WO2015147616A1 - Composition for preventing, inhibiting, or treating neuritis, containing peptide or protein including rgd motif - Google Patents

Composition for preventing, inhibiting, or treating neuritis, containing peptide or protein including rgd motif Download PDF

Info

Publication number
WO2015147616A1
WO2015147616A1 PCT/KR2015/003122 KR2015003122W WO2015147616A1 WO 2015147616 A1 WO2015147616 A1 WO 2015147616A1 KR 2015003122 W KR2015003122 W KR 2015003122W WO 2015147616 A1 WO2015147616 A1 WO 2015147616A1
Authority
WO
WIPO (PCT)
Prior art keywords
saxatilin
peptide
rgd motif
composition
immunoglobulin
Prior art date
Application number
PCT/KR2015/003122
Other languages
French (fr)
Korean (ko)
Inventor
홍성유
허지회
권일
장양수
김동익
Original Assignee
연세대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 연세대학교 산학협력단 filed Critical 연세대학교 산학협력단
Publication of WO2015147616A1 publication Critical patent/WO2015147616A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/06—Tripeptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/30—Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto

Definitions

  • composition for preventing, inhibiting or treating neuroinflammatory diseases comprising a peptide or protein comprising an RGD motif
  • the present invention was made by the task number 1355062273 under the support of the Ministry of Health and Welfare of the Republic of Korea, the research management specialized agency of the task is the Korea Health Industry Chongjinwon, the research project name is “lead-type specialized research and development project", the research title is “lead-type brain Cardiovascular Disease Convergence Research Group ", the lead institution is Yonsei University Industry-Academic Cooperation Group, and the research period is from Dec. 01 to Dec.
  • This patent application claims priority to Korean Patent Application No. 10-2014-0037128 filed with the Korea Patent Office on March 28, 2014, the disclosure of which is incorporated herein by reference.
  • the present invention relates to a composition for preventing, inhibiting or treating neuroinflammatory diseases comprising a peptide or protein comprising an RGD motif.
  • the nervous system consists of neurons (neuronal eel Is) and glial cells (glia eel Is), of which glial cells account for 90% of all brain cells and 50% of the brain by volume. .
  • Glial cells of the central nervous system are divided into astrocytes, oligogondrocytes, and microglia.
  • microglia are inflammatory cells of the nervous system, which account for 5 to 10% of all brain cells. Its role in the brain is not well known, but it is activated when brain injury occurs due to various causes such as trauma, degenerative brain disease, and stroke (Minghetti L, et al. , Prog. Neurobio.I. 54 (1), PP99-125, 1998).
  • microglial cells unlike normal state, are active in phagocytosis and proliferate, and have various cytokines, inducible nitric oxide synthase (iNOS) and cyclooxygenase-2 ( cycIooxygenase-2, C0X-2)
  • Saxatilin a novel disintegrin purified and cloned from Korean snake venom, has a tripeptide sequence Arg-Gly-Asp (RGD), which is a site of recognition of disintegrins for platelet GPIIb / IIIa receptors. recognition site) (Hong, Koh et al., 2002; and Hong, Sohn et al., 2002).
  • Saxatilin is known to have a potent inhibitory effect on platelet aggregation (Hong, Koh et al., 2002) and platelet activation (Jang, Jeon et al., 2007), thus preventing thrombus generation.
  • many papers and patent documents are referenced and their citations are indicated. The disclosures of cited papers and patent documents are incorporated herein by reference in their entirety, and the level of the technical field to which the present invention belongs and the contents of the present invention are more clearly explained.
  • the present inventors have sought to develop a composition capable of inhibiting neuroinflammatory inflammation induced by ischemic injury.
  • the present invention was completed by confirming that the peptide or protein containing the RGD motif known as thrombolytic agent has an activity of effectively inhibiting neuroinflammatory inflammation.
  • a pharmaceutical composition comprising (a) a pharmaceutically effective amount of a peptide or protein comprising an RGD motif; (b) It provides a pharmaceutical composition for preventing, inhibiting or treating neuroinflammatory inflammation comprising a pharmaceutically acceptable carrier.
  • the present inventors have sought to develop a composition capable of inhibiting neuroinflammatory inflammation induced by ischemic injury. As a result, it was confirmed that the peptide or protein containing the RGD motif, known as thrombolytic, has the effect of effectively inhibiting neuro-inflammatory.
  • the "peptide or protein comprising the RGD motif" of the present invention is a concept encompassing amino acid-based molecules capable of binding to integrin ⁇ ⁇ ⁇ 2 and
  • Peptides or proteins containing the RGD motif used as an active ingredient of the composition for the prevention, inhibition or treatment of neuritis of the present invention is bound to integrin ⁇ ⁇ ⁇ 2 and ⁇ ⁇ 2 present in the neutrophils and endothelial cell ICAM- Klntercellular Adhesion It inhibits the interaction with Molecule 1), which in turn inhibits neuroinflammatory inflammation induced by ischemic injury.
  • the peptide or protein comprising the RGD motif is a saxatilin or an analog thereof of SEQ ID NO: 1
  • the analogue of saxatilin is the activity of saxatilin analogues (ie, deletion mutants) saxatilin, ie neutrophils, based on the amino acid sequence of saxatilin (SEQ ID NO: 1) ICAM-1 (Intercellular) of Endothelial Cells Binding to Integrin ⁇ ⁇ ⁇ 2 and
  • the saxatilin of the present invention is a saxatilin conjugated with an immunoglobulin (iiranunoglobulin).
  • the saxatilin is a saxatilin conjugated to the Fc region of an immunoglobulin.
  • peptide refers to a linear molecule formed by binding amino acid groups to each other by peptide bonds.
  • Peptides of the invention can be prepared according to chemical synthesis methods known in the art, in particular sol id-phase synthesis techniques (Merrifield, J. Amer. Chem. Soc. 85: 2149-54) 1963); Stewart, et al. Solid Phase Peptide Synthesis, 2nd.ed., Pierce Chem. Co .: Rockford, 111 (1984)).
  • the peptide of the present invention is superior in stability to natural saxatilin by itself, but may be further improved by modification of amino acids.
  • the C-terminus of the peptide may be modified with a hydroxy group (-0H) or an amino group (-NH2), and the N-terminus of the peptide is an acetyl group, a fluorenyl methoxy carbonyl group, A protecting group selected from the group consisting of formyl group palmitoyl group, myristyl group, stearyl group and polyethylene glycol (PEG) may be bonded.
  • Modification of the above-mentioned amino acid serves to greatly improve the stability of the peptide of the present invention.
  • the term "stability” means not only in vivo stability but also storage stability (e.g., phase is storage stability).
  • the above protecting groups serve to protect the peptides of the present invention from the attack of protein cleavage enzymes in vivo.
  • the immunoglobulin conjugation can be carried out tailor-made at the nucleotide / gene level by recombinant techniques known in the art.
  • Nucleotide sequences encoding immunoglobulins are known and can be obtained, for example, from genomic databases (http://www.ncbi.nlm.nih.gov/genome).
  • the nucleotide sequence of saxatilin is also known,
  • a suitable cell can be selected to express the polypeptide encoded by the plasmid. For example, CH0 cells, NS0 cells, Sp2 / 0 cells, COS
  • HEK cells HEK cells, K562 cells, BHK cells, or PER. C6 cells; may be selected]. Regulatory elements of the expression vector may be functionally selected depending on the cell selected.
  • Host cells comprising an expression vector encoding the above chain of immunoglobulin conjugates can be cultured under conditions suitable for expression of ⁇ globulin. Immunoglobulins expressed from j cells are functionally assembled. From secreted immunoglobulin conjugates.
  • immunoglobulin conjugates of the invention are conjugated with a minimum] immunoglobulin at the end of the peptide.
  • the Fc region of the immunoglobulin is conjugated to the N-terminus or C-terminus of the i-rin.
  • said saxatilin is an Fc-saxatilin with the inverse of the immunoglobulin conjugated to its N-terminus.
  • a peptide or protein comprising an RGD motif "effective amount of the invention;
  • a pharmaceutical containing a pharmaceutically acceptable carrier will be inhibitory or preventative treatment, neuroinflammation.
  • the neuro-inflammatory is neuro-inflammation associated with stroke, cerebral infarction, i, brain embolism or cerebral ischemia.
  • Peptides or proteins comprising the RGD motif of the invention have Jtegrin activity.
  • the disintegrins are saxatilin, rhodostomin, albolabrin, aflagin, applagin, basil icin, batroxostatin, and bitistatin babulin (barbourin), cereberin, cerastin, crotatroxin, durissin, echistatin elegantin, eristicophin flavoridine (flavoridin), flavostatin (f lavostat in), halysin, jararacin, jarastatin, jararin, lachesin, lutosin, molosin ( mo! ossin, salmosin tergeminin, trigramin trimestatin, trimuctrin in trimutase, ussuristatin ) And viridin.
  • Peptides or proteins comprising the RGD motif of the invention bind to integrin ⁇ ⁇ ⁇ 2 present in neutrophils.
  • the peptide or protein comprising the RGD motif has a Kd (dissociation constant) value of 1 X 1 to 8 X 1 to 10 M with respect to integrin ip2 present in the neutrophil. Has a bonding force.
  • Peptides or proteins comprising the RGD motif of the invention bind to integrin ai 3 2 present in neutrophils.
  • the peptide or protein comprising the RGD motif has a binding capacity of the KcKdissociation constant value of 1 X K 8 8 to 1 X 10 10 ⁇ to integrin ⁇ _ ⁇ 2 present in the neutrophil.
  • Peptides or proteins comprising the RGD motif of the invention bind to the integrins of platelets and ectopic bulbs.
  • the peptide or protein comprising the RGD motif has the ability to bind to GPIIb / IIIa of platelets, integrin ⁇ ⁇ ⁇ 2 and p2 present in neutrophils.
  • Peptides or proteins comprising the RGD motif of the present invention is conventionally
  • a pharmaceutical composition comprising a pharmaceutically effective amount of a peptide or protein comprising the RGD motif of the invention and a pharmaceutically acceptable carrier may be administered to a patient whose blood vessels are occluded simultaneously with neuroinflammatory.
