WO2016066671A1 - Method for treating resistant cancers using progastrin inhibitors - Google Patents

Abstract

The disclosure relates to a compound which is an antagonist of progastrin or an inhibitor of the progastrin expression for use to improve the sensitivity of cancer cells to radiotherapy.

Description

METHOD FOR TREATING RADIORESISTANCE CANCERS

FIELD OF THE INVENTION:

The present invention relates to a compound which is an antagonist of progastrin or an inhibitor of the progastrin expression for use to improve the sensitivity of cancer cells to radiotherapy.

BACKGROUND OF THE INVENTION:

Colorectal cancers represent more than 1.2 million of new cases and more than 600000 deaths per year worldwide. Although the survival for patients with metastatic CRC has been improved significantly over the past two decades, the 5-year survival rates still remain low at about 10%. Rectal cancers account for about 40% of the total colorectal cancers. The standard treatment for advanced rectal cancers consists of a preoperative chemoradiotherapy followed by surgery. Although this approach reduces the risk of local recurrence, a high percentage of advanced rectal cancers are resistant to preoperative chemoradiotherapy. At least half the patients fail to achieve sufficient T-stage downstaging. In addition, the risk of metastatic disease in 30-40% of cases remains high. These observations highlight the problem of radioresistance for these patients. Therefore, increasing the efficiency of radiotherapy by specific targeting of factors involved in radioresistance seems a promising strategy to improve the curative resection rate and to reduce the high risk of metastasis. However to date, there is no targeted therapy used in clinic to radiosensitize rectal tumors. Therefore there is a need to identify new factors involved in rectal tumors radioresistance and to target these factors to increase the response to radiotherapy.

The hormone precursor progastrin (PG) is a growth factor that can potentially play a prominent role in proliferation of normal and cancerous colorectal cells. Transgenic mice overexpressing progastrin present an increased proliferative index and hyperplasia in colonic mucosa. They also have an increased risk of developing preneoplastic lesions (aberrant crypt foci) and adenocarcinomas in colonic epithelium when treated with a carcinogen, azoxymethane (Singh et al, 2000; Wang et al, 1996). The role of progastrin in proliferation, survival and migration of human colorectal cancer cells has also been clearly established (Baldwin et al, 2001; Brown et al, 2003; HoUande et al, 2003; Singh et al, 2003; Umar et al, 2008; Wu et al, 2003).

High concentrations of PG are found in colon and rectal tumours of 80% of patients with colorectal cancer. Surgical resection of the tumour induces a dramatic decrease of PG levels in the serum, suggesting that the tumour itself is the source of PG (Nemeth et al, 1993; Siddheshwar et al, 2001; Van Solinge et al, 1993). In contrast, this hormone precursor is absent from the healthy colorectal epithelium. In addition, a significant percentage of human colorectal cancer cells have been shown to require the expression of progastrin-like peptides for maintaining the in vitro and in vivo growth of the cells. Depletion of endogenous progastrin produced by colorectal cancer cells, leads to an inhibition of proliferation in vitro and tumour growth in vivo (Grabowska et al, 2007; Pannequin et al, 2009).

SUMMARY OF THE INVENTION: The inventors show that progastrin remains highly expressed after irradiation in rectal tumors of patients resistant to radiotherapy and in residual cancer cells resistant to radiation.

Moreover, they show, in-vitro and in-vivo, that the inhibition of progastrin expression or activity can enhance the radiosensitivity of cancer cells.

Thus, the present invention relates to a compound which is an antagonist of progastrin or an inhibitor of the progastrin expression for use to improve the sensitivity of cancer cells to radiotherapy.

DETAILED DESCRIPTION OF THE INVENTION:

The invention relates to a compound which is an antagonist of progastrin or an inhibitor of the progastrin expression for use to improve the sensitivity of cancer cells to radiotherapy.

In other word, the invention relates to a compound which is an antagonist of progastrin or an inhibitor of the progastrin expression for use to enhance the sensitivity of cancer cells to radiotherapy.

In other word, the invention relates to a compound which is an antagonist of progastrin or an inhibitor of the progastrin expression to improve the sensitivity of cancer cells to radiotherapy. In other word, the invention relates to a compound which is an antagonist of progastrin or an inhibitor of the progastrin expression to enhance the sensitivity of cancer cells to radiotherapy. In another embodiment, the compound according to the invention can be used to reduce the tumoral mass of the cancer before surgery or resection.

In another embodiment, the invention relates to a compound which is an antagonist of progastrin or an inhibitor of the progastrin expression for use in the treatment of resistant cancer.

In one embodiment, the cancer is resistant to radiotherapy or chemotherapy.

As used herein, the term "cancer resistant to radiotherapy" denotes a cancer which cannot be cure by using classical radiotherapy. In another particular embodiment, the compound according to the invention is administrated in combination with radiotherapy.

Thus, the invention also relates to i) compound according to the invention, and ii) a radiotherapy, as a combined preparation for simultaneous, separate or sequential for use in the treatment of resistant cancer.

In other word, the invention also relates to i) compound according to the invention, and ii) a radiotherapeutic agent, as a combined preparation for simultaneous, separate or sequential use in the treatment of resistant cancer.

In another embodiment, the invention also relates to i) compound according to the invention, and ii) a radiotherapeutic agent, as a combined preparation for simultaneous, separate or sequential use to improve the sensitivity of cancer cells to radiotherapy.

In another particular embodiment, the compound according to the invention can be used in association with a radiotherapeutic agent to reduce the tumoral mass of the cancer before surgery or resection.

Thus, the invention also relates to i) compound according to the invention, and ii) a radiotherapeutic agent, as a combined preparation for simultaneous, separate or sequential to reduce the tumoral mass of the cancer before surgery or resection.

As used herein, "radiotherapy" may consist of gamma-radiation, X-ray radiation, electrons or photons, external radiotherapy or curitherapy. As used herein, the term "radiotherapeutic agent", is intended to refer to any radio therapeutic agent known to one of skill in the art to be effective to treat or ameliorate cancer, without limitation. For instance, the radiotherapeutic agent can be an agent such as those administered in brachytherapy or radionuclide therapy. Such methods can optionally further comprise the administration of one or more additional cancer therapies, such as, but not limited to, chemotherapies, and/or another radiotherapy.

