable medium and under conditions allowing the polypeptide of interest to be expressed and/or isolated.

[0135] Techniques for recovering and purifying expressed protein are well known in the art and can be tailored to the particular polypeptide(s) being expressed by the recombinant filamentous fungal cell. Polypeptides can be recovered from the culture medium and or cell lysates. In embodiments where the method is directed to producing a secreted polypeptide, the polypeptide can be recovered from the culture medium. Polypeptides may be recovered or purified from culture media by a variety of procedures known in the art including but not limited to, centrifugation, filtration, extraction, spray-drying, evaporation, or precipitation. The recovered polypeptide may then be further purified by a variety of procedures known in the art including, but not limited to, chromatography {e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic procedures {e.g., preparative isoelectric focusing (IEF), differential solubility {e.g., ammonium sulfate precipitation), or extraction (see, e.g., Protein Purification, J.-C. Janson and Lars Ryden, editors, VCH Publishers, New York, 1989).

[0136] The recombinant filamentous fungal cells of the disclosure can be used in the production of cellulase compositions. The cellulase compositions of the disclosure typically include a recombinantly expressed POI, which is preferably a cellulase, a hemicellulase or an accessory polypeptide. Cellulase compositions typically include one or more cellobiohydrolases and/or endoglucanases and/or one or more β-glucosidases, and optionally include one or more hemicellulases and/or accessory proteins. In their crudest form, cellulase compositions contain the culture of the recombinant cells that produced the enzyme components. "Cellulase compositions" also refers to a crude fermentation product of the filamentous fungal cells that recombinantly express one or more of a cellulase, hemicellulase and/or accessory protein. A crude fermentation is preferably a fermentation broth that has been separated from the filamentous fungal cells and/or cellular debris (e.g., by centrifugation and/or filtration). In some cases, the enzymes in the broth can be optionally diluted, concentrated, partially purified or purified and/or dried. The recombinant POI produced by the recombinant filamentous fungal cells of the disclosure can be co-expressed with one or more of the other components of the cellulase composition (optionally recombinantly expressed using the same or a different expression cassette of the disclosure) or it can be expressed separately, optionally purified and combined with a composition comprising one or more of the other cellulase components.

[0137] Cellulase compositions comprising one or more POIs produced by the recombinant filamentous fungal cells of the disclosure can be used in saccharification reaction to produce simple sugars for fermentation. Accordingly, the present disclosure provides methods for saccharification comprising contacting biomass with a cellulase composition comprising a POI of the disclosure and, optionally, subjecting the resulting sugars to fermentation by a microorganism.

[0138] The term "biomass," as used herein, refers to any composition comprising cellulose (optionally also hemicellulose and/or lignin). Biomass can be derived from plants, animals, or microorganisms, and may include, but is not limited to agricultural, industrial, and forestry residues, industrial and municipal wastes, and terrestrial and aquatic crops grown for energy purposes. As used herein, biomass includes, without limitation, wood, wood pulp, paper pulp, corn fiber, corn silk, corn grain, corn cobs, crop residues such as corn husks, corn stover, grasses (including, e.g., Napier grass, Indian grass, such as Sorghastrum nutans; or, switchgrass, e.g., Panicum species, such as Panicum virgatum), wheat, wheat straw, barley, barley straw, hay, rice, rice straw, switchgrass, waste paper, paper and pulp processing waste, paper, woody or herbaceous plants, plant waste or byproducts, fruit or vegetable pulp, distillers grain, rice hulls, cotton, potatoes, soybean {e.g., rapeseed), rye, oats, beets, hemp, flax, sisal, sugar cane bagasse, energy cane, crushed sugar cane, energy cane bagasse, sorghum, components obtained from milling of grains, trees, branches, roots, leaves, wood chips, sawdust, shrubs and bushes, vegetables, fruits, and flowers and any suitable mixtures thereof. In some embodiments, the biomass comprises, without limitation, cultivated crops (e.g., grasses, including C4 grasses, such as switch grass, cord grass, rye grass, giant reed, elephant grass, miscanthus, reed canary grass, or any combination thereof), sugar processing residues, for example, but not limited to, bagasse (e.g., sugar cane bagasse, beet pulp such as sugar beet, or any combination thereof), agricultural residues (e.g. soybean stover, corn stover, corn fiber, rice straw, sugar cane straw, rice, rice hulls, barley straw, corn cobs, wheat straw, canola straw, oat straw, oat hulls, corn fiber, hemp, flax, sisal, cotton, or any combination thereof), fruit pulp, vegetable pulp, distillers' grains, forestry biomass (e.g., wood, wood pulp, paper pulp, recycled wood pulp fiber, sawdust, hardwood, such as aspen wood, softwood, such as Japanese cedar, or a combination thereof). Furthermore, in some embodiments, the biomass comprises cellulosic waste material and/or forestry waste materials, including but not limited to, hardwood pulp, softwood pulp, paper and pulp processing waste, newsprint, cardboard and the like. In some embodiments, the cellulosic biomass comprises one species of fiber, while in some alternative embodiments, the cellulosic biomass comprises a mixture of fibers.

[0139] In general, "saccharification" refers to the process in which biomass is broken down via the action of cellulases and hemicellulases to produce fermentable sugars (e.g. monosaccharides, including but not limited to glucose and/or xylose). In particular, "saccharification" is an enzyme- catalyzed reaction that results in hydrolysis of a complex carbohydrate to produce shorter-chain carbohydrate polymers and/or fermentable sugar(s) that are more suitable for fermentation or further hydrolysis. In some embodiments, the enzymes comprise cellulase enzyme(s) such as endoglucanases, beta-glucosidases, cellobiohydrolases (e.g., CBHl and/or CBHl , CBH2 and/or CBHII), a synthetic mixture of any of such enzymes, and/or cellulase enzymes contained in culture broth from an organism that produces cellulase enzymes, such as filamentous fungal cells or recombinant yeast cells. Products of saccharification may include disaccharides, and/or monosaccharides such as glucose or xylose. The saccharified biomass (e.g., cellulosic material processed by cellulase compositions of the disclosure) can be made into a number of bio-based products, via processes such as, e.g., microbial fermentation and/or chemical synthesis. As used herein, "microbial fermentation" refers to a process of growing and harvesting fermenting microorganisms under suitable conditions. The fermenting microorganism can be any microorganism suitable for use in a desired fermentation process for the production of bio- based products. Suitable fermenting microorganisms include, without limitation, filamentous fungi, yeast, and bacteria. The saccharified biomass can, for example, be made it into a fuel (e.g., a biofuel such as a bioethanol, biobutanol, biomethanol, a biopropanol, a biodiesel, a jet fuel, or the like) via fermentation and/or chemical synthesis. The saccharified biomass can, for example, also be made into biochemicals or commodity chemical (e.g., ascorbic acid, isoprene, 1 ,3 -propanediol), lipids, amino acids, polypeptides, and enzymes, via fermentation and/or chemical synthesis.

[0140] Biomass typically contains cellulose, which is hydrolyzable into glucose, cellobiose, and higher glucose polymers and includes dimers and oligomers. Cellulose is hydrolysed into glucose by the carbohydrolytic cellulases. Thus the carbohydrolytic cellulases are examples of catalysts for the hydrolysis of cellulose. The prevalent understanding of the cellulolytic system divides the cellulases into three classes; exo-l,4-P-D-glucanases or cellobiohydrolases (CBH) (EC 3.2.1.91), which cleave off cellobiose units from the ends of cellulose chains; endo-l,4- -D-glucanases (EG) (EC 3.2.1.4), which hydrolyse internal β-1 ,4- glucosidic bonds randomly in the cellulose chain; l ,4-P-D-glucosidase (EC 3.2.1.21), which hydrolyses cellobiose to glucose and also cleaves off glucose units from cellooligosaccharides. Therefore, if the biomass contains cellulose, suitable hydrolyzing enzymes include one or more cellulases.

[0141] Many biomasses include hemicellulose, which is hydrolyzable into xylan, glucuronoxylan, arabinoxylan, glucomannan, and xyloglucan. The different sugars in hemicellulose are liberated by the hemicellulases. The hemicellulytic system is more complex than the cellulolytic system due to the heterologous nature of hemicellulose. The systems may involve among others, endo-l,4-P-D-xylanases (EC 3.2.1.8), which hydrolyze internal bonds in the xylan chain; 1 ,4-P-D-xylosidases (EC 3.2.1.37), which attack xylooligosaccharides from the non-reducing end and liberate xylose; endo-l,4- -D- mannanases (EC 3.2.1.78), which cleave internal bonds; l ,4- -D-mannosidases (EC 3.2.1.25), which cleave mannooligosaccharides to mannose. The side groups are removed by a number of enzymes; such as a-D-galactosidases (EC 3.2.1.22), a-L-arabinofuranosidases (EC 3.2.1.55), a-D-glucuronidases (EC 3.2.1.139), cinnamoyl esterases (EC 3.1.1.), acetyl xylan esterases (EC 3.1.1.6) and feruloyl esterases (EC 3.1.1.73). Therefore, if the biomass contains hemicellulose, suitable hydrolyzing enzymes include one or more hemicellulases.

