WO2016210373A2

WO2016210373A2 - Recombinant bacteria engineered for biosafety, pharmaceutical compositions, and methods of use thereof

Info

Publication number: WO2016210373A2
Application number: PCT/US2016/039427
Authority: WO
Inventors: Jonathan Kotula; Dean Falb; Paul Miller; Vincent ISABELLA; Alex TUCKER
Original assignee: Synlogic, Inc.
Priority date: 2015-06-24
Filing date: 2016-06-24
Publication date: 2016-12-29
Also published as: WO2016210373A3

Abstract

The present disclosure provides methods for treating a disease or disorder by administering a programmed recombinant bacterial cell to a subject, wherein the programmed recombinant bacterial cell expresses a heterologous gene in response to an exogenous environmental condition in the subject, and wherein the programmed recombinant bacterial cell is no longer viable after either sensing the presence or absence of the same or a different exogenous environmental signal, which ultimately leads to the expression of a toxin which kills the recombinant bacterial cell. The disclosure further comprises the programmed recombinant bacterial cells, and pharmaceutical compositions comprising the programmed recombinant bacterial cells.

Description

RECOMBINANT BACTERIA ENGINEERED FOR BIOSAFETY,

PHARMACEUTICAL COMPOSITIONS, AND METHODS OF USE

THEREOF

CROSS-REFERENCE TO RELATED APPLICATIONS

[01] This application claims priority and related by subject matter to the inventions disclosed in the following commonly assigned applications: U.S. Provisional Patent

Application No. 62/183,935, filed on June 24, 2015; U.S. Provisional Patent Application No. 62/263,329, filed on December 04, 2015; U.S. Provisional Patent Application No.

62/277,654, filed on January 12, 2016, the entire contents of each of which are expressly incorporated herein by reference.

[02] This application is related by subject matter to the inventions disclosed in the following commonly assigned applications: U.S. Provisional Patent Application No.

15/164,828, filed on May 05, 2016; U.S. Provisional Patent Application No. 15/154,934, filed on May 13, 2016; U.S. Provisional Patent Application No. 62/336,338, filed on May 13, 2016; U.S. Provisional Patent Application No. 62/341,320, filed on May 25, 2016; U.S. Provisional Patent Application No. 62/341,315, filed on May 25, 2016; U.S. Provisional Patent Application No. 62/323,503, filed on April 14, 2016; U.S. Provisional Patent

Application No. 62/291,468, filed on February 02, 2016; U.S. Provisional Patent Application No. 62/348,620, filed on June 10, 2016; U.S. Provisional Patent Application No. 62/255,757, filed on November 11, 2015; U.S. Provisional Patent Application No. 62/336,012, filed on May 13, 2016; U.S. Provisional Patent Application No. 62/345,242, filed on June 03, 2016; U.S. Provisional Patent Application No. 62/348,360, filed on June 10, 2016; U.S. Provisional Patent Application No. 62/277,438, filed on January 01, 2016; U.S. Provisional Patent Application No. 62/348,699, filed on June 10, 2016; U.S. Provisional Patent Application No. 62/348,416, filed on June 10, 2016; U.S. Provisional Patent Application No. 62/347,508, filed on June 08, 2016; U.S. Provisional Patent Application No. 62/277,654, filed on January 12, 2016; U.S. Provisional Patent Application No. 62/184,811, filed on November 16, 2015; and the PCT Patent Application No. PCT/US2016/032565, filed on May 13, 2016, the entire contents of each of which are expressly incorporated herein by reference.

Background

[03] It has recently been discovered that the microbiome in mammals plays a large role in health and disease (see Cho and Blaser, Nature Rev. Genet, 13:260-270, 2012 and Owyang and Wu, Gastroenterol., 146(6): 1433- 1436, 2014). Indeed, bacteria- free animals have abnormal gut epithelial and immune function, suggesting that the microbiome in the gut plays a critical role in the mammalian immune system. Specifically, the gut microbiome has been shown to be involved in diseases, including, for example, immune diseases (such as Inflammatory Bowel Disease), autism, liver disease, cancer, food allergy, metabolic diseases (such as urea cycle disorder, phenylketonuria, and maple syrup urine disease), obesity, and infection, among many others.

[04] Fecal transplantation of native microbial strains has recently garnered much attention for its potential to treat certain microbial infections and immune diseases in the gut (Owyang and Wu, 2014). There have also been recent efforts to engineer microbes to produce therapeutic molecules and administer them to a subject in order to deliver the therapeutic molecule(s) directly to the site where therapy is needed, such as various sites in the gut. However, such efforts have been frustrated for various reasons, mostly relating to the constitutive production of the bacteria and/or its gene product(s). For example, in some instances, the production of the heterologous biomolecule, e.g., the payload(s) or therapeutic molecule(s), can be regulated by controlling the population of bacteria expressing the heterologous biomolecule. Also, the overall health of a subject could be impacted due to the complexity of the microbiome and the potential for the recombinant, non-native bacteria to colonize the gut or to alter the composition of the natural microbiome. In addition, use of the engineered microbes may raise concerns with respect to bio safety issues relating to unchecked proliferation and the possibility of unwanted spread or establishment of synthetic genetic material in other organisms. For these and other reasons, it would be beneficial to have the ability to regulate the population of the engineered microbes.

[05] Bacteria containing "kill switches" or other means to counter undesired horizontal gene transfer have been developed for in vitro research purposes, to limit the spread of a bio fuel-producing microorganism outside of a laboratory environment, or for use to track or "count" environmental signals (see, for example, Callura et ah, Proc. Natl. Acad. Set, 107(36): 15898-15903, 2010; Siuti et al, Nature Biotechnology, 31:448-452, 2013; U.S. Patent No. 8,975,061; and U.S. Patent No. 8,645,115). However, for the reasons discussed above, there exists a current need to regulate the population of engineered microorganisms expressing heterologous genes that are administered to treat a disease or disorder in a subject and, in particular, to eliminate or decrease the amount of the engineered microorganism following the expression and delivery of the heterologous gene(s), or after the engineered microorganism has spread beyond the disease site. Specifically, it is advantageous to prevent long-term colonization of subjects by the microorganism, as well as to prevent spread of the microorganism outside the area of interest within the subject (for example, outside the gut), or spread of the microorganism outside of the subject into the environment (for example, spread to the environment through the stool of the subject).

Summary

[06] The present disclosure provides engineered or programmed microorganisms, e.g., bacteria or viruses, that are engineered to die after expression and/or delivery of a molecule of interest, such as a therapeutic molecule, to a desired site(s) in a subject, for example, a mammalian gut. The kill switch is intended to actively kill engineered microbes in response to external stimuli. As opposed to an auxotrophic mutation where bacteria die because they lack an essential nutrient for survival, the kill switch is triggered by a particular factor in the environment that induces the production of toxic molecules within the microbe that cause cell death.

[07] Bacteria engineered for in vivo administration to treat a disease or disorder may also be programmed to die at a specific time after the expression and delivery of a heterologous gene or genes, for example, a therapeutic gene(s) or after the subject has experienced the therapeutic effect. For example, in some embodiments, the kill switch is activated to kill the bacteria after a period of time following oxygen level-dependent expression of a therapeutic molecule. In some embodiments, the kill switch is activated in a delayed fashion following oxygen level-dependent expression of the anti-cancer molecule. Alternatively, the bacteria may be engineered to die if the bacteria have spread outside of a tumor site. Specifically, it may be useful to prevent the spread of the microorganism outside the area of interest (for example, outside of the tumor site) within the subject, or spread of the microorganism outside of the subject into the environment (for example, spread to the environment through the blood or stool of the subject). Examples of such toxins that can be used in kill switches include, but are not limited to, bacteriocins, lysins, and other molecules that cause cell death by lysing cell membranes, degrading cellular DNA, or other

mechanisms. Such toxins can be used individually or in combination. The switches that control their production can be based on, for example, transcriptional activation (toggle switches; see, e.g., Gardner et al., 2000), translation (riboregulators), or DNA recombination (recombinase-based switches), and can sense environmental stimuli such as anaerobiosis or reactive oxygen species. These switches can be activated by a single environmental factor or may require several activators in AND, OR, NAND and NOR logic configurations to induce cell death. For example, an AND riboregulator switch is activated by tetracycline, isopropyl β-D-l-thiogalactopyranoside (IPTG), and arabinose to induce the expression of lysins, which permeabilize the cell membrane and kill the cell. IPTG induces the expression of the endolysin and holin mRNAs, which are then derepressed by the addition of arabinose and tetracycline. All three inducers must be present to cause cell death. Examples of kill switches are known in the art (Callura et al., 2010). In some embodiments, the kill switch is activated to kill the bacteria after a period of time following oxygen level-dependent expression of the anti-cancer molecule. In some embodiments, the kill switch is activated in a delayed fashion following oxygen level-dependent expression of the anti-cancer molecule.

[08] Kill switches can be designed such that a toxin is produced in response to an environmental condition or external signal (e.g., the bacteria is killed in response to an external cue) or, alternatively designed such that a toxin is produced once an environmental condition no longer exists or an external signal is ceased.

[09] In some aspects, the disclosure provides microorganisms that are engineered to die in response to either the presence or absence of one or more exogenous environmental signal(s), which signal(s) sets in motion one or more regulatory events that ultimately leads to the expression of a toxin or other gene which causes cell death. In other aspects, the exogenous environmental signal(s) sets in motion one or more regulatory events that ultimately prevents the expression of an essential gene and/or an antitoxin, resulting in cell death. In other aspects, the microorganisms are engineered to die in response to either the presence or absence of an exogenous environmental signal(s), which signal(s) sets in motion one or more regulatory events that ultimately leads to the expression of a toxin or other gene which causes cell death and also sets in motion one or more regulatory events that ultimately prevents the expression of an essential gene and/or an antitoxin, resulting in cell death. Thus, the engineered microbe is not only able to express the heterologous gene of interest, but is also able to effect its demise in response to one or more environmental cues.

[010] In addition to expressing a gene or genes of interest, such as a gene or genes encoding one or more therapeutic molecule(s), and containing gene sequence(s) which can effect cell death, the engineered microorganisms of the present disclosure may further comprise additional gene sequence(s), including, for example, further regulatory sequence(s) (e.g., inducible, constitutive and/or tissue- specific promoter sequence(s), ribosomal binding site(s)), sequence(s) that enable or assist in the transport (import) of a molecule(s) into the microorganism, sequence(s) that enable or assist in the secretion (export) of a molecule(s)s from the microorganism, and sequence(s) that confer antibiotic resistance. The engineered microrogansim may further comprise one or more genetic modifications resulting in one or more auxo trophies.

[011] The present disclosure further provides pharmaceutical compositions comprising the engineered microroganisms, e.g., bacteria and viruses, and methods for treating diseases or disorders in a subject by administration of the microroganism to the subject. The instant disclosure provides several important advantages over previously known techniques. For example, initial viability and stability of the engineered bacterial cells is not compromised, because the bacteria is not constitutively producing large amounts of a foreign heterologous protein; treatment of a subject with the engineered bacterial cells avoids systemic administration of drugs; treatment of a subject with the engineered bacterial cells delivers one or more gene product(s) of interest (e.g., payload(s)) directly to a desired site; and the bacterial cells can be engineered to die after expression of the payload(s) is induced, so that they cannot colonize the host or spread outside of the desired site or into the environment, for example, through the stool of the subject.

[012] In one aspect, the disclosure provides a method for treating a disease or disorder in a subject, the method bacterial cell expresses at least one gene of interest in response to a first exogenous environmental condition in the subject, and wherein the programmed bacterial cell is no longer viable after at least one recombination event which is also directly or indirectly induced by a second exogenous environmental condition in the subject.

[013] In some embodiments, the genetically engineered bacteria of the disclosure are further programmed to die after sensing an exogenous environmental signal, for example, in a low oxygen environment. In some embodiments, the genetically engineered bacteria of the present disclosure comprise one or more genes encoding one or more recombinase(s), whose expression is induced in response to an environmental condition or signal and causes one or more recombination events that ultimately leads to the expression of a toxin which kills the cell. In some embodiments, the at least one recombination event is the flipping of an inverted heterologous gene encoding a bacterial toxin which is then constitutively expressed after it is flipped by the first recombinase. In one embodiment, constitutive expression of the bacterial toxin kills the genetically engineered bacterium. In these types of kill switch systems, once the engineered bacterial cell senses the exogenous environmental condition and expresses the heterologous gene of interest, the recombinant bacterial cell is no longer viable.

[014] In one embodiment, the at least one recombination event is flipping of an inverted gene encoding a bacterial toxin by a first recombinase. In one embodiment, the inverted gene encoding the bacterial toxin is located between a first forward recombinase recognition sequence and a first reverse recombinase recognition sequence. In one embodiment, the heterologous gene encoding the bacterial toxin is constitutively expressed after it is flipped by the first recombinase. In one embodiment, constitutive expression of the bacterial toxin kills the programmed recombinant bacterial cell.

[015] In one embodiment, the programmed bacterial cell further expresses a gene encoding an anti-toxin in response to the first exogenous environmental condition. For example, in an embodiment in which the genetically engineered bacteria of the present disclosure express one or more recombinase(s) in response to an environmental condition or signal causing at least one recombination event, the genetically engineered bacterium can further express a gene encoding an anti-toxin in response to an exogenous environmental condition or signal. In one embodiment, the at least one recombination event is flipping of an inverted gene encoding a bacterial toxin by a first recombinase. In one embodiment, the inverted gene encoding the bacterial toxin is located between a first forward recombinase recognition sequence and a first reverse recombinase recognition sequence. In one embodiment, the gene encoding the bacterial toxin is constitutively expressed after it is flipped by the first recombinase. In one embodiment, the anti-toxin inhibits the activity of the toxin when the second exogenous environmental condition is present, thereby delaying death of the programmed recombinant bacterial cell. In one embodiment, the programmed bacterial cell is killed by the bacterial toxin when the gene encoding the anti-toxin is no longer expressed when the first exogenous environmental condition is no longer present.

[016] In one embodiment, the at least one recombination event is flipping of an inverted gene encoding a second recombinase by a first recombinase, followed by the flipping of an inverted gene encoding a bacterial toxin by the second recombinase. In one embodiment, the inverted gene encoding the second recombinase is located between a first forward recombinase recognition sequence and a first reverse recombinase recognition sequence. In one embodiment, the inverted gene encoding the bacterial toxin is located between a second forward recombinase recognition sequence and a second reverse recombinase recognition sequence. In one embodiment, the gene encoding the second recombinase is constitutively expressed after it is flipped by the first recombinase. In one embodiment, the gene encoding the bacterial toxin is constitutively expressed after it is flipped by the second recombinase. In one embodiment, the programmed recombinant bacterial cell is killed by the bacterial toxin. In one embodiment, the programmed bacterial cell further expresses a gene encoding an anti-toxin in response to the first exogenous environmental condition. In one embodiment, the anti-toxin inhibits the activity of the toxin when the first exogenous environmental condition is present, thereby delaying death of the programmed bacterial cell. In one embodiment, the programmed bacterial cell is killed by the bacterial toxin when the gene encoding the anti-toxin is no longer expressed when the first exogenous environmental condition is no longer present.

[017] In one embodiment, the at least one recombination event is flipping of an inverted gene encoding a second recombinase by a first recombinase, followed by flipping of an inverted heterologous gene encoding a third recombinase by the second recombinase, followed by flipping of an inverted gene encoding a bacterial toxin by the third recombinase.

[018] In one embodiment, the at least one recombination event is flipping of an inverted gene encoding a first excision enzyme by a first recombinase. In one embodiment, the inverted gene encoding the first excision enzyme is located between a first forward recombinase recognition sequence and a first reverse recombinase recognition sequence. In one embodiment, the gene encoding the first excision enzyme is constitutively expressed after it is flipped by the first recombinase. In one embodiment, the first excision enzyme excises a first essential gene. In one embodiment, the programmed recombinant bacterial cell is not viable after the first essential gene is excised.

[019] In one embodiment, the first recombinase further flips an inverted gene encoding a second excision enzyme. In one embodiment, the wherein the inverted gene encoding the second excision enzyme is located between a second forward recombinase recognition sequence and a second reverse recombinase recognition sequence. In one embodiment, the gene encoding the second excision enzyme is constitutively expressed after it is flipped by the first recombinase. In one embodiment, the programmed recombinant bacterial cell dies or is no longer viable when the first essential gene and the second essential gene are both excised. In one embodiment, the programmed recombinant bacterial cell dies or is no longer viable when either the first essential gene is excised or the second essential gene is excised by the first recombinase. [020] In one embodiment, the programmed bacterial cell dies after the at least one recombination event occurs. In another embodiment, the programmed bacterial cell is no longer viable after the at least one recombination event occurs. In other embodiments, the programmed bacterial cell dies after the at least two recombination events occur. In other embodiments, the programmed bacterial cell is no longer viable after at least two

recombination events occur.

[021] In one embodiment, the at least one recombination event is flipping of an inverted gene encoding a first excision enzyme by a first recombinase. In one embodiment, the inverted gene encoding the first excision enzyme is located between a first forward recombinase recognition sequence and a first reverse recombinase recognition sequence. In one embodiment, the gene encoding the first excision enzyme is constitutively expressed after it is flipped by the first recombinase. In one embodiment, the first excision enzyme excises a first essential gene. In one embodiment, the programmed recombinant bacterial cell is not viable after the first essential gene is excised.

[022] In any of these embodiment, the recombinase can be a recombinase selected from the group consisting of: Bxbl, PhiC31, TP901, Bxbl, PhiC31, TP901, HK022, HP1, R4, Intl, Int2, Int3, Int4, Int5, Int6, Int7, Int8, Int9, IntlO, Intl l, Intl2, Intl3, Intl4, Intl5, Intl6, Intl7, Intl8, Intl9, Int20, Int21, Int22, Int23, Int24, Int25, Int26, Int27, Int28, Int29, Int30, Int31, Int32, Int33, and Int34, or a biologically active fragment thereof.

[023] In the above-described kill switch circuits, a toxin is produced in the presence of an environmental factor or signal. In another aspect of kill switch circuitry, a toxin may be repressed in the presence of an environmental factor (not produced) and then produced once the environmental condition or external signal is no longer present. Such kill switches are called repression-based kill switches and represent systems in which the bacterial cells are viable only in the presence of an external factor or signal, such as arabinose or other sugar. For example, in some embodiments, the gene expressing the toxin is repressed. Thus, in the presence of a certain environmental condition(s), signal(s), or cue(s), expression of the toxin gene is repressed. However, in the absence of a certain environmental condition(s), signal(s), or cue(s), the repression is lifted and the toxin is expressed. In some embodiments, the environmental condition in which the expression of the toxin gene is repressed is low- oxygen, e.g., such as in the mammalian gut. In some embodiments, the environmental signal in which the expression of the toxin gene is repressed is the presence of arbinose which may be present in the gut, may be provided upon consumption of food, or may be provided with the administration of the engineered bacterial. Exemplary kill switch designs in which the toxin is repressed in the presence of an external factor or signal (and activated once the external signal is removed) are shown in Figs. 1-3.

[024] In some embodiments, the disclosure provides recombinant bacterial cells which express one or more heterologous gene(s) upon sensing arabinose or other sugar in the exogenous environment. In this aspect, the recombinant bacterial cells contain the araC gene, which encodes the AraC transcription factor, as well as one or more genes under the control of the araBAD promoter. In the absence of arabinose, the AraC transcription factor adopts a conformation that represses transcription of genes under the control of the araBAD promoter. In the presence of arabinose, the AraC transcription factor undergoes a conformational change that allows it to bind to and activate the AraBAD promoter, which induces expression of the desired gene, for example tetR, which represses expression of a toxin gene. In this embodiment, the toxing gene is repressed in the presence of arabinose or other sugar. In an environment where arabinose is not present, the tetR gene is not activated and the toxin is expressed, thereby killing the bacteria. The arbinoase system can also be used to express an essential gene, in which the essential gene is only expressed in the presence of arabinose or other sugar and is not expressed when arabinose or other sugar is absent from the

environment.