Radiotherapy is typically any kind of radiation-based treatment used for solid cancers such as colorectal cancer, prostate cancers, breast cancers, or blood cancer such as Hodgkin's and non-Hodgkin's lymphoma.

In one embodiment, the compound of the invention antagonizes or inhibits the human progastrin.

In another embodiment, the progastrin may be a prograstin like peptide like the glycine-extended gastrin G34-Gly of sequence QLGPQGPPHLVADPSK QGPWLEEEEEAYGWMDFG (SEQ ID NO: 1), the Glycine- extended gastrin G17-Gly of sequence QGPWLEEEEEAYGWMDFG (SEQ ID NO: 2) (see Seva C et al, 1994) or the C-terminal flanking peptide (CTFP) of sequence SAEDEN (SEQ ID NO: 3) (see Smith KA et al, 2006).

Thus, according to the invention, the compound according to the invention may be an antagonist of prograstin like peptide or an inhibitor of the prograstin like peptide.

In one embodiment, the cancer may be any solid cancer. Typically, the cancer may be selected from the group consisting of bile duct cancer (e.g. periphilar cancer, distal bile duct cancer, intrahepatic bile duct cancer), bladder cancer, bone cancer (e.g. osteoblastoma, osteochrondroma, hemangioma, chondromyxoid fibroma, osteosarcoma, chondrosarcoma, fibrosarcoma, malignant fibrous histiocytoma, giant cell tumor of the bone, chordoma, lymphoma, multiple myeloma), brain and central nervous system cancer (e.g. meningioma, astocytoma, oligodendrogliomas, ependymoma, gliomas, medulloblastoma, ganglioglioma, Schwannoma, germinoma, craniopharyngioma), breast cancer (e.g. ductal carcinoma in situ, infiltrating ductal carcinoma, infiltrating, lobular carcinoma, lobular carcinoma in, situ, gynecomastia), Castleman disease (e.g. giant lymph node hyperplasia, angio follicular lymph node hyperplasia), cervical cancer, colorectal cancer, endometrial cancer (e.g. endometrial adenocarcinoma, adenocanthoma, papillary serous adnocarcinroma, clear cell), esophagus cancer, gallbladder cancer (mucinous adenocarcinoma, small cell carcinoma), gastrointestinal carcinoid tumors (e.g. choriocarcinoma, chorioadenoma destruens), Hodgkin's disease, non- Hodgkin's lymphoma, Kaposi's sarcoma, kidney cancer (e.g. renal cell cancer), laryngeal and hypopharyngeal cancer, liver cancer (e.g. hemangioma, hepatic adenoma, focal nodular hyperplasia, hepatocellular carcinoma), lung cancer (e.g. small cell lung cancer, non-small cell lung cancer), mesothelioma, plasmacytoma, nasal cavity and paranasal sinus cancer (e.g. esthesioneuroblastoma, midline granuloma), nasopharyngeal cancer, neuroblastoma, oral cavity and oropharyngeal cancer, ovarian cancer, pancreatic cancer, penile cancer, pituitary cancer, prostate cancer, retinoblastoma, rhabdomyosarcoma (e.g. embryonal rhabdomyosarcoma, alveolar rhabdomyosarcoma, pleomorphic rhabdomyosarcoma), salivary gland cancer, skin cancer (e.g. melanoma, nonmelanoma skin cancer), stomach cancer, testicular cancer (e.g. seminoma, nonseminoma germ cell cancer), thymus cancer, thyroid cancer (e.g. follicular carcinoma, anaplastic carcinoma, poorly differentiated carcinoma, medullary thyroid carcinoma, thyroid lymphoma), vaginal cancer, vulvar cancer, and uterine cancer (e.g. uterine leiomyosarcoma).

In a particular embodiment, the cancer is a colorectal cancer or a colorectal adenomas.

In a particular embodiment, the invention relates to a compound which is an antagonist of progastrin or an inhibitor of the progastrin expression for use in the treatment of resistant colorectal cancer.

In still a particular embodiment, the invention relates to a compound which is an antagonist of progastrin or an inhibitor of the progastrin expression for use in the treatment of colorectal cancer resistant to radiotherapy.

In one embodiment, said antagonist of progastrin may be a low molecular weight antagonist, e. g. a small organic molecule (natural or not).

The term "small organic molecule" refers to a molecule (natural or not) of a size comparable to those organic molecules generally used in pharmaceuticals. The term excludes biological macromolecules (e. g., proteins, nucleic acids, etc.). Particular small organic molecules range in size up to about 10000 Da, more particularly up to 5000 Da, more particularly up to 2000 Da and most particularly up to about 1000 Da.

In one embodiment, the antagonist may bind to progastrin and block the binding of other compound on progastrin or block the binding of progastrin to its receptor. In another embodiment, antagonist of progastrin of the invention may be an anti- progastrin antibody which neutralizes progastrin or an anti-progastrin fragment thereof which neutralizes progastrin.

Antibodies directed against progastrin can be raised according to known methods by administering the appropriate antigen or epitope to a host animal selected, e.g., from pigs, cows, horses, rabbits, goats, sheep, and mice, among others. Various adjuvants known in the art can be used to enhance antibody production. Although antibodies useful in practicing the invention can be polyclonal or monoclonal antibodies. Monoclonal antibodies against progastrin can be prepared and isolated using any technique that provides for the production of antibody molecules by continuous cell lines in culture. Techniques for production and isolation include but are not limited to the hybridoma technique originally described by Kohler and Milstein (1975); the human B-cell hybridoma technique (Cote et al., 1983); and the EBV-hybridoma technique (Cole et al. 1985). Alternatively, techniques described for the production of single chain antibodies (see e.g., U.S. Pat. No. 4,946,778) can be adapted to produce anti-progastrin single chain antibodies. Progastrin antagonists useful in practicing the present invention also include anti-progastrin antibody fragments including but not limited to F(ab')2 fragments, which can be generated by pepsin digestion of an intact antibody molecule, and Fab fragments, which can be generated by reducing the disulfide bridges of the F(ab')2 fragments. Alternatively, Fab and/or scFv expression libraries can be constructed to allow rapid identification of fragments having the desired specificity to progastrin.