  • the pharmaceutical composition of the present invention includes a pharmaceutically acceptable carrier.
  • Pharmaceutically acceptable carriers included in the pharmaceutical compositions of the present invention are those commonly used in the preparation, such as lactose, dextrose, sucrose, sorbol, mannitol, starch, acacia rubber, calcium phosphate, alginate, Gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyridone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil Including, but not limited to.
  • the pharmaceutical composition of the present invention may further include a lubricant, a humectant, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, and the like.
  • a lubricant e.g., talc, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, a kaolin, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, mannitol, mannitol, mannitol, mannitol, mannitol, mannitol, mannitol, mannitol, mannitol, mann
  • the pharmaceutical composition of the present invention may be administered orally or parenterally.
  • Suitable dosages of the pharmaceutical compositions of the present invention may be prescribed in various ways depending on factors such as the formulation method, mode of administration, age, weight, sex, morbidity, food, time of administration, route of administration, rate of excretion and response to the patient. Can be.
  • Typical dosages of the pharmaceutical compositions of the invention are in the range of 0.001-100 nig / kg on an adult basis.
  • compositions of the present invention may be prepared in unit dose form by formulating with a pharmaceutically acceptable carrier and / or excipient according to methods which can be easily carried out by those skilled in the art. Or may be prepared by incorporation into a multi-dose container.
  • the formulation may be in the form of solutions, suspensions, syrups or emulsions in oils or aqueous media or in the form of extracts, powders, granules, tablets or capsules, and may further comprise dispersants or stabilizers.
  • the present invention provides a pharmaceutical composition for preventing, inhibiting or treating neuro-inflammatory diseases comprising a pharmaceutically effective amount of a peptide or protein comprising an RGD motif and a pharmaceutically acceptable carrier.
  • the present invention confirms the neuroinflammatory relieving effect of saxatilin and its analogues, thereby enabling the development of stroke therapeutics with dual functions with thrombolytic efficacy.
  • FIG. 1 is a diagram showing the structure of a saxatilin derivative cloned at the multicloning position of a pYK603 vector and a pYK602 vector, respectively. Distances between components or distances between restriction sites are not shown in proportions.
  • 'l eader' is the leader sequence; Immunoglobulin G2a Gamma Chain. .
  • Figure 2 is a Western blotting result confirming the expression of the saxatilin derivatives of the present invention.
  • the purified protein was centrifuged at 5,000 rpm for 10 minutes to investigate the presence of precipitate (lane 2 and lane 4).
  • the saxatilin derivative of the present invention was very stable (no precipitate formed).
  • 3A and 3B show the results of purification of Fc-saxatilin and saxatilin-Fc, respectively. Arrows indicate purified Fc-saxatilin and saxatilin-Fc.
  • PMA is phorbol 12-myr state 13-acetate and the fMLP is N-f rmyl-Met-Leu-Phe.
  • 5a and 5b show the results of confirming the integrin binding of saxatilin -Fc and Fc-saxatilin, respectively.
  • FIG. 7 shows the results of comparing Cc saxatilin's cerebral infarction effect parametrically (left graph) and nonparametrically (right graph).
  • 'Fc-Sax' is Fc-
  • Figure 9 shows the result of comparing the neurological disorders of the control group and Fc-saxatilin administration group.
  • Figure 10 shows the results of analyzing the neutrophil infiltration amount in the brain tissue of the control group and Fc-saxatilin administration group (including outlier).
  • Recombinant vectors comprising the above-described Fc-saxatilin or saxatilin-Fc were each expressed in PEHpolyethylen nine in 292E cells; Polysciences) was used for transfection. After transfection, supernatants were harvested on day 2 or 5 of the cell culture, followed by SDS-PAGE, transferred to NC membrane (M Hpore), and the secondary antibody, anti-HuFc-HRP (l: 2000). attenuation;
  • NC membrane was washed three times with PBS / T and then subjected to western blotting by developing the film with ECL solution (FIG. 2).
  • the Agilent 2100 bioanalyzer is an analytical instrument based on a lab-on-a-chip technology that automatically analyzes the size and concentration of proteins simultaneously. The results of the analysis can be confirmed in two forms (electrophorograms such as gel-electrophoresis images and chromatography) by performing the separation and detection pre-process simultaneously.
  • Saxatilin recombinant. Saxati Un
  • BSA Bovine Serum Albumin
  • FITCC Fluorescein isothiocyanate As the saxatilin used in this example, a recombinant saxatilin protein isolated and purified according to the method described in Korean Patent Laid-Open Publication No. 2002-0064787 was used, and its amino acid sequence is shown in SEQ ID NO: 1. Blood was collected from rats (8 weeks old, males) and placed in a sodium citrate tube and mixed to prevent blood from lumping.
  • the PMA is phorbol 12-myri state 13-acetate and the fMLP is N-formy '"Met-Leu' Phe.
  • RBC Red Blood Cell
  • Each integrin (a nb
  • the sample solution was loaded into each well in triplicates of 100 and reacted for 2 hours at phase silver. After reaction, the reaction was washed three times with PBS-T. Anti-human IgG (Fc) conjugated HRP antibody was diluted 1: 2 ⁇ 000 and added to each well 100 ⁇ and reacted for 1 hour at room temperature. The reaction was washed four times with PBS-T. After adding TMB solution and reacting for 30 minutes at room temperature, the reaction was terminated by adding a stop solution (0.5 MH 2 S0 4 ) and measuring the hop intensity at 450 ran to determine the interaction between neutrophils and endothelial cells. Integrin and saxatilin involved in binding.
  • mice Female ICR mice (32-34g) were used to induce a cerebral ischemic injury by modifying the previously reported method of middle cerebral artery occlusion using Nilesa.
  • the experimental animals were supplied with water only for about 12 hours before surgery, and were free to consume water and feed after surgery.
  • Inject anesthesia gas N20 and 02 in a ratio of 7: 3 to N20 and 02 with i sof lurane at 5%).
  • the patient was operated while maintaining anesthesia with 2% anesthetic gas through a face mask.
  • the body temperature was maintained at 37.0 ⁇ 0.5 ° C by inserting a rectal thermometer into the rectum and using a thermostat and thin pad.
  • the cervical section of the anesthetized mouse was incised to expose the left carotid artery, the vagus nerve, etc. were isolated, and the total carotid artery was ligated using 5/0 silk suture.
  • the external carotid artery was ligated and the branches of the internal and external carotid arteries were ligated or electrocauterized.
  • the internal carotid artery was temporarily ligated using a vascular clamp, and then a small window was opened at the base of the carotid artery and a standardized nile thread was inserted according to the weight of the mouse.
  • the cerebral artery occlusion was performed by releasing the blood vessel clamp and pushing the nylon yarn until the resistance was felt from the total carotid artery branch.
  • the nylon yarn remaining outside the blood vessel and the internal carotid artery were tightly ligated together, and the sutured skin was closed using a silk suture. After 1 hour, remove the nylon thread that you blocked until you feel resistance, and then cut the remaining end with scissors to restore blood flow.
  • the experimental animals were regenerated after 23 hours.
  • Zol et il® and rompun were combined and anesthetized by intraperitoneal injection, followed by an open chest to expose the heart.
  • the right atrium was dissected and the left ventricle was sacrificed by perfusion of cold saline mixed with heparin using a peristaltic pump. After perfusion, the head was removed, and then the skull was quickly removed and the brain removed.
  • the extracted brain was cut into five sections from the frontal region to the coronal plane using a cutting frame, and the first one from the front was cut 3 mm thick and the rest were cut at 2 1 intervals.
  • the first, third and fifth sections thus obtained were rapidly frozen and stored in -80 ° C. cryogenic freezer, and the second and fourth sections were fixed in 4% paraformaldehyde to prepare paraffin blocks.
  • Integrins ⁇ 2 and ⁇ 2 are integrins present in neutrophils, which interact with ICAM-1 (Intercellular Adhesion Molecule 1) present in endothelial cells to collect neutrophils in endothelial cells.
  • ICAM-1 Intercellular Adhesion Molecule 1
  • the cerebral infarct size of the Fc-saxatilin-administered group was about 31% when compared parametrically and about 49% when compared non-parametrically. This means that Fc-saxatilin has the effect of reducing cerebral infarct size (FIG. 7).
  • the degree of neurological disorder did not show a significant difference between the Fc—saxatilin administration group and the control group (FIG. 9).
  • the number of deaths was 6 of 18 Fc ⁇ saxatilin-treated groups and 4 of 16 controls. Of these, 4 of the Fc-saxatilin-treated groups and 2 of the controls were anesthetized by prolonged MRI. There was no difference in mortality between the Fc-saxatilin-treated and control groups (Table 5).
  • Fc-saxatilin cerebral infarction To determine whether the effect of reducing Fc-saxatilin cerebral infarction is due to anti-inflammatory effects, the amount of neutrophil infiltration in brain tissue was quantitatively analyzed (FIG. 10). Compared to the control group, the Fc-saxatilin-administered group had significantly lower neutrophil infiltration in the cerebral infarction hemisphere. As a result, Fc-saxatilin inhibits the penetration of immune cells into the brain tissue that occurs during cerebral infarction.
  • Saxatilin binds to integrins on the surface of neutrophils and inhibits interaction with endothelial cells, thereby inhibiting neuroinflammatory inflammation induced by ischemic injury.
  • Fc-saxatilin can inhibit the inflammatory response by inhibiting the penetration of immune cells into brain tissue.