[025] Thus, in some embodiments in which one or more heterologous gene(s) are expressed upon sensing arabinose in the exogenous environment, the one or more

heterologous genes are directly or indirectly under the control of the araBAD promoter. In some embodiments, the expressed heterologous gene is selected from one or more of the following: a heterologous therapeutic gene, a heterologous gene encoding an antitoxin, a heterologous gene encoding a repressor protein or polypeptide, for example, a TetR repressor, a heterologous gene encoding an essential protein not found in the bacterial cell, and/or a heterologous encoding a regulatory protein or polypeptide.

[026] Arabinose inducible promoters are known in the art, including Para, ParaB, ParaC, and ParaB AD. In one embodiment, the arabinose inducible promoter is from E. coli. In some embodiments, the ParaC promoter and the ParaB AD promoter operate as a bidirectional promoter, with the ParaB AD promoter controlling expression of a heterologous gene(s) in one direction, and the ParaC (in close proximity to, and on the opposite strand from the ParaB AD promoter), controlling expression of a heterologous gene(s) in the other direction. In the presence of arabinose, transcription of both heterologous genes from both promoters is induced. However, in the absence of arabinose, transcription of both

heterologous genes from both promoters is not induced.

[027] In one exemplary embodiment of the disclosure, the genetically engineered bacteria of the present disclosure contains a kill-switch having at least the following sequences: a ParaBAD promoter operably linked to a heterologous gene encoding a

Tetracycline Repressor Protein (TetR), a ParaC promoter operably linked to a heterologous gene encoding AraC transcription factor, and a heterologous gene encoding a bacterial toxin operably linked to a promoter which is repressed by the Tetracycline Repressor Protein (PTetR). In the presence of arabinose, the AraC transcription factor activates the ParaBAD promoter, which activates transcription of the TetR protein, which, in turn, represses transcription of the toxin. In the absence of arabinose, however, AraC suppresses

transcription from the the ParaBAD promoter and no TetR protein is expressed. In this case, expression of the heterologous toxin gene is activated, and the toxin is expressed. The toxin builds up in the recombinant bacterial cell, and the recombinant bacterial cell is killed. In one embodiment, the AraC gene encoding the AraC transcription factor is under the control of a constitutive promoter and is therefore constitutively expressed.

[028] In one embodiment of the disclosure, the genetically engineered bacterium further comprises an antitoxin under the control of a constitutive promoter. In this situation, in the presence of arabinose, the toxin is not expressed due to repression by TetR protein, and the antitoxin protein builds-up in the cell. However, in the absence of arabinose, TetR protein is not expressed, and expression of the toxin is induced. The toxin begins to build-up within the recombinant bacterial cell. The recombinant bacterial cell is no longer viable once the toxin protein is present at either equal or greater amounts than that of the anti-toxin protein in the cell, and the recombinant bacterial cell will be killed by the toxin.

[029] In another embodiment of the disclosure, the genetically engineered bacterium further comprises an antitoxin under the control of the ParaBAD promoter. In this situation, in the presence of arabinose, TetR and the anti-toxin are expressed, the anti-toxin builds up in the cell, and the toxin is not expressed due to repression by TetR protein. However, in the absence of arabinose, both the TetR protein and the anti-toxin are not expressed, and expression of the toxin is induced. The toxin begins to build-up within the recombinant bacterial cell. The recombinant bacterial cell is no longer viable once the toxin protein is expressed, and the recombinant bacterial cell will be killed by the toxin. [030] In another exemplary embodiment of the disclosure, the genetically engineered bacteria of the present disclosure contain a kill- switch having at least the following sequences: a ParaBAD promoter operably linked to a heterologous gene encoding an essential polypeptide not found in the recombinant bacterial cell (and required for survival), and a ParaC promoter operably linked to a heterologous gene encoding AraC transcription factor. In the presence of arabinose, the AraC transcription factor activates the ParaBAD promoter, which activates transcription of the heterologous gene encoding the essential polypeptide, allowing the recombinant bacterial cell to survive. In the absence of arabinose, however, AraC suppresses transcription from the ParaBAD promoter and the essential protein required for survival is not expressed. In this case, the recombinant bacterial cell dies in the absence of arabinose. In some embodiments, the sequence of ParaBAD promoter operably linked to a heterologous gene encoding an essential polypeptide not found in the recombinant bacterial cell can be present in the bacterial cell in conjunction with the TetR/toxin kill- switch system described directly above. In some embodiments, the sequence of ParaBAD promoter operably linked to a heterologous gene encoding an essential polypeptide not found in the recombinant bacterial cell can be present in the bacterial cell in conjunction with the TetR/toxin/anto-toxin kill- switch system described directly above.

[031] In yet other embodiments, the bacteria may comprise a plasmid stability system with a plasmid that produces both a short-lived anti-toxin and a long-lived toxin. In this system, the bacterial cell produces equal amounts of toxin and anti-toxin to neutralize the toxin. Howevere, if/when the cell loses the plasmid, the short-lived anti- toxin begins to decay. When the anti-toxin decays completely the cell dies as a result of the longer- lived toxin killing it.

[032] In some embodiments, the engineered bacteria of the present disclosure that are capable of producing an anti-cancer molecule further comprise the gene(s) encoding the components of any of the above-described kill switch circuits.

[033] In any of the above-described embodiments, the bacterial toxin is selected from the group consisting of a lysin, Hok, Fst, TisB, LdrD, Kid, SymE, MazF, FlmA, lbs, XCV2162, dinJ, CcdB, MazF, ParE, YafO, Zeta, hicB, relB, yhaV, yoeB, chpBK, hip A, microcin B, microcin B 17, microcin C, microcin C7-C51, microcin J25, microcin ColV, microcin 24, microcin L, microcin D93, microcin L, microcin E492, microcin H47, microcin 147, microcin M, colicin A, colicin El, colicin K, colicin N, colicin U, colicin B, colicin la, colicin lb, colicin 5, colicinlO, colicin S4, colicin Y, colicin E2, colicin E7, colicin E8, colicin E9, colicin E3, colicin E4, colicin E6; colicin E5, colicin D, colicin M, and cloacin DF13, or VapC, Doc, Rv0301, RelK, FitB, Tsel, VbhtT, Epsilon, ToxN, SpollSA, PezT, ldrD, symE, ibsC, txnA, srnB, pndA, shoB, bsrG, cbtA, ghoT, MosT, YeeV, PasB, ζ, dinJ, rnlA, mqsR, ygiM, yafW, yeeU, VapD, GinA, GinB, GinC, GinD, EndoA, HigB, Paml, RatA, CbtA, Ykfl, YpjF, GnsA, YjhX, and YdaS. In some embodiments, the bacterial cell comprises a gene encoding a toxin selected from MazF, CcdB, ParE, relB, VapC, Doc, hip A, and Kid or any biologically active fragment thereof.

[034] As discussed above, in one embodiment, the bacterial cell comprises a gene encoding a bacterial toxin and also comprises a gene encoding the toxin's cognate anti-toxin. Upon sensing an exogenous environmental condition, the anti-toxin protein levels increase in the cell and the anti-toxin binds to it's cognate toxin that is expressed after the toxin gene is either expressed or flipped by a recombinase. Thus, in one embodiment, the bacterial antitoxin is selected from the group consisting of anti-lysin, Sok, RNAII, IstR, RdlD, Kis, SymR, MazE, FlmB, Sib, ptaRNAl, yafQ, CcdA, ParD, yaf , Epsilon, HicA, relE, prlF, yefM, chpBI, VapB, PhD, hipB, RV0300, Relj, FitA, Tsil, VbhA, Zeta, Toxl, SpoUSB, PezA, rdlD, symR, sibC, ratA, srnC, pndB, ohsC, SR4, cbeA, ghoS, MosA, YeeU, PasC, ε, yafQ, rnlB, mqsA, ygiN, ykfl, yeeV, YdcD, HigA, pemK, YfjF, YeeU, YafW, YfjZ, YmcE, YjhQ, and YdaT. In some embodiments, the bacterial cell comprises a gene encoding an anti-toxin selected from MazE, CcdA, ParD, relE, VapB, PhD, hipB, Kis, MccE, MccECTD, MccF, Cai, ImmEl, Cki, Cni, Cui, Cbi, Iia, Imm, Cfi, ImlO, Csi, Cyi, Im2, Im7, Im8, Im9, Im3, Im4, ImmE6, cloacin immunity protein (Cim), ImmE5, ImmD, and Cmi, or a biologically active fragment thereof.

[035] In one embodiment, the bacterial toxin is bactericidal to the genetically engineered bacterium. In one embodiment, the bacterial toxin is bacteriostatic to the genetically engineered bacterium.

[036] In some embodiments, the engineered bacteria provided herein are capable of producing an molecule of interest, e.g., a therapeutic molecule, wherein the gene or gene cassette for producing the anti-cancer molecule is controlled by a promoter that is induced under low-oxygen or anaerobic conditions. In some embodiments, the promoter is selected from the fumarate and nitrate reductase regulator (FNR) promoter, arginine deiminiase and nitrate reduction (ANR) promoter, and dissimilatory nitrate respiration regulator (DNR) promoter. [037] In some embodiments, the genetically engineered bacteria for producing the molecule of interst is an auxotroph selected from a cysE, glnA, ilvD, leuB, lysA, serA, metA, glyA, hisB, ilvA, pheA, pro A, thrC, trpC, tyrA, thyA, uraA, dap A, dapB, dapD, dapE, dapF, flhD, metB, metC, proAB, and thil auxotroph. In some embodiments, the engineered bacteria have more than one auxotrophy, for example, they may be a AthyA and AdapA auxotroph.

[038] In some embodiments, the genetically engineered bacteria comprise one or more genes encoding one or more recombinase(s) under the control of an inducible promoter and an inverted toxin sequence. In some embodiments, the genetically engineered bacteria further comprise one or more genes encoding an anti-toxin. In some embodiments, the engineered bacteria further comprise one or more genes encoding one or more

recombinase(s) under the control of an inducible promoter and one or more inverted excision genes, wherein the excision gene(s) encode an enzyme that deletes an essential gene. In some embodiments, the genetically engineered bacteria further comprise one or more genes encoding an anti-toxin.

[039] In some instances, basal or leaky expression from an inducible promoter may result in the activation of the kill switch, thereby creating strong selective pressure for one or more mutations that disable the switch and thus the ability to kill the cell. In some embodiments, an environmental factor, e.g. arabinose, is present during manufacturing, and activates the production of a repressor that shuts down toxin production. Mutations in this circuit, with the exception of the toxin gene itself, will result in death with reduced chance for negative selection. When the environmental factor is absent, the repressor stops being made, and the toxin is produced. When the toxin concentration overcomes that of the antitoxin, the cell dies. In some embodiments, variations in the promoter and ribosome binding sequences of the antitoxin and the toxin allow for tuning of the circuit to produce variations in the timing of cell death. In alternate embodiments, the circuit comprises recombinases that are repressed by tetR and produced in the absence of tetR. These recombinases are capable of flipping the toxin gene or its promoter into the active configuration, thereby resulting in toxin production.

[040] Synthetic gene circuits express on plasmids may function well in the short term but lose ability and/or function in the long term, e.g., in the stringent conditions found in a tumor microenvironment (Danino et al., 2015). In some embodiments, the genetically engineered bacteria comprise stable circuits for expressing genes of interest, e.g., an anti- cancer molecule, over prolonged periods. In some embodiments, the genetically engineered bacteria are capable of targeting cancerous cells and producing an anti-cancer molecule and further comprise a toxin-antitoxin system that simultaneously produces a toxin (hok) and a short-lived antitoxin (sok), wherein loss of the plasmid causes the cell to be killed by the long-lived toxin (Danino et al., 2015; Fig. 21). In some embodiments, the genetically engineered bacteria further comprise alp7 from B. subtilis plasmid pL20 and produces filaments that are capable of pushing plasmids to the poles of the cells in order to ensure equal segregation during cell division (Danino et al., 2015).

[041] In some embodiments, the genetically engineered bacteria for producing the anti-cancer molecule is an auxotroph and further comprises a kill switch circuit, such as any of the kill switch circuits described herein.

[042] In some embodiments of the above described genetically engineered bacteria, the gene encoding the anti-cancer molecule is present on a plasmid in the bacterium and operatively linked on the plasmid to the promoter that is induced under low-oxygen or anaerobic conditions.

[043] In another aspect, the disclosure provides a method for treating a disease or disorder in a subject, the method comprising administering a programmed bacterial cell to the subject, wherein the programmed bacterial cell: i) expresses at least one heterologous gene in response to a first exogenous environmental condition in the subject, ii) expresses a heterologous gene encoding an anti-toxin, and iii) expresses a heterologous gene encoding a bacterial toxin when a second exogenous environmental condition is not present in the subject, wherein the programmed recombinant bacterial cell is no longer viable after expression of the bacterial toxin, thereby treating the disease or disorder in the subject.

[044] In one embodiment, the heterologous gene encoding the anti-toxin is constitutively expressed.

[045] In one embodiment, the heterologous gene encoding the anti-toxin is expressed in response to the second exogenous environmental condition in the subject. In one embodiment, when the second exogenous environmental condition is present, the heterologous gene encoding the bacterial toxin is not expressed.

[046] In one embodiment, the bacterial toxin kills the programmed recombinant bacterial cell when levels of the bacterial toxin in the recombinant bacterial cell are equal to or higher than levels of the antitoxin in the recombinant bacterial cell. [047] In one embodiment, the second exogenous environmental condition is the presence of arabinose.

[048] In one embodiment, the heterologous gene encoding the toxin is expressed from a PtetR promoter, and wherein the recombinant bacterial cell further comprises iv) a heterologous ara gene under the control of a ParaC promoter, and v) a heterologous tetR gene under the control of a ParaBAD promoter, wherein the ParaC promoter induces expression of AraC protein, wherein the AraC protein activates expression of the ParaBAD promoter, wherein the ParaBAD promoter induces expression of TetR protein, and wherein the TetR protein induces expression of the heterologous gene encoding the toxin.

[049] In one embodiment, the first exogenous environmental condition and the second exogenous environmental condition are the same exogenous environmental condition. In one embodiment, the first exogenous environmental condition and the second exogenous environmental condition are different exogenous environmental conditions.

[050] In one embodiment, the method further comprises administering a second recombinant bacterial cell to the subject, wherein the second recombinant bacterial cell comprises a heterologous reporter gene operably linked to an inducible promoter that is directly or indirectly induced by a third exogenous environmental condition. In one embodiment, the heterologous reporter gene is a fluorescence gene. In one embodiment, the fluorescence gene encodes a green fluorescence protein (GFP).

[051] In another aspect, the disclosure provides a method for treating a disease or disorder in a subject, the method comprising administering a pharmaceutical composition comprising a recombinant bacterial cell to the subject, wherein an exogenous environmental condition in the subject directly or indirectly induce expression in the recombinant bacterial cell of: a) at least one heterologous therapeutic gene that is effective to treat the disease or disorder in the subject, b) an anti-toxin, and c) at least one recombinase, wherein the at least one recombinase flips an inverted gene encoding a bacterial toxin so that the bacterial toxin is then constitutively expressed in the recombinant bacterial cell, and wherein the bacterial toxin kills the recombinant bacterial cell when the exogenous environmental condition is no longer present and the expression of anti-toxin is no longer induced, thereby treating the disease or disorder in the subject.

[052] In another aspect, the disclosure provides a method for treating a disease or disorder in a subject, the method comprising administering a pharmaceutical composition comprising a recombinant bacterial cell to the subject, wherein an exogenous environmental condition in the subject directly or indirectly induce expression in the recombinant bacterial cell of: a) at least one heterologous therapeutic gene that is effective to treat the disease or disorder in the subject, b) a heterologous gene encoding a first recombinase, wherein the first recombinase flips an inverted gene encoding a heterologous second recombinase, wherein the second recombinase is expressed and flips an inverted gene encoding a bacterial toxin, wherein the bacterial toxin kills the recombinant bacterial cell, thereby treating the disease or disorder in the subject.

[053] In another aspect, the disclosure provides a method for treating a disease or disorder in a subject, the method comprising administering a pharmaceutical composition comprising a recombinant bacterial cell to the subject, wherein an exogenous environmental condition in the subject directly or indirectly induce expression in the recombinant bacterial cell of: a) at least one heterologous therapeutic gene that is effective to treat the disease or disorder in the subject, b) a heterologous gene encoding a first recombinase, wherein the first recombinase flips an inverted gene encoding a heterologous first excision enzyme, wherein the first excision enzyme is expressed and excises an essential gene, wherein the lack of expression of the essential gene in the recombinant bacterial cell kills the recombinant bacterial cell, thereby treating the disease or disorder in the subject.

[054] In one embodiment, the disease is inflammatory bowel disease (IBD). In one embodiment, the disease is ulcerative colitis or Crohn's disease. In one embodiment, the disease is type I diabetes, type II diabetes, obesity, or metabolic syndrome. In one embodiment, the disease is a metabolic disease. In one embodiment, the metabolic disease is phenylketonuria (PKU) or urea cycle disorder (UCD). In one embodiment, the metabolic disease is a disease caused by conversion of a branched chain amino acid. In one

embodiment, the disease caused by conversion of a branched chain amino acid is maple syrup urine disease (MSUD). In one embodiment, the disease is a disease caused by activation of mTor. In one embodiment, the disease is hepatic encephalopathy. In one embodiment, the disease is non-alcoholic steatohepatitis. In one embodiment, the disease is a lysosomal storage disease. In one embodiment, the disease is cancer.

[055] In one embodiment, the pharmaceutical composition is administered orally.

[056] In one embodiment, the at least one heterologous gene is at least one therapeutic gene. [057] In one embodiment, the bacterial toxin is bactericidal to the programmed recombinant bacterial cell. In one embodiment, the bacterial toxin is bacteriostatic to the programmed recombinant bacterial cell.

[058] In one embodiment, the at least one heterologous gene is located on a plasmid in the programmed recombinant bacterial cell. In one embodiment, the at least one heterologous gene is located on a chromosome in the programmed recombinant bacterial cell.

[059] In one embodiment, the at least one heterologous gene is operably linked to a promoter which is directly or indirectly induced by the first exogenous environmental condition.

[060] In one embodiment, the heterologous gene encoding the anti-toxin is located on a plasmid in the programmed recombinant bacterial cell. In one embodiment, the heterologous gene encoding the anti-toxin is located on a chromosome in the programmed recombinant bacterial cell. In one embodiment, the heterologous gene encoding the antitoxin is operably linked to a promoter which is directly or indirectly induced by the first exogenous environmental condition.

[061] In one embodiment, the recombinase is encoded by a heterologous gene which is located on a plasmid in the programmed recombinant bacterial cell. In one embodiment, the recombinase is encoded by a heterologous gene which is located on a chromosome in the programmed recombinant bacterial cell. In one embodiment, the heterologous gene encoding the recombinase is operably linked to promoter which is directly or indirectly induced by the second exogenous environmental condition.

[062] In one embodiment, the promoter is directly or indirectly induced by low- oxygen or anaerobic conditions. In one embodiment, the promoter is an FNR responsive promoter. In one embodiment, the promoter is regulated by a reactive nitrogen species (RNS). In one embodiment, the promoter is regulated by a reactive oxygen species (ROS).

[063] In one embodiment, the programmed recombinant bacterial cell is a programmed recombinant probiotic bacterial cell. In one embodiment, the programmed recombinant bacterial cell is a member of a genus selected from the group consisting of Bacteroides, Bifidobacterium, Clostridium, Escherichia, Lactobacillus and Lactococcus. In one embodiment, the programmed recombinant bacterial cell is of the genus Escherichia. In one embodiment, the programmed recombinant bacterial cell is of the species Escherichia coli strain Nissle. [064] In one embodiment, the programmed recombinant bacterial cell is an auxotroph in a gene. In one embodiment, the gene is a DNA synthesis gene, a cell wall synthesis gene, or an amino acid gene. In one embodiment, the DNA synthesis gene is thyA. In one embodiment, the cell wall synthesis gene is dapA. In one embodiment, the amino acid gene is serA or metA.

[065] In one embodiment, the at least one heterologous gene is at least one heterologous therapeutic gene. In one embodiment, the at least one heterologous therapeutic gene encodes a therapeutic protein. In one embodiment, the therapeutic protein is IL-10. In one embodiment, the therapeutic protein is GLP2. In one embodiment, the therapeutic protein is GLP1. In one embodiment, the therapeutic protein is IL-27. In one embodiment, the therapeutic protein is TGFp. In one embodiment, the therapeutic protein bile salt hydrolase. In one embodiment, the therapeutic protein is IL-27.