[0142] The cellulase cocktails suitable for saccharification of the pretreated feedstock include one or more cellobiohydrolases, endoglucanases and/or β-glucosidases. Cellulase cocktails are compositions comprising two or more cellulases. In their crudest form, cellulase cocktails contain the microorganism culture that produced the enzyme components. "Cellulase cocktails" also refers to a crude fermentation product of the microorganisms. A crude fermentation is preferably a fermentation broth that has been separated from the microorganism cells and/or cellular debris (e.g., by centrifugation and/or filtration). In some cases, the enzymes in the broth can be optionally diluted, concentrated, partially purified or purified and/or dried.

[0143] Suitable cellulases include those of bacterial or fungal origin. Suitable cellulases include cellulases from the genera Bacillus, Pseudomonas, Trichoderma, Aspergillus, Chrysosporiuim, Humicola, Fusarium, Thielavia, Acremonium, e.g., the fungal cellulases produced from Humicola insolens, Myceliophthora thermophila and Fusarium oxysporum disclosed in U.S. Pat. No. 4,435,307, U.S. Pat. No. 5,648,263, U.S. Pat. No. 5,691,178, U.S. Pat. No. 5,776,757 and WO 89/09259. The Trichoderma reesei cellulases are disclosed in U.S. Pat. No. 4,689,297, U.S. Pat. No. 5,814,501, U.S. Pat. No. 5,324,649, WO 92/06221 and WO 92/06165. Bacillus cellulases are disclosed in U.S. Pat. No. 6,562,612.

[0144] Commercially available cellulases or cellulase cocktails that can suitably be used in the present methods include, for example, CELLIC CTec (Novozymes), ACCELLERASE (Genencor), SPEZYME CP (Genencor), 22 CG (Novozymes), Biocellulase W (Kerry) and Pyrolase (Verenium), Novozyme-188 β-glucosidase (Novozymes), AlternaFuel ® CMAX TM (Dyadic), AlternaFuel® 100P (Dyadic), AlternaFuel® 200P (Dyadic), AlternaFuel ® CMAX3 TM (Dyadic), Cellic CTec3 (Novozymes), Cellic CTec2 (Novozymes), Cellic CTec (Novozymes), Cellic HTec3 (Novozymes), Accellerase ® TRIO (Genencor).

[0145] Although a mixture of fermentation microorganisms, such as one or more different kinds of yeasts, can be used, suitably, a single fermentation organism such as a single kind of yeast that is capable of fermenting both pentose and hexose sugars is used in embodiments of this invention. The microorganism can be a wild type of microorganism or a recombinant microorganism, and can include, for example, Escherichia, Zymomonas, Saccharomyces, Candida, Pichia, Streptomyces, Bacillus, Schizosaccharomyces, Dekkera, Bretanomyces, Kluyveromyces, Issatchenkia, Hansenula, Pachysolen, Torulaspora, Zygosaccharomyces, Yarrowia, Lactobacillus, and Clostridium. Particularly suitable species of fermenting microorganisms include Escherichia coli, Z. mobilis, Bacillus stearothermophilus, Clostridia thermocellum, and Thermoanaerobacterium saccharolyticum. Genetically modified strains of E. coli or Zymomonas mobilis can be used for ethanol production (see, e.g., Underwood et al, 2002, Appl. Environ. Microbiol. 68:6263-6272 and US 2003/0162271 Al). [0146] More specific examples of suitable fermentation organisms include, for example, S. cerevisiae, S. carlsbergensis, S. pastorianus, BioTork strain SC48-EVG51, Schizosaccharomyces pombe, D. bruxellensis, D. Anomala, B. bruxellensis, B. anomalus, B. custerianus, B. naardensis, B. nanus, K. marxianus, K. lactis, C. sonorensis, C. methanosorbosa, C. ethanolica, C. maltose, C. tropicalis, C. albicans, C. stellate, C. shehatae, I. orientalis (also known as Pichia kudriavzevii and the anamorph form (asexual form) known as Candida krusei), ATCC 3196, ATCC PTA-6658, Issatchenkia kudryavtsev, Cargill strain 1822, Cargill strain 3556, Cargill strain 3085, Cargill strain 3849, Cargill strain 3859, H. polymorpha ML3, H. polymorpha ML9, H. polymorpha ML6, H. polymorpha ML8, H. polymorpha N95, P. tannophilus, P. tannophilus strain NRRL 2460, P. tannophilus strain I fGB 0101, P. stipitis (now known as Scheffersomyces stipitis), Scheffersomyces stipitis strain CBS 6054, Scheffersomyces stipitis NRRL 7124, Scheffersomyces stipitis NRRL 11545, P. fermentans, P. faleiformis, P. sp. YB-4149, P. deserticola, P. membranifaciens, P. galeiformis, P. segobiensis, P. segobiensis strain NRRL 11571, T. delbruekii, Z. bailii, and Y. lipolytica.

[0147] Thus, in certain aspects, POIs expressed by the recombinant filamentous fungal cells of the disclosure find utility in the generation of ethanol from biomass in either separate or simultaneous saccharification and fermentation processes. Separate saccharification and fermentation is a process whereby cellulose present in biomass is saccharified into simple sugars {e.g., glucose) and the simple sugars subsequently fermented by microorganisms {e.g., yeast) into ethanol. Simultaneous saccharification and fermentation is a process whereby cellulose present in biomass is saccharified into simple sugars {e.g., glucose) and, at the same time and in the same reactor, microorganisms {e.g., yeast) ferment the simple sugars into ethanol.

[0148] Prior to saccharification, biomass is preferably subject to one or more pretreatment step(s) in order to render cellulose material more accessible or susceptible to enzymes and thus more amenable to hydrolysis by POI polypeptides of the disclosure.

[0149] In an exemplary embodiment, the pretreatment entails subjecting biomass material to a catalyst comprising a dilute solution of a strong acid and a metal salt in a reactor. The biomass material can, e.g., be a raw material or a dried material. This pretreatment can lower the activation energy, or the temperature, of cellulose hydrolysis, ultimately allowing higher yields of fermentable sugars. See, e.g., U.S. Patent Nos. 6,660,506; 6,423,145. [0150] Another exemplary pretreatment method entails hydrolyzing biomass by subjecting the biomass material to a first hydrolysis step in an aqueous medium at a temperature and a pressure chosen to effectuate primarily depolymerization of hemicellulose without achieving significant depolymerization of cellulose into glucose. This step yields a slurry in which the liquid aqueous phase contains dissolved monosaccharides resulting from depolymerization of hemicellulose, and a solid phase containing cellulose and lignin. The slurry is then subject to a second hydrolysis step under conditions that allow a major portion of the cellulose to be depolymerized, yielding a liquid aqueous phase containing dissolved/soluble depolymerization products of cellulose. See, e.g., U.S. Patent No. 5,536,325.

[0151] A further exemplary method involves processing a biomass material by one or more stages of dilute acid hydrolysis using about 0.4% to about 2% of a strong acid; followed by treating the unreacted solid lignocellulosic component of the acid hydrolyzed material with alkaline delignification. See, e.g., U.S. Patent No. 6,409,841. Another exemplary pretreatment method comprises prehydrolyzing biomass {e.g., lignocellulosic materials) in a prehydrolysis reactor; adding an acidic liquid to the solid lignocellulosic material to make a mixture; heating the mixture to reaction temperature; maintaining reaction temperature for a period of time sufficient to fractionate the lignocellulosic material into a solubilized portion containing at least about 20% of the lignin from the lignocellulosic material, and a solid fraction containing cellulose; separating the solubilized portion from the solid fraction, and removing the solubilized portion while at or near reaction temperature; and recovering the solubilized portion. The cellulose in the solid fraction is rendered more amenable to enzymatic digestion. See, e.g., U.S. Patent No. 5,705,369. Further pretreatment methods can involve the use of hydrogen peroxide ¾(½. See Gould, 1984, Biotech, and Bioengr. 26:46- 52.