Abstract

The present invention relates to a composition for preventing, inhibiting, or treating neuritis, containing a peptide or protein including the RGD motif and, specifically, to a pharmaceutical composition for preventing, inhibiting, or treating neuritis, containing: (a) a pharmaceutically effective amount of a peptide or a protein including the RGD motif; and (b) a pharmaceutically acceptable carrier. The present invention confirms a neuritis-relieving effect of saxatilin and analogs thereof, thereby allowing for the development of a therapeutic agent for stroke, having dual functions including a thrombolytic efficacy.

Description

【명세서】  【Specification】
【발명의 명칭】  [Name of invention]
RGD 모티프를 포함하는 펩타이드 또는 단백질을 포함하는 신경염증 예방, 억제 또는 치료용 조성물  A composition for preventing, inhibiting or treating neuroinflammatory diseases comprising a peptide or protein comprising an RGD motif
【기술 분야】 [Technical field]
본 발명은 대한민국 보건복지부의 지원 하에서 과제번호 1355062273에 의해 이루어진 것으로서, 상기 과제의 연구관리전문기관은 한국보건산업진홍원, 연구사업명은 "선도형특성화연구개발사업" , 연구과제명은 "선도형 뇌심혈관질환 융합연구사업단" , 주관기관은 연세대학교 산학협력단, 연구기간은 2013. 12. 01 ~ 2014. 11. 30 이다. 본 특허출원은 2014년 03월 28일에 대한먼국 특허청에 제출된 대한민국 특허출원 제 10-2014-0037128 호에 대하여 우선권을 주장하며， 상기 특허출원의 개시 사항은 본 명세서에 참조로서 삽입된다.  The present invention was made by the task number 1355062273 under the support of the Ministry of Health and Welfare of the Republic of Korea, the research management specialized agency of the task is the Korea Health Industry Chongjinwon, the research project name is "lead-type specialized research and development project", the research title is "lead-type brain Cardiovascular Disease Convergence Research Group ", the lead institution is Yonsei University Industry-Academic Cooperation Group, and the research period is from Dec. 01 to Dec. This patent application claims priority to Korean Patent Application No. 10-2014-0037128 filed with the Korea Patent Office on March 28, 2014, the disclosure of which is incorporated herein by reference.
본 발명은 RGD 모티프를 포함하는 펩타이드 또는 단백질을 포함하는 신경염증 예방, 억제 또는 치료용 조성물에 관한 것이다.  The present invention relates to a composition for preventing, inhibiting or treating neuroinflammatory diseases comprising a peptide or protein comprising an RGD motif.
【배경 기술】 [Background technology]
신경계는 신경세포 (neuronal eel Is)와 신경교세포 (glia eel Is)로 구성되어 있으며, 그 중 신경교세포는 수적으로 전체 뇌 세포의 90%를 차지하고 있고, 부피로는 뇌 전체의 50%를 차지하고 있다. 중추신경계의 신경교세포는 성상세포 (astrocyte), 희소돌기교세포 (ol igodemdrocyte) 및 소교세포 (microglia)로 구분되며, 이중 소교세포는 전체 뇌세포의 5 내지 10%를 차지하는 신경계의 염증세포로서 정상상태의 뇌에서의 그 역할은 아직 잘 알려져 있지 않으나 외상, 퇴행성 뇌질환， 뇌졸중 등 여러 가지 원인에 의해 뇌손상이 발생시 활성화되어 대식세포 (macrophage)와 유사한 면역작용을 담당한다 (Minghetti L, et al., Prog. Neurobio. I. 54(1), PP99-125, 1998). 활성화된 소교세포는 정상상태와 달리 포식작용 (phagocytosis)이 활발해지고 세포증식을 하며 각종 사이토카인 (cytokine), 유도형 산화질소 생성효소 ( inducible nitric oxide synthase, iNOS) 및 사이클로옥시게나제— 2(cycIooxygenase-2, C0X-2) 등의  The nervous system consists of neurons (neuronal eel Is) and glial cells (glia eel Is), of which glial cells account for 90% of all brain cells and 50% of the brain by volume. . Glial cells of the central nervous system are divided into astrocytes, oligogondrocytes, and microglia. Among these, microglia are inflammatory cells of the nervous system, which account for 5 to 10% of all brain cells. Its role in the brain is not well known, but it is activated when brain injury occurs due to various causes such as trauma, degenerative brain disease, and stroke (Minghetti L, et al. , Prog. Neurobio.I. 54 (1), PP99-125, 1998). Activated microglial cells, unlike normal state, are active in phagocytosis and proliferate, and have various cytokines, inducible nitric oxide synthase (iNOS) and cyclooxygenase-2 ( cycIooxygenase-2, C0X-2)
대체용지 (규칙 제 26조) 유전자를 발현시켜 각종 염증매개 물질올 생산한다 (Dawson VL, et al. , J. Neurosci. , 13, pp2641-2661, 1993). 이와 같은 경로로 생산된 염증매개 물질이 알츠하이머병 (Alzheimer's disease), 파킨슨병 (Parkinson' s disease), 뇌졸중 및 치매 같은 퇴행성 뇌질환이 원인이 된다는 많은 증거가 제시되고 있다 (Wood PL, et al., Neurol. Res., 17, pp242-248, 1995) . Alternative Site (Article 26) Genes are expressed to produce a variety of inflammatory mediators (Dawson VL, et al., J. Neurosci., 13, pp2641-2661, 1993). There is much evidence that inflammatory mediators produced by this pathway are caused by degenerative brain diseases such as Alzheimer's disease, Parkinson's disease, stroke and dementia (Wood PL, et al. , Neurol. Res., 17, pp 242-248, 1995).
한국 뱀독으로부터 정제되고 클로닝된 신규한 디스인테그린인 삭사틸린 (Saxatilin)은 트리펩타이드 서열인 Arg-Gly-Asp(RGD)를 가지는데， 이 서열은 혈소판 GPIIb/IIIa 수용체에 대한 디스인테그린의 인지 부위 (recognition site)이다 (Hong, Koh et al .， 2002； 및 Hong, Sohn et al. , 2002). 삭사틸린은 혈소판 응집 (Hong, Koh et al. , 2002) 및 혈소판 활성화 (Jang, Jeon et al. , 2007) 상에 강력한 억제효능을 가져서, 혈전 생성을 방해하는 것으로 알려져 있다. 본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.  Saxatilin, a novel disintegrin purified and cloned from Korean snake venom, has a tripeptide sequence Arg-Gly-Asp (RGD), which is a site of recognition of disintegrins for platelet GPIIb / IIIa receptors. recognition site) (Hong, Koh et al., 2002; and Hong, Sohn et al., 2002). Saxatilin is known to have a potent inhibitory effect on platelet aggregation (Hong, Koh et al., 2002) and platelet activation (Jang, Jeon et al., 2007), thus preventing thrombus generation. Throughout this specification, many papers and patent documents are referenced and their citations are indicated. The disclosures of cited papers and patent documents are incorporated herein by reference in their entirety, and the level of the technical field to which the present invention belongs and the contents of the present invention are more clearly explained.
본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.  Throughout this specification, many papers and patent documents are referenced and their citations are indicated. The disclosures of cited papers and patent documents are incorporated herein by reference in their entirety, and the level of the technical field to which the present invention belongs and the contents of the present invention are more clearly explained.
【발명의 내용】 [Content of invention]
[해결하려는 과제】  Problem to be solved
본 발명자들은 허혈성 손상에 의해 유도되는 신경염증을 억제할 수 있는 조성물을 개발하고자 노력하였다. 그 결과， 혈전용해제로 알려진 RGD 모티프를 포함하는 펩타이드 또는 단백질이 신경염증을 효과적으로 억제하는 활성을 갖는 것을 확인함으로써 본 발명을 완성하였다.  The present inventors have sought to develop a composition capable of inhibiting neuroinflammatory inflammation induced by ischemic injury. As a result, the present invention was completed by confirming that the peptide or protein containing the RGD motif known as thrombolytic agent has an activity of effectively inhibiting neuroinflammatory inflammation.
따라서， 본 발명의 목적은 신경염증 예방, 억제 또는 치료용 약제학적 조성물을 제공하는 데 있다. .  Accordingly, it is an object of the present invention to provide a pharmaceutical composition for preventing, inhibiting or treating neuroinflammatory diseases. .
2 2
대체용지 (규칙 제 26조) 본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명, 구범위 및 도면에 의해 보다 명확하게 된다. 【과제의 해결 수단】 Alternative Site (Article 26) Other objects and advantages of the present invention will become apparent from the following detailed description, the scope and the drawings. [Measures of problem]
본 발명의 일 양태에 따르면, (a) RGD 모티프를 포함하는 펩타이드 또는 단백질의 약제학적 유효량; (b) 약제학적으로 허용되는 담체를 포함하는 신경염증 예방, 억제 또는 치료용 약제학적 조성물을 제공한다. 본 발명자들은 허혈성 손상에 의해 유도되는 신경염증을 억제할 수 있는 조성물을 개발하고자 노력하였다. 그 결과， 혈전용해제로 알려진 RGD 모티프를 포함하는 펩타이드 또는 단백질이 신경염증을 효과적으로 억제하는 활성을 갖는 것을 확인하였다.  According to one aspect of the invention, there is provided a pharmaceutical composition comprising (a) a pharmaceutically effective amount of a peptide or protein comprising an RGD motif; (b) It provides a pharmaceutical composition for preventing, inhibiting or treating neuroinflammatory inflammation comprising a pharmaceutically acceptable carrier. The present inventors have sought to develop a composition capable of inhibiting neuroinflammatory inflammation induced by ischemic injury. As a result, it was confirmed that the peptide or protein containing the RGD motif, known as thrombolytic, has the effect of effectively inhibiting neuro-inflammatory.
본 발명의 상기 "RGD 모티프를 포함하는 펩타이드 또는 단백질" 은 중성구에 존재하는 인테그린 αΜβ2 및 |32에 결합하여 신경염증을 억제할 수 있는 아미노산 기반 분자를 포괄하는 개념으로서, 펩타이드의 길이, 변형 (modi Heat ion) 여부, 전기적 특성 등을 불문하고 인테그,린 인식 부위인 RGD(Arg-Gly— Asp) 모티프를 포함하는 것이라면 제한 없이 사용될 수 있다. The "peptide or protein comprising the RGD motif" of the present invention is a concept encompassing amino acid-based molecules capable of binding to integrin α Μ β 2 and | 3 2 present in the neutrophils to inhibit neuroinflammation, the length of the peptide It can be used without limitation as long as it contains an RGD (Arg-Gly—Asp) motif, an inte, lean recognition site, regardless of the modification (modi heat ion), electrical characteristics, and the like.
본 발명의 신경염중 예방, 억제 또는 치료용 조성물의 유효성분으로 사용되는 RGD 모티프를 포함하는 펩타이드 또는 단백질은 중성구에 존재하는 인테그린 αΜβ2 및 ^β2에 결합하여 내피세포의 ICAM- Klntercellular Adhesion Molecule 1)과의 상호작용을 저해하여 허혈성 손상에 의해 유도되는 신경염증을 억제한다. Peptides or proteins containing the RGD motif used as an active ingredient of the composition for the prevention, inhibition or treatment of neuritis of the present invention is bound to integrin α Μ β 2 and ^ β 2 present in the neutrophils and endothelial cell ICAM- Klntercellular Adhesion It inhibits the interaction with Molecule 1), which in turn inhibits neuroinflammatory inflammation induced by ischemic injury.
본 발명의 일 구현예에 있어서, 상기 RGD 모티프를 포함하는 펩타이드 또는 단백질은 서열목록 제 1서열의 삭사틸린 또는 이의 유사체이다ᅳ  In one embodiment of the invention, the peptide or protein comprising the RGD motif is a saxatilin or an analog thereof of SEQ ID NO: 1
본 발명의 다른 구현예에 따르면, 상기 삭사틸린의 유사체는 삭사틸린의 아미노산 서열 (서열목톡 제 1서열)에 기반한 삭사틸린 유사체 [즉, 결실 돌연변이체 (deletion mutant)]삭사틸린의 활성, 즉 중성구에 존재하는 인테그린 αΜβ2 및 |32에 결합하여 내피세포의 ICAM-l(Intercellular According to another embodiment of the invention, the analogue of saxatilin is the activity of saxatilin analogues (ie, deletion mutants) saxatilin, ie neutrophils, based on the amino acid sequence of saxatilin (SEQ ID NO: 1) ICAM-1 (Intercellular) of Endothelial Cells Binding to Integrin α Μ β 2 and | 3 2