[066] In one embodiment, the at least one heterologous therapeutic gene encodes an enzyme or enzymes which synthesize a therapeutic molecule. In one embodiment, the therapeutic molecule is butyrate. In one embodiment, the therapeutic molecule is propionate.

[067] In one embodiment, the at least one heterologous therapeutic gene encodes at least one enzyme which processes and reduces levels of an exogenous molecule. In one embodiment, the exogenous molecule is ammonia. In one embodiment, the at least one enzyme is a branched chain amino acid catabolism enzyme, and wherein the exogenous molecule is a branched chain amino acid. In one embodiment, the branched chain amino acid catabolism enzyme is an alpha-ketoisovalerate decarboxylate. In one embodiment, the branched chain amino acid catabolism enzyme is a branched chain keto acid dehydrogenase. In one embodiment, the at least one enzyme is a phenylalanine ammonia lyase (PAL), and wherein the exogenous molecule is phenylalanine.

[068] In one embodiment, the recombinase is selected from the group consisting of: Bxbl, PhiC31, TP901, Bxbl, PhiC31, TP901, HK022, HP1, R4, Intl, Int2, Int3, Int4, Int5, Int6, Int7, Int8, Int9, IntlO, Intl l, Intl2, Intl3, Intl4, Intl5, Intl6, Intl7, Intl8, Intl9, Int20, Int21, Int22, Int23, Int24, Int25, Int26, Int27, Int28, Int29, Int30, Int31, Int32, Int33, and Int34, or a biologically active fragment thereof.

[069] In another aspect, the disclosure provides a pharmaceutical composition comprising a recombinant bacterial cell comprising at least one heterologous therapeutic gene operably linked to a first inducible promoter, a heterologous gene encoding an anti-toxin, a heterologous gene encoding a recombinase, and a nucleic acid comprising a second promoter, a forward recombinase recognition sequence, a heterologous gene encoding a bacterial toxin, and a reverse recombinase recognition sequence, wherein the heterologous gene encoding the bacterial toxin is in an inverted orientation relative to the second promoter, and a

pharmaceutically acceptable carrier.

[070] In another aspect, the disclosure provides a pharmaceutical composition comprising a recombinant bacterial cell comprising at least one heterologous therapeutic gene operably linked to a first inducible promoter, a heterologous gene encoding an anti-toxin, a heterologous gene encoding Ara operably linked to a ParaC promoter, a heterologous gene encoding TetR operably linked to a ParaBAD promoter, and a heterologous gene encoding a bacterial toxin operably linked to a PTetR promoter, and a pharmaceutically acceptable carrier.

[071] In one embodiment, the heterologous gene encoding the toxin encodes a polypeptide selected from the group consisting of a lysin, Hok, Fst, TisB, LdrD, Kid, SymE, MazF, FlmA, lbs, XCV2162, dinJ, CcdB, MazF, ParE, YafO, Zeta, hicB, relB, yhaV, yoeB, chpBK, hipA, microcin B, microcin B 17, microcin C, microcin C7-C51, microcin J25, microcin ColV, microcin 24, microcin L, microcin D93, microcin L, microcin E492, microcin H47, microcin 147, microcin M, colicin A, colicin El, colicin K, colicin N, colicin U, colicin B, colicin la, colicin lb, colicin 5, colicinlO, colicin S4, colicin Y, colicin E2, colicin E7, colicin E8, colicin E9, colicin E3, colicin E4, colicin E6; colicin E5, colicin D, colicin M, and cloacin DF13, or a biologically active fragment thereof.

[072] In one embodiment, the heterologous gene encoding the anti-toxin encodes a polypeptide selected from the group consisting of an anti- lysin, Sok, RNAII, IstR, RdlD, Kis, SymR, MazE, FlmB, Sib, ptaRNAl, yafQ, CcdA, MazE, ParD, yaf , Epsilon, HicA, relE, prlF, yefM, chpBI, hipB, MccE, MccECTD, MccF, Cai, ImmEl, Cki, Cni, Cui, Cbi, Iia, Imm, Cfi, ImlO, Csi, Cyi, Im2, Im7, Im8, Im9, Im3, Im4, ImmE6, cloacin immunity protein (Cim), ImmE5, ImmD, and Cmi, or a biologically active fragment thereof.

[073] In one embodiment, the heterologous gene encoding the toxin is a

heterologous gene encoding a lysin, or a biologically active fragment thereof, and the heterologous gene encoding the anti-toxin is a heterologous gene encoding an anti- lysin, or a biologically active fragment thereof. In one embodiment, the heterologous gene encoding the toxin is a heterologous gene encoding Kid, or a biologically active fragment thereof, and the heterologous gene encoding the anti-toxin is a heterologous gene encoding Kis, or a biologically active fragment thereof. In one embodiment, the heterologous gene encoding the toxin is a heterologous gene encoding LdrD, or a biologically active fragment thereof, and the heterologous gene encoding the anti-toxin is a heterologous gene encoding RdlD, or a biologically active fragment thereof. In one embodiment, the heterologous gene encoding the toxin is a heterologous gene encoding SymE, or a biologically active fragment thereof, and the heterologous gene encoding the anti-toxin is a heterologous gene encoding SymR, or a biologically active fragment thereof. In one embodiment, the heterologous gene encoding the toxin is a heterologous gene encoding MazF, or a biologically active fragment thereof, and the heterologous gene encoding the anti-toxin is a heterologous gene encoding MazE, or a biologically active fragment thereof. In one embodiment, the heterologous gene encoding the toxin is a heterologous gene encoding CcdB, or a biologically active fragment thereof, and the heterologous gene encoding the anti-toxin is a heterologous gene encoding CcdA, or a biologically active fragment thereof. In one embodiment, the heterologous gene encoding the toxin is a heterologous gene encoding ParE, or a biologically active fragment thereof, and the heterologous gene encoding the anti-toxin is a heterologous gene encoding ParD, or a biologically active fragment thereof. In one embodiment, the heterologous gene encoding the toxin is a heterologous gene encoding Zeta, or a biologically active fragment thereof, and the heterologous gene encoding the anti-toxin is a heterologous gene encoding Epsilon, or a biologically active fragment thereof.

[074] In one embodiment, the recombinase is specific for the forward and reverse recombinase recognition sequences.

[075] In one embodiment, the toxin is bactericidal to the recombinant bacterial cell. In one embodiment, the toxin is bacteriostatic to the recombinant bacterial cell.

[076] In one embodiment, the at least one heterologous therapeutic gene is located on a plasmid in the bacterial cell. In one embodiment, the at least one heterologous therapeutic gene is located on a chromosome in the bacterial cell.

[077] In one embodiment, the heterologous gene encoding Ara operably linked to the ParaC promoter is located on a plasmid or on a chromosome in the bacterial cell.

[078] In one embodiment, the heterologous gene encoding TetR operably linked to a ParaBAD promoter is located on a plasmid or on a chromosome in the bacterial cell.

[079] In one embodiment, the heterologous gene encoding the anti-toxin is located on a plasmid in the bacterial cell. In one embodiment, the heterologous gene encoding the anti- toxin is located on a chromosome in the bacterial cell. [080] In one embodiment, the heterologous gene encoding the recombinase is located on a plasmid in the bacterial cell. In one embodiment, the heterologous gene encoding the recombinase is located on a chromosome in the bacterial cell.

[081] In one embodiment, the nucleic acid is located on a plasmid in the bacterial cell. In one embodiment, the nucleic acid is located on a chromosome in the bacterial cell.

[082] In one embodiment, the heterologous gene encoding the anti-toxin is operably linked to the first inducible promoter. In one embodiment, the heterologous gene encoding the recombinase is operably linked to the first inducible promoter. In one embodiment, the at least one heterologous therapeutic gene, the heterologous gene encoding the anti-toxin, and the heterologous gene encoding the recombinase are all operably linked to the first promoter.

[083] In one embodiment, the heterologous gene encoding TetR and the

heterologous gene encoding the anti-toxin are both operably linked to the ParaBAD promoter.

[084] In one embodiment, the heterologous gene encoding the anti-toxin is operably linked to a constitutive promoter.

[085] In one embodiment, the first promoter is an inducible promoter.

[086] In one embodiment, the heterologous gene encoding the anti-toxin is operably linked to a third promoter. In one embodiment, the third promoter is an inducible promoter.

[087] In one embodiment, the heterologous gene encoding the recombinase is operably linked to a third promoter. In one embodiment, the third promoter is an inducible promoter.

[088] In one embodiment, the second promoter is a constitutive promoter. In one embodiment, the constitutive promoter is the tet promoter. In another embodiment, the constitutive promoter is the lac promoter. In another embodiment, the constitutive promoter is a constitutive Escherichia coli σ32 promoter. In another embodiment, the constitutive promoter is a constitutive Escherichia coli σ70 promoter. In another embodiment, the constitutive promoter is a constitutive Bacillus subtilis σΑ promoter. In another embodiment, the constitutive promoter is a constitutive Bacillus subtilis σΒ promoter. In another embodiment, the constitutive promoter is a Salmonella promoter. In another embodiment, the constitutive promoter is a bacteriophage T7 promoter. In another embodiment, the constitutive promoter is and a bacteriophage SP6 promoter.

[089] In one embodiment, the heterologous gene encoding the anti-toxin is linked to a third promoter, and the heterologous gene encoding the recombinase is operably linked to a fourth promoter. In one embodiment, the third promoter is an inducible promoter. In one embodiment, the fourth promoter is an inducible promoter.

[090] In one embodiment, the first promoter, the third promoter, and the fourth promoter are separate copies of the same promoter. In one embodiment, the first promoter, the third promoter, and the fourth promoter are all inducible promoters. In one embodiment, the first promoter, the third promoter, and the fourth promoter are each directly or indirectly induced by environmental conditions. In one embodiment, the first promoter, the third promoter, and the fourth promoter are each directly or indirectly induced by environmental conditions specific to the small intestine of a mammal. In one embodiment, the first promoter, the third promoter, and the fourth promoter are each directly or indirectly induced by low-oxygen or anaerobic conditions. In one embodiment, the first promoter; the third promoter; the fourth promoter; the first promoter and the third promoter; the first promoter and the fourth promoter; or the first promoter, the third promoter, and the fourth promoter; are each an FNR responsive promoter. In one embodiment, the first promoter; the third promoter; the fourth promoter; the first promoter and the third promoter; the first promoter and the fourth promoter; or the first promoter, the third promoter, and the fourth promoter; are each regulated by a reactive nitrogen species (RNS). In one embodiment, the first promoter; the third promoter; the fourth promoter; the first promoter and the third promoter; the first promoter and the fourth promoter; or the first promoter, the third promoter, and the fourth promoter; are each regulated by a reactive oxygen species (ROS).

[091] In one embodiment, the recombinant bacterial cell is a recombinant probiotic bacterial cell. In one embodiment, the recombinant bacterial cell is a member of a genus selected from the group consisting of Bacteroides, Bifidobacterium, Clostridium, Escherichia, Lactobacillus and Lactococcus. In one embodiment, the recombinant bacterial cell is of the genus Escherichia. In one embodiment, the recombinant bacterial cell is of the species Escherichia coli strain Nissle.

[092] In one embodiment, the recombinant bacterial cell is an auxotroph in a gene. In one embodiment, the gene is a DNA synthesis gene. In one embodiment, the gene is a cell wall synthesis gene. In one embodiment, the gene is an amino acid gene. In one

embodiment, the DNA synthesis gene is thyA. In one embodiment, the cell wall synthesis gene is dapA. In one embodiment, the amino acid gene is serA or metA.

[093] In one embodiment, the at least one heterologous therapeutic gene encodes a therapeutic protein. In one embodiment, the therapeutic protein is IL-10. In one embodiment, the therapeutic protein is GLP2. In one embodiment, the therapeutic protein is IL-27. In one embodiment, the therapeutic protein is TGFp.

[094] In one embodiment, the at least one heterologous therapeutic gene encodes an enzyme or enzymes which synthesize a therapeutic molecule. In one embodiment, the therapeutic molecule is butyrate. In one embodiment, the therapeutic molecule is propionate.

[095] In one embodiment, the at least one heterologous therapeutic gene encodes an enzyme which processes and reduces levels of an exogenous molecule. In one embodiment, the enzyme is a branched chain amino acid catabolism enzyme, and wherein the exogenous molecule is a branched chain amino acid. In one embodiment, the branched chain amino acid catabolism enzyme is an alpha-ketoisovalerate decarboxylate. In one embodiment, the branched chain amino acid catabolism enzyme is a branched chain keto acid dehydrogenase. In one embodiment, the enzyme is a phenylalanine ammonia lyase (PAL), and wherein the exogenous molecule is phenylalanine.

[096] In one embodiment, the recombinase is a recombinase selected from the group consisting of: Bxbl, PhiC31, TP901, Bxbl, PhiC31, TP901, HK022, HP1, R4, Intl, Int2, Int3, Int4, Int5, Int6, Int7, Int8, Int9, IntlO, Intl l, Intl2, Intl3, Intl4, Intl5, Intl6, Intl7, Intl8, Intl9, Int20, Int21, Int22, Int23, Int24, Int25, Int26, Int27, Int28, Int29, Int30, Int31, Int32, Int33, and Int34, or a biologically active fragment thereof.

[097] In one embodiment, the recombinant bacterial cell further comprises a heterologous reporter gene operably linked to a third inducible promoter. In one

embodiment, the heterologous reporter gene is a green fluorescence protein (GFP) gene.

[098] In another aspect, the disclosure provides a pharmaceutical composition comprising a recombinant bacterial cell comprising at least one heterologous therapeutic gene operably linked to a first inducible promoter, a heterologous gene encoding a first

recombinase, a first nucleic acid comprising a second promoter, a first forward recombinase recognition sequence, a heterologous gene encoding a second recombinase, and a first reverse recombinase recognition sequence, wherein the heterologous gene encoding the second recombinase is in an inverted orientation relative to the second promoter, a second nucleic acid comprising a third promoter, a second forward recombinase recognition sequence, a heterologous gene encoding a bacterial toxin, and a second reverse recombinase recognition sequence, wherein the heterologous gene encoding the bacterial toxin is in an inverted orientation relative to the third promoter, and a pharmaceutically acceptable carrier. [099] In another aspect, the disclosure provides a pharmaceutical composition comprising a recombinant bacterial cell comprising at least one heterologous therapeutic gene operably linked to a first inducible promoter, a heterologous gene encoding a recombinase, a first nucleic acid comprising a second promoter, a forward recombinase recognition sequence, a heterologous gene encoding a first excision enzyme, and a reverse recombinase recognition sequence, wherein the heterologous gene encoding the first excision enzyme is in an inverted orientation relative to the second promoter, a second nucleic acid comprising an essential gene flanked by sequences specific for the first excision enzyme, and a

pharmaceutically acceptable carrier.

[0100] In another aspect, the disclosure provides a pharmaceutical composition comprising a recombinant bacterial cell comprising at least one heterologous therapeutic gene operably linked to a first inducible promoter, a heterologous gene encoding a recombinase, a first nucleic acid comprising a second promoter, a first forward recombinase recognition sequence, a heterologous gene encoding a first excision enzyme, and a first reverse recombinase recognition sequence, wherein the heterologous gene encoding the first excision enzyme is in an inverted orientation relative to the second promoter, a second nucleic acid comprising a third promoter, a second forward recombinase recognition sequence, a heterologous gene encoding a second excision enzyme, and a second reverse recombinase recognition sequence, wherein the heterologous gene encoding the second excision enzyme is in an inverted orientation relative to the third promoter, a third nucleic acid encoding a first essential gene flanked by sequences specific for the first excision enzyme, a fourth nucleic acid encoding a second essential gene flanked by sequences specific for the second excision enzyme, and a pharmaceutically acceptable carrier.

[0101] In one embodiment, the first excision enzyme is Xisl. In one embodiment, the first excision enzyme is Xis2. In one embodiment, the first excision enzyme is Xisl, and the second excision enzyme is Xis2.

[0102] In another aspect, the disclosure provides a method for treating a subject having a disease or disorder, the method comprising administering the pharmaceutical composition of the disclosure to the subject, thereby treating the disease or disorder.

[0103] In another aspect, the disclosure provides a recombinant bacterial cell comprising at least one heterologous therapeutic gene operably linked to a first inducible promoter, a heterologous gene encoding an anti-toxin, a heterologous gene encoding a recombinase, and a nucleic acid comprising a second promoter, a forward recombinase recognition sequence, a heterologous gene encoding a bacterial toxin, and a reverse recombinase recognition sequence, wherein the heterologous gene encoding the bacterial toxin is in an inverted orientation relative to the second promoter.

[0104] In another aspect, the disclosure provides a recombinant bacterial cell comprising at least one heterologous therapeutic gene operably linked to a first inducible promoter, a heterologous gene encoding an anti-toxin, a heterologous gene encoding Ara operably linked to a ParaC promoter, a heterologous gene encoding TetR operably linked to a ParaBAD promoter, and a heterologous gene encoding a bacterial toxin operably linked to a PTetR promoter.

[0105] In one embodiment, the heterologous gene encoding the toxin encodes a polypeptide selected from the group consisting of a lysin, Hok, Fst, TisB, LdrD, Kid, SymE, MazF, FlmA, lbs, XCV2162, dinJ, CcdB, MazF, ParE, YafO, Zeta, hicB, relB, yhaV, yoeB, chpBK, hipA, microcin B, microcin B 17, microcin C, microcin C7-C51, microcin J25, microcin ColV, microcin 24, microcin L, microcin D93, microcin L, microcin E492, microcin H47, microcin 147, microcin M, colicin A, colicin El, colicin K, colicin N, colicin U, colicin B, colicin la, colicin lb, colicin 5, colicinlO, colicin S4, colicin Y, colicin E2, colicin E7, colicin E8, colicin E9, colicin E3, colicin E4, colicin E6; colicin E5, colicin D, colicin M, and cloacin DF13, or a biologically active fragment thereof.

[0106] In one embodiment, the heterologous gene encoding the anti-toxin encodes a polypeptide selected from the group consisting of an anti- lysin, Sok, RNAII, IstR, RdlD, Kis, SymR, MazE, FlmB, Sib, ptaRNAl, yafQ, CcdA, MazE, ParD, yaf , Epsilon, HicA, relE, prlF, yefM, chpBI, hipB, MccE, MccECTD, MccF, Cai, ImmEl, Cki, Cni, Cui, Cbi, Iia, Imm, Cfi, ImlO, Csi, Cyi, Im2, Im7, Im8, Im9, Im3, Im4, ImmE6, cloacin immunity protein (Cim), ImmE5, ImmD, and Cmi, or a biologically active fragment thereof.

[0107] In one embodiment, the heterologous gene encoding the toxin is a

[0108] In one embodiment, the recombinase is specific for the forward and reverse recombinase recognition sequences.

[0109] In one embodiment, the toxin is bactericidal to the recombinant bacterial cell. In one embodiment, the toxin is bacteriostatic to the recombinant bacterial cell.

[0110] In one embodiment, the at least one heterologous therapeutic gene is located on a plasmid in the bacterial cell. In one embodiment, the at least one heterologous therapeutic gene is located on a chromosome in the bacterial cell.

[0111] In one embodiment, the heterologous gene encoding the anti-toxin is located on a plasmid in the bacterial cell. In one embodiment, the heterologous gene encoding the anti- toxin is located on a chromosome in the bacterial cell.

[0112] In one embodiment, the heterologous gene encoding the recombinase is located on a plasmid in the bacterial cell. In one embodiment, the heterologous gene encoding the recombinase is located on a chromosome in the bacterial cell.

[0113] In one embodiment, the nucleic acid is located on a plasmid in the bacterial cell. In one embodiment, the nucleic acid is located on a chromosome in the bacterial cell. In one embodiment, the heterologous gene encoding the anti-toxin is operably linked to the first inducible promoter. [0114] In one embodiment, the heterologous gene encoding Ara is located on a plasmid in the bacterial cell or in a chromosome in the bacterial cell.

[0115] In one embodiment, the heterologous gene encoding TetR is located on a plasmid in the bacterial cell or in a chromosome in the bacterial cell.