Humanized anti-progastrin antibodies and antibody fragments therefrom can also be prepared according to known techniques. "Humanized antibodies" are forms of non-human (e.g., rodent) chimeric antibodies that contain minimal sequence derived from non-human immunoglobulin. For the most part, humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a hypervariable region (CDRs) of the recipient are replaced by residues from a hypervariable region of a non-human species (donor antibody) such as mouse, rat, rabbit or nonhuman primate having the desired specificity, affinity and capacity. In some instances, framework region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues. Furthermore, humanized antibodies may comprise residues that are not found in the recipient antibody or in the donor antibody. These modifications are made to further refine antibody performance. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the hypervariable loops correspond to those of a non-human immunoglobulin and all or substantially all of the FRs are those of a human immunoglobulin sequence. The humanized antibody optionally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. Methods for making humanized antibodies are described, for example, by Winter (U.S. Pat. No. 5,225,539) and Boss (Celltech, U.S. Pat. No. 4,816,397).

Then, for this invention, neutralizing antibodies of progastrin are selected.

In one embodiment, the antibody binds the N-terminal region of the human progastrin.

In a particular embodiment, the antibody anti-progastrin according to the invention may be an antibody as explained in the patent application WO2011045080.

In still another embodiment, progastrin antagonists may be selected from aptamers. Aptamers are a class of molecule that represents an alternative to antibodies in term of molecular recognition. Aptamers are oligonucleotide or oligopeptide sequences with the capacity to recognize virtually any class of target molecules with high affinity and specificity. Such ligands may be isolated through Systematic Evolution of Ligands by Exponential enrichment (SELEX) of a random sequence library, as described in Tuerk C. and Gold L., 1990. The random sequence library is obtainable by combinatorial chemical synthesis of DNA. In this library, each member is a linear oligomer, eventually chemically modified, of a unique sequence. Possible modifications, uses and advantages of this class of molecules have been reviewed in Jayasena S.D., 1999. Peptide aptamers consists of a conformationally constrained antibody variable region displayed by a platform protein, such as E. coli Thioredoxin A that are selected from combinatorial libraries by two hybrid methods (Colas et al, 1996).

Then, for this invention, neutralizing aptamers of progastrin are selected.

In another embodiment, progastrin antagonists may be selected from peptides or peptides mimetic.

For example, the peptide can be the peptide JMV1155 (see Litvak DA et al, 1999). In a particular embodiment, the peptide JMV1 155 antagonizes the Gly cine-extended gastrin G17-Gly.

In a particular embodiment, the compound according to the invention is an inhibitor of progastrin expression. Small inhibitory R As (siR As) can also function as inhibitors of progastrin gene expression for use in the present invention. Progastrin gene expression can be reduced by contacting a subject or cell with a small double stranded R A (dsR A), or a vector or construct causing the production of a small double stranded RNA, such that progastrin gene expression is specifically inhibited (i.e. RNA interference or RNAi). Methods for selecting an appropriate dsRNA or dsRNA-encoding vector are well known in the art for genes whose sequence is known (e.g. see for example Tuschl, T. et al. (1999); Elbashir, S. M. et al. (2001); Hannon, GJ. (2002); McManus, MT. et al. (2002); Brummelkamp, TR. et al. (2002); U.S. Pat. Nos. 6,573,099 and 6,506,559; and International Patent Publication Nos. WO 01/36646, WO 99/32619, and WO 01/68836).

Ribozymes can also function as inhibitors of progastrin gene expression for use in the present invention. Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. The mechanism of ribozyme action involves sequence specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleo lytic cleavage. Engineered hairpin or hammerhead motif ribozyme molecules that specifically and efficiently catalyze endonucleo lytic cleavage of progastrin mRNA sequences are thereby useful within the scope of the present invention. Specific ribozyme cleavage sites within any potential RNA target are initially identified by scanning the target molecule for ribozyme cleavage sites, which typically include the following sequences, GUA, GUU, and GUC. Once identified, short RNA sequences of between about 15 and 20 ribonucleotides corresponding to the region of the target gene containing the cleavage site can be evaluated for predicted structural features, such as secondary structure, that can render the oligonucleotide sequence unsuitable. The suitability of candidate targets can also be evaluated by testing their accessibility to hybridization with complementary oligonucleotides, using, e.g., ribonuclease protection assays.

Both antisense oligonucleotides and ribozymes useful as inhibitors of progastrin gene expression can be prepared by known methods. These include techniques for chemical synthesis such as, e.g., by solid phase phosphoramadite chemical synthesis. Alternatively, anti-sense RNA molecules can be generated by in vitro or in vivo transcription of DNA sequences encoding the RNA molecule. Such DNA sequences can be incorporated into a wide variety of vectors that incorporate suitable RNA polymerase promoters such as the T7 or SP6 polymerase promoters. Various modifications to the oligonucleotides of the invention can be introduced as a means of increasing intracellular stability and half-life. Possible modifications include but are not limited to the addition of flanking sequences of ribonucleotides or deoxyribonucleotides to the 5' and/or 3' ends of the molecule, or the use of phosphorothioate or 2'-0-methyl rather than phosphodiesterase linkages within the oligonucleotide backbone.

Antisense oligonucleotides siRNAs and ribozymes of the invention may be delivered in vivo alone or in association with a vector. In its broadest sense, a "vector" is any vehicle capable of facilitating the transfer of the antisense oligonucleotide siRNA or ribozyme nucleic acid to the cells and particularly cells expressing progastrin. Particularly, the vector transports the nucleic acid to cells with reduced degradation relative to the extent of degradation that would result in the absence of the vector. In general, the vectors useful in the invention include, but are not limited to, plasmids, phagemids, viruses, other vehicles derived from viral or bacterial sources that have been manipulated by the insertion or incorporation of the antisense oligonucleotide siRNA or ribozyme nucleic acid sequences. Viral vectors are a particular type of vector and include, but are not limited to nucleic acid sequences from the following viruses: retrovirus, such as moloney murine leukemia virus, harvey murine sarcoma virus, murine mammary tumor virus, and rouse sarcoma virus; adenovirus, adeno-associated virus; SV40-type viruses; polyoma viruses; Epstein-Barr viruses; papilloma viruses; herpes virus; vaccinia virus; polio virus; and RNA virus such as a retrovirus. One can readily employ other vectors not named but known to the art.