[0152] Pretreatment can also comprise contacting a biomass material with stoichiometric amounts of sodium hydroxide and ammonium hydroxide at a very low concentration. See Teixeira et al, 1999, Appl. Biochem.and Biotech. 77-79:19-34. Pretreatment can also comprise contacting a lignocellulose with a chemical {e.g., a base, such as sodium carbonate or potassium hydroxide) at a pH of about 9 to about 14 at moderate temperature, pressure, and pH. See PCT Publication WO2004/081185.

[0153] Ammonia pretreatment can also be used. Such a pretreatment method comprises subjecting a biomass material to low ammonia concentration under conditions of high solids. See, e.g., U.S. Patent Publication No. 20070031918 and PCT publication WO 06/110901. [0154] Table 1 below provides a list of the SEQ ID NOs referenced herein and the corresponding polynucleotide or polypeptide sequences.

TABLE 1

SEQ ID NO: Description Sequence

1 native gpd 5' UTR AACAACATCG ACATTCTCTC CTAA CACCA GCCTCGCAAA TCCTCAGGTT AGTATTACTA

CTACTACAAT CA CACCACG ATGCTCCGCC CGACGATGCG GCTTCTGTTC GCCTGCCCCT CCTCTCACTC GTGCCCTTGA CGAGCTACCC CGCCAGACTC TCCTGCGTCA CCAATTTTTT TCCCTATTTA CCCCTCCTCC CTCTCTCCCT CTCGTTTCTT CCTAACAAAC AACCACCACC AAAATCTCTT TGGAAGCTCA CGACTCACGC AAGCTCAATT CGCAGAT

Cochliobolus ATGCTGTGGC TTGCACAAGC ATTGTTGGTC GGCCTTGCCC AGGCATCGCC CAGGTTCCCT heterostrophus β- CGTGCTACCA ACGACACCGG CAGTGATTCT TTGAACAATG CCCAGAGCCC GCCATTCTAC glucosidase nucleotide CCAAGTCCTT GGGTAGATCC CACCACCAAG GACTGGGCGG CTGCCTATGA AAAAGCAAAG sequence GCTTTTGTTA GCCAATTGAC TCTTATTGAG AAGGTCAACC TCACCACCGG CACTGGATGG

CAGAGCGACC ACTGCGTTGG TAACGTGGGC GCTATTCCTC GCCTTGGCTT TGATCCCCTC TGCCTCCAGG ACAGCCCTCT CGGCATCCGT TTCGCAGACT ACGTTTCTGC TTTCCCAGCA GGTGGCACCA TTGCTGCATC ATGGGACCGC TATGAGTTTT ACACCCGCGG TAACGAGATG GGTAAGGAGC ACCGAAGGAA GGGAGTCGAC GTTCAGCTTG GTCCTGCCAT TGGACCTCTT GGTCGCCACC CCAAGGGCGG TCGTAACTGG GAAGGCTTCA GTCCTGATCC TGTACTTTCC GGTGTGGCCG TGAGCGAAAC AGTCCGCGGT ATCCAGGATG CTGGTGTCAT TGCCTGCACT AAGCACTTCC TTCTGAACGA GCAAGAACAT TTCCGTCAGC CCGGCAGTTT CGGAGA ATC CCCTTTGTCG ATGCCATCAG CTCCAATACC GATGACACGA CTCTACACGA GCTCTACCTG TGGCCCTTTG CCGACGCCGT CCGCGCTGGT ACTGGTGCCA TCATGTGCTC TTACAACAAG GCCAACAACT CGCAACTCTG CCAAAACTCG CACCTTCAAA ACTATATTCT CAAGGGCGAG CTTGGCTTCC AGGGTTTCAT TGTATCTGAC TGGGATGCAC AGCACTCGGG CGTTGCGTCG GCTTATGCTG GATTGGACAT GACTATGCCT GGTGATACTG GATTCAACAC TGGACTGTCC TTCTGGGGCG CTAACATGAC CGTCTCCATT CTCAACGGCA CCATTCCCCA GTGGCGTCTC GACGATGCGG CCATCCGTAT CATGACCGCA TACTACTTTG TCGGCCTTGA TGAGTCTATC CCTGTCAACT TTGACAGCTG GCAAACTAGC ACGTACGGAT TCGAGCATTT TTTCGGAAAG AAGGGCTTCG GTCTGATCAA CAAGCACATT GACGTTCGCG AGGAGCACTT CCGCTCCATC CGCCGCTCTG CTGCCAAGTC AACCGTTCTC CTCAAGAACT CTGGCGTCCT TCCCCTCTCT GGAAAGGAGA AGTGGACTGC TGTATTTGGA GAAGATGCTG GCGAAAACCC GCTGGGCCCC AACGGATGCG CTGACCGCGG CTGCGACTCT GGCACCTTGG CCATGGGCTG GGGTTCGGGA ACTGCAGACT TCCCTTACCT CGTCACTCCT CTCGAAGCCA TCAAGCGTGA GGTTGGCGAG AATGGCGGCG TGATCACTTC GGTCACAGAC AACTACGCCA CTTCGCAGAT CCAGACCATG GCCAGCAGGG CCAGCCACTC GATTGTCTTC GTCAATGCCG ACTCTGGTGA AGGTTACATC ACTGTTGATA ACAACATGGG TGACCGCAAC AACATGACTG TGTGGGGCAA TGGTGATGTG CTTGTCAAGA ATATCTCTGC TCTGTGCAAC AACACGA TG TGGTTATCCA CTCTGTCGGC

TABLE 1

SEQ ID NO: Description Sequence

CCAGTCATTA TTGACGCCTG GAAGGCCAAC GACAACGTGA CTGCCATTCT CTGGGCTGGT CTTCCTGGCC AGGAGTCTGG TAACTCGATT GCTGACATTC A ACGGACA CCACAACCCT GGTGGCAAGC TCCCCTTCAC CATTGGCAGC TCTTCAGAGG AGTATGGCCC GA G CA C TACGAGCCCA CGAACGGCAT CCTCAGCCCT CAGGCCAACT TTGAAGAGGG CGTCTTCATT GACTACCGCG CGTTTGACAA GGCGGGCATT GAGCCCACGT ACGAATTTGG CTTTGGTCTT TCGTACACGA CTTTTGAATA CTCGGACCTC AAGGTCACTG CGCAGTCTGC CGAGGCTTAC AAGCCTTTCA CCGGCCAGAC TTCGGCTGCC CCTACATTCG GAAACTTCAG CAAGAACCCC GAGGACTACC AGTACCCTCC CGGCCTTGTT ACCCCGACA CGTTCATCTA CCCCTACCTC AACTCGACTG ACCTCAAGAC GGCATCTCAG GA CCCGAGT ACGGCCTCAA CGTTACCTGG CCCAAGGGCT CTACCGATGG CTCGCCTCAG ACCCGCATTG CGGCTGGTGG TGCGCCCGGC GGTAACCCCC AGCTCTGGGA CGTTTTGTTC AAGGTCGAGG CCACGATCAC CAACACTGGT CACGTTGCTG GTGACGAGGT GGCCCAGGCG TACATCTCGC TTGGTGGCCC CAACGACCCC AAGGTGCTAC TCCGTGACTT TGACCGCTTG ACCATCAAGC CTGGTGAGAG CGCTGTTTTC ACAGCCAACA TCACCCGCCG TGATGTCAGC AACTGGGACA CTGTCAGCCA GAACTGGGTC A TACCGAGT ACCCCAAGAC GATCCACGTT GGTGCCAGTT CGAGGAACCT TCCTCTTTCT GCCCCACTGG ACACTAGCAG CTTTAGATAA

Cochliobolus LWLAQALLV GLAQASPRFP RATNDTGSDS LNNAQSPPFY PSPWVDPTTK DWAAAYEKAK heterostrophus β- AFVSQLTLIE KVNLTTGTGW QSDHCVGNVG AIPRLGFDPL CLQDSPLGIR FADYVSAFPA glucosidase polypeptide GGTIAASWDR YEFYTRGNEM GKEHRRKGVD VQLGPAIGPL GRHPKGGRNW EGFSPDPVLS sequence GVAVSETVRG IQDAGVIACT KHFLLNEQEH FRQPGSFGDI PFVDAISSNT DDTTLHELYL