[0116] In one embodiment, the heterologous gene encoding the recombinase is operably linked to the first inducible promoter. In one embodiment, the at least one heterologous therapeutic gene, the heterologous gene encoding the anti-toxin, and the heterologous gene encoding the recombinase are all operably linked to the first promoter.

[0117] In one embodiment, the first promoter is an inducible promoter.

[0118] In one embodiment, the heterologous gene encoding the anti-toxin is operably linked to a third promoter. In one embodiment, the third promoter is an inducible promoter.

[0119] In one embodiment, the heterologous gene encoding the recombinase is operably linked to a third promoter. In one embodiment, the third promoter is an inducible promoter.

[0120] In one embodiment, the second promoter is a constitutive promoter.

[0121] In one embodiment, the heterologous gene encoding the anti-toxin is linked to a third promoter, and the heterologous gene encoding the recombinase is operably linked to a fourth promoter. In one embodiment, the third promoter is an inducible promoter. In one embodiment, the fourth promoter is an inducible promoter. In one embodiment, the first promoter, the third promoter, and the fourth promoter are separate copies of the same promoter.

[0122] In one embodiment, the first promoter, the third promoter, and the fourth promoter are all inducible promoters. In one embodiment, the first promoter, the third promoter, and the fourth promoter are each directly or indirectly induced by an environmental condition. In one embodiment, the first promoter, the third promoter, and the fourth promoter are each directly or indirectly induced by the same environmental condition. In one embodiment, the first promoter, the third promoter, and the fourth promoter are each directly or indirectly induced by different environmental conditions. In one embodiment, the first promoter, the third promoter, and the fourth promoter are each directly or indirectly induced by environmental conditions specific to the small intestine of a mammal. In one

embodiment, the first promoter, the third promoter, and the fourth promoter are each directly or indirectly induced by low-oxygen or anaerobic conditions. [0123] In one embodiment, the first promoter; the third promoter; the fourth promoter; the first promoter and the third promoter; the first promoter and the fourth promoter; or the first promoter, the third promoter, and the fourth promoter; are each an FNR responsive promoter. In one embodiment, the first promoter; the third promoter; the fourth promoter; the first promoter and the third promoter; the first promoter and the fourth promoter; or the first promoter, the third promoter, and the fourth promoter; are each regulated by a reactive nitrogen species (RNS). In one embodiment, the first promoter; the third promoter; the fourth promoter; the first promoter and the third promoter; the first promoter and the fourth promoter; or the first promoter, the third promoter, and the fourth promoter; are each regulated by a reactive oxygen species (ROS).

[0124] In one embodiment, the recombinant bacterial cell is a recombinant probiotic bacterial cell. In one embodiment, the recombinant bacterial cell is a member of a genus selected from the group consisting of Bacteroides, Bifidobacterium, Clostridium, Escherichia, Lactobacillus and Lactococcus. In one embodiment, the recombinant bacterial cell is of the genus Escherichia. In one embodiment, the recombinant bacterial cell is of the species Escherichia coli strain Nissle.

[0125] In one embodiment, the recombinant bacterial cell is an auxotroph in a gene. In one embodiment, the gene is a DNA synthesis gene. In one embodiment, the gene is a cell wall synthesis gene. In one embodiment, the gene is an amino acid gene. In one

[0126] In one embodiment, the recombinant bacterial cell is an auxotroph in diaminopimelic acid or an enzyme in the thymine biosynthetic pathway. In one embodiment, the essential gene is a diaminopimelic acid gene or a gene in the thymine biosynthetic pathway.

[0127] In one embodiment, the at least one heterologous therapeutic gene encodes a therapeutic protein. In one embodiment, the therapeutic protein is IL-10. In one embodiment, the therapeutic protein is GLP2. In one embodiment, the therapeutic protein is IL-27. In one embodiment, the therapeutic protein is TGFp.

[0128] In one embodiment, the at least one heterologous therapeutic gene encodes an enzyme or enzymes which synthesize a therapeutic molecule. In one embodiment, the therapeutic molecule is butyrate. In one embodiment, the therapeutic molecule is propionate. [0129] In one embodiment, the at least one heterologous therapeutic gene encodes an enzyme which processes and reduces levels of an exogenous molecule. In one embodiment, the exogenous molecule is ammonia. In one embodiment, the enzyme is a branched chain amino acid catabolism enzyme, and wherein the exogenous molecule is a branched chain amino acid. In one embodiment, the branched chain amino acid catabolism enzyme is an alpha-ketoisovalerate decarboxylate. In one embodiment, the branched chain amino acid catabolism enzyme is a branched chain keto acid dehydrogenase. In one embodiment, the enzyme is a phenylalanine ammonia lyase (PAL), and wherein the exogenous molecule is phenylalanine.

[0130] In one embodiment, the recombinase is a recombinase selected from the group consisting of: Bxbl, PhiC31, TP901, Bxbl, PhiC31, TP901, HK022, HPl, R4, Intl, Int2, Int3, Int4, Int5, Int6, Int7, Int8, Int9, IntlO, Intl l, Intl2, Intl3, Intl4, Intl5, Intl6, Intl7, Intl8, Intl9, Int20, Int21, Int22, Int23, Int24, Int25, Int26, Int27, Int28, Int29, Int30, Int31, Int32, Int33, and Int34, or a biologically active fragment thereof.

[0131] In one embodiment, the recombinant bacterial cell further comprises a heterologous reporter gene operably linked to a third inducible promoter. In one

[0132] In another aspect, the disclosure provides a recombinant bacterial cell comprising at least one heterologous therapeutic gene operably linked to a first inducible promoter, a heterologous gene encoding a first recombinase, a first nucleic acid comprising a second promoter, a first forward recombinase recognition sequence, a heterologous gene encoding a second recombinase, and a first reverse recombinase recognition sequence, wherein the heterologous gene encoding the second recombinase is in an inverted orientation relative to the second promoter, a second nucleic acid comprising a third promoter, a second forward recombinase recognition sequence, a heterologous gene encoding a bacterial toxin, and a second reverse recombinase recognition sequence, wherein the heterologous gene encoding the bacterial toxin is in an inverted orientation relative to the third promoter.

[0133] In one aspect, the disclosure provides a recombinant bacterial cell comprising at least one heterologous therapeutic gene operably linked to a first inducible promoter, a heterologous gene encoding a recombinase, a first nucleic acid comprising a second promoter, a forward recombinase recognition sequence, a heterologous gene encoding a first excision enzyme, and a reverse recombinase recognition sequence, wherein the heterologous gene encoding the first excision enzyme is in an inverted orientation relative to the second promoter, a second nucleic acid comprising an essential gene flanked by sequences specific for the first excision enzyme.

[0134] In another aspect, the disclosure provides a recombinant bacterial cell comprising at least one heterologous therapeutic gene operably linked to a first inducible promoter, a heterologous gene encoding a recombinase, a first nucleic acid comprising a second promoter, a first forward recombinase recognition sequence, a heterologous gene encoding a first excision enzyme, and a first reverse recombinase recognition sequence, wherein the heterologous gene encoding the first excision enzyme is in an inverted orientation relative to the second promoter, a second nucleic acid comprising a third promoter, a second forward recombinase recognition sequence, a heterologous gene encoding a second excision enzyme, and a second reverse recombinase recognition sequence, wherein the heterologous gene encoding the second excision enzyme is in an inverted orientation relative to the third promoter, a third nucleic acid encoding a first essential gene flanked by sequences specific for the first excision enzyme, and a fourth nucleic acid encoding a second essential gene flanked by sequences specific for the second excision enzyme.

[0135] In one embodiment, the first excision enzyme is Xisl. In one embodiment, the first excision enzyme is Xis2. In one embodiment, the first excision enzyme is Xisl, and the second excision enzyme is Xis2.

Brief Description of the Drawings

[0136] Fig. 1A-C depicts the design of a repression-based kill switch. A repression- based kill switch depends on the presence of an inducer (such as arabinose) to keep the cells alive. The essential gene switch involves the expression of a gene, e.g., DNA polymerase, which is not found in the gut environment. A repression-based kill switch may be toxin- based or essential-gene based. Fig. 1A depicts a non-limiting embodiment of the disclosure, wherein the expression of a heterologous gene is activated by an exogenous environmental signal. In the absence of arabinose, the AraC transcription factor adopts a conformation that represses transcription. In the presence of arabinose, the AraC transcription factor undergoes a conformational change that allows it to bind to and activate the ParaBAD promoter (ParaBAD), which induces expression of the Tet repressor (TetR) and an anti-toxin. The anti-toxin builds up in the recombinant bacterial cell, while TetR prevents expression of a toxin (which is under the control of a promoter having a TetR binding site). However, when arabinose is not present, both the anti-toxin and TetR are not expressed. Since TetR is not present to repress expression of the toxin, the toxin is expressed and kills the cell. Fig. 1A also depicts another non- limiting embodiment of the disclosure, wherein the expression of an essential gene not found in the recombinant bacteria is activated by an exogenous

environmental signal. In the absence of arabinose, the AraC transcription factor adopts a conformation that represses transcription of the essential gene under the control of the araBAD promoter and the bacterial cell cannot survive. In the presence of arabinose, the AraC transcription factor undergoes a conformational change that allows it to bind to and activate the araBAD promoter, which induces expression of the essential gene and maintains viability of the bacterial cell. Fig. IB depicts a non-limiting embodiment of the disclosure, where an anti-toxin is expressed from a constitutive promoter, and expression of a heterologous gene is activated by an exogenous environmental signal. In the absence of arabinose, the AraC transcription factor adopts a conformation that represses transcription. In the presence of arabinose, the AraC transcription factor undergoes a conformational change that allows it to bind to and activate the araBAD promoter, which induces expression of TetR, thus preventing expression of a toxin. However, when arabinose is not present, TetR is not expressed, and the toxin is expressed, eventually overcoming the anti-toxin and killing the cell. The constitutive promoter regulating expression of the anti-toxin should be a weaker promoter than the promoter driving expression of the toxin. The araC gene is under the control of a constitutive promoter in this circuit. Fig. 1C depicts another non-limiting embodiment of the disclosure, wherein the expression of a heterologous gene is activated by an exogenous environmental signal. In the absence of arabinose, the AraC transcription factor adopts a conformation that represses transcription. In the presence of arabinose, the AraC transcription factor undergoes a conformational change that allows it to bind to and activate the araBAD promoter, which induces expression of the Tet repressor (TetR) and an anti-toxin. The anti-toxin builds up in the recombinant bacterial cell, while TetR prevents expression of a toxin (which is under the control of a promoter having a TetR binding site). However, when arabinose is not present, both the anti-toxin and TetR are not expressed. Since TetR is not present to repress expression of the toxin, the toxin is expressed and kills the cell. The araC gene is either under the control of a constitutive promoter or an inducible promoter (e.g., AraC promoter) in this circuit.

[0137] Fig. 2 depicts one non-limiting embodiment of the disclosure, where an exogenous environmental condition or one or more environmental signals activates expression of a heterologous gene and at least one recombinase from an inducible promoter or inducible promoters. The recombinase then flips a toxin gene into an activated

conformation, and the natural kinetics of the recombinase create a time delay in expression of the toxin, allowing the heterologous gene to be fully expressed. Once the toxin is expressed, it kills the cell.

[0138] Fig. 3 is a schematic demonstrating an activation-based kill-switch design. When the cell producese equal amounts of toxin and anti-toxin, the cell is stable. However, when the cell no longer produces the anti-toxin, the anti-toxin proteins begin to decay. Once the anti-toxin has decayed completely, the cell dies.

[0139] Fig. 4 depicts a non-limiting embodiment of the disclosure, where an exogenous environmental condition or one or more environmental signals activates expression of a heterologous gene, an anti-toxin, and at least one recombinase from an inducible promoter or inducible promoters. The recombinase then flips a toxin gene into an activated conformation, but the presence of the accumulated anti- toxin suppresses the activity of the toxin. Once the exogenous environmental condition or cue(s) is no longer present, expression of the anti-toxin is turned off. The toxin is constitutively expressed, continues to accumulate, and kills the bacterial cell.

[0140] Fig. 5 depicts another non-limiting embodiment of the disclosure, where an exogenous environmental condition or one or more environmental signals activates expression of a heterologous gene and at least one recombinase from an inducible promoter or inducible promoters. The recombinase then flips at least one excision enzyme into an activated conformation. The at least one excision enzyme then excises one or more essential genes, leading to senescence, and eventual cell death. The natural kinetics of the

recombinase and excision genes cause a time delay, the kinetics of which can be altered and optimized depending on the number and choice of essential genes to be excised, allowing cell death to occur within a matter of hours or days. The presence of multiple nested

recombinases can be used to further control the timing of cell death.

[0141] Fig. 6 depicts one non-limiting embodiment of the disclosure, where an exogenous environmental condition, or one or more environmental signals, activates expression of a heterologous gene and a first recombinase from an inducible promoter or inducible promoters. The recombinase then flips a second recombinase from an inverted orientation to an active conformation. The activated second recombinase flips the toxin gene into an activated conformation, and the natural kinetics of the recombinase create a time delay in expression of the toxin, allowing the heterologous gene to be fully expressed. Once the toxin is expressed, it kills the cell.

[0142] Fig. 7 depicts depicts an example of a genetically engineered bacteria that comprises a plasmid that has been modified to create a host-plasmid mutual dependency, such as the GeneGuard system described in more detail herein. All engineered DNA is present on a plasmid which can be conditionally destroyed. See, for example, Wright et al., "GeneGuard: A Modular Plasmid System Designed for Biosafety," ACS Synthetic Biology (2015) 4: 307-316.

[0143] Fig. 8 depicts a synthetic biotic engineered to target urea cycle disorder (UCD) having the kill- switch embodiment described in Fig. 2. In this example, the Int recombinase and the Kid-Kis toxin-antitoxin system are used in a recombinant bacterial cell for treating UCD. The recombinant bacterial cell is engineered to consume excess ammonia to produce beneficial byproducts to improve patient outcomes. The recombinant bacterial cell also comprises a highly controllable kill switch to ensure safety. In response to a low oxygen environment (e.g., such as that found in the gut), the FNR promoter induces expression of the Int recombinase and also induces expression of the Kis anti-toxin. The Int recombinase causes the Kid toxin gene to flip into an activated conformation, but the presence of the accumulated Kis anti-toxin suppresses the activity of the expressed Kid toxin. In the presence of oxygen (e.g., outside the gut), expression of the anti-toxin is turned off. Since the toxin is constitutively expressed, it continues to accumulate and kills the bacterial cell.

[0144] Fig. 9A depicts a schematic of E coli Nissle with ArgR knockout. Fig. 9B depicts a schematic of E coli Nissle with ArgR knockout, having the integrase 8. Fig. 9C depicts a schematic of E coli Nissle with ArgR knockout, having the kid Toxin.

[0145] Figs. 10A-B shows the results of a synthetic biotic engineered to target urea cycle disorder (UCD) having the kill-switch embodiment described in Fig. 2. Fig. 10A shows that in the absence of recombinase, the toxin is not expressed and the bacterial cells are viable. Fig. 10B shows that in the presence of the recombinase, the toxin is expressed under the control of an inducible promoter and kills the bacterial cells.

[0146] Fig. 11A depicts a synthetic biotic engineered to target phenylketonuria having the kill- switch embodiment described in Fig. 2. In this example, the Int recombinase and the Kid-Kis toxin-antitoxin system are used in a recombinant bacterial cell for treating PKU. The recombinant bacterial cell is engineered to consume excess ammonia to produce beneficial byproducts to improve patient outcomes. The recombinant bacterial cell also comprises a highly controllable kill switch to ensure safety. In response to a low oxygen environment (e.g., such as that found in the gut), the FNR promoter induces expression of the Int recombinase and also induces expression of the Kis anti-toxin. The Int recombinase causes the Kid toxin gene to flip into an activated conformation, but the presence of the accumulated Kis anti-toxin suppresses the activity of the expressed Kid toxin. In the presence of oxygen (e.g., outside the gut), expression of the anti-toxin is turned off. Since the toxin is constitutively expressed, it continues to accumulate and kills the bacterial cell. Fig. 1 IB depicts a synthetic bio tic engineered to target phenylketonuria having the kill- switch embodiment described in Fig. IB.

[0147] Fig. 12 depicts a synthetic biotic engineered to target maple syrup urine disease (MSUD) having the kill-switch embodiment described in Fig. 1A.

[0148] Fig. 13 depicts a graph of Nissle residence in vivo. Streptomycin-resistant Nissle was administered to mice via oral gavage without antibiotic pre-treatment. Fecal pellets from 6 total mice were monitored post-administration to determine the amount of administered Nissle still residing within the mouse gastrointestinal tract. The bars represent the number of bacteria administered to the mice. The line represents the number of Nissle recovered from the fecal samples each day for 10 consecutive days.

[0149] Fig. 14 depicts a map of exemplary integration sites within the E. coli 1917 Nissle chromosome. These sites indicate regions where circuit components may be inserted into the chromosome without interfering with essential gene expression.

[0150] Fig. 15 depicts three bacterial strains which constitutively express red fluorescent protein (RFP). In strains 1-3, the rfp gene was inserted into different sites in the bacterial chromosome, and resulted in varying degrees of brightness under fluorescent light. Unmodified E. coli Nissle (strain 4) is non-fluorescent.

[0151] Fig. 16 depicts an exemplary schematic of the E. coli 1917 Nissle

chromosome comprising multiple mechanisms of action (MoAs).

[0152] Fig. 17 depicts a schematic of a secretion system based on the flagellar type III secretion in which an incomplete flagellum is used to secrete a therapeutic peptide of interest (star) by recombinantly fusing the peptide to an N-terminal flagellar secretion signal of a native flagellar component so that the intracellularly expressed chimeric peptide can be mobilized across the inner and outer membranes into the surrounding host environment.

[0153] Fig. 18 depicts a schematic of a type V secretion system for the extracellular production of recombinant proteins in which a therapeutic peptide (star) can be fused to an N- terminal secretion signal, a linker and the beta-domain of an autotransporter. In this system, the N-terminal signal sequence directs the protein to the SecA-YEG machinery which moves the protein across the inner membrane into the periplasm, followed by subsequent cleavage of the signal sequence. The beta-domain is recruited to the Bam complex where the beta- domain is folded and inserted into the outer membrane as a beta-barrel structure. The therapeutic peptide is then thread through the hollow pore of the beta-barrel structure ahead of the linker sequence. The therapeutic peptide is freed from the linker system by an autocatalytic cleavage or by targeting of a membrane-associated peptidase (scissors) to a complementary protease cut site in the linker.

[0154] Fig. 19 depicts a schematic of a type I secretion system, which translocates a passenger peptide directly from the cytoplasm to the extracellular space using HlyB (an ATP- binding cassette transporter); HlyD (a membrane fusion protein); and TolC (an outer membrane protein) which form a channel through both the inner and outer membranes. The secretion signal-containing C-terminal portion of HlyA is fused to the C-terminal portion of a therapeutic peptide (star) to mediate secretion of this peptide.

[0155] Fig. 20 depicts a schematic of the outer and inner membranes of a gram- negative bacterium, and several deletion targets for generating a leaky or destabilized outer membrane, thereby facilitating the translocation of a therapeutic polypeptides to the extracellular space, e.g., therapeutic polypeptides of eukaryotic origin containing disulphide bonds. Deactivating mutations of one or more genes encoding a protein that tethers the outer membrane to the peptidoglycan skeleton, e.g., lpp, ompC, ompA, ompF, tolA, tolB, pal, and/or one or more genes encoding a periplasmic protease, e.g., degS, degP, nlpl, generates a leaky phenotype. Combinations of mutations may synergistically enhance the leaky phenotype.

[0156] Fig. 21 depicts a modified type 3 secretion system (T3SS) to allow the bacteria to inject secreted therapeutic proteins into the gut lumen. An inducible promoter (small arrow, top), e.g. a FNR-inducible promoter, drives expression of the T3 secretion system gene cassette (3 large arrows, top) that produces the apparatus that secretes tagged peptides out of the cell. An inducible promoter (small arrow, bottom), e.g. a FNR-inducible promoter, drives expression of a regulatory factor, e.g. T7 polymerase, that then activates the expression of the tagged therapeutic peptide (hexagons).