Particular viral vectors are based on non-cytopathic eukaryotic viruses in which nonessential genes have been replaced with the gene of interest. Non-cytopathic viruses include retroviruses (e.g., lentivirus), the life cycle of which involves reverse transcription of genomic viral RNA into DNA with subsequent proviral integration into host cellular DNA. Retroviruses have been approved for human gene therapy trials. Most useful are those retroviruses that are replication-deficient (i.e., capable of directing synthesis of the desired proteins, but incapable of manufacturing an infectious particle). Such genetically altered retroviral expression vectors have general utility for the high-efficiency transduction of genes in vivo. Standard protocols for producing replication-deficient retroviruses (including the steps of incorporation of exogenous genetic material into a plasmid, transfection of a packaging cell lined with plasmid, production of recombinant retroviruses by the packaging cell line, collection of viral particles from tissue culture media, and infection of the target cells with viral particles) are provided in Kriegler, 1990 and in Murry, 1991).

Particular viruses for certain applications are the adeno-viruses and adeno-associated viruses, which are double-stranded DNA viruses that have already been approved for human use in gene therapy. The adeno-associated virus can be engineered to be replication deficient and is capable of infecting a wide range of cell types and species. It further has advantages such as, heat and lipid solvent stability; high transduction frequencies in cells of diverse lineages, including hemopoietic cells; and lack of superinfection inhibition thus allowing multiple series of transductions. Reportedly, the adeno-associated virus can integrate into human cellular DNA in a site-specific manner, thereby minimizing the possibility of insertional mutagenesis and variability of inserted gene expression characteristic of retroviral infection. In addition, wild-type adeno-associated virus infections have been followed in tissue culture for greater than 100 passages in the absence of selective pressure, implying that the adeno-associated virus genomic integration is a relatively stable event. The adeno- associated virus can also function in an extrachromosomal fashion.

Other vectors include plasmid vectors. Plasmid vectors have been extensively described in the art and are well known to those of skill in the art. See e.g. Sambrook et al, 1989. In the last few years, plasmid vectors have been used as DNA vaccines for delivering antigen-encoding genes to cells in vivo. They are particularly advantageous for this because they do not have the same safety concerns as with many of the viral vectors. These plasmids, however, having a promoter compatible with the host cell, can express a peptide from a gene operatively encoded within the plasmid. Some commonly used plasmids include pBR322, pUC18, pUC19, pRC/CMV, SV40, and pBlueScript. Other plasmids are well known to those of ordinary skill in the art. Additionally, plasmids may be custom designed using restriction enzymes and ligation reactions to remove and add specific fragments of DNA. Plasmids may be delivered by a variety of parenteral, mucosal and topical routes. For example, the DNA plasmid can be injected by intramuscular, eye, intradermal, subcutaneous, or other routes. It may also be administered by intranasal sprays or drops, rectal suppository and orally. It may also be administered into the epidermis or a mucosal surface using a gene-gun. The plasmids may be given in an aqueous solution, dried onto gold particles or in association with another DNA delivery system including but not limited to liposomes, dendrimers, cochleate and microencapsulation.

In a particular embodiment, the antisense oligonucleotide, siRNA, shRNA or ribozyme nucleic acid sequence is under the control of a heterologous regulatory region, e.g., a heterologous promoter. The promoter may be specific for Muller glial cells, microglia cells, endothelial cells, pericyte cells and astrocytes For example, a specific expression in Muller glial cells may be obtained through the promoter of the glutamine synthetase gene is suitable. The promoter can also be, e.g., a viral promoter, such as CMV promoter or any synthetic promoters. In one embodiment, nucleases, endonucleases or meganucleases which target the gene which codes for the progastrin can be used as compound according to the invention.

The term "nuclease" or "endonuclease" means synthetic nucleases consisting of a DNA binding site, a linker, and a cleavage module derived from a restriction endonuclease which is used for gene targeting efforts. The synthetic nucleases according to the invention exhibit increased preference and specificity to bipartite or tripartite DNA target sites comprising DNA binding (i.e. TALE recognition site(s)) and restriction endonuclease target site while cleaving at off-target sites comprising only the restriction endonuclease target site is prevented.

Example of nucleases which may be used in the present invention are disclosed in WO

2010/079430, WO2011072246, WO2013045480, Mussolino C, et al (Curr Opin Biotechnol. 2012 Oct;23(5):644-50) and Papaioannou I. et al (Expert Opinion on Biological Therapy, March 2012, Vol. 12, No. 3 : 329-342) all of which are herein incorporated by reference. A further object of the invention relates to a method of improving the sensitivity of cancer cells to radiotherapy comprising administering to a subject in need thereof a therapeutically effective amount of compound which is an antagonist of progastrin or an inhibitor of the progastrin expression.

In another embodiment, the invention relates to a method of improving the sensitivity of cancer cells to radiotherapy comprising administering to a subject in need thereof a therapeutically effective amount of i) compound according to the invention, and ii) a radio therapeutic agent, as a combined preparation for simultaneous, separate or sequential.

In another embodiment, the invention relates to a method of treating resistant cancer comprising administering to a subject in need thereof a therapeutically effective amount of a compound which is an antagonist of progastrin or an inhibitor of the progastrin expression.

Compounds of the invention may be administered in the form of a pharmaceutical composition, as defined below.

In one embodiment, said compound is an antagonist of progastrin.

By a "therapeutically effective amount" is meant a sufficient amount of compound to improve the sensitivity of cancer cells to radiotherapy. It will be understood that the total daily usage of the compounds and compositions of the present invention will be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level for any particular patient will depend upon a variety of factors including the disorder being treated and the severity of the disorder; activity of the specific compound employed; the specific composition employed, the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidental with the specific antagonist employed; and like factors well known in the medical arts. For example, it is well within the skill of the art to start doses of the compound at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. However, the daily dosage of the products may be varied over a wide range from 0.01 to 1,000 mg per adult per day. Particularly, the compositions contain 0.01, 0.05, 0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100, 250 and 500 mg of the active ingredient for the symptomatic adjustment of the dosage to the patient to be treated. A medicament typically contains from about 0.01 mg to about 500 mg of the active ingredient, particularly from 1 mg to about 100 mg of the active ingredient. An effective amount of the drug is ordinarily supplied at a dosage level from 0.0002 mg/kg to about 20 mg/kg of body weight per day, especially from about 0.001 mg/kg to 7 mg/kg of body weight per day.