3 3
대체용지 (규칙제 26조) Adhesion Molecule 1)과의 상호작용을 저해하여 허혈성 손상에 의해 유도되는 신경염증에 대한 저해 효과를 효율적으로 나타낼 수 있는 서열을 예측하여 최적화된 아미노산서열로 제조된다. Alternative Paper (Article 26) By inhibiting the interaction with Adhesion Molecule 1), an optimized amino acid sequence is prepared by predicting a sequence capable of efficiently exhibiting an inhibitory effect on neuroinflammatory inflammation induced by ischemic injury.
본 발명의 상기 삭사틸린은 면역글로불린 (iiranunoglobulin)이 컨쥬게이션 (conjugation)된 삭사틸린이다.  The saxatilin of the present invention is a saxatilin conjugated with an immunoglobulin (iiranunoglobulin).
본 발명의 일 구현예에 따르면， 상기 삭사틸린은 면역글로불린의 Fc 영역이 컨쥬게이션된 삭사틸린이다.  According to one embodiment of the invention, the saxatilin is a saxatilin conjugated to the Fc region of an immunoglobulin.
본 명세서에서 용어 "펩타이드" 는 펩타이드 결합에 의해 아미노산 기들이 서로 결합되어 형성된 선형의 분자를 의미한다.  As used herein, the term "peptide" refers to a linear molecule formed by binding amino acid groups to each other by peptide bonds.
' 본 발명의 펩타이드는 당업계에 공지된 화학적 합성 방법， 특히 고상 합성 기술 (sol id-phase synthesis techniques)에 따라 제조될 수 있다 (Merrifield, J. Amer. Chem. Soc. 85:2149-54(1963); Stewart, et al. Solid Phase Peptide Synthesis, 2nd. ed. , Pierce Chem. Co.: Rockford, 111(1984)).  Peptides of the invention can be prepared according to chemical synthesis methods known in the art, in particular sol id-phase synthesis techniques (Merrifield, J. Amer. Chem. Soc. 85: 2149-54) 1963); Stewart, et al. Solid Phase Peptide Synthesis, 2nd.ed., Pierce Chem. Co .: Rockford, 111 (1984)).
본 발명의 펩타이드는 그 자체로서 천연의 삭사틸린보다 안정성이 우수하지만, 아미노산의 변형에 의해 안정성이 더욱 향상될 수 있다. 본 발명의 바람직한 구현예에 따르면， 상기 펩타이드의 C-말단은 히드록시기 (- 0H) 또는 아미노기 (-NH2)로 변형될 수 있으며, 상기 펩타이드의 N-말단은 아세틸기， 플투오레닐 메록시 카르보닐기, 포르밀기ᅳ 팔미토일기， 미리스틸기, 스테아릴기 및 폴리에틸렌글리콜 (PEG)로 구성된 군으로부터 선택되는 보호기가 결합될 수 있다.  The peptide of the present invention is superior in stability to natural saxatilin by itself, but may be further improved by modification of amino acids. According to a preferred embodiment of the present invention, the C-terminus of the peptide may be modified with a hydroxy group (-0H) or an amino group (-NH2), and the N-terminus of the peptide is an acetyl group, a fluorenyl methoxy carbonyl group, A protecting group selected from the group consisting of formyl group palmitoyl group, myristyl group, stearyl group and polyethylene glycol (PEG) may be bonded.
상술한 아미노산의 변형은 본 발명의 펩타이드의 안정성을 크게 개선하는 작용을 한다. 본 명세서에서 용어 "안정성" 은 인 비보 안정성 뿐만 아니라, 저장 안정성 (예컨대ᅳ 상은 저장 안정성)도 의미한다. 상술한 보호기는 생체 내의 단백질 절단효소의 공격으로부터 본 발명의 펩타이드를 보호하는 작용을 한다.  Modification of the above-mentioned amino acid serves to greatly improve the stability of the peptide of the present invention. As used herein, the term "stability" means not only in vivo stability but also storage stability (e.g., phase is storage stability). The above protecting groups serve to protect the peptides of the present invention from the attack of protein cleavage enzymes in vivo.
상기 면역글로불린 컨쥬게이션은 당업계의 공지된 재조합 기술에 의해 뉴클레오타이드 /유전자 수준에서 맞춤 (tailor-made)으로 실시될 수 있다. 면역글로불린을 코딩하는 뉴클레오타이드 서열은 공지되어 있으며, 예컨대， 게놈 데이터베이스 (http://www.ncbi .nlm.nih.gov/genome)로부터 구할 수 있다. 삭사틸린의 뉴클레오타이드 서열 또한 공지되어 있으며,  The immunoglobulin conjugation can be carried out tailor-made at the nucleotide / gene level by recombinant techniques known in the art. Nucleotide sequences encoding immunoglobulins are known and can be obtained, for example, from genomic databases (http://www.ncbi.nlm.nih.gov/genome). The nucleotide sequence of saxatilin is also known,
4 대체용지 (규칙 제 26조) -록 제 1서열의 삭사틸린을 코딩하는 아미노산 서열에 근거하여 추정할 다. 본 발명의 면역글로불린 컨쥬게이션된 삭사틸린을 발현하기 위해 터 (폴라스미드)의 컨스트럭트는 이의 천연 및 /또는 변형 및 /또는4 Alternative paper (Article 26) Estimate based on the amino acid sequence encoding the saxatilin of the Rock first sequence. Constructs of ter (polasmid) to express the immunoglobulin conjugated saxatilins of the invention may be naturally and / or modified and / or
1이션 형태의 면역글로불린 경쇄를 위한 발현 카세트， 이의 천연 는 변형 및 /또는 컨쥬게이션 형태의 면역글로불린 중쇄를 위한 발현Expression cassettes for monovalent immunoglobulin light chains, their natural silver modified and / or conjugated forms for immunoglobulin heavy chains
L , 선별 마커 및 대장균 복제뿐 아니라 선별 유닛의 요소가 요구된다. \ 카세트는 프로모터， 구조 유전자, 분비 신호 서열을 코딩하는 DNA 및 터미네이터로 구성된다. 이러한 요소들은 작동적으로 연결되어 로불린 컨쥬게이트의 경쇄 및 중쇄로 어샘블리된다. 터 (플라스미드)에 코딩된 폴리펩타이드를 발현하기 위해 적절한 】포를 선택할 수 있다. 예컨대, CH0 세포， NS0 세포， Sp2/0 세포， COSL, selection markers and E. coli replication as well as elements of the selection unit are required. Cassettes consist of promoters, structural genes, DNA encoding secretory signal sequences, and terminators. These elements are operatively linked to sample the light and heavy chains of the lobulin conjugates. A suitable cell can be selected to express the polypeptide encoded by the plasmid. For example, CH0 cells, NS0 cells, Sp2 / 0 cells, COS
HEK 세포, K562 세포, BHK 세포 또는 PER .C6 세포를;선택할 수 ] 이에 한정되지 않는다. 발현 백터의 조절 요소는 선택되는 1포에 따라 기능적으로 선택될 수 있다. 면역글로불린 컨쥬게이트의 이상의 쇄를 코딩하는 발현백터를 포함하는 숙주세포는 ^로불린의 발현에 적합한 조건 하에 배양될 수 있다. j포로부터 발현된 면역글로불린은 기능적으로 어셈블리된다. 부터 분비된 면역글로불린 컨쥬게이트를 수득한다. HEK cells, K562 cells, BHK cells, or PER. C6 cells; may be selected]. Regulatory elements of the expression vector may be functionally selected depending on the cell selected. Host cells comprising an expression vector encoding the above chain of immunoglobulin conjugates can be cultured under conditions suitable for expression of ^ globulin. Immunoglobulins expressed from j cells are functionally assembled. From secreted immunoglobulin conjugates.
본 발명의 면역글로불린 컨쥬게이트는 펩타이드의 말단에 최소 ] 면역글로불린이 컨쥬게이션된다. I  The immunoglobulin conjugates of the invention are conjugated with a minimum] immunoglobulin at the end of the peptide. I
본 발명의 일 구현예에 따르면， 상기 면역글로불린의 Fc 영역은 상기 i린의 N-말단 또는 C-말단에 컨쥬게이션되어 있다.  According to one embodiment of the invention, the Fc region of the immunoglobulin is conjugated to the N-terminus or C-terminus of the i-rin.
본 발명의 다른 구현예에 따르면, 상기 삭사틸린은 면역글로불린의 역이 그의 N-말단에 컨쥬게이션된 Fc-삭사틸린이다.  According to another embodiment of the invention, said saxatilin is an Fc-saxatilin with the inverse of the immunoglobulin conjugated to its N-terminus.
본 발명의 (a) RGD 모티프를 포함하는 펩타이드 또는 단백질의 ] "적 유효량; (b) 약제학적으로 허용되는 담체를 포함하는 약제학적 은 신경염증 예방, 억제 또는 치료한다. The (a) a peptide or protein comprising an RGD motif: "effective amount of the invention; (b) a pharmaceutical containing a pharmaceutically acceptable carrier will be inhibitory or preventative treatment, neuroinflammation.
본 발명의 일 구현예에 있어세 상기 신경염증은 뇌졸중, 뇌경색， i증, 뇌색전증 또는 뇌허혈에 수반되는 신경염증이다.  In one embodiment of the present invention, the neuro-inflammatory is neuro-inflammation associated with stroke, cerebral infarction, i, brain embolism or cerebral ischemia.
본 발명의 RGD 모티프를 포함하는 펩타이드 또는 단백질은 J테그린 활성을 갖는다.  Peptides or proteins comprising the RGD motif of the invention have Jtegrin activity.
5 대체용지 (규칙 제 26조) 상기 디스인테그린은 삭사틸린 (saxatilin), 로도스토민 (rhodostomin) , 알보라브린 (albolabrin), 아플라긴 (applagin), 바실리신 (basil icin) 바트록소스타틴 (batroxostatin), 비티스타틴 (bitistatin) 바부린 (barbourin), 세레베린 (cereber in) , 세라스틴 (cerast in) 크로타트록신 (crotatroxin), 두리신 (durissin)， 에키스타틴 (echistatin) 엘레간틴 (elegantin), 에리스티코핀 (eristicophin) 플라보리딘 (flavoridin), 플라보스타틴 (f lavostat in)， 할리신 (halysin) 자라라신 (jararacin), 자라스타린 (jarastatin)， 자라린 (jararin) 라체신 (lachesin), 루토신 (lutosin) , 몰로신 (mo!ossin) , 살모신 (salmosin) 테르게미닌 (tergeminin), 트리그라민 (trigramin) 트리메스타틴 (trimestatin), 트리무크린 (tr imucr in) 트리무타제 (trimutase), 우슈리스타틴 (ussuristatin) 및 비리딘 (viridin)으로 구성된 군으로부터 선택될 수 있다. 5 Alternative Paper (Article 26) The disintegrins are saxatilin, rhodostomin, albolabrin, aflagin, applagin, basil icin, batroxostatin, and bitistatin babulin (barbourin), cereberin, cerastin, crotatroxin, durissin, echistatin elegantin, eristicophin flavoridine (flavoridin), flavostatin (f lavostat in), halysin, jararacin, jarastatin, jararin, lachesin, lutosin, molosin ( mo! ossin, salmosin tergeminin, trigramin trimestatin, trimuctrin in trimutase, ussuristatin ) And viridin.
본 발명의 RGD 모티프를 포함하는 펩타이드 또는 단백질은 중성구에 존재하는 인테그린 αΜβ2 과 결합한다. Peptides or proteins comprising the RGD motif of the invention bind to integrin α Μ β 2 present in neutrophils.
본 발명의 일 구현예에 따르면， 상기 RGD 모티프를 포함하는 펩타이드 또는 단백질은 중성구 (neutrophil)에 존재하는 인테그린 ip2에 대하여 1 X 1으 8 내지 1 X 1으10 M의 Kd(dissociation constant) 값의 결합력을 갖는다. According to one embodiment of the present invention, the peptide or protein comprising the RGD motif has a Kd (dissociation constant) value of 1 X 1 to 8 X 1 to 10 M with respect to integrin ip2 present in the neutrophil. Has a bonding force.
본 발명의 RGD 모티프를 포함하는 펩타이드 또는 단백질은 중성구에 존재하는 인테그린 ai 32과 결합한다. Peptides or proteins comprising the RGD motif of the invention bind to integrin ai 3 2 present in neutrophils.
본 발명의 일 구현예에 따르면, 상기 RGD 모티프를 포함하는 펩타이드 또는 단백질은 중성구 (neutrophil)에 존재하는 인테그린 αι_β2 에 대하여 1 X ΚΓ8 내지 1 X 1010 Μ의 KcKdissociation constant) 값의 결합력을갖는다. According to one embodiment of the invention, the peptide or protein comprising the RGD motif has a binding capacity of the KcKdissociation constant value of 1 X K 8 8 to 1 X 10 10 Μ to integrin αι_β2 present in the neutrophil.
본 발명의 RGD 모티프를 포함하는 펩타이드 또는 단백질은 혈소판 및 증성구의 인테그린과 결합한다.  Peptides or proteins comprising the RGD motif of the invention bind to the integrins of platelets and ectopic bulbs.
본 발명의 일 구현예에 따르면, 상기 RGD 모티프를 포함하는 펩타이드 또는 단백질은 혈소판의 GPIIb/IIIa, 중성구에 존재하는 인테그린 αΜβ2및 p2 에 대하여 결합능을 갖는다. According to one embodiment of the invention, the peptide or protein comprising the RGD motif has the ability to bind to GPIIb / IIIa of platelets, integrin α Μ β 2 and p2 present in neutrophils.
본 발명의 RGD 모티프를 포함하는 펩타이드 또는 단백질은 종래에  Peptides or proteins comprising the RGD motif of the present invention is conventionally
6 대체용지 (규칙제 26조) 혈전 용해 효과가 공지되어 있다. 6 Alternative paper (Article 26) The thrombolytic effect is known.