[0157] Fig. 22A-B depicts a schematic of a wild-type clbA construct and a clbA knock-out construct. [0158] Fig. 23 depicts a schematic of a design-build-test cycle. Steps are as follows: 1: Define the disease pathway; 2. Identify target metabolites; 3. Designe genetic circuits; 4. Biuld synthetic biotic; 5. Activate circuit in vivo; 6. Characterize circuit activation kinetics; 7. Optimize in vitro productivity to disease threshold; 8. Test optimize circuit in animla disease model; 9. Assimilate into the microbiome; 10. Develop understanding of in vivo PK and dosing regimen.

[0159] Figs. 24A, B, C, D, and E depict a schematic of non-limiting manufacturing processes for upstream and downstream production of the genetically engineered bacteria of the present disclosure. Fig. 24A depicts the parameters for starter culture 1 (SCI): loop full - glycerol stock, duration overnight, temperature 37° C, shaking at 250 rpm. Fig. 24B depicts the parameters for starter culture 2 (SC2): 1/100 dilution from SCI, duration 1.5 hours, temperature 37° C, shaking at 250 rpm. Fig. 24C depicts the parameters for the production bioreactor: inoculum - SC2, temperature 37° C, pH set point 7.00, pH dead band 0.05, dissolved oxygen set point 50%, dissolved oxygen cascade agitation/gas FLO, agitation limits 300-1200 rpm, gas FLO limits 0.5-20 standard liters per minute, duration 24 hours. Fig. 24D depicts the parameters for harvest: centrifugation at speed 4000 rpm and duration 30 minutes, wash IX 10% glycerol/PBS, centrifugation, re-suspension 10% glycerol/PBS. Fig. 24E depicts the parameters for vial fill/storage: 1-2 mL aliquots, -80° C.

Detailed Description

[0160] The present disclosure provides recombinant bacterial cells which express a heterologous protein of interest, such as a therapeutic protein, that have been engineered to die after sensing the presence or absence of an environmental signal (or signals). Thus, sensing the presence or absence of an environmental signal (or signals) by the recombinant bacterial cell effectively dooms the bacterial cell. This disclosure provides recombinant bacterial cells with one or more programmable components for the biocontainment of the recombinant bacterial cells for safety and waste management. The present disclosure further provides pharmaceutical compositions comprising the recombinant bacteria, and methods for treating diseases or disorders in a subject by administration of the recombinant bacteria to the subject.

[0161] In order that the disclosure may be more readily understood, certain terms are first defined. These definitions should be read in light of the remainder of the disclosure and as understood by a person of ordinary skill in the art. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by a person of ordinary skill in the art. Additional definitions are set forth throughout the detailed description.

[0162] As used herein, the term "recombinant bacterial cell" or "recombinant bacteria" refers to a bacterial cell or bacteria that have been genetically modified from their native state. For instance, a recombinant bacterial cell may have nucleotide insertions, nucleotide deletions, nucleotide rearrangements, and nucleotide modifications introduced into their DNA. These genetic modifications may be present in the chromosome of the bacteria or bacterial cell, or on a plasmid in the bacteria or bacterial cell. Recombinant bacterial cells of the disclosure may comprise exogenous nucleotide sequences on plasmids. Alternatively, recombinant bacterial cells may comprise exogenous nucleotide sequences stably

incorporated into their chromosome.

[0163] A "programmed or engineered recombinant bacterial cell" or "programmed or engineered bacterial cell" is a bacterial cell that has been genetically modified from its native state to perform a specific function. In certain embodiments, the programmed or engineered bacterial cell has been modified to express one or more proteins, for example, one or more proteins that have a therapeutic activity or serve a therapeutic purpose. The programmed or engineered bacterial cell may additionally have the ability to stop growing or to destroy itself once the protein(s) of interest have been expressed. For example, in one embodiment of the disclosure, a programmed or engineered bacterial cell dies after at least one recombination event which is directly or indirectly induced by exogenous environmental condition(s) or by one or more environmental signals. In one embodiment, the at least one recombination event leads to the excision of one or more essential genes which affects viability. In another embodiment, the at least one recombination event leads to the expression of one or more toxins which kills the programmed recombinant bacterial cell. In another embodiment, a programmed or engineered recombinant bacterial cell dies after the expression of a toxin, which expression is directly or indirectly induced in response to exogenous environmental condition(s) or one or more environmental signals. In any of these embodiments, the induction of one or more biological events that ultimately leads to cell death may occur due to the absence of an environmental condition(s) and/or signal(s), the presence of an environmental condition(s) and/or signal(s), or a combination of the absence and presence of an environmental condition(s) or signal(s). For example, in some embodiments, the expression of a recombinase, toxin or other protein or factor may be induced in the absence of an environmental condition(s) and/or signal(s). In some embodiments, the expression of a recombinase, toxin or other protein or factor may be induced in the presence of an

environmental condition(s) and/or signal(s). In some embodiments, the expression of a recombinase, toxin or other protein or factor may be induced by a combination of the absence and presence of an environmental condition(s) and/or signal(s). For example, in one embodiment, a programmed or engineered recombinant bacterial cell dies after the expression of a toxin or other protein which is induced in the cell due to an absence of an exogenous environmental signal, such as the absence of arabinose or other sugar. In another

embodiment, a programmed or engineered recombinant bacterial cell dies after the expression of a toxin or other protein (e.g., recombinase) which is induced in the cell due to an absence of an exogenous environmental condition, such as the absence or diminishment of oxygen. In another embodiment, a programmed or engineered recombinant bacterial cell dies after the expression of a toxin or other protein (e.g., recombinase) which is induced in the cell due to the presence of an exogenous environmental signal, such as the presence of an inflammatory protein or factor. In another embodiment, a programmed or engineered recombinant bacterial cell dies after the expression of a toxin or other protein (e.g., recombinase) which is induced in the cell due to the presence of an exogenous environmental condition, such as the presence of nitric oxide.

[0164] As used herein, the term "gene" or "gene sequenc"refers to a nucleic acid sequence that encodes a protein or fragment thereof, optionally including regulatory sequences preceding (5' non-coding sequences) and following (3' non-coding sequences) the coding sequence. In one embodiment, a "gene" does not include regulatory sequences preceding and following the coding sequence. A "native gene" refers to a gene as found in nature, optionally with its own regulatory sequences preceding and following the coding sequence. A "chimeric gene" refers to any gene that is not a native gene, optionally comprising regulatory sequences preceding and following the coding sequence, wherein the coding sequences and/or the regulatory sequences, in whole or in part, are not found together in nature. Thus, a chimeric gene may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory and coding sequences that are derived from the same source, but arranged differently than is found in nature.

[0165] As used herein, a "heterologous gene" or "heterologous sequence" refers to a nucleotide sequence that has been introduced to the bacteria either on a plasmid or integrated into a chromosome of the bacteria. The heterologous gene may be normally or naturally found in a given cell genome or in a given plasmid (e.g., the heterologous gene could be an extra copy of the gene) or may be a nucleotide sequence that is not normally or naturally found in the bacteria. As used herein, a heterologous sequence encompasses a nucleic acid sequence that is exogenously introduced into a given cell or plasmid. "Heterologous gene" includes a native gene, or fragment thereof, that has been introduced into the host cell in a form that is different from the corresponding native gene. For example, a heterologous gene may include a native coding sequence that is a portion of a chimeric gene that includes one or more non-native regulatory regions that is reintroduced into the host cell. A heterologous gene may also include a gene, or fragment thereof, that is introduced into a host cell that does not normally contain such gene. As used herein, the term "endogenous gene" refers to a native gene in its natural location in the genome of an organism. As used herein, the term "transgene" refers to a gene that has been introduced into the host organism, e.g., host bacterial cell genome.

[0166] As used herein, a "non- native" nucleic acid sequence refers to a nucleic acid sequence not normally present in a bacterial host cell, e.g., an extra copy of an endogenous sequence, or a heterologous sequence such as a sequence from a different species, strain, or substrain of bacteria, or a sequence that is modified and/or mutated as compared to the unmodified sequence from bacteria of the same subtype. In some embodiments, the non- native nucleic acid sequence is a synthetic, non-naturally occurring sequence (see, e.g., Purcell et al., 2013). The non- native nucleic acid sequence may be a regulatory region, a promoter, and/or a gene. The non-native nucleic acid sequence may be present on a plasmid or chromosome. In some embodiments, the recombinant bacterial cells of the disclosure comprise a gene encoding a leucine-metabolizing enzyme that is operably linked to a directly or indirectly inducible promoter that is not associated with said gene in nature, e.g., an FNR responsive promoter operably linked to a gene encoding a branched chain amino acid catabolism enzyme.

[0167] As used herein, the terms "gene of interest", "payload", "therapeutic gene" all refer to gene sequences that have been exogenously introduced into the bacterial or virus cell. As used herein, "payload" or "molecule of interest" refers to one or more molecules to be produced by a genetically engineered microorganism, such as a bacteria or a virus. In some embodiments, the payload is a therapeutic payload, such as a therapeutic polypeptide. In some embodiments, the payload is a short chain fatty acid, metabolite, transporter peptide (assists in importing molecules into the bacterial cell), secretion system peptide, a kill-switch component, antibiotic resistance gene, biosynethetic cassette, catabolic cassette. In some embodiments, the payload is a regulatory molecule, e.g., a transcriptional regulator such as FNR. In some embodiments, the payload comprises a regulatory element, such as a promoter or a repressor. In some embodiments, the payload comprises an inducible promoter, such as from FNRS. In some embodiments the payload comprises a repressor element, such as a kill switch. In some embodiments, the payload is encoded by a gene or multiple genes or an operon. In alternate embodiments, the payload is produced by a biosynthetic or biochemical pathway, wherein the biosynthetic or biochemical pathway may optionally be endogenous to the microorganism. In some embodiments, the genetically engineered microorganism comprises two or more payloads.

[0168] As used herein, the term "gene" or "gene sequence" refers to any sequence expressing a polypeptide or protein, including genomic sequences, cDNA sequences, naturally occurring sequences, artificial sequences, and codon optimized sequences.

[0169] As used herein, the term "coding region" refers to a nucleotide sequence that codes for a specific amino acid sequence. The term "regulatory sequence" refers to a nucleotide sequence located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence, and which influences the transcription, RNA processing, RNA stability, or translation of the associated coding sequence. Examples of regulatory sequences include, but are not limited to, promoters, enhancers, translation leader sequences, effector binding sites, termination sequences, IRES, and stem-loop structures. In one embodiment, the regulatory sequence comprises a promoter, e.g., an FNR responsive promoter.

[0170] As used herein the term "codon-optimized" refers to the modification of codons in the gene or coding regions of a nucleic acid molecule to reflect the typical codon usage of the host organism without altering the polypeptide encoded by the nucleic acid molecule. Such optimization includes replacing at least one, or more than one, or a significant number, of codons with one or more codons that are more frequently used in the genes of the host organism.

[0171] "Operably linked" refers to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is affected by the other. A regulatory element is operably linked with a coding sequence when it is capable of affecting the expression of the gene coding sequence, regardless of the distance between the regulatory element and the coding sequence. More specifically, operably linked refers to a nucleic acid sequence, e.g., a gene encoding a branched chain amino acid catabolism enzyme, that is joined to a regulatory sequence in a manner which allows expression of the nucleic acid sequence, e.g., the gene encoding the branched chain amino acid catabolism enzyme. In other words, the regulatory sequence acts in cis. In one embodiment, a gene may be "directly linked" to a regulatory sequence in a manner which allows expression of the gene. In another embodiment, a gene may be "indirectly linked" to a regulatory sequence in a manner which allows expression of the gene. In one embodiment, two or more genes may be directly or indirectly linked to a regulatory sequence in a manner which allows expression of the two or more genes.

[0172] A "promoter" as used herein, refers to a nucleotide sequence that is capable of controlling the expression of a coding sequence or gene. Promoters are generally located 5' of the sequence that they regulate. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from promoters found in nature, and/or comprise synthetic nucleotide segments. Those skilled in the art will readily ascertain that different promoters may regulate expression of a coding sequence or gene in response to a particular stimulus, e.g., in a cell- or tissue- specific manner, in response to different environmental or physiological conditions, or in response to specific compounds.

Prokaryotic promoters are typically classified into two classes: inducible and constitutive.

[0173] A "constitutive promoter" refers to a promoter that allows for continuous transcription of the coding sequence or gene under its control that is not increased or decreased by stimuli or exogenous environmental conditions. Many constitutive promoters, and their variants, are well known to one of skill in the art, including but not limited to, a constitutive Escherichia coli oS promoter (e.g., an osmY promoter (International Genetically Engineered Machine (iGEM) Registry of Standard Biological Parts Name BBa_J45992; BBa_J45993)), a constitutive Escherichia coli σ32 promoter (e.g., htpG heat shock promoter (BBa_J45504)), a constitutive Escherichia coli σ70 promoter (e.g., lacq promoter

(BBa_J54200; BBa_J56015), E. coli CreABCD phosphate sensing operon promoter

(BBa_J64951), GlnRS promoter (BBa_K088007), lacZ promoter (BBa_Kl 19000;

BBa_Kl 19001); M13K07 gene I promoter (BBa_M13101); M13K07 gene II promoter (BBa_M13102), M13K07 gene III promoter (BBa_M13103), M13K07 gene IV promoter (BBa_M13104), M13K07 gene V promoter (BBa_M13105), M13K07 gene VI promoter (BBa_M13106), M13K07 gene VIII promoter (BBa_M13108), M13110 (BBa_M13110)), a constitutive Bacillus subtilis σΑ promoter (e.g., promoter veg (BBa_K143013), promoter 43 (BBa_K143013), PliaG (BBa_K823000), PlepA (BBa_K823002), Pveg (BBa_K823003)), a constitutive Bacillus subtilis σΒ promoter (e.g., promoter etc (BBa_K143010), promoter gsiB (BBa_K143011)), a Salmonella promoter (e.g., Pspv2 from Salmonella (BBa_Kl 12706), Pspv from Salmonella (BBa_Kl 12707)), a bacteriophage T7 promoter (e.g., T7 promoter (BBa_I712074; BBa_I719005; BBa_J34814; BBa_J64997; BBa_K113010; BBa_Kl 13011 ; BBa_Kl 13012; BBa_R0085; BBa_R0180; BBa_R0181; BBa_R0182; BBa_R0183;

BBa_Z0251 ; BBa_Z0252; BBa_Z0253)), and a bacteriophage SP6 promoter (e.g., SP6 promoter (BBa_J64998)).

[0174] An "inducible promoter" refers to a promoter that initiates increased levels of transcription of the coding sequence or gene under its control in response to a stimulus or an exogenous environmental condition. A "directly inducible promoter" refers to a regulatory region, wherein the regulatory region is operably linked to a gene encoding a protein or polypeptide, where, in the presence of an inducer of said regulatory region, the protein or polypeptide is expressed. An "indirectly inducible promoter" refers to a regulatory system comprising two or more regulatory regions, for example, a first regulatory region that is operably linked to a first gene encoding a first protein, polypeptide, or factor, e.g., a transcriptional regulator, which is capable of regulating a second regulatory region that is operably linked to a second gene, the second regulatory region may be activated or repressed, thereby activating or repressing expression of the second gene. Both a directly inducible promoter and an indirectly inducible promoter are encompassed by "inducible promoter." Examples of inducible promoters include, but are not limited to, an FNR promoter, a ParaC promoter, a ParaBAD promoter, and a PTetR promoter, each of which are described in more detail herein. Examples of other inducible promoters are provided herein below.

[0175] As used herein, "stably maintained" or "stable" is used to refer to a bacterial host cell carrying non-native genetic material, e.g., a gene encoding a branched chain amino acid catabolism enzyme, which is incorporated into the host genome or propagated on a self- replicating extra-chromosomal plasmid, such that the non-native genetic material is retained, expressed, and/or propagated. The stable bacterium is capable of survival and/or growth in vitro, e.g., in medium, and/or in vivo, e.g., in the gut. For example, the stable bacterium may be a genetically modified bacterium comprising a gene encoding a branched chain amino acid catabolism enzyme, in which the plasmid or chromosome carrying the gene is stably maintained in the host cell, such that branched chain amino acid catabolism enzyme can be expressed in the host cell, and the host cell is capable of survival and/or growth in vitro and/or in vivo. In some embodiments, copy number affects the stability of expression of the non-native genetic material. In some embodiments, copy number affects the level of expression of the non-native genetic material.

[0176] As used herein, the term "expression" refers to the transcription and stable accumulation of sense (mRNA) or anti-sense RNA derived from a nucleic acid, and/or to translation of an mRNA into a polypeptide

[0177] As used herein, the term "plasmid" or "vector" refers to an extrachromosomal nucleic acid, e.g., DNA, construct that is not integrated into a bacterial cell's genome.

Plasmids are usually circular and capable of autonomous replication. Plasmids may be low- copy, medium-copy, or high-copy, as is well known in the art. Plasmids may optionally comprise a selectable marker, such as an antibiotic resistance gene, which helps select for bacterial cells containing the plasmid and which ensures that the plasmid is retained in the bacterial cell. A plasmid of the disclosure may comprise a nucleic acid sequence encoding a heterologous gene.

[0178] As used herein, the term "transform" or "transformation" refers to the transfer of a nucleic acid fragment into a host bacterial cell, resulting in genetically- stable inheritance. Host bacterial cells comprising the transformed nucleic acid fragment are referred to as "recombinant" or "transgenic" or "transformed" organisms.

[0179] The term "genetic modification," as used herein, refers to any genetic change. Exemplary genetic modifications include those that increase, decrease, or abolish the expression of a gene, including, for example, modifications of native chromosomal or extrachromosomal genetic material. Exemplary genetic modifications also include the introduction of at least one plasmid, modification, mutation, base deletion, base substitution, base addition, and/or codon modification of chromosomal or extrachromosomal genetic sequence(s), gene over-expression, gene amplification, gene suppression, promoter modification or substitution, gene addition (either single or multi-copy), antisense expression or suppression, or any other change to the genetic elements of a host cell, whether the change produces a change in phenotype or not. Genetic modification can include the introduction of a plasmid, e.g., a plasmid comprising a branched chain amino acid catabolism enzyme operably linked to a promoter, into a bacterial cell. Genetic modification can also involve a targeted replacement in the chromosome, e.g., to replace a native gene promoter with an inducible promoter, regulated promoter, strong promoter, or constitutive promoter. Genetic modification can also involve gene amplification, e.g., introduction of at least one additional copy of a native gene into the chromosome of the cell. Alternatively, chromosomal genetic modification can involve a genetic mutation.

[0180] As used herein, the term "genetic mutation" refers to a change or changes in a nucleotide sequence of a gene or related regulatory region that alters the nucleotide sequence as compared to its native or wild-type sequence. Mutations include, for example,

substitutions, additions, and deletions, in whole or in part, within the wild-type sequence. Such substitutions, additions, or deletions can be single nucleotide changes (e.g., one or more point mutations), or can be two or more nucleotide changes, which may result in substantial changes to the sequence. Mutations can occur within the coding region of the gene as well as within the non-coding and regulatory sequence of the gene. The term "genetic mutation" is intended to include silent and conservative mutations within a coding region as well as changes which alter the amino acid sequence of the polypeptide encoded by the gene. A genetic mutation in a gene coding sequence may, for example, increase, decrease, or otherwise alter the activity (e.g., enzymatic activity) of the gene's polypeptide product. A genetic mutation in a regulatory sequence may increase, decrease, or otherwise alter the expression of sequences operably linked to the altered regulatory sequence.