The present invention also provides a pharmaceutical composition comprising an effective dose of an antagonist of progastrin according to the invention.

Any therapeutic agent of the invention may be combined with pharmaceutically acceptable excipients, and optionally sustained-release matrices, such as biodegradable polymers, to form therapeutic compositions.

"Pharmaceutically" or "pharmaceutically acceptable" refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to a mammal, especially a human, as appropriate. A pharmaceutically acceptable carrier or excipient refers to a non-toxic solid, semi-solid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type.

The form of the pharmaceutical compositions, the route of administration, the dosage and the regimen naturally depend upon the condition to be treated, the severity of the illness, the age, weight, and sex of the patient, etc. The pharmaceutical compositions of the invention can be formulated for a topical, oral, intranasal, parenteral, intraocular, intravenous, intramuscular or subcutaneous administration and the like.

Particularly, the pharmaceutical compositions contain vehicles which are pharmaceutically acceptable for a formulation capable of being injected. These may be in particular isotonic, sterile, saline solutions (monosodium or disodium phosphate, sodium, potassium, calcium or magnesium chloride and the like or mixtures of such salts), or dry, especially freeze-dried compositions which upon addition, depending on the case, of sterilized water or physiological saline, permit the constitution of injectable solutions.

The doses used for the administration can be adapted as a function of various parameters, and in particular as a function of the mode of administration used, of the relevant pathology, or alternatively of the desired duration of treatment.

In addition, other pharmaceutically acceptable forms include, e.g. tablets or other solids for oral administration; time release capsules; and any other form currently can be used.

Pharmaceutical compositions of the present invention may comprise a further therapeutic active agent. The present invention also relates to a kit comprising a compound according to the invention and a further therapeutic active agent.

In one embodiment, the pharmaceutical composition is administrated in combination with radiotherapy.

In one embodiment said therapeutic active agent is an anticancer agent. For example, said anticancer agents include but are not limited to fludarabine, gemcitabine, capecitabine, methotrexate, taxol, taxotere, mercaptopurine, thioguanine, hydroxyurea, cytarabine, cyclophosphamide, ifosfamide, nitrosoureas, platinum complexes such as cisplatin, carboplatin and oxaliplatin, mitomycin, dacarbazine, procarbazine, etoposide, teniposide, campathecins, bleomycin, doxorubicin, idarubicin, daunorubicin, dactinomycin, plicamycin, mitoxantrone, L-asparaginase, doxorubicin, epimbicm, 5-fluorouracil, taxanes such as docetaxel and paclitaxel, leucovorin, levamisole, irinotecan, estramustine, etoposide, nitrogen mustards, BCNU, nitrosoureas such as carmustme and lomustine, vinca alkaloids such as vinblastine, vincristine and vinorelbine, imatimb mesylate, hexamethyhnelamine, topotecan, kinase inhibitors, phosphatase inhibitors, ATPase inhibitors, tyrphostins, protease inhibitors, inhibitors herbimycm A, genistein, erbstatin, and lavendustin A. In one embodiment, additional anticancer agents may be selected from, but are not limited to, one or a combination of the following class of agents: alkylating agents, plant alkaloids, DNA topoisomerase inhibitors, anti-folates, pyrimidine analogs, purine analogs, DNA antimetabolites, taxanes, podophyllotoxin, hormonal therapies, retinoids, photosensitizers or photodynamic therapies, angiogenesis inhibitors, antimitotic agents, isoprenylation inhibitors, cell cycle inhibitors, actinomycins, bleomycins, anthracyclines, MDR inhibitors and Ca2+ ATPase inhibitors.

Additional anticancer agents may be selected from, but are not limited to, cytokines, chemokines, growth factors, growth inhibitory factors, hormones, soluble receptors, decoy receptors, monoclonal or polyclonal antibodies, mono-specific, bi-specific or multi-specific antibodies, monobodies, polybodies.

Additional anticancer agent may be selected from, but are not limited to, growth or hematopoietic factors such as erythropoietin and thrombopoietin, and growth factor mimetics thereof.

In the present methods for treating cancer the further therapeutic active agent can be an antiemetic agent. Suitable antiemetic agents include, but are not limited to, metoclopromide, domperidone, prochlorperazine, promethazine, chlorpromazine, trimethobenzamide, ondansetron, granisetron, hydroxyzine, acethylleucine monoemanolamine, alizapride, azasetron, benzquinamide, bietanautine, bromopride, buclizine, clebopride, cyclizine, dunenhydrinate, diphenidol, dolasetron, meclizme, methallatal, metopimazine, nabilone, oxypemdyl, pipamazine, scopolamine, sulpiride, tetrahydrocannabinols, thiefhylperazine, thioproperazine and tropisetron. In a particular embodiment, the antiemetic agent is granisetron or ondansetron.

In another embodiment, the further therapeutic active agent can be an hematopoietic colony stimulating factor. Suitable hematopoietic colony stimulating factors include, but are not limited to, filgrastim, sargramostim, molgramostim and epoietin alpha.

In still another embodiment, the other therapeutic active agent can be an opioid or non-opioid analgesic agent. Suitable opioid analgesic agents include, but are not limited to, morphine, heroin, hydromorphone, hydrocodone, oxymorphone, oxycodone, metopon, apomorphine, nomioiphine, etoipbine, buprenorphine, mepeddine, lopermide, anileddine, ethoheptazine, piminidine, betaprodine, diphenoxylate, fentanil, sufentanil, alfentanil, remifentanil, levorphanol, dextromethorphan, phenazodne, pemazocine, cyclazocine, methadone, isomethadone and propoxyphene. Suitable non-opioid analgesic agents include, but are not limited to, aspirin, celecoxib, rofecoxib, diclofmac, diflusinal, etodolac, fenoprofen, flurbiprofen, ibuprofen, ketoprofen, indomethacin, ketorolac, meclofenamate, mefanamic acid, nabumetone, naproxen, piroxicam and sulindac. In yet another embodiment, the further therapeutic active agent can be an anxiolytic agent. Suitable anxiolytic agents include, but are not limited to, buspirone, and benzodiazepines such as diazepam, lorazepam, oxazapam, chlorazepate, clonazepam, chlordiazepoxide and alprazolam.