WPFADAVRAG TGAIMCSYNK ANNSQLCQNS HLQNYILKGE LGFQGFIVSD WDAQHSGVAS AYAGLDMTMP GDTGFNTGLS FWGANMTVSI LNGTIPQWRL DDAAIRIMTA YYFVGLDESI PVNFDSWQTS TYGFEHFFGK KGFGLINKHI DVREEHFRSI RRSAAKSTVL LKNSGVLPLS GKEKWTAVFG EDAGENPLGP NGCADRGCDS GTLAMGWGSG TADFPYLVTP LEAIKREVGE NGGVITSVTD NYATSQIQTM ASRASHSIVF VNADSGEGYI TVDNNMGDRN NMTVWGNGDV LVKNISALCN NTIVVIHSVG PVIIDAWKAN DNVTAILWAG LPGQESGNSI ADILYGHHNP GGKLPFTIGS SSEEYGPDVI YEPTNGILSP QANFEEGVFI DYRAFDKAGI EPTYEFGFGL SYTTFEYSDL KVTAQSAEAY KPFTGQTSAA PTFGNFSKNP EDYQYPPGLV YPDTFIYPYL NSTDLKTASQ DPEYGLNVTW PKGSTDGSPQ TRIAAGGAPG GNPQLWDVLF KVEATITNTG HVAGDEVAQA YISLGGPNDP KVLLRDFDRL TIKPGESAVF TANITRRDVS NWDTVSQNWV ITEYPKTIHV GASSRNLPLS APLDTSSFR

Aureococcus GACGCGCTCG GCGTGGCCGC GACGTGCTGC GCGGTCGACG GCGAGGCGTC

anophagefferens GTGGTCGCCC CACCGACAGC GTTGGCCTCG GCGT

TABLE 1

SEQ ID NO: Description Sequence

ACJIOOOOOOOO

5 Aureococcus GACCAATGAA AAGCAAGATC ACGAGGTCCG CTCCGGCTGC CGGTCTCGAG

anophagefferens ATTAGCAGCC CCTCTCCCAA CCCAAAACAC ACGC

ACJIOOOOOOOO

6 Aureococcus TCTCTCCCTC GTCGAGGTTC CCCGCGCGCT CCTTCGTCTG ACTTCCCGCC

anophagefferens ACCGAGTTCG TCCACTTTCG CAGACCCCTA CCTC

ACJIOOOOOOOO

7 Aureococcus ACTTCGGTCT TCGATCGGCC TCCAGCGCAT CGTGCCCGGA ACGCGTTCAC

anophagefferens CGAAGACCCG CCACCAGCCG CAAACCAGTA CACT

ACJIOOOOOOOO

8 Aureococcus CGCGCGCGCT ACGCCCCCTT CGCCGCGTTT GCGTTCCGAT CTTGATCCGC

anophagefferens CCGCCCCCTC CTAGGTACTC TCCCACCCAC TCTT

ACJIOOOOOOOO

9 Aureococcus ACGCCCCCCC CCCTCGTATC CCTTCCAATC ACCGCCCCGA AACAACTCGC

anophagefferens GATCCCCCAA ATCAAAAAGT CTCGACGCGT AGGC

ACJIOOOOOOOO

10 Aureococcus AGGCGACGAC GCAGAGGTTT TGCAGCTGCC AGGGCATAGC GTGTTAATTT

anophagefferens ACAGACGAGC TGCGACGAGA GTGCGGGTTC AGTG

ACJIOOOOOOOO

11 Aureococcus CCCGCCCCCC GGAAACGGCC CCGCCTCCGC CCCGCCGCGC CCCGGACGCC

anophagefferens CCCGACGCCC GACGCCCCCA AAAA CACAG GTCA

ACJIOOOOOOOO

12 Aureococcus GGCCGCCGCC GCACGACGCC GGGCGAGAGG CGACGCGCGC CGCTGCGAAA

anophagefferens CGGCGCCGCA TTCGACGCGC CCCCGCCTCC GCAG

ACJIOOOOOOOO

13 Aureococcus

anophagefferens ATGTGTCGTC CCGCGCCGAT ACCGACGCGG GGCGCGGCAT GCAGTTCAAGTGCCGCGTGT ACJIOOOOOOOO TACCTTTTGA GCATCAAGCG CGGA

14 Aureococcus

anophagefferens ACGCC GGCAGCTGCC ACGTCGACAT CCCCTTCCAC GCCCGCGCCC CCGCCGGCTC ACJIOOOOOOOO CCCGGCTCAC CCCCCGCCCC CCGCAGGCT

15

Aureococcus ACCTCCGGCC GCGCGCGCGC GCGCGCTCGG GCCGCGCGAC CCGCCCCTCC GCGCTCCGCC

5. EXAMPLES

5.1. Example 1; Computational Identification of Non-Fungal UTRs

[0155] As a strategy to select 5' untranslated regions (UTRs) from the genomes of non- fungal species, a set of highly expressed genes of identifiable function was selected from the T. reesei genome. In order to identify highly-expressed T. reesei genes, expression data was generated using Illumina-based RNA sequencing (RNA Seq) of RNA samples extracted from T. reesei growing under fermentation conditions. Gene annotations were obtained from the Joint Genome Institute (JGI) and are in the public domain. 30 genes were chosen from the T. reesei genome on the basis that these genes showed high normalized values for Reads Per Kilobase per Million mapped reads (RPKM) from the RNA Seq data. RPKM is a measure of mRNA abundance for a given transcript.

[0156] Genome annotation data were also used to assess functions that were considered to be most likely to be conserved between eukaryotic species (see Table 2).

[0157] Samples of total RNA were isolated from fermentation cultures of T. reesei at 31h, 48h, 72h, and 96h using standard methods. The RNA was sent to a contract research company, Ambry Genetics, to generate RNA Seq data. In this case the samples were depleted for ribosomal RNA and used as template to generate cDNA, which was then subjected to sequencing using Illumina technology. The raw sequencing data was then assembled against the genome sequence of the T. reesei strain, and used to calculate RPKM values. The data from the 72h time point was used to select highly expressed genes of known function that were likely to be conserved in other eukaryotic organisms (see Table 2).

514 1 7 Aceto y roxy ac somerore uctase

[0158] The predicted exons for each gene were concatenated as coding sequences (CDS). Each of the thirty T. reesei CDs in the set was used to query the predicted coding sequences from the genome sequences of five non-fungal eukaryotic species (see Table 3), using the BLAST program (blastn).

[0159] Hits among the target genomes were scored according to three criteria: 1) number of hits to the orthologous CDs; 2) coverage of hits to the orthologous CDs; 3) statistics of the BLAST hits (E Value, score, % ID of hits, gaps and mismatches). In total, 69 hits were selected in the highest scoring category. From this set of hits, a sequence was extracted in each case from lOObp upstream of the predicted start codon to 8bp downstream of the start codon.

5.2. Example 2: Construction of an Expression Vector Containing a

Mammalian Viral Promoter Upstream of a β-glucosidase from Cochliobolus heterostrophus to Test UTR performance

[0160] This example describes the construction of expression vectors comprising a cytomegalovirus (CMV) promoter operably linked in a 5' to 3' direction to a sequence coding for Cochliobolus heterostrophus β-glucosidase and a terminator sequence from T. reesei

GLA, which includes a 3' UTR.

[0161] Construction of a base vector containing the Hyg resistance marker. First, a base vector containing the Hyg resistance marker, encoding the hygromycin B- phosphotransferase, under the control of 200 bp of the Trichoderma reesei glucoamylase (GLA) promoter and the Aspergillus niger ubiquitin terminator followed by a DNA sequence region from the 3 'end of the T. reesei GLA gene was constructed by cloning these fragments into the commercial plasmid pBluescript II SK (+). This initial vector was named pGLA- 200_hyg (see FIG. 3).

[0162] All procedures utilizing commercial vendor products, described in this and the following Examples, were carried out by following the instructions of the manufacturer. To produce this vector, the GLA promoter was fused to the hyg-Tubi fragment during a three step fusion polymerase chain reaction (PCR) described below. Amplifications were performed from T. reesei gDNA, as well as a previously generated vector containing the hyg- cassette as templates with AccuPrime™ Pfx SuperMix (Invitrogen, Carlsbad, CA) using the primers listed in Table 4, below.

[0163] Each primer (except the ones used for the fusion) contained a CACCA sequence of nucleotides on its 5' end to ensure efficient cutting as a PCR product. For the first step of the fusion PCR, the forward primer amplifying the GLA promoter contained an Xhol restriction site and the reverse primer was composed of 23 bp from the GLA promoter and 23 bp of the hyg gene. The forward primer used to amplify the hyg-cassette was composed of 23 bp of the GLA promoter and 23 bp of the hyg gene. The reverse primer contained a Pacl as well as a BamHl restriction site. The primers used are shown in Table 4, with restriction sites underlined and GLA promoter bolded and italicized.