[0181] "Exogenous environmental condition(s)" refer to setting(s) or circumstance(s) under which the promoter described herein is induced. In some embodiments, the exogenous environmental conditions are specific to a malignant growth containing cancerous cells, e.g., a tumor. The phrase "exogenous environmental conditions" is meant to refer to the environmental conditions external to the intact (unlysed) engineered micororganism, but endogenous or native to tumor environment or the host subject environment. Thus,

"exogenous" and "endogenous" may be used interchangeably to refer to environmental conditions in which the environmental conditions are endogenous to a mammalian body, but external or exogenous to an intact microorganism cell. In some embodiments, the exogenous environmental conditions are low-oxygen, microaerobic, or anaerobic conditions, such as hypoxic and/or necrotic tissues. In some embodiments, the exogenous environmental condition is a low-pH environment. In some embodiments, the genetically engineered microorganism of the disclosure comprise a pH-dependent promoter. In some embodiments, the genetically engineered microorganism of the diclosure comprise an oxygen level- dependent promoter. In some aspects, bacteria have evolved transcription factors that are capable of sensing oxygen levels. Different signaling pathways may be triggered by different oxygen levels and occur with different kinetics. An "oxygen level-dependent promoter" or "oxygen level-dependent regulatory region" refers to a nucleic acid sequence to which one or more oxygen level-sensing transcription factors is capable of binding, wherein the binding and/or activation of the corresponding transcription factor activates downstream gene expression.

[0182] Examples of oxygen level-dependent transcription factors include, but are not limited to, FNR (fumarate and nitrate reductase), ANR, and DNR. Corresponding FNR- responsive promoters, ANR (anaerobic nitrate respiration)-responsive promoters, and DNR (dissimilatory nitrate respiration regulator)-responsive promoters are known in the art (see, e.g., Castiglione et al., 2009; Eiglmeier et al., 1989; Galimand et al., 1991; Hasegawa et al., 1998; Hoeren et al., 1993; Salmon et al., 2003), and non-limiting examples are shown in Table 1.

[0183] In a non-limiting example, a promoter (PfnrS) was derived from the E. coli Nissle fumarate and nitrate reductase gene S (fnrS) that is known to be highly expressed under conditions of low or no environmental oxygen (Durand and Storz, 2010; Boysen et al, 2010). The PfnrS promoter is activated under anaerobic conditions by the global

transcriptional regulator FNR that is naturally found in Nissle. Under anaerobic conditions, FNR forms a dimer and binds to specific sequences in the promoters of specific genes under its control, thereby activating their expression. However, under aerobic conditions, oxygen reacts with iron-sulfur clusters in FNR dimers and converts them to an inactive form. In this way, the PfnrS inducible promoter is adopted to modulate the expression of proteins or RNA. PfnrS is used interchangeably in this application as FNRS, fnrs, FNR, P-FNRS promoter and other such related designations to indicate the promoter PfnrS.

Table 1. Examples of transcription factors and responsive genes and regulatory regions

[0184] In some embodiments, the exogenous environmental condition(s) and/or signal(s) stimulates the activity of an inducible promoter. In some embodiments, the exogenous environmental condition(s) and/or signal(s) that serves to activate the inducible promoter is not naturally present within the gut of a mammal. In some embodiments, the inducible promoter is stimulated by a molecule or metabolite that is administered in combination with the pharmaceutical composition of the disclosure, for example,

tetracycline, arabinose, or any biological molecule that serves to activate an inducible promoter. In some embodiments, the exogenous environmental condition(s) and/or signal(s) is added to culture media comprising a recombinant bacterial cell of the disclosure. In some embodiments, the exogenous environmental condition that serves to activate the inducible promoter is naturally present within the gut of a mammal (for example, low oxygen or anaerobic conditions, or biological molecules involved in an inflammatory response). In some embodiments, the loss of exposure to an exogenous environmental condition (for example, in vivo) inhibits the activity of an inducible promoter, as the exogenous

environmental condition is not present to induce the promoter (for example, an aerobic environment outside the gut).

[0185] As used herein, the term "recombination event" refers to the recombination between two recombinase recognition sequences that results in the excision, integration, inversion, or exchange of a DNA fragment by a heterologous recombinase in a recombinant bacterial cell of the disclosure. In one embodiment, the term "recombination event" refers to the inversion of an inverted heterologous toxin gene into an activated conformation by a heterologous recombinase in a recombinant bacterial cell of the disclosure. In another embodiment, the term "recombination event" refers to the inversion of an inverted

heterologous excision enzyme gene by a heterologous recombinase in a recombinant bacterial cell of the disclosure. In one embodiment, at least one recombination event occurs in the recombinant bacterial cell. In another embodiment, at least two recombination events occur, i.e., a first recombinase inverts a second recombinase gene, which is expressed and then inverts a third gene, e.g., a toxin gene, an excision enzyme gene, or other gene. In another embodiment, at least three recombination events occur, i.e., a first recombinase inverts a second recombinase gene, which is expressed and then inverts a third recombinase gene, which is expressed and then inverts a fourth gene, e.g., a toxin gene, an excision enzyme gene, or other gene. In another embodiment, at least four recombination events occur, i.e., a first recombinase inverts a second recombinase gene, which is expressed and then inverts a third recombinase gene, which is expressed and then inverts a fourth recombinase gene, which is expressed and the inverts a fifth gene, e.g., a toxin gene, an excision enzyme gene, or other gene. In another embodiment, at least five, six, seven, eight, nine, or ten recombination events occur in the manner described.

[0186] Based on the teachings herein, one of ordinary skill in the art would understand that the number of recombination events could be increased to delay the death of the recombinant bacterial cell due to the amount of time it takes for each recombinase to invert the next gene and for the next gene to be expressed. One of ordinary skill in the art would also understand that the number of recombination events could be decreased to speed up the death of the recombinant bacterial cell. The recombination event is directly or indirectly induced by an exogenous environmental condition, i.e., expression of the first recombinase gene is directly or indirectly induced by the exogenous environmental condition.

[0187] "Gut" refers to the organs, glands, tracts, and systems that are responsible for the transfer and digestion of food, absorption of nutrients, and excretion of waste. In humans, the gut comprises the gastrointestinal (GI) tract, which starts at the mouth and ends at the anus, and additionally comprises the esophagus, stomach, small intestine, and large intestine. The gut also comprises accessory organs and glands, such as the spleen, liver, gallbladder, and pancreas. The upper gastrointestinal tract comprises the esophagus, stomach, and duodenum of the small intestine. The lower gastrointestinal tract comprises the remainder of the small intestine, i.e., the jejunum and ileum, and all of the large intestine, i.e., the cecum, colon, rectum, and anal canal. Bacteria can be found throughout the gut, e.g., in the gastrointestinal tract, and particularly in the intestines.

[0188] "Non-pathogenic bacteria" refer to bacteria that are not capable of causing disease or harmful responses in a host. Examples of non-pathogenic bacteria include, but are not limited to Bacillus, Bacteroides, Bifidobacterium, Brevibacteria, Clostridium,

Enterococcus, Escherichia, Lactobacillus, Lactococcus, and Staphylococcus, e.g., Bacillus coagulans, Bacillus subtilis, Bacteroides fragilis, Bacteroides subtilis, Bacteroides

thetaiotaomicron, Bifidobacterium bifidum, Bifidobacterium infantis, Bifidobacterium lactis, Bifidobacterium longum, Clostridium butyricum, Enterococcus faecium, Escherichia coli, Lactobacillus acidophilus, Lactobacillus bulgaricus, Lactobacillus casei, Lactobacillus johnsonii, Lactobacillus paracasei, Lactobacillus plantarum, Lactobacillus reuteri,

Lactobacillus rhamnosus, and Lactococcus lactis (Sonnenborn et al., 2009; Dinleyici et al., 2014; U.S. Patent No. 6,835,376; U.S. Patent No. 6,203,797; U.S. Patent No. 5,589,168; U.S. Patent No. 7,731,976). Non-pathogenic bacteria also include commensal bacteria, which are present in the indigenous microbiota of the gut. In one embodiment, the disclosure further includes non-pathogenic Saccharomyces, such as Saccharomyces boulardii.

[0189] "Probiotic" is used to refer to live, non-pathogenic microorganisms, e.g., bacteria, which can confer health benefits to a host organism that contains an appropriate amount of the microorganism. In some embodiments, the host organism is a mammal. In some embodiments, the host organism is a human. Some species, strains, and/or subtypes of non-pathogenic bacteria are currently recognized as probiotic. Examples of probiotic bacteria include, but are not limited to, Bifidobacteria, and Escherichia, Lactobacillus, e.g.,

Bifidobacterium bifidum, Enterococcus faecium, Escherichia coli, Escherichia coli strain Nissle, Lactobacillus acidophilus, Lactobacillus bulgaricus, Lactobacillus paracasei, and Lactobacillus plantarum (Dinleyici et al., 2014; U.S. Patent No. 5,589,168; U.S. Patent No. 6,203,797; U.S. Patent 6,835,376). Non-pathogenic bacteria may be genetically engineered to provide probiotic properties. Probiotic bacteria may be genetically engineered to enhance or improve probiotic properties. In one embodiment, the disclosure further includes nonpathogenic Saccharomyces, such as Saccharomyces boulardii.

[0190] As used herein, the term "auxotroph" or "auxotrophic" refers to an organism that requires a specific factor, e.g., an amino acid, a sugar, or other nutrient, to support its growth. An "auxotrophic modification" is a genetic modification that causes the organism to die in the absence of an exogenously added nutrient essential for survival or growth because it is unable to produce said nutrient. As used herein, the term "essential gene" refers to a gene which is necessary to for cell growth and/or survival. Essential genes are described in more detail infra and include, but are not limited to, DNA synthesis genes (such as thyA), cell wall synthesis genes (such as dapA), and amino acid genes (such as serA and metA).

[0191] As used herein, the term "treat" and its cognates refer to an amelioration of a disease, or at least one discernible symptom thereof. In another embodiment, "treat" refers to an amelioration of at least one measurable physical parameter, not necessarily discernible by the patient. In another embodiment, "treat" refers to inhibiting the progression of a disease, either physically (e.g., stabilization of a discernible symptom), physiologically (e.g., stabilization of a physical parameter), or both. In another embodiment, "treat" refers to slowing the progression or reversing the progression of a disease. As used herein, "prevent" and its cognates refer to delaying the onset or reducing the risk of acquiring a given disease.

[0192] Those in need of treatment may include individuals already having a particular medical disease, as well as those at risk of having, or who may ultimately acquire the disease. The need for treatment is assessed, for example, by the presence of one or more risk factors associated with the development of a disease, the presence or progression of a disease, or likely receptiveness to treatment of a subject having the disease. Diseases may be caused by inborn genetic mutations for which there are no known cures. Diseases can also be secondary to other conditions, e.g., liver diseases. Treating diseases does not necessarily encompass the elimination of the underlying disease.

[0193] As used herein a "pharmaceutical composition" refers to a preparation of bacterial cells of the disclosure with other components such as a physiologically suitable carrier and/or excipient.

[0194] The phrases "physiologically acceptable carrier" and "pharmaceutically acceptable carrier" which may be used interchangeably refer to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered bacterial compound. An adjuvant is included under these phrases.

[0195] The term "excipient" refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient. Examples include, but are not limited to, calcium bicarbonate, sodium bicarbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils, polyethylene glycols, and surfactants, including, for example, polysorbate 20.

[0196] The terms "therapeutically effective dose" and "therapeutically effective amount" are used to refer to an amount of a compound that results in prevention, delay of onset of symptoms, or amelioration of symptoms of a disease. A therapeutically effective amount may, for example, be sufficient to treat, prevent, reduce the severity, delay the onset, and/or reduce the risk of occurrence of one or more symptoms of a disease or condition. A therapeutically effective amount, as well as a therapeutically effective frequency of administration, can be determined by methods known in the art and discussed below.

[0197] As used herein, the term "viable" refers to a microorganism capable of normal metabolic activity and/or normal growth, division, multiplication or replication. The term "non- viable" or "neutralized" refers to a microorganism no longer metabolically-active and/or incapable of normal growth, division, multiplication or replication. In some embodiments, a non-viable recombinant bacterial cell of the disclosure may refer to a cell having a ruptured, degraded, or modified cell membrane. In some embodiments, a nonviable recombinant bacterial cell of the disclosure may refer to a cell with reduced metabolic activity. In some embodiments, a non-viable recombinant bacterial cell of the disclosure may refer to a cell incapable of normal growth, division, multiplication or replication. In one embodiment, a non-viable recombinant bacterial cell of the disclosure is alive but can no longer grow, divide, multiply or replicate.

[0198] As used herein, the term "bacteriostatic" or "cytostatic" refers to a molecule or protein which is capable of arresting, retarding, or inhibiting the growth, division,

multiplication or replication of recombinant bacterial cell of the disclosure.

[0199] As used herein, the term "bactericidal" refers to a molecule or protein which is capable of killing the recombinant bacterial cell of the disclosure.

[0200] As used herein, the term "toxin" refers to a protein, enzyme, or polypeptide fragment thereof, or other molecule which is capable of arresting, retarding, or inhibiting the growth, division, multiplication or replication of the recombinant bacterial cell of the disclosure, or which is capable of killing the recombinant bacterial cell of the disclosure. The term "toxin" is intended to include bacteriostatic proteins and bactericidal proteins. The term "toxin" is intended to include, but not limited to, lytic proteins, bacteriocins (e.g., microcins and colicins), gyrase inhibitors, polymerase inhibitors, transcription inhibitors, translation inhibitors, DNases, and RNases. The term "anti-toxin" or "antitoxin," as used herein, refers to a protein or enzyme which is capable of inhibiting the activity of a toxin. The term antitoxin is intended to include, but not limited to, immunity modulators, and inhibitors of toxin expression. Examples of toxins and antitoxins are known in the art and described in more detail infra.

[0201] As used herein, the term "lytic protein" or "lytic peptide" refers to any protein, in whole or in part, that is capable of permeabilizing or disrupting a bacterial cell membrane.

[0202] As used herein, the term "excision enzyme" or "excisionase" refers to a protein or enzyme which is capable of removing a DNA fragment or a gene in a recombinant bacterial cell of the disclosure. Excision enzymes are well known in the art and include, but are not limited to, Xisl and Xis2 from phage lambda (see, for example Numrych et al., 1992, EMBO J., l l(10):3797-3806). Examples of excision enzymes are further described infra.

[0203] As used herein, the term "therapeutic" refers to any protein(s) or biologically active fragment(s) thereof, or a nucleic acid sequence(s) encoding one or more proteins or fragment thereof (e.g., an operon, a heterologous gene), or any payload, that can heal, cure or provide a remedial, palliative, or preventive effect on a pathologic process (e.g., altered metabolic state, defective catabolism of a compound(s), abnormal immune response) in a subject in need thereof. In one embodiment of the disclosure, the heterologous gene is a heterologous therapeutic gene.

[0204] As used herein, "diseases and conditions associated with gut inflammation and/or compromised gut barrier function" include, but are not limited to, inflammatory bowel diseases, diarrheal diseases, and related diseases. "Inflammatory bowel diseases" and "IBD" are used interchangeably to refer to a group of diseases associated with gut inflammation, which include, but are not limited to, Crohn's disease, ulcerative colitis, collagenous colitis, lymphocytic colitis, diversion colitis, Behcet's disease, and indeterminate colitis. "Diarrheal diseases" include, but are not limited to, acute watery diarrhea, e.g., cholera, acute bloody diarrhea, e.g., dysentery, and persistent diarrhea. Related diseases include, but are not limited to, short bowel syndrome, ulcerative proctitis, proctosigmoiditis, left-sided colitis, pancolitis, and fulminant colitis. Symptoms associated with the aforementioned diseases and conditions include, but are not limited to, one or more of diarrhea, bloody stool, mouth sores, perianal disease, abdominal pain, abdominal cramping, fever, fatigue, weight loss, iron deficiency, anemia, appetite loss, weight loss, anorexia, delayed growth, delayed pubertal development, inflammation of the skin, inflammation of the eyes, inflammation of the joints, inflammation of the liver, and inflammation of the bile ducts.

[0205] "Microorganism" refers to an organism or microbe of microscopic, submicroscopic, or ultramicroscopic size that typically consists of a single cell. Examples of microrganisms include bacteria, viruses, parasites, fungi, certain algae, and protozoa. In certain embodiments, the engineered microorganism is an engineered bacteria.

[0206] As used herein, the terms "secretion system" or "secretion protein" refers to a native or non-native secretion mechanism capable of secreting or exporting the anti-cancer molecule from the microbial, e.g., bacterial cytoplasm. The secretion system may comprise a single protein or may comprise two or more proteins assembled in a complex

e.g.,HlyBD. Non-limiting examples of secretion systems for gram negative bacteria include the modified type III flagellar, type I (e.g., hemolysin secretion system), type II, type IV, type V, type VI, and type VII secretion systems, resistance-nodulation-division (RND) multi-drug efflux pumps, various single membrane secretion systems. Non-liming examples of secretion systems for gram positive bacteria include Sec and TAT secretion systems. In some embodiments, the anti-cancer molecule(s) include a "secretion tag" of either RNA or peptide origin to direct the anti-cancer molecule(s) to specific secretion systems. In some

embodiments, the secretion system is able to remove this tag before secreting the anti-cancer molecule from the engineered bacteria. For example, in Type V auto-secretion-mediated secretion the N-terminal peptide secretion tag is removed upon translocation of

the "passenger" peptide from the cytoplasm into the periplasmic compartment by the native Sec system. Further, once the auto-secretor is translocated across the outer membrane the C- terminal secretion tag can be removed by either an autocatalytic or protease-catalyzed e.g., OmpT cleavage thereby releasing the anti-cancer molecule(s) into the extracellular milieu.

[0207] As used herein, the term "transporter" is meant to refer to a mechanism, e.g., protein or proteins, for importing a molecule into the microorganism from the

extracellular milieu.

[0208] The articles "a" and "an," as used herein, should be understood to mean "at least one," unless clearly indicated to the contrary.

[0209] The phrase "and/or," when used between elements in a list, is intended to mean either (1) that only a single listed element is present, or (2) that more than one element of the list is present. For example, "A, B, and/or C" indicates that the selection may be A alone; B alone; C alone; A and B; A and C; B and C; or A, B, and C. The phrase "and/or" may be used interchangeably with "at least one of or "one or more of the elements in a list.

[0210] Ranges provided herein are understood to be shorthand for all of the values within the range. For example, a range of 1 to 50 is understood to include any number, combination of numbers, or sub-range from the group consisting 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50.

Bacterial Strains

[0211] The disclosure provides a bacterial cell that comprises a heterologous gene encoding a therapeutic. In some embodiments, the bacterial cell is a non-pathogenic bacterial cell. In some embodiments, the bacterial cell is a commensal bacterial cell. In some embodiments, the bacterial cell is a probiotic bacterial cell.

[0212] In certain embodiments, the bacterial cell is selected from the group consisting of a Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides subtilis, Bifidobacterium bifidum, Bifidobacterium infantis, Bifidobacterium lactis, Clostridium butyricum,

Escherichia coli, Lactobacillus acidophilus, Lactobacillus plantarum, Lactobacillus reuteri, and Lactococcus lactis bacterial cell. In one embodiment, the bacterial cell is a Bacteroides fragilis bacterial cell. In one embodiment, the bacterial cell is a Bacteroides thetaiotaomicron bacterial cell. In one embodiment, the bacterial cell is a Bacteroides subtilis bacterial cell. In one embodiment, the bacterial cell is a Bifidobacterium bifidum bacterial cell. In one embodiment, the bacterial cell is a Bifidobacterium infantis bacterial cell. In one

embodiment, the bacterial cell is a Bifidobacterium lactis bacterial cell. In one embodiment, the bacterial cell is a Clostridium butyricum bacterial cell. In one embodiment, the bacterial cell is an Escherichia coli bacterial cell. In one embodiment, the bacterial cell is a

Lactobacillus acidophilus bacterial cell. In one embodiment, the bacterial cell is a

Lactobacillus plantarum bacterial cell. In one embodiment, the bacterial cell is a

Lactobacillus reuteri bacterial cell. In one embodiment, the bacterial cell is a Lactococcus lactis bacterial cell.