The invention will be further illustrated by the following figures and examples. However, these examples and figures should not be interpreted in any way as limiting the scope of the present invention.

FIGURES:

Figure 1: Figure 1A shows mRNA progastrin relative expression, measured by RT- QPCR, in different human colorectal cancer cell lines (DLD1, HCT116, sw620, Sw837) in basal condition. Results are expressed relative to the expression in DLD1 cell line set at 1. Figure IB shows mRNA progastrin expression, measured by RT-QPCR, in different human colorectal cancer cell lines after irradiation. NIR: non-irradiated cells, IR: irradiated cells (72h post-radiation, 10 Gy). Quantifications of 3 experiments are presented as means ± S.E.M. Figure 2: shows the inhibition of the expression of progastrin in 4 different human colorectal cancer cell lines stably transfected with a scramble sh-RNA (negative control, sh- Scr) or a specific progastrin sh-RNA (sh-PG) in basal condition (Fig 2A) or after irradiation (72h post-radiation, 10 Gy) (fig 2B). Quantifications of 3 experiments are presented as means ± S.E.M.

Figure 3: shows for different human colorectal cancer cell lines (DLD1, HCT116, sw620, Sw837) the survival fraction after 2 Gy of radiation (in clonogenic assays) as a function of progastrin relative expression. Figure 4: illustrates the effects of the inhibition of progastrin expression on the sensitivity of colorectal cancer cells to radiations. Clonogenic assays have been performed with increasing doses of radiations (1 to 8 Gy) in 4 different colorectal cancer cell lines stably transfected with a scramble sh-RNA or a specific progastrin sh-RNA. The best fit survival curve was generated according to the linear quadratic model and the mean inactivation dose (MID) calculated to compare the radiosensitivity of the different cell lines (HCT116, DLD1, SW620, SW837). Quantifications of 3 experiments are presented as means ± S.E.M.

Figure 5: shows that progastrin targeting with a specific shRNA increases apoptotic cell death induced by radiation in colorectal cancer cells. The effects of the inhibition of progastrin expression by shRNA (in 2 colorectal cancer cell lines, HCT116 and sw837) after radiation is shown on the activation of the effector caspase 7 (fig. 5A, 5B) and on the cleavage and inactivation of an enzyme involved in DNA repair, the poly. (ADP-ribose) polymerase (PARP) (fig. 5C, 5D), measured by western-blot. Western-blots are representative of at least 3 experiments. Quantifications of 3 experiments are presented as means ± S.E.M

Figure 6: shows the effect of the inhibition of progastrin expression by a specific shRNA in the rectal cancer cell line SW837 on the activation of the ERK (A) or AKT (B) pathway after irradiation measured by western blot. Western-blots are representative of at least 3 experiments. Quantifications of 3 experiments are presented as means ± S.E.M.

Figure 7: shows the effects of the inhibition of progastrin expression on the growth of transplanted human rectal cancer cells in vivo in response to irradiation. Figure 7A shows a flow chart of the in vivo experiment. Figure 7B shows the growth curve for the human rectal cancer cell line sw837, stably transfected with a scramble sh-RNA or a specific progastrin shRNA, transplanted into nude mice and submitted to radiations or not as described in A. All experimental groups consisted of 5-8 mice. Quantifications are presented as means ± S.E.M.

EXAMPLE:

Material & Methods

Cell lines and cell culture.

Human colorectal cancer cell lines (HCT116, DLD1, SW620, SW837) were obtained from the American Type Culture Collection (ATCC) and cultured in RPMI supplemented with 10% fetal bovine serum at 37°C in a humidified atmosphere containing 5% C02.

ShRNA transfection, RNA extraction, reverse-transcription and Real-time PCR. The shR A directed against PG (sh-PG: ATGCAGCGACTATGTGTGTATGT, SEQ ID NO: 4), or a non target shRNA control (sh-control: GGAATCTCATTCGATGCATAC, SEQ ID NO: 5) cloned in the SureSilencing shRNA plasmid (SuperArray, Bioscience corporation) were transfected into cells using Attractene Transfection Reagent (Qiagen) and selected in a polyclonal background with neomycin.

Total RNA was isolated by using the RNeasy RNA isolation Kit (Qiagen). mRNA expression was determined by real-time PCR (using different forward and reverse primers), using Evagreen dye and ABI-Stepone+ Detection System (Applied Biosystems, Life Technology, cergy Pontoise, France). ACTB (beta actin) was used for normalization.

Radiotherapy and cell survival in vitro.

Tumor cells growing in log-phase were seeded as single cell suspension (500 cells/mL) into T25 flasks. After attachment cells were irradiated with a single dose of 1 to 8 Gy of gamma-rays (GammaCell Irradiator), and a standard colony- forming assay was performed to determine the respective surviving fractions. After 15 days, cells were fixed with paraformaldehyde and stained with Crystal Violet. Colonies with more than 50 cells were scored as survivors. Non- irradiated cultures were used for data normalization. The best fit survival curve was generated according to the linear quadratic model and the mean inactivation dose (MID) calculated to compare the radiosensitivity of the different cell lines.

Western-blot analysis.

Fractions, containing identical levels of proteins, were separated by SDS-PAGE and analyzed by western-blot with the indicated antibodies as described previously (Bertrand et al, 2010). Primary antibodies used for western blot: anti-tubulin and anti-actin (Millipore), anti-cleaved caspase 7, anti-cleaved caspase 8, anti-cleaved caspase 9, anti-cleaved PARP, anti-phospho-AKT, anti-phospho-ERK (Cell Signaling Technology). HRP-goat anti-rabbit and HRP -rabbit anti-mouse secondary antibodies from Pierce were used (Fisher Scientific).

Animal model studies.

All procedures were approved by animal facility care committee. Eight-week old athymic nude mice (Charles River, France) were inoculated subcutaneously with 2x 106 cells. Tumor volume was measured every two days with a digital calliper using the following formula: (width2 x length)/2. At a volume of- 150 mm3 tumors were irradiated every 3 days with 2.5 Gy for 9 days (total dose of 10 Gy) as described in figure 9 A using a gamma-ray irradiator (GammaCell irradiator). Four to five weeks after the randomization at 150 mm3 mice were euthanized. All experimental groups consisted of 5-8 mice.