[0164] Following PCR, the products were gel purified with Zymoclean Gel DNA Recovery Kit (Zymo Research, Irvine, CA). In the second fusion PCR step, both fragments were used as a template without primers to make the fusion of both pieces. This second PCR served as template in the third and final step of the fusion PCR with primers GLA- 200_hyg_XhoI_fw and Tubi PacI BamHI rev to amplify the complete fusion of GLA promoter, hyg gene and ubiquitin terminator. The amplified fragment was then gel purified with Zymoclean™ Gel DNA Recovery Kit (Zymo Research, Irvine, CA), digested with Xhol and BamHI (NEB, Ipswich, MA); and purified with the DNA Clean & Concentrator™-5 kit (Zymo Research, Irvine, CA) to prepare the fusion DNA for ligation.

[0165] The GLA 3' flanking region was amplified using a forward primer with a BamHI and Sbfl restriction site as well as a reverse primer that contained a Notl site. In preparation for ligation, the GLA 3' flanking region was gel purified after amplification with Zymoclean™ Gel DNA Recovery Kit (Zymo Research, Irvine, CA), then digested using restriction enzymes BamHI and Notl, and then purified with the DNA Clean & Concentrator™-5 kit (Zymo Research, Irvine, CA). Plasmid DNA was prepared by digesting pBluescript II SK (+) with Xhol and Notl at 37°C for 2 hours and then gel purified with the Zymoclean™ Gel DNA Recovery Kit. The ligation reaction between the fusion DNA fragment, the GLA 3 ' flanking region and the plasmid DNA was carried out with T4 DNA Ligase (NEB, Ipswich, MA). Each ΙΟμΕ ligation consisted of 50ng of plasmid DNA, with the two inserts in a molar ratio of 1 :5 of vector to inserts, as well as lx T4 DNA Ligase buffer and 0.2μί T4 DNA ligase. The sequence of the inserted DNA fragments was verified by sequencing using Big-Dye™ terminator chemistry (Applied Biosystems, Inc., Foster City, CA). FIG. 3 depicts a schematic map of the resulting pGLA-200 ^>_hyg vector. [0166] Construction of 5' UTR screening vector containing a Cochliobolus heterostrophus β- glucosidase coding sequence under control of the CMV promoter. The pGLA-200_hyg vector was digested with Sbfi and Pad at 37°C for 2 hours and gel purified with the Zymoclean™ Gel DNA Recovery Kit. A DNA fragment encoding a Cochliobolus heterostrophus β-glucosidase (BG) was amplified using AccuPrime™ Pfx SuperMix with the primers listed in Table 5, below.

[0167] Primers were designed to have a CACCA sequence on their 5' end to ensure efficient cutting as PCR products in subsequent steps. The forward primer included Ascl and Xbal restriction sites and the reverse primer a Sbfi. restriction site to allow for cloning into the pGLA-200_hyg vector. Restriction sites are underlined and the sequence corresponding to the β-glucosidase coding sequence is shown in bold italics in Table 4. The CMV promoter was amplified from a synthesized template using AccuPrime™ Pfx SuperMix with primers listed in Table 5. The amplified sequences were then gel purified with the Zymoclean™ Gel DNA Recovery Kit (Zymo Research, Irvine, CA), digested with Pad and Asd (NEB, Ipswich, MA) in case of the CMV promoter and Asd and Sbfi in case of the BG gene; purified with DNA Clean & Concentrator™- 5 (Zymo Research, Irvine, CA) to prepare the sequences for ligation. Ligation was carried out using T4 DNA Ligase (NEB, Ipswich, MA). Each ΙΟμΤ ligation consisted of 50ng of pGLA-200 _hyg vector, the two inserts in a molar ratio 1 :5 of vector to inserts, lx T4 DNA Ligase buffer and 0.2μΤ T4 DNA Ligase. The nucleotide sequences of the final constructs were confirmed using Big-Dye™ terminator chemistry (Applied Biosystems, Inc., Foster City, CA). The plasmid containing the CMV promoter operably linked to β-glucosidase is referred to as pGLA-200 ' BG noUTR. 5.3. Example 3: Construction of a Vector Containing an Expression Cassette Including a CMV, a 5' Untranslated Region (5' UTR) from the T. reesei gpd gene, and the Protein Coding Sequence for Cochliobol s heterostrophus β-glucosidase

[0168] This example describes the construction of a vector by cloning a 5' UTR from the

Trichoderma reesei gpd gene, and the protein coding sequence for Cochliobolus heterostrophus β-glucosidase, and a GLA terminator as the 3' UTR.

[0169] The vector pGLA-200_BG_noUTR was digested with HmdIII and Xbal at 37°C for 2 hours and gel purified with the Zymoclean™ Gel DNA Recovery Kit. The Trichoderma reesei gpd 5' UTR was amplified from gDNA using AccuPrime™ Pfx SuperMix with primers listed in Table 6, below.

79 gpd_UTR_XbaI_rev CACCATCTAGAATCTGCGAATTGAGCTTG

[0170] Each primer contained a CACCA sequence of nucleotides on its 5' end to ensure efficient cutting. The forward primer contained a HmdII and the reverse primer an Xbal restriction site. The amplified sequence was then gel purified with the Zymoclean™ Gel DNA Recovery Kit (Zymo Research, Irvine, CA) digested with HmdIII and Xbal (NEB, Ipswich, MA); purified with DNA Clean & Concentrator™-5 (Zymo Research, Irvine, CA) to prepare the sequences for ligation. Ligation was carried out using T4 DNA Ligase (NEB, Ipswich, MA). A 10μΕ ligation consisted of 50ng of pGLA-200_BG_noUTR vector and the insert in a molar ratio 1 :5 of vector to insert, lx T4 DNA Ligase buffer and 0.2μΕ T4 DNA Ligase. The nucleotide sequences of the final constructs were confirmed using Big-Dye™ terminator chemistry (Applied Biosystems, Inc., Foster City, CA). The resulting vector was named pGLA-200_BG JIUTR.

[0171] The 5' UTR sequence used to generate expression cassettes was the native gpd 5' UTR, given by SEQ ID NO: 1.

5.4. Example 4: Construction of vectors containing non-fungal UTRs

[0172] This example describes the construction of multiple, unique vectors containing non- fungal untranslated region (UTR) DNA sequences in place of the native Cochliobolus UTR upstream of the Cochliobolus β-glucosidase (BG) gene.

[0173] 64 Non-fungal UTRs were cloned, singly, into two base vectors (containing the CMV or CaMV promoter) to replace the Cochliobolus UTR, creating 128 unique vectors. The cloning site was downstream of the promoter, and upstream of the BG start site and native Cochliobolus ribosome binding sequence.

[0174] Preparing the non-fungal UTR DNA. The following was performed for each unique non-fungal UTR sequence. The first 84 bases of the non-fungal UTR, ending six bases upstream of its native transcription start site, were chosen as the sequence to replace the native Cochliobolus UTR. Prior to synthesis as DNA oligonucleotides, bases were added to the ends of the sense and anti-sense sequences to create sticky ends for cloning. Restriction sites, Hind!II and Xbal, were used, upstream and downstream, respectively (Table 7).

[0175] The appended sense and anti-sense sequences were created synthetically as oligonucleotides (Integrated DNA Technologies, Coralville, Iowa), and annealed together to create a double- stranded DNA fragment with sticky ends. Sequences are shown in Table 8.

[0176] Construction of the vectors containing the non-fungal UTRs. The following procedures were carried out to clone the double- stranded UTR fragments into the vector pGLA-200_BG_noUTR. The construction of all 64 vectors took place over time, using different commercial vendor products and different manufacturer instructions, as indicated below. The resultant constructed vector products were of the same quality, verified by DNA sequencing.

[0177] First, the linear no-UTR vector was created by digesting the circularized plasmid base vector DNA with Hindlll and Xbal following the manufacturer's instructions (New England Biolabs, Ipswich, Massachusetts). The digested vector was gel-purified using a Bio-Rad ReadyAgarose gel (Bio-Rad Laboratories, Hercules, California) and purified using the Zymoclean Gel DNA Recovery Kit (Zymo Research Corporation,). The annealed UTR oligonucleotides were ligated into the vector individually using T4 DNA Ligase (Roche Diagnostics Corporation, Indianapolis, Indiana, or New England Biolabs) following the manufacturer's instructions. The following were combined for the 10 μΕ ligation reaction: 20-50 ng vector DNA; 20-800 μg UTR DNA; lx DNA Ligase Buffer; 0.5 T4 DNA Ligase). The reaction was incubated at 4°C overnight or room temperature for 2 hours.