[0213] In some embodiments, the bacterial cell is Escherichia coli strain Nissle 1917 (E. coli Nissle), a Gram-positive bacterium of the Enterobacteriaceae family that has evolved into one of the best characterized probiotics (Ukena et al., 2007). The strain is characterized by its complete harmlessness (Schultz, 2008), and has GRAS (generally recognized as safe) status (Reister et al., 2014). Genomic sequencing confirmed that E. coli Nissle lacks prominent virulence factors (e.g., E. coli a-hemolysin, P-fimbrial adhesins) (Schultz, 2008), and E. coli Nissle does not carry pathogenic adhesion factors and does not produce any enterotoxins or cytotoxins, it is not invasive, not uropathogenic (Sonnenborn et al., 2009). As early as in 1917, E. coli Nissle was packaged into medicinal capsules, called Mutaflor, for therapeutic use. E. coli Nissle has since been used to treat ulcerative colitis in humans in vivo (Rembacken et al., 1999), to treat inflammatory bowel disease, Crohn's disease, and pouchitis in humans in vivo (Schultz, 2008), and to inhibit enteroinvasive Salmonella, Legionella, Yersinia, and Shigella in vitro (Altenhoefer et al., 2004). It is commonly accepted that E. coli Nissle' s therapeutic efficacy and safety have convincingly been proven (Ukena et al., 2007).

[0214] One of ordinary skill in the art would appreciate that the genetic modifications disclosed herein may be adapted for other species, strains, and subtypes of bacteria.

Furthermore, genes from one or more different species can be introduced into one another, e.g., a gene from Lactococcus lactis can be expressed in Escherichia coli.

[0215] In some embodiments, the bacterial cell is a recombinant bacterial cell. In another embodiment, the bacterial cell is a programmed or engineered recombinant bacterial cell. In some embodiments, the disclosure comprises a colony of bacterial cells of the disclosure. In another aspect, the disclosure provides a recombinant bacterial culture which comprises bacterial cells of the disclosure.

Genes of Interest

[0216] The recombinant bacterial cells of the disclosure produce at least one heterologous gene under the control of a directly or indirectly inducible promoter only at the site of disease, thereby lowering the safety issues associated with systemic exposure, and are more stable than prior art recombinant bacteria. Moreover, the recombinant bacterial cells of the disclosure are also programmed to die at a certain time after the expression of the heterologous gene, e.g., a therapeutic gene, thereby avoiding concerns associated with the long-term colonization of subjects by the recombinant bacteria, spread of the recombinant bacteria beyond the disease site, and spread of the recombinant bacteria into the environment, e.g., through stools of the subject.

[0217] Many heterologous genes are useful in the instant disclosure. In one aspect, the heterologous gene is a heterologous therapeutic gene. In some embodiments, the heterologous gene encodes a therapeutic protein or polypeptide. The heterologous gene may encode any therapeutic protein or polypeptide. In some embodiments, the therapeutic protein or polypeptide is an enzyme or enzymes which synthesizes a therapeutic molecule. In some embodiments, the therapeutic protein or polypeptide is an enzyme or enzymes that removes a toxic substrate, for example, ammonia or phenylalanine. In one embodiment, the

heterologous gene does not encode a gene encoding a vaccine protein.

[0218] In one embodiment, the heterologous gene encodes a therapeutic protein. For example, the therapeutic protein may be IL-10, GLP1, GLP2, IL-27, TGFp, a Ghrelin receptor antagonist, Peptide YY3-36, a protein of the Cholecystokinin (CCK) family, e.g., CCK58, CCK33, CCK22, or CCK8, a protein of the Bombesin family, e.g., bombesin, gastrin releasing peptide (GRP), or neuromedin B, a Glucagon protein, e.g., GLP-1 or GLP-2, Apo lipoprotein A-IV, Amylin, Somatostatin, Enterostatin, Oxyntomodulin, or Pancreatic peptide. In one embodiment, the therapeutic protein is IL-10. In another embodiment, the therapeutic protein is GLP2. In another embodiment, the therapeutic protein is IL-27. In another embodiment, the therapeutic protein is TGFp. In another embodiment, the therapeutic protein is a Ghrelin receptor antagonist. In another embodiment, the therapeutic protein is Peptide YY3-36. In another embodiment, the therapeutic protein is a

Cholecystokinin (CCK) family protein, such as CCK58, CCK33, CCK22, or CCK8. In another embodiment, the therapeutic protein is a Bombesin family protein, such as bombesin, gastrine releasing peptide (GRP), or neuromedin B. In another embodiment, the therapeutic protein is a glucagon protein, such as GLP-1 or GLP-2. In yet another embodiment, the therapeutic protein is apo lipoprotein A-IV. In another embodiment, the therapeutic protein is amylin. In another embodiment, the therapeutic protein is somatostatin. In another embodiment, the therapeutic protein is enterostatin. In another embodiment, the therapeutic protein is oxyntomodulin. In another embodiment, the therapeutic protein is pancreatic peptide. In another embodiment, the therapeutic protein is bile salt hydrolase. In another embodiment, the therapeutic protein is seleceted from a CTLA-4 inhibitor, a PD- 1 inhibitor, and a PD-L1 inhibitor. In another embodiment, the therapeutic protein is selected from an immune checkpoint inhibitor of TIGIT, VISTA, LAG- 3, TIM1, CEACAM1, LAIR-1, HVEM, BTLA, CD 160, CD200, CD200R, GITR, or A2aR. In another embodiment, the therapeutic protein is IL-15. In another embodiment, the therapeutic protein is IL-12. In another embodiment, the therapeutic protein is GM-CSF. In another embodiment, the therapeutic protein is IL-21. In another embodiment, the therapeutic protein is an agonist ligand for OX40. In another embodiment, the therapeutic protein is an agonist ligand for ICOS.

[0219] In another embodiment, the heterologous therapeutic gene encodes an enzyme or enzymes which synthesize a therapeutic molecule, or a gene or cassette encoding a biosynthetic pathway. For example, the therapeutic molecule may be butyrate, propionate, acetate, NAD (nicotinamide adrenine dinucleotide), NMN (nicotinamide mononucleotide, NR (nucleotide riboside), nicotinamide, nicotinic acid (NA), n-acyl-phophatidylethanolamine (NAPE), or n-acyl-ethanolamine (NAE). In one embodiment, the therapeutic molecule may be butyrate. In another embodiment, the therapeutic molecule may be propionate. In another embodiment, the therapeutic molecule may be acetate. In another embodiment, the therapeutic molecule may be NAD (nicotinamide adrenine dinucleotide). In another embodiment, the therapeutic molecule may be NMN (nicotinamide mononucleotide). In another embodiment, the therapeutic molecule may be NR (nucleotide riboside). In another embodiment, the therapeutic molecule may be nicotinamide. In another embodiment, the therapeutic molecule may be nicotinic acid (NA). In another embodiment, the therapeutic molecule may be n-acyl-phophatidylethanolamine (NAPE). In another embodiment, the therapeutic molecule may be n-acyl-ethanolamine (NAE). [0220] As used herein, a "gene cassette" or "operon" encoding a biosynthetic pathway refers to the two or more genes that are required to produce the therapeutic, e.g., butyrate. In addition to encoding a set of genes capable of producing said molecule, the gene cassette or operon may also comprise additional transcription and translation elements, e.g., a ribosome binding site.

[0221] A "butyrogenic gene cassette," "butyrate biosynthesis gene cassette," and "butyrate operon" are used interchangeably to refer to a set of genes capable of producing butyrate in a biosynthetic pathway. Unmodified bacteria that are capable of producing butyrate via an endogenous butyrate biosynthesis pathway include, but are not limited to, Clostridium, Peptoclostridium, Fusobacterium, Butyrivibrio, Eubacterium, and Treponema. The genetically engineered bacteria of the disclosure may comprise butyrate biosynthesis genes from a different species, strain, or substrain of bacteria, or a combination of butyrate biosynthesis genes from different species, strains, and/or substrains of bacteria. A

butyrogenic gene cassette may comprise, for example, the eight genes of the butyrate production pathway from Peptoclostridium difficile (also called Clostridium difficile): bcd2, etfB3, etfA3, thiAl, hbd, crt2, pbt, and buk, which encode butyryl-CoA dehydrogenase subunit, electron transfer flavoprotein subunit beta, electron transfer flavoprotein subunit alpha, acetyl-CoA C-acetyltransferase, 3-hydroxybutyryl-CoA dehydrogenase, crotonase, phosphate butyry transferase, and butyrate kinase, respectively (Aboulnaga et al., 2013). One or more of the butyrate biosynthesis genes may be functionally replaced or modified.

Peptoclostridium difficile strain 630 and strain 1296 are both capable of producing butyrate, but comprise different nucleic acid sequences for etfA3, thiAl, hbd, crt2, pbt, and buk. A butyrogenic gene cassette may comprise bcd2, etfB3, etfA3, and thiAl from Peptoclostridium difficile strain 630, and hbd, crt2, pbt, and buk from Peptoclostridium difficile strain 1296. Alternatively, a single gene from Treponema denticola (ter, encoding trans-2-enoynl-CoA reductase) is capable of functionally replacing all three of the bcd2, etfB3, and etfA3 genes from Peptoclostridium difficile. Thus, a butyrogenic gene cassette may comprise thiAl, hbd, crt2, pbt, and buk from Peptoclostridium difficile and ter from Treponema denticola. The butyrogenic gene cassette may comprise genes for the aerobic biosynthesis of butyrate and/or genes for the anaerobic or microaerobic biosynthesis of butyrate.

[0222] Likewise, a "propionate gene cassette" or "propionate operon" refers to a set of genes capable of producing propionate in a biosynthetic pathway. Unmodified bacteria that are capable of producing propionate via an endogenous propionate biosynthesis pathway are known in the art. The genetically engineered bacteria of the disclosure may comprise propionate biosynthesis genes from a different species, strain, or substrain of bacteria, or a combination of propionate biosynthesis genes from different species, strains, and/or substrains of bacteria. In some embodiments, the propionate gene cassette comprises the genes pet, led, and acr, which encode the enzymes propionate CoA-transferase, lactoyl-CoA dehydratase, and acryloyl-CoA reductase in bacteria such as Clostridium propionicum and Escherichia coli. One or more of the propionate biosynthesis genes may be functionally replaced or modified.

[0223] An "acetate gene cassette" or "acetate operon" refers to a set of genes capable of producing acetate in a biosynthetic pathway. Bacteria "synthesize acetate from a number of carbon and energy sources," including a variety of substrates such as cellulose, lignin, and inorganic gases, and utilize different biosynthetic mechanisms and genes, which are known in the art (Ragsdale et al., 2008). The genetically engineered bacteria of the disclosure may comprise acetate biosynthesis genes from a different species, strain, or substrain of bacteria, or a combination of acetate biosynthesis genes from different species, strains, and/or substrains of bacteria. Escherichia coli are capable of consuming glucose and oxygen to produce acetate and carbon dioxide during aerobic growth (Kleman et al., 1994). Several bacteria, such as Acetitomaculum, Acetoanaerobium, Acetohalobium, Acetonema, Balutia, Butyribacterium, Clostridium, Moorella, Oxobacter, Sporomusa, and Thermoacetogenium, are acetogenic anaerobes that are capable of converting CO or C02 + H2 into acetate, e.g., using the Wood-Ljungdahl pathway (Schiel-Bengelsdorf et al, 2012). Genes in the Wood- Ljungdahl pathway for various bacterial species are known in the art. The acetate gene cassette may comprise genes for the aerobic biosynthesis of acetate and/or genes for the anaerobic or microaerobic biosynthesis of acetate. One or more of the acetate biosynthesis genes may be functionally replaced or modified.

[0224] In yet another embodiment, the heterologous therapeutic gene encodes an enzyme which processes and reduces levels of an exogenous molecule. For example, the enzyme may be a branched chain amino acid catabolism enzyme, and the exogenous molecule may be a branched chain amino acid. In one embodiment, the branched chain amino acid catabolism enzyme is an alpha-ketoisovalerate decarboxylate. In one

embodiment, the gene encoding the a-ketoisovalerate decarboxylase is a kivD gene. In another embodiment, the kivD gene is a Lactococcus lactis kivD gene. In one embodiment, the at least one heterologous gene encoding the branched chain amino acid catabolism enzyme is at least one gene encoding a branched chain keto acid dehydrogenase. In one embodiment, the at least one gene encoding a branched chain keto acid dehydrogenase is a bkdAl-bkdA2-bkdB-lpdV operon. In one embodiment, the bkdAl-bkdA2-bkdB-lpdV operon is a Pseudomonas aeruginosa operon. In one embodiment, the recombinant bacterial cell further comprises a heterologous gene encoding a branched chain amino acid

dehydrogenase. In one embodiment, the branched chain amino acid dehydrogenase is ldh. In another embodiment, the branched chain amino acid catabolism enzyme is a branched chain keto acid dehydrogenase. In another embodiment, the enzyme may be a phenylalanine ammonia lyase (PAL), and the exogenous molecule is phenylalanine.

[0225] In one embodiment, the recombinant bacterial cell comprising a heterologous gene encoding a branched chain amino acid catabolism enzyme further comprises a genetic modification that reduces export of a branched chain amino acid from the bacterial cell. In one embodiment, the genetic modification that reduces export of the branched chain amino acid from the bacterial cell comprises a genetic mutation in an endogenous gene encoding an exporter of a branched chain amino acid. In one embodiment, the endogenous gene encoding the exporter of the branched chain amino acid is a leuE gene. In one embodiment, the genetic mutation reduces expression of the leuE gene. In another embodiment, the genetic mutation is a deletion of the leuE gene. In another embodiment, the genetic mutation reduces activity of LeuE protein. In another embodiment, the genetic mutation inhibits activity of LeuE protein. In one embodiment, the genetic modification that reduces export of the branched chain amino acid from the bacterial cell comprises a genetic mutation in a promoter of an endogenous gene encoding an exporter of a branched chain amino acid. In one embodiment, the promoter is a promoter of the leuE gene, and wherein the genetic mutation in the promoter of the leuE gene reduces expression of the leuE gene.

[0226] In another embodiment, the recombinant bacterial cell comprising a heterologous gene encoding a branched chain amino acid catabolism enzyme further comprises at least one heterologous gene encoding an importer of the branched chain amino acid. In one embodiment, the at least one heterologous gene encoding the importer of the branched chain amino acid is located on a plasmid in the bacterial cell. In another embodiment, the at least one heterologous gene encoding the importer of the branched chain amino acid is located on a chromosome in the bacterial cell. In one embodiment, the at least one heterologous gene encoding an importer of a branched chain amino acid imports leucine into the bacterial cell. In one embodiment, the at least one heterologous gene encoding the importer of the branched chain amino acid comprises a livKHMGF operon. In another embodiment, the livKHMGF operon is an Escherichia coli livKHMGF operon.

[0227] In one embodiment, the heterologous gene may encode an anti-inflammation molecule or a gut barrier function enhancer molecule. As used herein, "anti- inflammation molecules" and/or "gut barrier function enhancer molecules" include, but are not limited to, short-chain fatty acids, butyrate, propionate, acetate, GLP-2, IL-10, IL-27, TGF-βΙ, TGF-P2, N-acylphosphatidylethanolamines (NAPEs), elafin (also called peptidase inhibitor 3 and SKALP), and trefoil factor. Such molecules may also include compounds that inhibit proinflammatory molecules, e.g., a single-chain variable fragment (scFv), antisense RNA, siRNA, or shRNA that neutralizes TNF-a, IFN-γ, IL-Ιβ, IL-6, IL-8, IL-17, and/or

chemokines, e.g., CXCL-8 and CCL2. A molecule may be primarily anti- inflammatory, e.g., IL-10, or primarily gut barrier function enhancing, e.g., GLP-2. A molecule may be both anti- inflammatory and gut barrier function enhancing. An anti-inflammation and/or gut barrier function enhancer molecule may be encoded by a single gene, e.g., elafin is encoded by the PI3 gene. Alternatively, an anti- inflammation and/or gut barrier function enhancer molecule may be synthesized by a biosynthetic pathway requiring multiple genes, e.g., butyrate. These molecules may also be referred to as therapeutic molecules.

[0228] Other exemplary payloads or gene of interest are described in detail in the following applications, each of which are hereby incorporated by reference in their entireties: U.S. Provisional Patent Application No. 15/164,828, filed on May 05, 2016; U.S. Provisional Patent Application No. 15/154,934, filed on May 13, 2016; U.S. Provisional Patent

Application No. 62/336,338, filed on May 13, 2016; U.S. Provisional Patent Application No. 62/341,320, filed on May 25, 2016; U.S. Provisional Patent Application No. 62/341,315, filed on May 25, 2016; U.S. Provisional Patent Application No. 62/323,503, filed on April 14, 2016; U.S. Provisional Patent Application No. 62/291,468, filed on February 02, 2016; U.S. Provisional Patent Application No. 62/348,620, filed on June 10, 2016; U.S. Provisional Patent Application No. 62/255,757, filed on November 11, 2015; U.S. Provisional Patent Application No. 62/336,012, filed on May 13, 2016; U.S. Provisional Patent Application No. 62/345,242, filed on June 03, 2016; U.S. Provisional Patent Application No. 62/348,360, filed on June 10, 2016; U.S. Provisional Patent Application No. 62/277,438, filed on January 01, 2016; U.S. Provisional Patent Application No. 62/348,699, filed on June 10, 2016; U.S. Provisional Patent Application No. 62/348,416, filed on June 10, 2016; U.S. Provisional Patent Application No. 62/347,508, filed on June 08, 2016; U.S. Provisional Patent Application No. 62/277,654, filed on January 12, 2016; U.S. Provisional Patent Application No. 62/184,811, filed on November 16, 2015; and the PCT Patent Application No.

PCT/US2016/032565, filed on May 13, 2016, the entire contents of each of which are expressly incorporated herein by reference.

[0229]

Kill-Switch Components

Inducible Promoters

[0230] The engineered microorganisms, e.g., bacterial cells or viruses, of the disclosure comprises gene sequence(s) encoding one or more payload(s), e.g., one or more therapeutic molecules, under the control of a directly or indirectly inducible promoter. In some embodiments, the bacterial cell comprises a stably maintained plasmid or chromosome carrying the gene(s) encoding the payload(s), such that the payload(s) can be expressed in the host cell, and the host cell is capable of survival and/or growth in vitro, e.g., in medium, and/or in vivo, e.g., in the gut. In some embodiments, bacterial cell comprises two or more distinct payloads or operons, e.g., two or more payload genes or two or more operons. In some embodiments, bacterial cell comprises three or more distinct payloads or operons, e.g., three or more payload genes or three or more operons. In some embodiments, bacterial cell comprises 4, 5, 6, 7, 8, 9, 10, or more distinct payloads or operons, e.g., 4, 5, 6, 7, 8, 9, 10, or more payload genes or operons.

[0231] In some embodiments, the genetically engineered bacteria comprise multiple copies of the same payload gene(s). In some embodiments, the gene(s) encoding the payload(s) is present on a plasmid and operably linked to a directly or indirectly inducible promoter. In some embodiments, the gene(s) encoding the payload(s) is present on a plasmid and operably linked to a promoter that is induced under low-oxygen or anaerobic conditions. In some embodiments, the gene(s) encoding the payload(s) is present on a chromosome and operably linked to a directly or indirectly inducible promoter. In some embodiments, the gene(s) encoding the payload(s) is present in the chromosome and operably linked to a promoter that is induced under low-oxygen or anaerobic conditions. In some embodiments, the gene(s) encoding the payload(s) is present on a plasmid and operably linked to a promoter that is induced by exposure to tetracycline, arabinose, or some other compound that may or may not be present in the gut.

[0232] In some embodiments, the promoter that is operably linked to the gene(s) encoding the payload(s) is directly induced by exogenous environmental conditions. In some embodiments, the promoter that is operably linked to the gene(s) encoding the payload(s) is indirectly induced by exogenous environmental conditions. In some embodiments, the promoter is directly or indirectly induced by exogenous environmental conditions specific to the gut of a mammal. In some embodiments, the promoter is directly or indirectly induced by exogenous environmental conditions specific to the small intestine of a mammal. In some embodiments, the promoter is directly or indirectly induced by low-oxygen or anaerobic conditions such as the environment of the mammalian gut. In some embodiments, the promoter is directly or indirectly induced by molecules or metabolites that are specific to the gut of a mammal. In some embodiments, the promoter is directly or indirectly induced by a molecule that is co- administered with the bacterial cell. In some embodiments, the promoter is directly or indirectly induced by a molecule that is tissue- specific.