본 발명의 RGD 모티프를 포함하는 펩타이드 또는 단백질의 약제학적 유효량 및 약제학적으로 허용되는 담체를 포함하는 약제학적 조성물은 신경염증과 동시에 혈관이 폐색된 환자에 투여될 수 있다. 본 발명의 조성물이 약제학적 조성물로 제조되는 경우, 본 발명의 약제학적 조성물은 약제학적으로 허용되는 담체를 포함한다. 본 발명의 약제학적 조성물에 포함되는 약제학적으로 허용되는 담체는 제제시에 통상적으로 이용되는 것으로서, 락토스， 덱스트로스, 수크로스, 솔비롤, 만니틀, 전분, 아카시아 고무， 인산 칼슘, 알기네이트， 젤라틴 , 규산 칼슘， 미세결정성 샐를로스， 폴리비닐피를리돈， 샐를로스, 물， 시럽, 메틸 샐를로스, 메틸히드록시벤조에이트， 프로필히드록시벤조에이트, 활석， 스테아르산 마그네슘 및 미네랄 오일 등을 포함하나， 이에 한정되는 것은 아니다. 본 발명의 약제학적 조성물은 상기 성분들 이외에 윤활제, 습윤제， 감미제， 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다. 적합한 약제학적으로 허용되는 담체 및 제제는 Remington ' s Pharmaceut ical Sciences (19th ed. , 1995)에 상세히 기재되어 있다.  A pharmaceutical composition comprising a pharmaceutically effective amount of a peptide or protein comprising the RGD motif of the invention and a pharmaceutically acceptable carrier may be administered to a patient whose blood vessels are occluded simultaneously with neuroinflammatory. When the composition of the present invention is made into a pharmaceutical composition, the pharmaceutical composition of the present invention includes a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers included in the pharmaceutical compositions of the present invention are those commonly used in the preparation, such as lactose, dextrose, sucrose, sorbol, mannitol, starch, acacia rubber, calcium phosphate, alginate, Gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyridone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil Including, but not limited to. In addition to the above components, the pharmaceutical composition of the present invention may further include a lubricant, a humectant, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, and the like. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).
본 발명의 약제학적 조성물은 경구 또는 비경구 투여할수 있다. 본 발명의 약제학적 조성물의 적합한 투여량은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성， 병적 상태， 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하게 처방될 수 있다. 본 발명의 약제학적 조성물의 일반적인 투여량은 성인 기준으로 0.001-100 nig/kg 범위 내이다.  The pharmaceutical composition of the present invention may be administered orally or parenterally. Suitable dosages of the pharmaceutical compositions of the present invention may be prescribed in various ways depending on factors such as the formulation method, mode of administration, age, weight, sex, morbidity, food, time of administration, route of administration, rate of excretion and response to the patient. Can be. Typical dosages of the pharmaceutical compositions of the invention are in the range of 0.001-100 nig / kg on an adult basis.
본 발명의 약제학적 조성물은 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라， 약제학적으로 허용되는 담체 및 /또는 부형제를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다. 이때 제형은 오일 또는 수성 매질중의 용액， 현탁액, 시럽제 또는 유화액 형태이거나 엑스제， 산제, 분말제， 과립제， 정제 또는 캅셀제 형태일 수도 있으며, 분산제 또는 안정화제를추가적으로 포함할수 있다.  The pharmaceutical compositions of the present invention may be prepared in unit dose form by formulating with a pharmaceutically acceptable carrier and / or excipient according to methods which can be easily carried out by those skilled in the art. Or may be prepared by incorporation into a multi-dose container. The formulation may be in the form of solutions, suspensions, syrups or emulsions in oils or aqueous media or in the form of extracts, powders, granules, tablets or capsules, and may further comprise dispersants or stabilizers.
7 7
대체용지 (규칙 제 26조) 【발명의 효과】 Alternative Site (Article 26) 【Effects of the Invention】
본 발명의 특징 및 이점을 요약하면 다음과 같다:  The features and advantages of the present invention are summarized as follows:
(a) 본 발명은 RGD 모티프를 포함하는 펩타이드 또는 단백질의 약제학적 유효량 및 약제학적으로 허용되는 담체를 포함하는 신경염증 예방， 억제 또는 치료용 약제학적 조성물을 제공한다.  (a) The present invention provides a pharmaceutical composition for preventing, inhibiting or treating neuro-inflammatory diseases comprising a pharmaceutically effective amount of a peptide or protein comprising an RGD motif and a pharmaceutically acceptable carrier.
(b) 본 발명은 삭사틸린 및 그 유사체들의 신경염증 완화 효과를 확인함으로써， 혈전용해 효능과 함께 이중 기능을 갖는 뇌졸중 치료제 개발이 가능하게 한다. 【도면의 간단한 설명】  (b) The present invention confirms the neuroinflammatory relieving effect of saxatilin and its analogues, thereby enabling the development of stroke therapeutics with dual functions with thrombolytic efficacy. [Brief Description of Drawings]
도 1은 각각 pYK603 백터 및 pYK602 백터의 멀티클로닝 위치에 클로닝된 삭사틸린 유도체의 구조를 도식작으로 나타내는 도면이다. 구성성분들 간의 거리 또는 제한효소 위치들 간의 거리는 비율에 따라 표시되어 있지 않다. ' l eader' 는 리더 서열; 면역글로블린 G2a 감마 체인. .  1 is a diagram showing the structure of a saxatilin derivative cloned at the multicloning position of a pYK603 vector and a pYK602 vector, respectively. Distances between components or distances between restriction sites are not shown in proportions. 'l eader' is the leader sequence; Immunoglobulin G2a Gamma Chain. .
도 2는 본 발명의 삭사틸린 유도체의 발현을 확인한 웨스턴 블랏팅 결과이다. 정제된 단백질의 안정성을 확인하기 위해ᅳ 5 , 000 rpm에서 10분 동안 원심분리하여 침전물의 생성 유무를 조사하였다 (레인 2 및 레인 4) . 그 결과, 본 발명의 삭사틸린 유도체는 매우 안정하였다 (침전물이 생기지 않았음) .  Figure 2 is a Western blotting result confirming the expression of the saxatilin derivatives of the present invention. In order to confirm the stability of the purified protein was centrifuged at 5,000 rpm for 10 minutes to investigate the presence of precipitate (lane 2 and lane 4). As a result, the saxatilin derivative of the present invention was very stable (no precipitate formed).
도 3a 및 도 3b는 각각 Fc-삭사틸린 및 삭사틸린 -Fc의 정제 결과를 나타낸다. 화살표는 정제된 Fc-삭사틸린 및 삭사틸린 -Fc를 나타낸다.  3A and 3B show the results of purification of Fc-saxatilin and saxatilin-Fc, respectively. Arrows indicate purified Fc-saxatilin and saxatilin-Fc.
도 4a 및 4b는 각각 삭사틸린과 단핵 백혈구 및 삭사틸린과 호중성 백혈구의 상호작용을 확인한 결과를 보여준다. PMA는 phorbol 12-myr i st ate 13-acet ate이고, 상기 fMLP는 N-f이 rmyl-Met-Leu-Phe이다.  4a and 4b show the results of confirming the interaction between saxatilin and mononuclear leukocytes and saxatilin and neutrophils, respectively. PMA is phorbol 12-myr state 13-acetate and the fMLP is N-f rmyl-Met-Leu-Phe.
도 5a 및 5b는 각각 삭사틸린 -Fc 및 Fc-삭사틸린의 인테그린 결합을 확인한 결과를 보여준다.  5a and 5b show the results of confirming the integrin binding of saxatilin -Fc and Fc-saxatilin, respectively.
도 6은 Fc-삭사틸린의 뇌경색 완화 효과를 확인한 T2 이미지상의 뇌경색 병변을 보여준다. 'Fc-Sax' 는 Fc-삭사틸린를 의미한디- .  6 shows cerebral infarct lesions on T2 images confirming the effect of Fc-saxatilin on infarct relief. 'Fc-Sax' means Fc-saxatilin.
도 7은 Fc-삭사틸린의 뇌경색 완화 효과를 모수적 (왼쪽 그래프) 및 비모수적 (오른쪽 그래프)으로 비교한 결과를 보여준다. 'Fc-Sax' 는 Fc-  FIG. 7 shows the results of comparing Cc saxatilin's cerebral infarction effect parametrically (left graph) and nonparametrically (right graph). 'Fc-Sax' is Fc-
8 8
대체용지 (규칙제 26조) 삭사틸린를 의미한다 . Alternative Paper (Article 26) Means saxatilin.
도 8은 T2 star 이미지상의 뇌출혈 병변을 보여준다.  8 shows cerebral hemorrhage lesions on T2 star image.
도 9는 대조군 및 Fc-삭사틸린 투여군의 신경학적 장애를 비교한 결과를보여준다.  Figure 9 shows the result of comparing the neurological disorders of the control group and Fc-saxatilin administration group.
도 10은 대조군 및 Fc-삭사틸린 투여군의 뇌조직 내 호중구 침투량을 분석한 결과를 보여준다 (outlier 포함).  Figure 10 shows the results of analyzing the neutrophil infiltration amount in the brain tissue of the control group and Fc-saxatilin administration group (including outlier).
【발명을 실시하기 위한 구체적인 내용】 [Specific contents to carry out invention]
이하， 실시 예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시 예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로， 본 발명의 요지에 따라 본 발명의 범위가 이들 실시 예에 의해 제한되지 않는다는 것은 당 업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다. 실시예  Hereinafter, the present invention will be described in more detail with reference to the following examples. These examples are only for illustrating the present invention in more detail, it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention. . Example
실험재료 및 실험방법 Experimental Materials and Methods
Fc-삭사틸린 및 삭사틸린 -Fc의 제조  Preparation of Fc-Saxatilins and Saxatilin-Fc
본 실시예에서 사용한 삭사틸린 및 Fc-삭사틸린을 제조하기 위해， 다음의 방법을 실시하였다:  In order to prepare saxatilin and Fc-saxatilin used in this example, the following method was carried out:
재조합 삭사틸린 단백질을 발현시키기 위하여， 본 발명자들은 하기 기재된 프라이머쌍 (삭사틸린 -F 및 삭사틸린 -R)을 이용하여 PCR을 실시하였다. 얻어진 PCR 산물올 제한효소 siiKthermo scientific)으로 절단하여 PYK603 백터 .및 pYK602 백터 (에이앤알쎄라퓨틱스)에 T4 DNA 리가제 (thermo scientific)를 이용하여 클로닝하여 각각 Fc-삭사틸린 및 삭사틸린 _Fc 단백질 발현용 재조합 백터를 제조하였다 (도 1). To express the recombinant saxatilin protein, we performed PCR using the primer pairs described below (saxatilin-F and saxatilin-R). All PCR products with restriction enzymes siiKthermo scientific) by cutting the vector obtained by PYK603. PYK602 and vector (this RNR ssera Pew vertices) in T4 DNA ligase (thermo scientific) Each Fc- saksa was cloned using the motilin and saksa motilin _ Fc protein A recombinant vector for expression was prepared (FIG. 1).
삭人 !·틸린誦 F agtaggccgtgggggccgaggccggagaagaatgtgactgt  Satin! · Tyrin 誦 F agtaggccgtgggggccgaggccggagaagaatgtgactgt
삭사틸린ᅳ R gcatggccgacgcggccaaggcatggaagggatttctgggaca  Saxatilinjan R gcatggccgacgcggccaaggcatggaagggatttctgggaca
상술한 Fc-삭사틸린 또는 삭사틸린 -Fc를 포함하는 재조합 백터를 각각 292E 세포에 PEHpolyethylen nine; Polysciences)를 이용하여 트랜스펙션 (transfection)시켰다. 트랜스펙션 후 세포 배양 2일 또는 5일 째에 상층액 (supernatant)을 수거하여 SDS-PAGE를 실시한 후 NC 막 (membrane; M Hpore)으로 옮기고 2차 항체인 항 -HuFc-HRP(l :2000 회석;  Recombinant vectors comprising the above-described Fc-saxatilin or saxatilin-Fc were each expressed in PEHpolyethylen nine in 292E cells; Polysciences) was used for transfection. After transfection, supernatants were harvested on day 2 or 5 of the cell culture, followed by SDS-PAGE, transferred to NC membrane (M Hpore), and the secondary antibody, anti-HuFc-HRP (l: 2000). attenuation;
9 9
대체용지 (규칙제 26조) thermo scientific)와 상은에서 1시간 동안 반웅시켰다. 상기 NC 막을 PBS/T로 3번에 걸쳐서 세척한 후 ECL 용액으로 필름을 현상하여 웨스턴 블랏팅을 실시하였다 (도 2). Alternative Paper (Article 26) thermo scientific) and phase were reacted for 1 hour at. The NC membrane was washed three times with PBS / T and then subjected to western blotting by developing the film with ECL solution (FIG. 2).