[0178] The ligated plasmid vector was used to transform E. coli using conventional methods. 1 - 4 μΤ plasmid DNA was combined with 50 μΕ XLl-blue super-competent cells (Agilent Technologies, Santa Clara, California) and incubated for 30 minutes on ice. The cells were heat shocked at 42 °C for 45 seconds and placed on ice for 2 minutes. 250 μΕ of warm (37 °C) SOC medium was added, and the cells were incubated for 1 hour (37 °C, 250 rpm). The entire transformation mixture was plated onto a (Luria-Bertani) LB Carbenicillin (100 μg/μL) agar plate and incubated at 37 °C overnight. Colonies for verification were picked individually into LB Carbenicillin (100 liquid medium, incubated at 37 °C, 250 rpm, overnight. The plasmid DNAs were mini-prepped using 5prime PerfectPrep Direct 96 Vac Direct kit (5 PRIME, Inc., Gaithersburg, Maryland) and DNA eluted in H₂0.

[0179] The insertion of the UTR fragment was verified by PCR amplification of the cloning region using the plasmid DNA as template and primers upstream and downstream of the cloning site, followed by visualization of the correct product size on an agarose gel. The amplification reactions (25μ1) were set up using the Platinum® Taq DNA Polymerase High Fidelity kit (Life Technologies, Carlsbad, California): lx High Fidelity PCR Buffer, 0.4 μΜ primer CMV Fwd (5'-GTG GAT AGC GGT TTG ACT C-3') or primer CaMV Fwd (5'-CAC CAT TAA TTA AGT CAA AGA TTC AAA-3"), 0.4 μΜ primer BG Rev (5'-CCA ACG CAG TGG TCG CTC-3'), 1 μΐ MgS0₄, 0.1 μΐ Platinum® Taq DNA Polymerase High Fidelity, and 10 - 100 ng of plasmid DNA. The reactions were subjected to thermocycling in a MJ PTC-225 thermal cycler (Bio-Rad Laboratories) programmed as follows: 95°C for 2 minutes, then 30 cycles each of 15 seconds at 95°C, 30 seconds at 48°C, and 45 seconds at 68°C (with a 10 minute final extension at 68°C). The reaction products were visualized on a Bio-Rad ReadyAgarose gel (Bio-Rad Laboratories).

[0180] The cloned UTR region was verified by sequencing using the ABI 3730x1 DNA Analyzer and ABI BigDye® v3.1 cycle sequencing chemistry (Life Technologies). The single primer used for sequencing was primer BG Rev (5'-CCA ACG CAG TGG TCG CTC- 3').

[0181] Generation of DNA for fungal transformation. Generation of DNA for fungal transformation was done by PCR amplification. The amplification reactions (50μ1) were set up using the Platinum® Taq DNA Polymerase High Fidelity kit (Life Technologies, Carlsbad, California): lx High Fidelity PCR Buffer, 0.4 μΜ primer GLA Fwd (5'-CAC CAC TCG AGC GCG AAT CAC TGG AC-3'), 0.4 μΜ primer GLA Rev (5'-TGG TGG CGG CCG CAG CAA CGC CAA CA-3'), 1 μΐ MgS0₄, 0.2 μΐ Platinum® Taq DNA Polymerase High Fidelity, and 10 - 100 ng of plasmid DNA. The reactions were subjected to thermocycling in a MJ PTC-225 thermal cycler (Bio-Rad Laboratories) programmed as follows: 95°C for 2 minutes, then 30 cycles each of 15 seconds at 95°C, 30 seconds at 55°C, and 8 minutes 30 seconds at 68°C (with a 10 minute final extension at 68°C). The reaction products were visualized on a Bio-Rad ReadyAgarose gel (Bio-Rad Laboratories) and stored at -20°C.

5.5. Example 5: Transformation of T. reesei with Vectors Containing Non- Fungal UTRs and a Mammalian Viral Promoter. [0182] Media. The following media was used for the transformation procedure. Aspergillus Complete Medium with uridine (ACMU₂) was made as follows: 10 g/1 yeast extract (1% final); 25 g/1 glucose (2.5% final); 10 g/1 Bacto Peptone (Bacto Laboratories, Liverpool, NSW, Australia) (1% final); 7 mM KC1; 11 mM KH₂P0₄; 2 mM MgS0₄; 77 μΜ ZnS0₄; 178 μΜ H₃B0₃; 25 μΜ MnCl₂; 18 μΜ FeS0₄; 7.1 μΜ CoCl₂; 6.4 μΜ CuS0₄; 6.2 μΜ Na₂Mo0₄; 134 μΜ Na₂EDTA; 1 mg/ml riboflavin; 1 mg/ml thiamine; 1 mg/ml nicotinamide; 0.5 mg/ml pyridoxine; 0.1 mg/ml pantothenic acid; 2 μg/ml biotin; 0.6g/L uracil (5 mM final); 1.2g/L uridine (5 mM final).

[0183] Transformation of Trichoderma reesei. A Trichoderma reesei strain, TR1, was used as the expression host for the non-fungal 5' UTR-BG constructs. Mycelial cultures of TR1 were produced by adding 6.7x10 spores to 25 ml ACMU2 + lOOx Pen/Strep (Gibco 15140) in a 250 ml non-baffled flask for a final spore concentration of approximately 2.6xl0⁶ spores/ml and incubated in an orbital shaker at 30 °C and 275 rpm for 8 hrs. The culture was then completely transferred to 400ml ACMU2 + Pen/Strep in a 2L non-baffled flask and incubated in an orbital shaker at 30°C and 275 rpm for 16 hrs. Mycelia were gently washed with 400 ml 0.5x OM using sterile Miracloth (EMD Biosciences, Gibbstown, NJ). Wet cell weight of mycelia (grams) was multiplied by 7 to determine volume (ml) of resuspension KCM:OM (2:1) solution. Washed mycelia were suspended in KCM:OM solution containing 16 mg/ml Lysing Enzymes from Trichoderma harzianum (Sigma- Aldrich, St. Louis, MO) and incubated in an orbital shaker at 30°C and 100 rpm for 90 minutes. Mycelial debris was removed from the protoplast suspension by centrifuging protoplast solution in a 50 ml conical tube (2 min, 150xg, 4°C). The resulting supernatant was transferred to a 250 ml centrifuge bottle and filled to the top with ice cold STC (1 M sorbitol; 50 mM CaCl₂; 10 mM Tris-HCl, pH 7.5), mixed and centrifuged (5 min, 3000 x g, 4°C). After discarding the supernatant, the pellet was gently suspended in 250 ml ice cold STC and centrifuged again (5 min, 3000 x g, 4°C). The resulting pellet was suspended in a 8: 1 : 1 suspension of STC : 0.2M ammonium aurintricarboxylate (Sigma-Aldrich, St. Louis, MO) : PEG buffer (60% polyethylene glycol 4000; 50 mM CaCl₂; 10 mM Tris-HCl, pH 7.5) at a concentration of approximately 5 x 10⁷ protoplasts per ml, based on hemacytometer count.

[0184] For each filamentous fungal transformation, a 200 μΐ aliquot of protoplast suspension was added to a 15 ml test tube containing 20 μΐ of PCR-amplified expression vector DNA with 5μ1 PCR-amplified hygromycin resistance marker, to provide a co-transformation of unmarked vector with marker gene. The tube was incubated on ice for 20 min. 2 ml of PEG buffer was then added and mixed thoroughly by carefully rotating the tube. After a final 5 min incubation at room temperature, 6 ml of ice cold STC was added to the tube and mixed by inversion. The sample was then centrifuged (5 min, 2500 x g, 4°C) and the resulting pellet was suspended in approximately 200 μΐ of ice cold STC. A Tris-buffered soft top agar

(lOmM Tris pH7.0 + 7.5g/L Noble Agar + 1.2M sorbitol) overlay technique was used to plate the transformation suspension onto selective media (PDA, 5mM uridine, hygromycin 50g/L,

1.2M sorbitol) plates. Plates were incubated at 30°C for 6 days.

5.6. Example 6: Expression of a β-Glucosidase Using Non-Fungal UTR Sequences and a Promoter from a Mammalian Virus

[0185] Growth conditions and media. For analysis of expression of β-glucosidase by

Trichoderma reesei transformants, individual fungal colonies displaying hygromycin resistance were inoculated into the wells of a 1ml 96-well 25μΜ filter plate containing 0.4 ml/well Vogels Medium with 8% glycerol 5% glucose (Vgly8glu5 medium). Vgly8glu5 is as follows: 2.5% sodium citrate; 5% KH₂P0₄; NH₄N0₃; 0.2% MgS0₄; 0.1% CaCl₂; 2 μ^ιηΐ biotin; 0.1% Trace Elements solution; 10% MES pH 6.0; 8% glycerol, 0.9% soytone, 5% glucose. Sixteen transformants for each vector were picked into two columns of eight in the

96-well plates, with one column of transformants from the control vector with no UTR.