Immunohistochemistry on human tissues.

Paraffin embedded tissues were obtained from the Pathology department of Rangueil

Hospital, France. Approval of an institutional research ethics committee was obtained in accordance with the precepts of the Helsinki Declaration For immunohistochemistry on the formaldehyde- fixed, paraffin embedded tissues, heat Induced epitope retrieval was performed in Tris/EDTA buffer and primary antibodies were applied overnight. Detection was done using the DakoCytomation Envision+ System-HRP. Anti-progastrin antibody (1137) (Ciccotosto et al, 1995) kindly provided by Pr Shulkes was used for all the study (dilution used 1 : 1000).

Statistical analysis.

Continuous numerical values were summarized by their means ± SE. Comparisons between groups were performed using Student t-tests. The significance level was set at 0.05 with ***p < 0.001; **0.001 < p < 0.01; *0.01 < p < 0.05.

Results

The present invention discloses that progastrin remains highly expressed after irradiation of rectal tumors of patients resistant to radiotherapy and in residual cancer cells resistant to radiation (data not shown) indicating that progastrin is overexpressed in radioresistant colorectal cancer cells. In order to confirm that the expression levels of progastrin correlate with sensitivity to radiation in colorectal cancer cells, the present invention compared the expression levels of progastrin mRNA in different colorectal cancer cell lines, DLDl, HCTl 16, sw620, Sw837 measured by RT-QPCR and the radiosensitivity of the cell lines measured by clonogenic assays (sf2, survival fraction at 2 Gy). Figure 1A and figure 3 show that the resistance to radiation is higher in the cell lines expressing the highest levels of progastrin (sw620, SW837). Particularly the very radioresistant rectal cell line sw837 (sf2 = 0.83) presents the highest expression level of progastrin. Conversely the DLDl which has the lowest level of progastrin is the most sensitive to radiation. These results indicate that progastrin may act as a constitutive radioresistance factor in colorectal cancer cells. The present invention also discloses that the expression of progastrin is increased under radiation in all colorectal cancer cell lines tested (DLD1, HCT116, sw620, Sw837Fig. IB), suggesting that the increase of progastrin expression after irradiation may also act as an inducible radioresistant factor. These results are confirmed by the clonogenic assays with increasing doses of radiation (1 to 8 Gy) that allow to calculate the mean inactivation dose (MID) to compare the radiosensitivity of the different cell lines (fig. 4A and 4B). Sw837 that expresses the highest level of progastrin was the most radioresistant with the highest MID (5.39). Conversely, DLD1 which has the lowest level of progastrin was the most radiosensitive with the lowest MID (2.78).

In order to confirm that progastrin is a radioresistant factor and to demonstrate that the inhibition of the expression of progastrin increases the sensitivity of cancer cells to radiations, the present invention confirmed first that the basal expression of the progastrin gene (fig. 2A) as well as the expression of the prohormone induced by radiations (fig. 2B)were significantly inhibited by stable transfection of a specific progastrin Sh-R A in all colorectal cancer cell lines tested. Second, the present invention discloses that survival of cancer cells after irradiation, measured by clonogenic assays was significantly decreased in all cells in which the progastrin gene has been inhibited (Sh-PG) as compared to cells transfected with a scramble control and overexpressing progastrin (Sh-Scr) (fig. 4). In other words, radiation- induced cytotoxicity was enhanced when progastrin expression was blocked. It is important to notice that radiosensibilization of cancer cells by inhibiting progastrin was also observed in cell lines harbouring p53 mutations (SW620 and SW837) since this mutation has been particularly associated with radioresistance. Thus it can be understood that (1) progastrin expression is correlated to cancer cell radioresistance, (2) progastrin plays a direct role in mediating radioresistance and (3) that progastrin inhibition can lead to a radiosensitization of cancer cells. It was also demonstrated that the inhibition of progastrin expression increases radiation-induced apoptosis which is one of the main cell death induced by radiations. When radiations are used in treatment of cancer cells they induce apoptosis through the activation of pro-apoptotic factors including the initiator caspases 8 and 9 (data not shown), the effector caspase 7 (fig. 5A and 5B) and through the cleavage and inactivation of an enzyme involved in DNA repair, the poly (ADP-ribose) polymerase (PARP) (fig. 5C, 5D). In cancer cells in which the progastrin gene has been inhibited the activation of caspases 8, 9 and 7 is highly enhanced as well as the cleavage of PARP It is particularly interesting to notice the very important synergic effect of progastrin inhibition and irradiation in the very radioresistant rectal cell line sw837. Irradiation alone or progastrin blocking alone have no effect on the activation of the pro-apoptotic factor, caspase 7 or the cleavage and inactivation of PARP but combination of both treatments leads to an important activation of caspase 7 and PARP cleavage, suggesting a synergic effect of combined treatment on apoptotic cell death (fig. 5 A to 5D).

Thus it can be understood the sensitivity of cancer cells to the death by irradiation may be enhanced by inhibiting the expression or activity of progastrin. It was also demonstrated that the inhibition of progastrin in combination with irradiation increases the expression of pro-apoptotic genes including, BIM, TRAIL, TNF-alpha (data not shown). A synergic effect of the combined treatment was also observed. For BIM and TRAIL in both cell line tested (HCT116 and SW837). The expression of these two pro-apoptotic factors was not increased by radiations alone but significantly enhanced by combination of both progastrin inhibition and irradiation. The present invention also discloses that in addition to an increase in radio- induced apoptosis progastrin blocking by specific shRNA also lead to an inhibition of survival pathways which are activated after irradiation in cells resistant to radiations particularly, the AKT and the ERK pathways. As shown in figure 6, in the very radioresistant rectal cancer cell SW837 transfected with a scramble control shRNA the two survival pathways are activated by irradiation. In contrast in the SW837 cells in which progastrin expression was inhibited, the increase in AKT and ERK activation by radiations was completely blocked.