트랜스펙션된 293E 세포의 배양에서 3， 5 또는 7일 째의 배양 상층액을 0.22 탑 -필터 (top-filter; Millipore)를 사용하여 여과하였다. 여과된 상층액을 500 ≠ 단백질 A 비드 (GE healthcare가 패킹되어 있는 5 \\ύ 컬럼에 로딩하여 비드와 결합시켰다. 펌프 (peri-start pump; Bio— rad)를 사용하여 0.9 /분의 유속으로 4°C에서 하룻밤 동안 결합시킨 후， 100 mi 이상의 PBS로 세척하고 0.1 M 글라이신 (Glycine)-HCl올 이용하여 6개의 분획 (fraction)으로 용출시켰다. 상기 용출액들은 1 M TrisCpH 9.0) 용액으로 중화 (neutralization)시켰다. 이후, 단백질의 양을 정량하고 2- 3개의 분획에 포함된 단백질들을 아미콘 을트라 원심분리 필터 (amicon ultra centrifugal filter; MUHpore)를 사용하여 농축시켰다. PBS로 10번 이상완층액을 교환시켰다. Culture supernatants at 3, 5 or 7 days in culture of transfected 293E cells were filtered using a 0.22 top-filter (Millipore). The filtered supernatant was loaded into 500 ≠ Protein A beads (5 \\ ύ column packed with GE healthcare) and combined with the beads at a flow rate of 0.9 / min using a peri-start pump (Bio-rad). After binding overnight at 4 ° C., washed with PBS at least 100 mi and eluted with 6 fractions using 0.1 M Glycine-HClol.The eluates were neutralized with 1 M TrisCpH 9.0) solution. neutralization). The amount of protein was then quantified and the proteins contained in the 2-3 fractions were concentrated using an Amicon ultra centrifugal filter (MUHpore). The supernatant was exchanged at least 10 times with PBS.
얻어진 단백질 농축액의 순도 (purity)는 Agilent 2100 생체분석기 Purity of the obtained protein concentrate was determined using the Agilent 2100 Bioanalyzer.
(Bioanalyzer)를 이용하여 분석하였다 (도 3a 및 도 3b). Agilent 2100 생체분석기는 랩 -은-어-칩 (lab-on-a— chip) 기술올 기반으로 한 분석 장비로 단백질의 크기와 농도를 동시에 자동으로 분석할 수 있는 시스템으로, 마이크로칩 안에서 샘풀 처리， 분리 및 검출 전-과정을 동시에 수행하여 신뢰성 높은 데이터를 두 가지 형태 (겔 -전기영동 이미지 및 크로마토그래피 같은 전기이동그램 (electropherogram))으로 분석결과를 확인할수 있다. 백혈구와 삭사틸린의 상호작용 (Bioanalyzer) was used to analyze (Fig. 3a and 3b). The Agilent 2100 bioanalyzer is an analytical instrument based on a lab-on-a-chip technology that automatically analyzes the size and concentration of proteins simultaneously. The results of the analysis can be confirmed in two forms (electrophorograms such as gel-electrophoresis images and chromatography) by performing the separation and detection pre-process simultaneously. White blood cell interaction with saxatilin
삭사틸린 (recombinant . saxati Un) 및 BSA(Bovine Serum Albumin)에 FITCCFluorescein isothiocyanate)를 표지하였다. 상기 본 실시예에서 사용한 삭사틸린은 대한민국 공개특허 제 2002-0064787호에 기재된 방법에 따라 분리 정제한 재조합 삭사틸린 단백질을 사용하였으며 그 아미노산 서열은 서열목록 게 1서열에 나타내었다. 랫트 (8주령, 수컷)로부터 채혈하여 구연산나트륨 류브 (sodium citrate tube)에 넣고, 혈액이 웅고되지 않도록 흔합하였다.  Saxatilin (recombinant. Saxati Un) and BSA (Bovine Serum Albumin) were labeled with FITCC Fluorescein isothiocyanate. As the saxatilin used in this example, a recombinant saxatilin protein isolated and purified according to the method described in Korean Patent Laid-Open Publication No. 2002-0064787 was used, and its amino acid sequence is shown in SEQ ID NO: 1. Blood was collected from rats (8 weeks old, males) and placed in a sodium citrate tube and mixed to prevent blood from lumping.
상기 혈액에 FITC-표지 삭사틸린 또는 FITC-표지 BSA를 넣고  Put FITC-labeled saxatilin or FITC-labeled BSA into the blood
10 대체용지 (규칙제 26조) 37°C에서 30분 동안 반응시켰다. 실험군의 구성은 표 1과 같다. 10 Alternative Paper (Article 26) The reaction was carried out at 37 ° C. for 30 minutes. The composition of the experimental group is shown in Table 1.
Figure imgf000013_0001
Figure imgf000013_0001
상기 PMA는 phorbol 12-myri state 13-acetate이고， 상기 fMLP는 N- formy卜 "Met-Leuᅳ Phe이다.  The PMA is phorbol 12-myri state 13-acetate and the fMLP is N-formy '"Met-Leu' Phe.
반응 후， RBC(Red Blood Cell) 용해 완충액을 첨가하여 상은에서 After the reaction, RBC (Red Blood Cell) lysis buffer was added to the
15분 동안 반웅시켰다. PBSCPhosphate Buffered Saline)로 3차례 세척한 후， 유세포분석기 (flow cytometer)로 형광을 측정하여 백혈구와 삭사틸린의 상호작용을 확인하였다. 인테그린과 삭사틸린의 결합 Reaction for 15 minutes. After washing three times with PBSCPhosphate Buffered Saline), fluorescence was measured by a flow cytometer to confirm the interaction between white blood cells and saxatilin. Combination of Integrin and Saxatilin
96-웰 플레이트에 각 인테그린 ( anb|33, QvPa, αΜ 2 및 c 32)을 100 ng/웰씩 첨가하고, 4°C에서 밤새 코팅하였다. 코팅 후 PBS-T(0.5% Tween 20)로 3차례 세척하였다. 1% BSA(in PBS-T) 용액으로 상온에서 2시간 동안 블로킹 (blocking)하였다. 블로킹 후 PBS-T로 3차례 세척하였다. 삭사틸린 -Fc 또는 Fcᅳ삭사틸린을 100 nM 부터 1/4씩 연속 회석하여 8개의 샘폴용액을 제조하였다. Each integrin (a nb | 3 3 , QvPa, α Μ 2 and c 3 2 ) was added to the 96-well plate at 100 ng / well and coated overnight at 4 ° C. After coating, the plate was washed three times with PBS-T (0.5% Tween 20). Blocking was performed at room temperature with 1% BSA (in PBS-T) solution for 2 hours. After blocking, three washes were performed with PBS-T. Eight sample solutions were prepared by continuously diluting saxatilin-Fc or Fc * saxatilinity from 100 nM to 1/4.
상기 샘플 용액을 100 씩 3 중으로 각 웰에 로딩하고 상은에서 2시간 동안 반응시켰다. 반웅 후 PBS-T로 3차례 세척하였다. 항 -인간 IgG(Fc) 컨쥬게이티드 HRP 항체를 1:2ᅳ 000으로 희석하여 각 웰에 100 ^씩 첨가하고 상온에서 1시간 동안 반응시켰다. 반응 후 PBS-T로 4차례 세척하였다. TMB 용액을 첨가하고 실온에서 30분 동안 반웅시킨 후, 종결 용액 (stop solution, 0.5 M H2S04)를 첨가하여 반응을 종결시키고 450 ran에서 홉광도를 측정하여， 중성구 및 내피세포의 상호작용에 관여하는 인테그린과삭사틸린의 결합을 확인하였다. The sample solution was loaded into each well in triplicates of 100 and reacted for 2 hours at phase silver. After reaction, the reaction was washed three times with PBS-T. Anti-human IgG (Fc) conjugated HRP antibody was diluted 1: 2 ᅳ 000 and added to each well 100 ^ and reacted for 1 hour at room temperature. The reaction was washed four times with PBS-T. After adding TMB solution and reacting for 30 minutes at room temperature, the reaction was terminated by adding a stop solution (0.5 MH 2 S0 4 ) and measuring the hop intensity at 450 ran to determine the interaction between neutrophils and endothelial cells. Integrin and saxatilin involved in binding.
11 11
대체용지 (규칙제 26조) 뇌경색 동물모델 실험 Alternative Paper (Article 26) Cerebral Infarction Animal Model Experiment
1) 동물모델  1) Animal Model
웅성의 ICR 마우스 (32-34g)를 이용하여 기존에 보고된 나일른사를 이용한 중대뇌동맥 폐색 방법을 일부 변형하여 뇌의 허혈손상을 유발하였다. 실험동물은 수술 전 약 12시간 동안 물만 공급 하고, 수술 후에는 물과 사료를 자유롭게 섭취할 수 있게 하였다. 마취통 안에서 마취가스 [N20와 02를 7: 3의 비율로 흔합한 가스에 아이소플루레인 ( i sof lurane)을 5%로 함]를 흡입하게 하여 마취를 유도한 마우스의 체중을 측정하고 절개부위를 면도한 후, 안면 마스크를 통해 2% 마취가스로 마취를 유지하며 수술하였다. 수술 중 체온은 직장체온계를 직장 내로 삽입하여 연계된 자동온도조절장치와 가은 패드를 이용하여 37.0 ± 0.5°C로 유지하였다. 마취된 마우스의 경부를 정증 절개하여 좌측 경동맥을 노출시키고 미주신경 등을 분리한 뒤, 5/0 실크봉합사를 이용해서 총경동맥을 결찰하였다. 이어서 외경동맥을 결찰하고， 내경동맥과 외경동맥의 분지들을 결찰하거나 전기소작하였다. 다음으로 혈관용 클램프를 이용하여 내경동맥을 일시적으로 결찰한 뒤 , 내경동맥 기시부에 작은 창을 내고 마우스의 체중에 따라 규격화된 나일른사를 삽입하였다. 나일론사가 내경동맥 쪽으로 들어간 것을 확인하면 혈관용 클램프를 풀고 나일론사를 총경동맥 분지점으로부터 저항이 느껴질 때까지 밀어 넣어 증간대뇌동맥 폐색을 시행하였다. 폐색 후의 출혈을 막고 나일론사를 고정시키기 위해 혈관 밖에 남은 나일론사와 내경동맥을 함께 단단히 결찰하고, 실크 봉합사를 이용해서 절개된 피부를 봉합하였다. 1시간이 지나면 막아두었던 나일론사를 저항이 느껴질 때까지 잡아 뺀 후 나머지 끝부분을 가위로 절단함으로써 혈류를 회복시켜주고Male ICR mice (32-34g) were used to induce a cerebral ischemic injury by modifying the previously reported method of middle cerebral artery occlusion using Nilesa. The experimental animals were supplied with water only for about 12 hours before surgery, and were free to consume water and feed after surgery. Inject anesthesia gas (N20 and 02 in a ratio of 7: 3 to N20 and 02 with i sof lurane at 5%). After shaving, the patient was operated while maintaining anesthesia with 2% anesthetic gas through a face mask. During surgery, the body temperature was maintained at 37.0 ± 0.5 ° C by inserting a rectal thermometer into the rectum and using a thermostat and thin pad. The cervical section of the anesthetized mouse was incised to expose the left carotid artery, the vagus nerve, etc. were isolated, and the total carotid artery was ligated using 5/0 silk suture. The external carotid artery was ligated and the branches of the internal and external carotid arteries were ligated or electrocauterized. Next, the internal carotid artery was temporarily ligated using a vascular clamp, and then a small window was opened at the base of the carotid artery and a standardized nile thread was inserted according to the weight of the mouse. After confirming that the nylon yarn entered the internal carotid artery, the cerebral artery occlusion was performed by releasing the blood vessel clamp and pushing the nylon yarn until the resistance was felt from the total carotid artery branch. In order to prevent bleeding after occlusion and fix the nylon yarn, the nylon yarn remaining outside the blood vessel and the internal carotid artery were tightly ligated together, and the sutured skin was closed using a silk suture. After 1 hour, remove the nylon thread that you blocked until you feel resistance, and then cut the remaining end with scissors to restore blood flow.
23시간후에 실험동물을 회생하였다. The experimental animals were regenerated after 23 hours.
2) 실험군 및 약물투여 2) Experimental group and drug administration
4 mg/kg 용량의 Fc—삭사틸린을 투여하는 실험군과 매칭되는 위약을 이용한 대조군으로 하며 Fc-삭사틸린 투여군 18마리， 대조군 16마리를 사용하였다. 이는 삭사틸린을 이용한 선행연구에서 얻어진 결과를 바탕으로 통계기법을 이용하여 적절한 표본크기를 도출하고， The Data and Safety Moni tor ing Board의 권유를 수용하여 결정된 두수이다. 총 투여용량인 4  A control group using a placebo matched with an experimental group receiving 4 mg / kg Fc-saxatilin was used, and 18 control groups and 16 control groups were used. Based on the results obtained in the previous studies using saxatilin, this is the number of heads determined by accepting the recommendation of The Data and Safety Board. Total dosage 4
12 대체용지 (규칙제 26조) mg/kg Fc-삭사틸린을 중대뇌동맥 폐색 직전과 재관류 직전에 두 번으로 나누어 (각 2 mg/kg) 좌측 대퇴정맥을 통해 볼루스 주입하였고, 대조군은 동량의 생리식염수를 투여하였다. 3) 약물 준비 및 공급 12 Alternative Paper (Article 26) The mg / kg Fc-saxatilin was divided into two doses (2 mg / kg each) just before middle cerebral artery occlusion and just before reperfusion, and the control group received the same amount of normal saline. 3) drug preparation and supply
① 약물의 준비: 실험에 관여하지 않는 연구자 (A)가 무작위로 약물의 투여 순서를 정한 코드를 만들어서 실험에 관여하지 않는 다른 연구자 (B)에게 제공하였다.  ① Preparation of the drug: A researcher (A) who was not involved in the experiment randomly generated a code for the order of administration of the drug and provided it to another researcher (B) who was not involved in the experiment.
② 약물의 공급: 연구자 (B)가 무작위 코드에 맞게 약물을 제조하여 동일한 용기에 담아실험자에게 공급하였다.  ② Supply of the drug: The researcher (B) prepared the drug according to the random code and put it in the same container and supplied it to the experimenter.