Plates were incubated in an orbital shaker at 30°C and 850 rpm for 6 days. Following incubation, the fluid underneath the fungal mats was harvested and assayed for β-glucosidase activity.

[0186] β-glucosidase Assay. To assess the relative β-glucosidase activity among a collection of fungal transformants, supernatants harvested from submerged fungal cultures were first diluted 36-fold in 50 mM sodium acetate buffer, pH 5.0. Enzyme assays were performed in a clear polystyrene 96-well plate. For each sample, ten microliters of diluted supernatant was added to 90 microliters of l .lx pNP-G reaction buffer (2.3 mM 4-nitrophenyl β-D- glucopyranoside; 56 mM sodium acetate, pH 5.0) and mixed. Reactions were allowed to incubate at room temperature for precisely 3 minutes. One hundred microliters of 200 mM sodium carbonate, pH 10.0 was added to stop the reaction. Absorbance was measured at 405 nm. Data are shown for UTR Nos. 1-64 in FIGS. 4A-4F.

[0187] The activity data showed that although there was significant variation among the transformants for each of the test vectors, it was clear that some of the UTRs were functional in enabling translation of the β-glucosidase, as they led to greater β-glucosidase activity than the control that lacked a UTR. Since the experiment used a co-transformation to introduce the expression vector and marker as separate pieces of DNA, it is possible that several of the transformants among the sixteen picked for either test UTR vector or no-UTR control did not contain a copy of the expression vector. The variation in β-glucosidase among transformants could also have been caused by the presence of different numbers of copies of the expression vector that have integrated into the genome. The location of the integrated cassettes into the genome may also influence the level of expression from the cassette. Therefore, although it is clear that many of the test UTRs did function in the filamentous fungal host, the lack of expression associated with some of the other UTRs may have been due to lack of integration of a copy of the vector, and integration of only the hygromycin marker cassette.

5.7. Example 7: PCR Confirmation

[0188] PCR tests were used to determine whether each transformant contained a copy of the expression cassette, since the transformants were the product of co-transformations and negative expression data may be the result of a lack of an integrated copy.

[0189] PCR analysis of co-transformants of the expression cassette control with no UTR and the hygromycin marker is shown in Table 9, below. PCR Analysis of co-transformants from cassettes containing 84bp UTR sequences that did not lead to β-glucosidase expression is shown in Table 10, below. PCR analysis of co-transformants from expression cassettes containing 84bp UTRs that led to β -glucosidase expression is shown in Table 11, below.

None Colony 30 . -

[0190] The co-transformants from transformations including the control expression cassette lacking a UTR were found to contain the expression cassette in approximately half the transformants (14 out of 30 tested). See Table 9, showing that the lack of a UTR prevented expression of the β-glucosidase. The co-transformants for expression cassettes containing 84bp UTRs that did not appear to lead to beta-glucosidase activity for the most part contained the expression cassette (15 out of 16 tested)— see Table 10. However, lack of activity from these constructs does not necessarily mean that those UTRs are ineffective in a fungal host. It is well known in the art that different lengths of UTR sequences can dramatically affect the performance of the UTR in promoting translation efficiency; hence while positive results show activity of a UTR sequence, negative results may mean that the length of UTR simply needs to be optimized. Selected co-transformants that had produced significant beta- glucosidase activity all contained the expression cassette, showing that β-glucosidase activity depended on the presence of the added expression cassette (see Table 1 1).

[0191] All publications, patents, patent applications and other documents cited in this application are hereby incorporated by reference in their entireties for all purposes to the same extent as if each individual publication, patent, patent application or other document were individually indicated to be incorporated by reference for all purposes.

[0192] While various specific embodiments have been illustrated and described, it will be appreciated that various changes can be made without departing from the spirit and scope of the invention(s).

Claims

WHAT IS CLAIMED IS:

1. A nucleic acid comprising an expression cassette, said expression cassette comprising, operably linked in a 5' to 3' direction:

(a) a promoter operable in filamentous fungi;

(b) a non- fungal 5' untranslated region ("5' UTR") operable in filamentous fungi;

(c) a first polypeptide coding sequence comprising a start codon and a stop codon; and

(d) a 3 ' untranslated region ("3 ' UTR").

2. The nucleic acid of claim 1, wherein the 5' UTR is from a non- fungal homolog of a highly expressed fungal gene that is conserved between fungi and non-fungi.

3. The nucleic acid of claim 2, wherein the 5' UTR is from a non- fungal homolog of a highly expressed Trichoderma reesei gene.

4. The nucleic acid of claim 3, wherein the Trichoderma reesei gene is an Elongation Factor Tu; Hsp70; WD40; Glyceraldehyde 3 -phosphate dehydrogenase; Thioredoxin; ATP synthase; Actin; Calreticulin; E1-E2 ATPase; Thiamine pyrophosphate enzyme; Elongation Factor 5 A; Ubiquitin; Ribosomal Protein S3 A; Thi4; Thi5; Histone; Hsp90; NAD(P) Transhydrogenase; Glutamine Synthetase; Aconitase; Elongation Factor 1 ; Ribosomal Protein S13/S18; RRMl ; Ubiquitin; Thioredoxin; ATPase; or Acetohydroxy acid isomeroreductase gene.

5. The nucleic acid of any one of claims 2 to 4, wherein the non-fungal homolog is from a species of phylum Euglenozoa, Percolozoa, Loukozoa, Metamonada, Cercozoa, Heterokontophyta, Haptophyta, Cryptophyta, Alveolata, Apicomplexa, Chromerida, Ciliophora, Dinoflagellata, Retaria, Foraminifera, or Radiolaria.

6. The nucleic acid of any one of claims 2 to 5, wherein the non-fungal homolog is from Dictyostelium purpureum, Daphnia pulex, Ostreococcus RCC809, Aureococcus anophagefferens, or Arabidopsis lyrata.

7. The nucleic acid of claim 1, wherein the 5' UTR comprises a nucleotide sequence having at least 70% sequence identity to any one of SEQ ID NOS:4-67.

8. The nucleic acid of claim 7, wherein the 5' UTR comprises a nucleotide sequence having at least 75% sequence identity to any one of SEQ ID NOS:4-67.

9. The nucleic acid of claim 8, wherein the 5' UTR comprises a nucleotide sequence having at least 80% sequence identity to any one of SEQ ID NOS:4-67.

10. The nucleic acid of claim 9, wherein the 5' UTR comprises a nucleotide sequence having at least 85% sequence identity to any one of SEQ ID NOS:4-67.

11. The nucleic acid of claim 10, wherein the 5' UTR comprises a nucleotide sequence having at least 90% sequence identity to any one of SEQ ID NOS:4-67.

12. The nucleic acid of claim 11, wherein the 5' UTR comprises a nucleotide sequence having at least 95% sequence identity to any one of SEQ ID NOS:4-67.

13. The nucleic acid of claim 12, wherein the 5' UTR comprises the nucleotide sequence of any one of SEQ ID NOS:4-67.

14. The nucleic acid of any one of claims 1 to 13, wherein the 5' UTR is at least 30 nucleotides in length.

15. The nucleic acid of claim 14 wherein the 5' UTR is 30 to 500 nucleotides in length.

16. The nucleic acid of claim 14 or claim 15, wherein the 5' UTR is at least 50 nucleotides in length.

17. The nucleic acid of claim 14 or claim 15, wherein the 5' UTR is at least 75 nucleotides in length.

18. The nucleic acid of claim 14 or claim 15, wherein the 5' UTR is at least 100 nucleotides in length.

19. The nucleic acid of any one of claims 1 to 18, wherein the 3' UTR comprises a polyadenylation signal.

20. The nucleic acid of any one of claims 1 to 18, which further comprises between the first polypeptide coding sequence and the 3 ' UTR an internal ribosome entry site ("IRES") and a second polypeptide coding sequence.

21. The nucleic acid of any one of claims 1 to 20, wherein the first polypeptide is a filamentous fungal polypeptide.

22. The nucleic acid of claim 21, wherein the first polypeptide is a Trichoderma reesei polypeptide.

23. The nucleic acid of any one of claims 1 to 20, wherein the first polypeptide is a yeast, mammalian or bacterial polypeptide.