At last, in order to confirm that the inhibition of progastrin expression or activity can also mediates the radiosensitization of cancer cells in vivo, the present inventors examined the effect of radiation alone, progastrin inhibition alone or in combination on the growth of subcutaneous SW837 xenograft in nude mice (fig. 7B). From the sixteenth days after rendomization and the first irradiation, the tumors volume in the combined treatment group (radiation + progastrin inhibition by a specific shRNA, sh-PG IR) was significantly lower than in the radiation only group (radiation + control shRNA, Sh-control IR). Growth delay after the combined treatment was more than that caused by radiations alone (Sh-control IR) or progastrin inhibition alone (sh-PG NIR) demonstrating a synergic effect of the combined treatment also in vivo. Thus it can be understood that progastrin expression enhances the radioresistance of cancer cells in vivo and that the inhibition of progastrin expression or activity can enhance the radiosensitivity of cancer cells in vivo. REFERENCES:

Throughout this application, various references describe the state of the art to which this invention pertains. The disclosures of these references are hereby incorporated by reference into the present disclosure.

Baldwin GS, Hollande F, Yang Z, Karelina Y, Paterson A, Strang R et al (2001). Biologically active recombinant human progastrin(6-80) contains a tightly bound calcium ion. J Biol Chem 276: 7791-6.

Bertrand C, Kowalski-Chauvel A, Do C, Resa C, Najib S, Daulhac L et al (2010). A gastrin precursor, gastrin-gly, upregulates VEGF expression in colonic epithelial cells through an HIF-1 -independent mechanism. Int J Cancer 126: 2847-57.

Brown D, Yallampalli U, Owlia A, Singh P (2003). pp60c-Src Kinase mediates growth effects of the full-length precursor progastrinl-80 peptide on rat intestinal epithelial cells, in vitro. Endocrinology 144: 201-11.

Ciccotosto GD, McLeish A, Hardy KJ, Shulkes A (1995). Expression, processing, and secretion of gastrin in patients with colorectal carcinoma. Gastroenterology 109: 1142-53.

Grabowska AM, Hughes J, Watson SA (2007). Use of interfering RNA to investigate the role of endogenous gastrin in the survival of gastrointestinal cancer cells. Br J Cancer 96: 464-73.

Hollande F, Lee DJ, Choquet A, Roche S, Baldwin GS (2003). Adherens junctions and tight junctions are regulated via different pathways by progastrin in epithelial cells. J Cell Sci 116: 1187-97.

Litvak DAI, Hellmich MR, Iwase K, Evers BM, Martinez J, Amblard M, Townsend

CM Jr. JMV1155: a novel inhibitor of glycine-extended progastrin-mediated growth of a human colon cancer in vivo. Anticancer Res. 1999 Jan-Feb;19(lA):45-9.

Nemeth J, Taylor B, Pauwels S, Varro A, Dockray GJ (1993). Identification of progastrin derived peptides in colorectal carcinoma extracts. Gut 34: 90-5.

Pannequin J, Bonnans C, Delaunay N, Ryan J, Bourgaux JF, Joubert D et al (2009).

The wnt target jagged- 1 mediates the activation of notch signaling by progastrin in human colorectal cancer cells. Cancer Res 69: 6065-73.

Seva C, Dickinson CJ, Yamada T. Growth-promoting effects of glycine-extended progastrin. Science. 1994 Jul 15;265(5170):410-2. Siddheshwar RK, Gray JC, Kelly SB (2001). Plasma levels of progastrin but not amidated gastrin or glycine extended gastrin are elevated in patients with colorectal carcinoma. Gut 48: 47-52.

Singh P, Lu X, Cobb S, Miller BT, Tarasova N, Varro A et al (2003). Progastrinl-80 stimulates growth of intestinal epithelial cells in vitro via high-affinity binding sites. Am J Physiol Gastrointest Liver Physiol 284: G328-39.

Singh P, Velasco M, Given R, Varro A, Wang TC (2000). Progastrin expression predisposes mice to colon carcinomas and adenomas in response to a chemical carcinogen. Gastroenterology 119: 162-71.

Smith KA, Patel O, Lachal S, Jennings I, Kemp B, Burgess J, Baldwin GS, Shulkes A.

Production, secretion, and biological activity of the C-terminal flanking peptide of human progastrin. Gastroenterology. 2006 Nov;131(5): 1463-74. Epub 2006 Aug 22.

Umar S, Sarkar S, Cowey S, Singh P (2008). Activation of NF-kappaB is required for mediating proliferative and antiapoptotic effects of progastrin on proximal colonic crypts of mice, in vivo. Oncogene 27: 5599-611.

Van Solinge WW, Nielsen FC, Friis-Hansen L, Falkmer UG, Rehfeld JF (1993). Expression but incomplete maturation of progastrin in colorectal carcinomas. Gastroenterology 104: 1099-107.

Wang TC, Koh TJ, Varro A, Cahill RJ, Dangler CA, Fox JG et al (1996). Processing and proliferative effects of human progastrin in transgenic mice. J Clin Invest 98: 1918-29.

Wu H, Owlia A, Singh P (2003). Precursor peptide progastrin(l-80) reduces apoptosis of intestinal epithelial cells and upregulates cytochrome c oxidase Vb levels and synthesis of ATP. Am J Physiol Gastrointest Liver Physiol 285: G 1097-110.

Claims

CLAIMS:

1. A compound which is an antagonist of progastrin or an inhibitor of the progastrin expression for use to improve the sensitivity of cancer cells to radiotherapy.

2. A compound which is an antagonist of progastrin or an inhibitor of the progastrin expression for use in the treatment of resistant cancer.

3. A compound for use according to claims 1 or 2 wherein the progastrin is the human progastrin.

4. A i) compound which is an antagonist of progastrin or an inhibitor of the progastrin expression, and ii) a radiotherapeutic agent, as a combined preparation for simultaneous, separate or sequential use in the treatment of resistant cancer.

5. A compound according to claims 1 to 3 or a combined preparation according to claim 4 wherein the cancer a colorectal cancer or a colorectal adenomas.

6. A compound according to claim 1 to 3 or 5 a combined preparation according to claim 4 or 5 wherein the antagonist is an anti-progastrin antibody.

7. A pharmaceutical composition for use to improve the sensitivity of cancer cells to radiotherapy comprising a compound according to claims 1 to 3 and a pharmaceutically acceptable carrier.

8. A pharmaceutical composition for use in the treatment of resistant cancer comprising a compound according to claims 1 to 3 and a pharmaceutically acceptable carrier.