4) 실험동물의 회생 및 조직처리 4) Regeneration and tissue treatment of experimental animals
졸레틸 (zol et i l®)과 럼푼 (rompun)을 흔합하여 복강 내로 주사하여 마취한 후 , 개흉을 시행하여 심장을 노출시켰다. 우심방을 절개하고 좌심실을 통해 연동펌프로 헤파린이 섞인 차가운 생리식염수를 관류해서 희생시켰다. 관류가 끝나면 단두를 한 뒤, 신속하게 두개골을 제거하고 뇌를 적출하였다. 적출한 뇌를 절단틀을 이용해 전두부에서부터 관상면으로 5개의 절편으로 자르며, 앞쪽부터 첫 번째 절편은 3 mm 두께로 하고 나머지는 2 1 간격으로 잘랐다. 이렇게 얻어진 1， 3， 5번째 절편은 급속냉동하여 -80 °C 초저온냉동고에 보관하고, 2 , 4번째 절편은 4% 파라포름알데히드에 고정하여 파라핀 블록을 제작했다. Zol et il® and rompun were combined and anesthetized by intraperitoneal injection, followed by an open chest to expose the heart. The right atrium was dissected and the left ventricle was sacrificed by perfusion of cold saline mixed with heparin using a peristaltic pump. After perfusion, the head was removed, and then the skull was quickly removed and the brain removed. The extracted brain was cut into five sections from the frontal region to the coronal plane using a cutting frame, and the first one from the front was cut 3 mm thick and the rest were cut at 2 1 intervals. The first, third and fifth sections thus obtained were rapidly frozen and stored in -80 ° C. cryogenic freezer, and the second and fourth sections were fixed in 4% paraformaldehyde to prepare paraffin blocks.
5) 뇌경색 예후 측정항목 및 측정방법 5) Measurement items and methods of prognosis of cerebral infarction
① 뇌경색 크기  ① cerebral infarction size
중대뇌동맥폐색-재관류 22시간째에 9.4T Bruker 동물용 MRI를 이용하여 0.5 丽 간격으로 촬영한 T2 이미지 상의 뇌경색 병변의 크기를 각 실험동물에 대해 아무런 정보가 없는 연구자가측정하여 비교하였다 (도 6) .  At 22 hours of mid-cerebral artery occlusion-reperfusion, the size of cerebral infarct lesions on T2 images taken at intervals of 0.5 D using 9.4T Bruker MRI for animals was measured and compared by the investigator who had no information for each experimental animal (FIG. 6). ).
② 뇌출혈 여부 ② Brain hemorrhage
중대뇌동맥폐색-재관류 22시간째에 9.4T Bruker 동물용 MRI로 으 5 删 간격으로 촬영한 T2* 이미지 상에서 각 실험동물에 대해 아무런 정보가 없는 Middle cerebral artery occlusion-reperfusion T2 * images taken at intervals of 5 μs with a 9.4T Bruker MRI for 22 hours showed no information for each experimental animal.
13 13
대체용지 (규칙제 26조) 연구자가뇌출혈 여부를 조사하여 비교하였다 (도 8). Alternative Paper (Article 26) The investigator compared and examined the hemorrhage (Figure 8).
③ 신경학적 장애 ③ neurological disorders
각 실험동물에 대해 아무런 정보가 없는 연구자가 신경학적 장애를 평가하였다. 뇌경색 동물모델의 신경학적 장애를 평가하는 고전적인 방법인 Longa의 측정방법으로 모든 동물의 수술 및 약물 투여 전후 아래와 같은 항목을 측정하였다.  Investigators with no information on each animal evaluated neurological disorders. Longa, a classical method for evaluating neurological disorders in cerebral infarction animal models, measured the following items before and after surgery and drug administration in all animals.
꼬리를 잡고 거꾸로 들었을 때 우측 앞발로 책상 모서리를 잡을 수 없거나 그 힘이 미약할 때 (1점), 우측 앞다리를 완전히 내전 시키는 경우 (2점)， 한쪽 방향으로만 도는 경우 (3점)， 및 지면에 내려놓고 몸통을 옆으로 부드럽게 밀 때 버티는 힘이 감소하여 쓰러지는 경우 (4점)로 0점에서 4점으로 갈수록 신경학적 장애가 심각함을 나타낸다.  When holding the tail upside down and unable to grasp the edge of the desk with the right forefoot or when the strength is weak (1 point), when the right forelimb is fully extended (2 points), when turning in only one direction (3 points), and If you put it down on the ground and push your body gently to the side, the support force decreases and you fall down (4 points). The neurological disorder is more severe from 0 to 4 points.
Fc-삭사틸린의 항염증 기전 Anti-inflammatory mechanism of Fc-saxatilin
1) 뇌조직 내 호중구 침투량 분석 1) Analysis of neutrophil infiltration in brain tissue
각 개체의 투여 약물에 대한 정보를 전혀 모르는 연구자가 motorized stage가 장착되어 있는 정립 광학현미경 (Carl Zeiss, Germany)와 스테레오 인베스티게이터 (stereo investigator, MBF bioscience, USA)를 이용하여 동측성 반구 (ipsilateral hemisphere)의 뇌경색 부위 및 비-뇌경색 부위의 염색된 세포 수를 측정하고, 대측성 반구 (contralateral hemisphere) 상응 부위의 세포 수를 측정하여 Fc-삭사틸린 투여군과 대조군의 뇌조직 내 면역세포 유입량을 비교하였다. 실험결과  Researchers who do not know any information about the drug administered by each individual are using ipsilateral hemispheres with a stereoscopic microscope (Carl Zeiss, Germany) equipped with a motorized stage and a stereo investigator (MBF bioscience, USA). The number of stained cells in the cerebral infarction region and the non-cerebral infarction region of hemisphere, and the number of cells in the contralateral hemisphere corresponding region were measured to compare the influx of immune cells into the brain tissue of the Fc-saxatilin-administered group It was. Experiment result
백혈구와 삭사틸린의 상호작용 White blood cell interaction with saxatilin
BSA를 처리한 군과 삭사틸린을 처리한 군을 비교한 결과， 삭사틸린을 처리한 군에서 그래프의 이동 (shi ft)이 나타났으며, PMA 또는 fMLP를 함께 처리한 군이 처리하지 않은 군보다 더 많이 이동되었다. 이는 삭사틸린이 백혈구와 상호작용함을 의미한다 (도 4). 인테그린과 삭사틸린의 결합  As a result of comparing the BSA treated group with the saxatilin-treated group, the graph showed shift (shi ft) in the saxatilin-treated group, and the group treated with PMA or fMLP was compared with the untreated group. Moved more. This means that saxatilin interacts with leukocytes (FIG. 4). Combination of Integrin and Saxatilin
14 14
대체용지 (규칙제 26조) 인테그린 αΜβ2 및 αίβ2는 중성구에 존재하는 인테그린으로, 내피세포에 존재하는 ICAM-l(Intercellular Adhesion Molecule 1)과 상호작용하여 중성구가 내피세포에 모이도록 한다. ELISA를 이용한 결합 분석 결과, Fc-삭사틸린은 인테그린 αΜρ2 및 aLi32와 강하게 결합하였다 (Kd, 6.9 10"9 M 및 9.2ΧΚΓ9 M) . 또한 Fc-삭사틸린 보다는 약하지만 삭사틸린 -Fc도 인테그린 αΜβ2 및 aL|32와 결합하였다 (Kd, 3.0X10"7 M 및 4.4X10—7 M) (표 2 내지 3 및 도 5). Alternative Paper (Article 26) Integrins αΜβ2 and αίβ2 are integrins present in neutrophils, which interact with ICAM-1 (Intercellular Adhesion Molecule 1) present in endothelial cells to collect neutrophils in endothelial cells. As a result of binding assay using ELISA, Fc-saxatilin bound strongly with integrin α Μ ρ 2 and a L i3 2 (Kd, 6.9 10 "9 M and 9.2ΧΚΓ 9 M) .Also weaker than Fc-saxatilin, but motilin -Fc also integrin α Μ β 2 and a L | were combined with 3 2 (Kd, 3.0X10 "7 M and 4.4X10- 7 M) (tables 2 to 3 and 5).
【표 2]  [Table 2]
Figure imgf000017_0001
Figure imgf000017_0001
뇌경색 동물모델 실험 Cerebral Infarction Animal Model Experiment
① 뇌경색 크기  ① cerebral infarction size
대조군 (P cebo)과 비교하여 Fc-삭사틸린 투여군의 뇌경색 크기가 모수적으로 비교했을 때， 약 31%, 비모수적으로 비교했을 때 약 49% 작았다. 이는 Fc-삭사틸린이 뇌경색 크기를 감소시키는 효능이 있음을 의미한다 (도 7).  Compared with the control group (P cebo), the cerebral infarct size of the Fc-saxatilin-administered group was about 31% when compared parametrically and about 49% when compared non-parametrically. This means that Fc-saxatilin has the effect of reducing cerebral infarct size (FIG. 7).
© 뇌출혈 여부 © Brain hemorrhage
【표 4】  Table 4
15 15
대체용지 (규칙 제 26조) - 대조군 Fc-삭사틸린 P-값 뇌내출혈 ( ICH) 6/10(60%) 7/11(63%) >0.9999 지주막하출혈 (SAH) 2/10(20%) 2/11( 18.2%) >0.9999 뇌내출혈 ( Intracerebral hemorrhage ; ICH) 및 지주막하출혈 (Subarachnoid hemorrhage ; SAH) , 모두 Fc-삭사틸린 투여군과 대조군사이의 차이가 없었다 (표 4) . Alternative Site (Article 26) Control Fc-Saxatilin P-Value Intracerebral Hemorrhage (ICH) 6/10 (60%) 7/11 (63%)> 0.9999 Subarachnoid hemorrhage (SAH) 2/10 (20%) 2/11 (18.2%) > 0.9999 Intracerebral hemorrhage (ICH) and Subarachnoid hemorrhage (SAH) were not different between the Fc-saxatilin-treated group and the control group (Table 4).
본 실험에서 사용한 4 mg/kg Fc-삭사틸린 투여는 마우스 뇌경색 모델에서 뇌출혈을 증가시키지 않음을 의미한다.  Administration of 4 mg / kg Fc-saxatilin used in this experiment means no increase in cerebral hemorrhage in mouse cerebral infarction model.
③ 신경학적 장애 ③ neurological disorders
신경학적 장애의 정도는 Fc—삭사틸린 투여군 및 대조군 사이에 유의한 차이를 보이지 않았다 (도 9) .  The degree of neurological disorder did not show a significant difference between the Fc—saxatilin administration group and the control group (FIG. 9).
④사망를 ④ death
사망한 개체 수는 Fcᅳ삭사틸린 투여군 18마리 증 6마리, 대조군 16마리 중 4마리였으며, 이 중 Fc-삭사틸린 투여군의 4마리와 대조군의 2마리는 장시간 MRI 촬영에 의한 마취사였다. Fc-삭사틸린 투여군과 대조군의 사망를은 차이가 없었다 (표 5) .  The number of deaths was 6 of 18 Fc 증 saxatilin-treated groups and 4 of 16 controls. Of these, 4 of the Fc-saxatilin-treated groups and 2 of the controls were anesthetized by prolonged MRI. There was no difference in mortality between the Fc-saxatilin-treated and control groups (Table 5).
【표 5]  [Table 5]
Figure imgf000018_0001
Figure imgf000018_0001
⑤ Fc-삭사틸린의 항염증 기전 ⑤ anti-inflammatory mechanism of Fc-saxatilin
Fc-삭사틸린의 뇌경색 감소 효능이 항염증 효과에 기인하는 것인지 여부를 확인하기 위해, 뇌조직 내 호중구 (neutrophi l ) 침투량을 정량 분석하였다 (도 10) . 대조군에 비해 Fc-삭사틸린 투여군에서 뇌경색 반구 내 호증구 침투량이 유의하게 적었다. 이로써 뇌경색 발병 시 일어나는 면역세포의 뇌조직 내 침투를 Fc-삭사틸린이 억제하여 추가적인 염증반응에  To determine whether the effect of reducing Fc-saxatilin cerebral infarction is due to anti-inflammatory effects, the amount of neutrophil infiltration in brain tissue was quantitatively analyzed (FIG. 10). Compared to the control group, the Fc-saxatilin-administered group had significantly lower neutrophil infiltration in the cerebral infarction hemisphere. As a result, Fc-saxatilin inhibits the penetration of immune cells into the brain tissue that occurs during cerebral infarction.
16 16
대체용지 (규칙 제 26조) 의한 이차적인 뇌손상을 방지하는 역할을 함으로써 궁극적으로 뇌경색의 크기를 감소시키는 기전을 확인하였다. 결론 Alternative Site (Article 26) By preventing the secondary brain damage caused by the mechanism that ultimately reduces the size of cerebral infarction was identified. conclusion
삭사틸린이 중성구 표면의 인테그린에 결합하여 내피 세포와의 상호작용을 저해하므로 허혈성 손상에 의해 유도되는 신경염증을 억제할 수 있다. 또한， Fc-삭사틸린은 면역세포의 뇌조직 내 침투를 억제하여 염증반응을 억제할 수 있다. 이상으로 본 발명의 특정한 부분을 상세히 기술하였는바， 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현예일뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.  Saxatilin binds to integrins on the surface of neutrophils and inhibits interaction with endothelial cells, thereby inhibiting neuroinflammatory inflammation induced by ischemic injury. In addition, Fc-saxatilin can inhibit the inflammatory response by inhibiting the penetration of immune cells into brain tissue. The specific parts of the present invention have been described in detail above, and it is apparent to those skilled in the art that these specific technologies are merely preferred embodiments, and thus the scope of the present invention is not limited thereto. Therefore, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.
17 17
대체용지 (규칙제 26조) Alternative Paper (Article 26)