24. The nucleic acid of any one of claims 1 to 23, wherein the first polypeptide comprises a signal sequence.

25. The nucleic acid of any one of claims 1 to 23, wherein the first polypeptide is a β-glucosidase.

26. The nucleic acid of claim 24, wherein the β-glucosidase comprises the amino acid sequence of SEQ ID NO:3.

27. The nucleic acid of any one of claims 1 to 26, wherein the promoter is a mammalian viral promoter.

28. The nucleic acid of claim 25, wherein the mammalian viral promoter is is a Rous sarcoma virus (RSV) long terminal repeat (LTR) promoter, a cytomegalovirus immediate early gene (CMV) promoter, a simian virus early (SV40) promoter, or an adenovirus major late promoter.

29. The nucleic acid of claim 26, wherein the promoter is not an SV40 promoter.

30. The nucleic acid of claim 26, wherein the mammalian viral promoter is a CMV promoter.

31. The nucleic acid of any one of claims 1 to 26, wherein the promoter is a plant viral promoter.

32. The nucleic acid of claim 31, wherein the plant viral promoter is a cauliflower mosaic virus (CaMV) promoter, a Commelina yellow mottle virus ("CoYMV") promoter, a Figwort Mosaic Virus (FMV) promoter, or a cassava vein mosaic virus (CsVMV) promoter.

33. The nucleic acid of claim 31, wherein the plant viral promoter is a CaMV 35S promoter.

34. The nucleic acid of claim 31, wherein the plant viral promoter is a CoYMV promoter.

35. The nucleic acid of any one of claims 1 to 26, wherein the promoter is a fungal promoter.

36. The nucleic acid of claim 34, wherein the promoter is obtained from a gene selected from: Aspergillus oryzae TAKA amylase, Rhizomucor miehei aspartic proteinase, Aspergillus niger neutral alpha-amylase, Aspergillus niger acid stable alpha- amylase, Aspergillus nigeror Aspergillus awamori glucoamylase (glciA), Rhizomucor miehei lipase, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase, Aspergillus nidulans acetamidase, Fusarium ve«e«atwmamyloglucosidase, Fusarium venenatum Daria, Fusarium venenatum Quinn, Fusarium oxysporum trypsin-like protease, Trichoderma reesei β-glucosidase, Trichoderma reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II, Trichoderma reesei endoglucanase I, Trichoderma reesei endoglucanase II, Trichoderma reesei endoglucanase III, Trichoderma reesei endoglucanase IV, Trichoderma reesei endoglucanase V, Trichoderma reesei xylanase I, Trichoderma reesei xylanase II, Trichoderma reesei β-xylosidase, and NA2-tpi.

37. The nucleic acid of any one of claims 1 to 26, wherein the promoter is a viral promoter selected from the long terminal repeat promoter of the Moloney murine leukemia virus, the long terminal repeat promoter of the Rous sarcoma virus (RSV), and the adenoviral El A promoter.

38. The vector comprising the nucleic acid of any one of claims 1 to 37.

39. The vector of claim 38 which comprises an origin of replication.

40. The vector of claim 38 or claim 39 which comprises a selectable marker.

41. The vector of claim 40, wherein the selectable marker is an antibiotic resistance gene or an auxotrophic marker.

42. A filamentous fungal cell comprising a recombinant expression cassette, said expression cassette comprising:

(a) promoter operable in filamentous fungi;

b) non- fungal 5' untranslated region ("5' UTR") operable a first polypeptide coding sequence comprising a start codon and a stop

a 3' untranslated region ("3' UTR").

43. The filamentous fungal cell of claim 42 in which the expression cassette is according to any one of claim 1 to 37.

44. The filamentous fungal cell of claim 42 or claim 43 which is a species of Acremonium, Aspergillus, Emericella, Fusarium, Humicola, Mucor, Myceliophthora, Neurospora, Penicillium, Scytalidium, Thielavia, Chrysosporium, Phanerochaete, Tolypocladium, or Trichoderma.

45. The filamentous fungal cell of claim 44 which is of the species Aspergillus awamori, Aspergillus fumigatus, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Chrysosporium lucknowense, Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, Fusarium venenatum, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Neurospora intermedia, Penicillium purpurogenum, Penicillium canescens, Penicillium solitum, Penicillium funiculosum, Phanerochaete chrysosporium, Phlebia radiate, Pleurotus eryngii, Thielavia terrestris, Trichoderma harzianum, Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride.

46. The filamentous fungal cell of any one of claims 42 to 45, wherein the first protein is a cellulase, a hemicellulase or an accessory protein.

47. The filamentous fungal cell of claim 42, wherein the cellulase, hemicellulase or accessory protein comprises a signal sequence.

48. The filamentous fungal cell of any one of claims 42 to 45, wherein the first protein comprises a signal sequence.

49. A method for producing a recombinant polypeptide, comprising culturing the filamentous fungal cell of any one of claims 42 to 48 under conditions that result in expression of the first polypeptide.

50. The method of claim 49, further comprising recovering the first polypeptide.

51. The method of claim 50, further comprising purifying the first polypeptide.

52. A method for producing a secreted polypeptide, comprising culturing the filamentous fungal cell of claim 42 or claim 43 under conditions that result in expression and secretion of the first polypeptide.

53. The method of claim 52, further recovering the first polypeptide.

54. The method of claim 53, wherein the first polypeptide is recovered from the culture medium.

55. The method of claim 54, further comprising purifying the first polypeptide.

56. A method for producing a cellulase composition, comprising culturing the filamentous fungal cell of claim 42 under conditions that result in expression of the first protein.

57. The method of claim 56, further comprising recovering a cellulase composition.

58. The method of claim 57, wherein the cellulase composition is a fermentation broth in which the filamentous fungal cells are cultured.

59. A method for saccharifying biomass, comprising:

(a) producing a cellulase composition by the method of any one of claims

56 to 58; (b) treating biomass with said cellulase composition, thereby saccharifying said biomass.

60. The method of claim 59, further comprising recovering fermentable sugars from said saccharified biomass.

61. The method of claim 60, wherein the fermentable sugars comprise disaccharides.

62. The method of claim 60 or 61, wherein the fermentable sugars comprise monosaccharides.

63. The method of any one of claims 59 to 62, wherein said biomass is corn, corn fiber, corn grain, corn cobs, crop residues such as corn husks, corn stover, seeds, grains, tubers, plant waste or byproducts of food processing or industrial processing, grasses, wood, paper, pulp, recycled paper, potatoes, soybean, barley, rye, oats, wheat, beets, sugar cane bagasse, poplars, willows, miscanthus, sorghum, alfalfa, prairie bluestream, bagasses, sorghum, giant reed, elephant grass, Japanese cedar, wheat straw, switchgrass, hardwood pulp, softwood pulp, crushed sugar cane, energy cane, Napier grass, or rice straw.

64. The method of any one of claims 59 to 63, further comprising, prior to step (b), pretreating the biomass.

65. A method for producing a fermentation product, comprising:

(a) producing a cellulase composition by the method of any one of claims

56 to 58;

(b) treating biomass with said cellulase composition, thereby producing fermentable sugars; and

(c) culturing a fermenting microorganism in the presence of the fermentable sugars produced in step (b) under fermentation conditions, thereby producing a fermentation product.

66. The method of claim 65, wherein said fermentable sugars comprise disaccharides.

67. The method of claim 65 or 66, wherein the fermentable sugars comprise monosaccharides.

68. The method of claim 65, wherein the fermentation product is ethanol.

69. The method of claim 50, wherein the fermentation product is butanol.

70. The method of claim 50, wherein the fermentation product is a biochemical.

71. The method of any one of claims 65 to 70, further comprising, prior to step (b), pretreating the biomass.

72. The method of anye one of claims 65 to 71, wherein said fermenting microorganism is a bacterium or a yeast.

73. The method of claim 72, wherein said fermenting microorganism is a yeast selected from Escherichia, Zymomonas, Saccharomyces, Candida, Pichia, Streptomyces, Bacillus, Schizosaccharomyces, Dekkera, Bretanomyces, Kluyveromyces, Issatchenkia, Hansenula, Pachysolen, Torulaspora, Zygosaccharomyces, Yarrowia, Lactobacillus, and Clostridium.

74. The method of any one of claims 65 to 73, wherein said biomass is corn stover, corn fiber, bagasse, sorghum, giant reed, elephant grass, miscanthus, Japanese cedar, wheat straw, switchgrass, hardwood pulp, softwood pulp, crushed sugar cane, energy cane, Napier grass, or rice straw.