Claims

【특허청구범위】 【Patent Claims】
【청구항 U 【Claim U
(a) RGD 모티프를 포함하는 펩타이드 또는 단백질의 약제학적 유효량; (b) 약제학적으로 허용되는 담체를 포함하는 신경염증 예방， 억제 또는 치료용 약제학적 조성물. (a) a pharmaceutically effective amount of a peptide or protein comprising an RGD motif; (b) A pharmaceutical composition for preventing, suppressing or treating neuroinflammation containing a pharmaceutically acceptable carrier.
【청구항 2】 【Claim 2】
제 1 항에 있어서, 상기 RGD 모티프를 포함하는 펩타이드 또는 단백질은 서열목록 제 1서열의 삭사틸린 (saxat i l in) 또는 이의 유사체인 것을 특징으로 하는 조성물. The composition according to claim 1, wherein the peptide or protein containing the RGD motif is saxatilin or an analog thereof of sequence 1 in the sequence listing.
【청구항 3】 【Claim 3】
제 2 항에 있어서， 상기 삭사틸린은 면역글로불린 ( immunoglobul in)의 Fc 영역이 컨쥬게이션 (conjugat ion)된 삭사틸린인 것을 특징으로 하는 조성물. The composition according to claim 2, wherein the saxatilin is saxatilin in which the Fc region of an immunoglobulin is conjugated.
【청구항 4】 【Claim 4】
제 3 항에 있어서, 상기 면역글로불린의 Fc 영역은 상기 삭사틸린의 N—말단 또는 C-말단에 컨쥬게이션되어 있는 것을 특징으로 하는 조성물. The composition according to claim 3, wherein the Fc region of the immunoglobulin is conjugated to the N-terminus or C-terminus of the saxatilin.
【청구항 5】 【Claim 5】
제 4 항에 있어서， 상기 삭사틸린은 면역글로불린의 Fc 영역이 그의 N-말단에 컨쥬게이션된 Fc-삭사틸린인 것을 특징으로 하는 조성물. The composition according to claim 4, wherein the saxatilin is Fc-saxatilin in which the Fc region of an immunoglobulin is conjugated to its N-terminus.
【청구항 6】 【Claim 6】
제 1 항에 있어서， 상기 신경염증은 뇌졸중, 뇌경색, 뇌혈전증, 뇌색전증 또는 뇌허혈에 수반되는 신경염증인 것을 특징으로 하는 조성물. The composition according to claim 1, wherein the neuroinflammation is neuroinflammation accompanying stroke, cerebral infarction, cerebral thrombosis, cerebral embolism, or cerebral ischemia.
【청구항 7】 ― 【Claim 7】 ―
제 1 항에 있어서， 상기 RGD 모티프를 포함하는 펩타이드 또는 단백질은 중성구 (neutrophi l )에 존재하는 인테그 '린 α Μ 2 에 대하여 1 X The method of claim 1, wherein the peptide or protein containing the RGD motif is 1
18 18
대체용지 (규칙 제 26조) 10"8 내지 1 x 1으10 M의 Kd(dissociation constant) 값의 결합력을 갖는 것을 특징으로 하는 조성물. Substitute paper (Rule Article 26) A composition characterized by having a binding force of 10 "8 to 1 x 1 and a Kd (dissociation constant) value of 10 M.
【청구항 8】 【Claim 8】
제 1 항에 있어서, 상기 RGD 모티프를 포함하는 펩타이드 또는 단백질은 중성구 (neutrophil)에 존재하는 인테그린 aLi32 에 대하여 1 X 10"8 내지 1 X 10"10 M의 KcKdissociation constant) 값의 결합력을 갖는 것을 특징으로 하는 조성물. The method of claim 1, wherein the peptide or protein containing the RGD motif has a binding affinity of a KcKdissociation constant of 1 A composition characterized by having.
【청구항 9】 【Claim 9】
제 1 항에 있어서, 상기 RGD 모티프를 포함하는 펩타이드 또는 단백질은 혈소판의 GPIIb/IIIa, 증성구에 존재하는 인테그린 αΜβ2 및 L&2 에 대하여 결합능을 갖는 것을특징으로 하는 조성물. The composition of claim 1, wherein the peptide or protein containing the RGD motif has binding ability to GPIIb/IIIa of platelets and integrins αΜβ2 and L& 2 present in hypertrophic cells.
【청구항 10】 【Claim 10】
제 1 항에 있어서， 상기 약제학적 조성물은 혈전에 의해 혈관이 폐색된 환자에 투여되는 용도를 갖는 것을특징으로 하는 조성물. The composition according to claim 1, wherein the pharmaceutical composition is administered to a patient whose blood vessel is occluded by a blood clot.
【청구항 111 【Claim 111
(a) RGD 모티프를 포함하는 펩타이드 또는 단백질의 약제학적 유효량; (b) 약제학적으로 허용되는 담체를 포함하는 신경염증 예방, 억제 또는 치료 방법 . (a) a pharmaceutically effective amount of a peptide or protein comprising an RGD motif; (b) A method for preventing, inhibiting, or treating neuroinflammation comprising a pharmaceutically acceptable carrier.
[청구항 12】 [Claim 12]
제 11 항에 있어서， 상기 RGD 모티프를 포함하는 펩타이드 또는 단백질은 서열목록 제 1서열의 삭사틸린 (saxatilin) 또는 이의 유사체인 것을 특징으로 하는 방법 . The method according to claim 11, wherein the peptide or protein containing the RGD motif is saxatilin or an analog thereof in the first sequence of the sequence listing.
[청구항 13】 [Claim 13]
제 12 항에 있어서， 상기 삭사틸린은 면역글로불린 (ί薩 unoglobulin)의 Fc 영역이 컨쥬게이션 (conjugat ion)된 The method of claim 12, wherein the saxatilin is a conjugat ion of the Fc region of immunoglobulin (ί薩 unoglobulin).
19 19
대체용지 (규칙제 26조) 삭사틸린인 것을 특징으로 하는 방법 . Substitute paper (Article 26 of the Rules) A method characterized in that saxatilin.
【청구항 14】 【Claim 14】
제 13 항에 있어서, 상기 면역글로불린의 Fc 영역은 상기 삭사틸린의 N-말단 또는 Cᅳ말단에 컨쥬게이션되어 있는 것을 특징으로 하는 방법. The method of claim 13, wherein the Fc region of the immunoglobulin is conjugated to the N-terminus or C-terminus of the saxatilin.
【청구항 15】 【Claim 15】
제 14 항에 있어서， 상기 삭사틸린은 면역글로불린의 Fc 영역이 그의 Nᅳ말단에 컨쥬게이션된 Fc—삭사틸린인 것을 특징으로 하는 방법 . The method according to claim 14, wherein the saxatilin is Fc-saxatilin in which the Fc region of an immunoglobulin is conjugated to its N-terminus.
【청구항 16】 【Claim 16】
제 11 항에 있어서, 상기 신경염증은 뇌졸증, 뇌경색, 뇌혈전증, 뇌색전증 또는 뇌허혈에 수반되는 신경염증인 것을 특징으로 하는 방법. The method of claim 11, wherein the neuroinflammation is neuroinflammation accompanying stroke, cerebral infarction, cerebral thrombosis, cerebral embolism, or cerebral ischemia.
【청구항 17】 【Claim 17】
제 11 항에 있어서, 상기 RGD 모티프를 포함하는 펩타이드 또는 단백질은 중성구 (neutrophil)에 존재하는 인테그린 αΜβ2 에 대하여 1 X 1으 8 내지 1 X 10""10 Μ의 Kd(dissociation constant) 값의 결합력을 갖는 것을 특징으로 하는 방법 . The method of claim 11 , wherein the peptide or protein containing the RGD motif has a Kd (dissociation constant) value of 1 A method characterized by having a binding force of .
【청구항 18] [Claim 18]
제 11 항에 있어서， 상기 RGD 모티프를 포함하는 펩타이드 또는 단백질은 중성구 (neutrophil)에 존재하는 인테그린 aLp2 에 대하여 1 X 10— 8 내지 1 X 10_10 M의 KcKdissociation constant) 값의 결합력을 갖는 것을 특징으로 하는 방법. The method of claim 11, wherein the peptide or protein containing the RGD motif has a binding affinity of a KcKdissociation constant of 1 A method characterized by:
[청구항 19】 [Claim 19]
제 11 항에 있어서， 상기 RGD 모티프를 포함하는 펩타이드 또는 단백질은 혈소판의 GPIIb/IIIa, 중성구에 존재하는 인테그린 αΜβ2 및 aLi32 에 대하여 결합능을 갖는 것을 특징으로 하는 방법. The method of claim 11, wherein the peptide or protein containing the RGD motif has binding ability to GPIIb/IIIa of platelets and integrins α Μ β 2 and a L i3 2 present in neutrophils.
20 20
대체용지 (규칙제 26조) 【청구항 20】 Substitute paper (Article 26 of the Rules) 【Claim 20】
제 11 항에 있어서, 상기 방법은 혈전에 의해 혈관이 폐색된 환자에 투여되는 용도를 갖는 것을 특징으로하는 방법ᅳ The method according to claim 11, wherein the method is administered to a patient whose blood vessel is occluded by a blood clot.
21 21
대체용지 (규칙 제 26조) Substitute paper (Rule Article 26)
PCT/KR2015/003122 2014-03-28 2015-03-30 Composition for preventing, inhibiting, or treating neuritis, containing peptide or protein including rgd motif WO2015147616A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2014-0037128 2014-03-28
KR20140037128 2014-03-28

Publications (1)

Publication Number Publication Date
WO2015147616A1 true WO2015147616A1 (en) 2015-10-01

Family

ID=54196022

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2015/003122 WO2015147616A1 (en) 2014-03-28 2015-03-30 Composition for preventing, inhibiting, or treating neuritis, containing peptide or protein including rgd motif

Country Status (2)

Country Link
KR (1) KR101724129B1 (en)
WO (1) WO2015147616A1 (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080188413A1 (en) * 2006-12-26 2008-08-07 Woei-Jer Chuang Disintegrin variants and pharmaceutical uses thereof
KR20120057429A (en) * 2010-11-26 2012-06-05 단국대학교 산학협력단 Fusion protein using for bone and teeth regeneration
KR20120130752A (en) * 2009-12-23 2012-12-03 내셔널 타이완 유니버시티 Compositions and methods for the treatment of angiogenesis-related eye diseases
WO2013049200A1 (en) * 2011-09-26 2013-04-04 University Of Louisville Research Foundation, Inc. Methods of treating periodontal inflammation and periodontal bone loss

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2679400T3 (en) * 2010-11-01 2018-08-27 Industry-Academic Cooperation Foundation, Yonsei University Composition for use for thrombus dissolution

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080188413A1 (en) * 2006-12-26 2008-08-07 Woei-Jer Chuang Disintegrin variants and pharmaceutical uses thereof
KR20120130752A (en) * 2009-12-23 2012-12-03 내셔널 타이완 유니버시티 Compositions and methods for the treatment of angiogenesis-related eye diseases
KR20120057429A (en) * 2010-11-26 2012-06-05 단국대학교 산학협력단 Fusion protein using for bone and teeth regeneration
WO2013049200A1 (en) * 2011-09-26 2013-04-04 University Of Louisville Research Foundation, Inc. Methods of treating periodontal inflammation and periodontal bone loss

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
FRANKE: "Role of G protein-coupled receptors (GPCRs) for purines and pyrimidines in mediating degeneration and regeneration under neuroinflammatory processes", PURINERGIC SIGNALING, vol. 7, 2011, pages 1 - 5, XP055227100 *

Also Published As

Publication number Publication date
KR101724129B1 (en) 2017-04-10
KR20150114420A (en) 2015-10-12

Similar Documents

Publication Publication Date Title
US10994010B2 (en) Selective targeting of the CD40L/Mac-1 interaction by small peptide inhibitors and its use for the treatment of inflammation and atherogenesis
TAYLOR et al. Lactadherin (formerly BA46), a membrane-associated glycoprotein expressed in human milk and breast carcinomas, promotes Arg-Gly-Asp (RGD)-dependent cell adhesion
AU2008296733B2 (en) VEGFR-1/NRP-1 targeting peptides
JP7365715B2 (en) Bispecific therapeutic proteins for tissue repair
JPH06509551A (en) Platelet aggregation inhibitor with high specificity for Gp II↓bIII↓a
AU7328891A (en) C4 binding protein fusion proteins
US8324344B2 (en) Membrane transduction peptides and methods of delivering material to a target cell
US9388213B2 (en) Polycomb repressive complex 2 (PRC2) inhibitors and uses thereof
CA2161971A1 (en) Recombinant bpi-based and lbp-based proteins, nucleic acid molecules encoding same, methods of producing same, and uses thereof
Li et al. pHLIP-mediated targeting of truncated tissue factor to tumor vessels causes vascular occlusion and impairs tumor growth
Thorne et al. CD36 forms covalently associated dimers and multimers in platelets and transfected COS-7 cells
BR112021008832A2 (en) MININUCLEOsome CORE PROTEINS AND USE IN NUCLEIC ACID DISTRIBUTION
AU690421B2 (en) Anti-inflammatory CD14 peptides
JP5208135B2 (en) Recombinant leukocyte inhibitory factor and hirugen chimeric protein and drug composition thereof
EA027336B1 (en) Fragments of daxx protein inhibiting apoptosis, peptidomimetics, conjugates and compositions thereof and use thereof
von Ungern-Sternberg et al. Extracellular cyclophilin a augments platelet-dependent thrombosis and thromboinflammation
JP2008537877A (en) RAGE / DIAPHANUSUS interaction and related compositions and methods
WO2015147616A1 (en) Composition for preventing, inhibiting, or treating neuritis, containing peptide or protein including rgd motif
US20130108580A1 (en) Fusion protein and its uses
WO2017015553A1 (en) Compositions and methods for producing pro-inflammatory macrophages
Zen et al. Binding site on human C‐reactive Protein (CRP) recognized by the Leukocyte CRP‐receptor
JP4139508B2 (en) Human delta 3
JP4332581B2 (en) Human delta-3
ES2956439T3 (en) fusion protein
Agah et al. Isolation, characterization, and cloning of porcine complement component C7

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15768276

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase
122 Ep: pct application non-entry in european phase

Ref document number: 15768276

Country of ref document: EP

Kind code of ref document: A1