[0233] In some embodiments, one or more other components of the kill-switch are also under the control of a directly or indirectly inducible promoter, including, for example, one or more components selected from a gene encoding a recombinase, gene encoding a bacterial toxin, gene encoding a bacterial anti-toxin, gene encoding an activator protein, gene encoding repressor protein, gene encoding an essential gene product and/or gene encoding an excision polypeptide. In some embodiments, the inducible promoter is the same inducible promoter as the inducible promoter driving expression of the payload or therapeutic gene or genes. In some embodiments, the inducible promoter is a different inducible promoter from the inducible promoter driving expression of the payload or therapeutic gene or genes. In some embodiments, the one or more other components of the kill- switch, for example, one or more components selected from a s gene encoding a recombinase, gene encoding a bacterial toxin, gene encoding a bacterial anti-toxin, gene encoding an excision polypeptide, gene encoding an activator protein, gene encoding a repressor protein and/or gene encoding an essential gene product are all under control of the same inducible promoter. In some embodiments, the one or more other components of the kill-switch, for example, one or more components selected from a gene encoding a recombinase, gene encoding a bacterial toxin, gene encoding a bacterial anti-toxin, gene encoding an excision polypeptide, gene encoding an activator protein, gene encoding a repressor protein and/or gene encoding an essential gene product are each under control of a different inducible promoter. In any of these embodiments, the inducible promoter is activated via the presence or absence of an exogenous environmental condition or signal, which activation results in expression of the operably linked heterologous gene. In alternate embodiments, one or more other components of the kill-switch are under the control of a constitutive promoter, including, for example, one or more components selected from a gene encoding a recombinase, gene encoding a bacterial toxin, gene encoding a bacterial anti-toxin, gene encoding an excision polypeptide, gene encoding an activator protein, gene encoding a repressor protein and/or gene encoding an essential gene product. The engineered microrganisms of the disclosure produce their therapeutic effect at the site of disease, thereby minimizing any safety issues associated with systemic exposure. In addition, the amount and the duration of the expression/release of the therapeutic can be regiulated in the engineered microorganisms by controlling the expression of the therapeutic and/or controlling the population of the engineered microorganism. The ability to regulate the expression of the payload or therapeutic results in amore stable bacteria than prior art recombinant bacteria. Moreover, the engineered bacteriaare also programmed to die at a certain time after the expression of the payload or therapeutic gene, thereby avoiding concerns associated with the long-term colonization of subjects by the engineered bacteria, spread of the engineered bacteria beyond the disease site, and spread of the engineered bacteria into the environment, e.g., through stools of the subject.

[0234] In some embodiments, the engineered bacterial cell of the disclosure comprises a stably maintained plasmid or chromosome carrying at least one heterologous gene and one or more other components of the kill-switch, e.g., at least one payload or therapeutic gene, and one or more components selected from a gene encoding a recombinase, gene encoding a bacterial toxin, gene encoding a bacterial anti-toxin, gene encoding an excision polypeptide, gene encoding an activator protein, gene encoding a repressor protein, and/or gene encoding an essential gene product, such that the heterologous protein(s) is/are expressed upon sensing the presence or absence of an exogenous environmental condition or signal. In other embodiments, the engineered bacterial cell of the disclosure comprises a stably maintained plasmid or chromosome carrying at least one heterologous gene and one or more other components of the kill-switch, e.g., at least one payload or therapeutic gene, and one or more components selected from a gene encoding a recombinase, gene encoding a bacterial toxin, gene encoding a bacterial anti-toxin, gene encoding an excision polypeptide, gene encoding an activator protein, gene encoding a repressor protein, and/or gene an essential gene product such that the heterologous protein(s) is/are not expressed upon sensing the presence or absence of an exogenous environmental signal. In some embodiments, any of the heterologous genes is present on a plasmid in the bacterial cell. In some embodiments, any of the heterologous genes is present in the chromosome of the bacterial cell. In some embodiments, any one or more of the heterologous genes is present on a plasmid in the bacterial cell and any one or more of the heterologous genes is present in the chromosome of the bacterial cell. In other embodiments, any of the genes encoding a kill-switch component is present on a plasmid in the bacterial cell and/or present in the chromosome of the bacterial cell.

[0235] In some embodiments, at least one heterologous gene and one or more other components of the kill-switch, e.g., at least one payload or therapeutic gene, and one or more components selected from a gene encoding a recombinase, gene encoding a bacterial toxin, gene encoding a bacterial anti-toxin, gene encoding an excision polypeptide, gene encoding an activator protein, gene encoding a repressor protein and/or gene encoding an essential gene product is operably linked to a directly or indirectly inducible promoter. In one embodiment, at least one heterologous gene and one or more other components of the kill- switch, e.g., at least one payload or therapeutic gene, and one or more components selected from a gene encoding a recombinase, gene encoding a bacterial toxin, gene encoding a bacterial anti-toxin, gene encoding an excision polypeptide, gene encoding an activator protein, gene encoding a repressor protein and/or gene encoding an essential gene product is operably linked to a directly inducible promoter. In another embodiment, at least one heterologous gene and one or more other components of the kill-switch, e.g., at least one payload or therapeutic gene, and one or more components selected from a gene encoding a recombinase, gene encoding a bacterial toxin, gene encoding a bacterial anti-toxin, gene encoding an excision polypeptide, gene encoding an activator protein, gene encoding a repressor protein and/or gene encoding an essential gene product is operably linked to an indirectly inducible promoter. In some embodiments, the promoter is induced under low- oxygen or anaerobic conditions.

[0236] In some embodiments, the promoter is directly or indirectly induced by exogenous environmental conditions and/or signal(S) specific to the gut of a mammal. In some embodiments, the promoter is directly or indirectly induced by exogenous

environmental conditions and/or signal(s) specific to the small intestine of a mammal. In some embodiments, the promoter is directly or indirectly induced by low-oxygen or anaerobic conditions such as the environment of the mammalian gut. In some embodiments, the promoter is directly or indirectly induced by molecules or metabolites that are specific to the gut of a mammal, e.g., propionate. In some embodiments, the promoter is directly or indirectly induced by molecules or metabolites that are not specific to the gut of a mammal. In some embodiments, the promoter is directly or indirectly induced by a molecule that is coadministered with the bacterial cell of the disclosure.

[0237] In some embodiments, the exogenous environmental condition or signal(s) stimulates the activity of an inducible promoter of the disclosure, i.e., activates transcription of the gene(s) that is operably linked to the inducible promoter. In some embodiments, the inducible promoter of the disclosure is stimulated by a molecule or metabolite that is coadministered in combination with the pharmaceutical composition of the disclosure, for example, tetracycline or arabinose.

[0238] In some embodiments, the exogenous environmental condition or signal(s) represses the activity of an inducible promoter of the disclosure, i.e., represses transcription of the gene(s) that is operably linked to the inducible promoter. In some embodiments, the inducible promoter of the disclosure is repressed by a molecule or metabolite that is coadministered in combination with the pharmaceutical composition of the disclosure, for example, tetracycline or arabinose.

[0239] In some embodiments, the exogenous environmental condition and/or signal(s) is not present within the gut of a mammal. In some embodiments, the exogenous environmental condition and/or signals(s) is added to culture media comprising an engineered microorganism of the disclosure. In some embodiments, the loss of exposure to an exogenous environmental condition and/or signals(s) (for example, in vivo) inhibits the activity of an inducible promoter of the disclosure, as the exogenous environmental condition is not present to induce the promoter. In some embodiments, the loss of exposure to an exogenous environmental condition and/or signals(s) (for example, in vivo) stimulates the activity of an inducible promoter of the disclosure, as the exogenous environmental condition is not present to repress the promoter.

[0240] In some embodiments, the engineered bacterial cells express at least about 1.5- fold, at least about 2-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 30-fold, at least about 50-fold, at least about 100-fold, at least about 200-fold, at least about 300-fold, at least about 400-fold, at least about 500-fold, at least about 600-fold, at least about 700-fold, at least about 800- fold, at least about 900- fold, at least about 1,000- fold, or at least about 1,500-fold more of at least one heterologous gene, e.g., at least one payload or therapeutic gene, and one or more components selected from a gene encoding a recombinase, gene encoding a bacterial toxin, gene encoding a bacterial anti-toxin, gene encoding an excision polypeptide, gene encoding an activator protein, gene encoding a repressor protein and/or gene encoding an essential gene product in the presence of the exogenous environmental condition and/or signal(s) than unmodified bacteria of the same subtype under the same conditions. In some embodiments, the engineered bacterial cells express one or more gene(s) encoding a recombinase, bacterial toxin, bacterial anti-toxin, excision polypeptide, activator protein, repressor protein and/or gene encoding an essential gene product in the absence of the exogenous environmental condition and/or signal(s) than unmodified bacteria of the same subtype under the same conditions.

[0241] In some embodiments, the promoter that is operably linked to the gene(s) encoding the payload(s) is directly induced by exogenous environmental conditions. In some embodiments, the promoter that is operably linked to the gene(s) encoding the payload(s) is indirectly induced by exogenous environmental conditions. In some embodiments, the promoter is directly or indirectly induced by exogenous environmental conditions specific to the gut of a mammal. In some embodiments, the promoter is directly or indirectly induced by exogenous environmental conditions specific to the small intestine of a mammal. In some embodiments, the promoter is directly or indirectly induced by low-oxygen or anaerobic conditions such as the environment of the mammalian gut. In some embodiments, the promoter is directly or indirectly induced by molecules or metabolites that are specific to the gut of a mammal. In some embodiments, the promoter is directly or indirectly induced by a molecule that is co- administered with the bacterial cell. In some embodiments, the promoter that is operably linked to the gene(s) encoding the kill- switch component(s) is directly induced or repressed by exogenous environmental conditions. In some embodiments, the promoter that is operably linked to the gene(s) encoding the kill- switch component(s) is indirectly induced or repressed by exogenous environmental conditions. In some

embodiments, the promoter is directly or indirectly induced or repressed by exogenous environmental conditions specific to the gut of a mammal. In some embodiments, the promoter is directly or indirectly induced or repressed by exogenous environmental conditions specific to the small intestine of a mammal. In some embodiments, the promoter is directly or indirectly induced or repressed by low-oxygen or anaerobic conditions such as the environment of the mammalian gut. In some embodiments, the promoter is directly or indirectly induced or repressed by molecules or metabolites that are specific to the gut of a mammal. In some embodiments, the promoter is directly or indirectly induced or repressed by a molecule that is co- administered with the bacterial cell. A. Fumarate and Nitrate Reductase Regulator (FNR) Responsive Promoters

[0242] In certain embodiments, the inducible promoter is a fumarate and nitrate reductase regulator (FNR) responsive promoter. As used herein, the term "FNR responsive promoter" or "FNR promoter" refers to a promoter that is responsive to fumarate and nitrate reductase (FNR), and multiple FNR promoters are known in the art. For example, in E. coli, FNR is a major transcriptional activator that controls the switch from aerobic to anaerobic metabolism (Unden et al., 1997). In the anaerobic state, FNR dimerizes into an active DNA binding protein that activates hundreds of genes responsible for adapting to anaerobic growth. In the aerobic state, FNR is prevented from dimerizing by oxygen and is inactive. Thus, the term "FNR responsive promoter" refers to any promoter of the many genes responsible for adapting to anaerobic growth which is responsive to FNR.

[0243] FNR responsive promoters include, but are not limited to, the FNR responsive promoters listed in Table 2, below. Underlined sequences are predicted ribosome binding sites, and bolded sequences are restriction sites used for cloning.

Table 2

AGTTGTTCTTATTGGTGGTGTTGCTTTATGGTTGCATCGTAGTAA

ATGGTTGTAACAAAAGCAATTTTTCCGGCTGTCTGTATACAAAA

SEQ ID NO: 5 ACGCCGTAAAGTTTGAGCGAAGTCAATAAACTCTCTACCCATTC

AGGGCAATATCTCTCTTGGATCCCTCTAGAAATAATTTTGTTTA ACTTTAAGAAGGAGATATACAT

[0244] In one embodiment, the FNR responsive promoter comprises SEQ ID NO: l. In another embodiment, the FNR responsive promoter comprises SEQ ID NO:2. In another embodiment, the FNR responsive promoter comprises SEQ ID NO:3. In another

embodiment, the FNR responsive promoter comprises SEQ ID NO:4. In yet another embodiment, the FNR responsive promoter comprises SEQ ID NO:5. Additional FNR responsive promoters are shown below.

[0245] FNR promoter sequences are known in the art, and any suitable FNR promoter sequence(s) may be used in the genetically engineered bacteria of the invention. Any suitable FNR promoter(s) may be combined with any suitable payload and/or kill-switch component. Non- limiting FNR promoter sequences are provided in Table 3. Table 3 depicts the nucleic acid sequences of exemplary regulatory region sequences comprising a FNR-responsive promoter sequence. Underlined sequences are predicted ribosome binding sites, and bolded sequences are restriction sites used for cloning.

Table 3

CGGCCCGATCGTTGAACATAGCGGTCCGCAGGCGGCACTGCTTA

CAGCAAACGGTCTGTACGCTGTCGTCTTTGTGATGTGCTTCCTGT

TAGGTTTCGTCAGCCGTCACCGTCAGCATAACACCCTGACCTCT

CATTAATTGCTCATGCCGGACGGCACTATCGTCGTCCGGCCTTTT

nirB2

CCTCTCTTCCCCCGCTACGTGCATCTATTTCTATAAACCCGCTCA SEQ ID NO: 9

TTTTGTCTATTTTTTGCACAAACATGAAATATCAGACAATTCCGT

GACTTAAGAAAATTTATACAAATCAGCAATATACCCATTAAGGA

GTATATAAAGGTGAATTTGATTTACATCAATAAGCGGGGTTGCT

GAATCGTTAAGGTAGGCGGTAATAGAAAAGAAATCGAGGCAAA

Aatgtttgtttaactttaagaaggagatatacat

GTCAGCATAACACCCTGACCTCTCATTAATTGCTCATGCCGGAC

GGCACTATCGTCGTCCGGCCTTTTCCTCTCTTCCCCCGCTACGTG

nirB3 CATCTATTTCTATAAACCCGCTCATTTTGTCTATTTTTTGCACAA SEQ ID NO: 10 ACATGAAATATCAGACAATTCCGTGACTTAAGAAAATTTATACA

AATCAGCAATATACCCATTAAGGAGTATATAAAGGTGAATTTGA

TTTACATCAATAAGCGGGGTTGCTGAATCGTTAAGGTAGGCGGT

AATAGAAAAGAAATCGAGGCAAAA

ATTTCCTCTCATCCCATCCGGGGTGAGAGTCTTTTCCCCCGACTT

ydfZ ATGGCTCATGCATGCATCAAAAAAGATGTGAGCTTGATCAAAA SEQ ID NO: 11 ACAAAAAATATTTCACTCGACAGGAGTATTTATATTGCGCCCGT

TACGTGGGCTTCGACTGTAAATCAGAAAGGAGAAAACACCT

GTCAGCATAACACCCTGACCTCTCATTAATTGTTCATGCCGGGC

GGCACTATCGTCGTCCGGCCTTTTCCTCTCTTACTCTGCTACGTA

CATCTATTTCTATAAATCCGTTCAATTTGTCTGTTTTTTGCACAA

nirB+RBS

ACATGAAATATCAGACAATTCCGTGACTTAAGAAAATTTATACA SEQ ID NO: 12

AATCAGCAATATACCCCTTAAGGAGTATATAAAGGTGAATTTGA

TTTACATCAATAAGCGGGGTTGCTGAATCGTTAAGGATCCCTCT

AGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACAT

CATTTCCTCTCATCCCATCCGGGGTGAGAGTCTTTTCCCCCGACT

TATGGCTCATGCATGCATCAAAAAAGATGTGAGCTTGATCAAAA

ydfZ+RBS

ACAAAAAATATTTCACTCGACAGGAGTATTTATATTGCGCCCGG SEQ ID NO: 13

ATCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATA

CAT

AGTTGTTCTTATTGGTGGTGTTGCTTTATGGTTGCATCGTAGTAA ATGGTTGTAACAAAAGCAATTTTTCCGGCTGTCTGTATACAAAA

fnrSl

ACGCCGTAAAGTTTGAGCGAAGTCAATAAACTCTCTACCCATTC SEQ ID NO: 14

AGGGCAATATCTCTCTTGGATCCCTCTAGAAATAATTTTGTTTA ACTTTAAGAAGGAGATATACAT AGTTGTTCTTATTGGTGGTGTTGCTTTATGGTTGCATCGTAGTAA ATGGTTGTAACAAAAGCAATTTTTCCGGCTGTCTGTATACAAAA

fnrS2

ACGCCGCAAAGTTTGAGCGAAGTCAATAAACTCTCTACCCATTC SEQ ID NO: 15

AGGGCAATATCTCTCTTGGATCCAAAGTGAACTCTAGAAATAAT

TTTGTTTAACTTTAAGAAGGAGATATACAT

TCGTCTTTGTGATGTGCTTCCTGTTAGGTTTCGTCAGCCGTCACC

GTCAGCATAACACCCTGACCTCTCATTAATTGCTCATGCCGGAC

GGCACTATCGTCGTCCGGCCTTTTCCTCTCTTCCCCCGCTACGTG

CATCTATTTCTATAAACCCGCTCATTTTGTCTATTTTTTGCACAA

nirB+crp

ACATGAAATATCAGACAATTCCGTGACTTAAGAAAATTTATACA SEQ ID NO: 16

AATCAGCAATATACCCATTAAGGAGTATATAAAGGTGAATTTGA

TTTACATCAATAAGCGGGGTTGCTGAATCGTTAAGGTAGaaatgtgat ctagttcacatttGCGGTAATAGAAAAGAAATCGAGGCAAAAaigOTgiitaac tttaagaaggagatatacat

AGTTGTTCTTATTGGTGGTGTTGCTTTATGGTTGCATCGTAGTAA

ATGGTTGTAACAAAAGCAATTTTTCCGGCTGTCTGTATACAAAA

fnrS+crp

ACGCCGCAAAGTTTGAGCGAAGTCAATAAACTCTCTACCCATTC SEQ ID NO: 17

AGGGCAATATCTCTCaaatgtgatctagttcacatttiiigiitoaciitoagaaggagatotoc at

[0246] In some embodiments, the genetically engineered bacteria of the invention comprise one or more of: SEQ ID NO: 6, SEQ ID NO: 7, nirB l promoter (SEQ ID NO: 8), nirB2 promoter (SEQ ID NO: 9), nirB3 promoter (SEQ ID NO: 10), ydfZ promoter (SEQ ID NO: 11), nirB promoter fused to a strong ribosome binding site (SEQ ID NO: 12), ydfZ promoter fused to a strong ribosome binding site (SEQ ID NO: 13), fnrS, an anaerobically induced small RNA gene (fnrS l promoter SEQ ID NO: 14 or fnrS2 promoter SEQ ID NO:

15), nirB promoter fused to a crp binding site (SEQ ID NO: 16), and fnrS fused to a crp binding site (SEQ ID NO: 17).

[0247] In some embodiments, genetically engineered bacteria comprise a nucleic acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% homologous to the DNA sequence of any of SEQ ID NOs: 1-17, or a functional fragment thereof.

[0248] In some embodiments, multiple distinct FNR nucleic acid sequences are inserted in the recombinant bacterial cell. In alternate embodiments, an inducible promoter of the disclosure is an alternate oxygen level-dependent promoter, e.g., dissimilatory nitrate respirationregulator DNR promoter (Trunk et al., 2010) or anaerobic regulation of arginine deiminiase and nitrate reduction ANR promoter (Ray et al., 1997). In these embodiments, expression of a gene linked to the inducible promoter is particularly activated in a low- oxygen or anaerobic environment, such as in the gut. In some embodiments, gene expression is further optimized by methods known in the art, e.g., by optimizing ribosomal binding sites and/or increasing mRNA stability. In one embodiment, the mammalian gut is a human mammalian gut.

[0249] In some embodiments, the bacterial cell of the disclosure comprises an oxygen-level dependent transcriptional regulator, e.g., FNR, ANR, or DNR, and

corresponding promoter from a different bacterial species. The heterologous oxygen-level dependent transcriptional regulator and promoter increase the transcription of genes operably linked to said promoter, e.g., the payload gene and/or kill- switch component gene, in a low- oxygen or anaerobic environment, as compared to the native gene(s) and promoter in the bacteria under the same conditions. In certain embodiments, the non-native oxygen-level dependent transcriptional regulator is an FNR protein from N. gonorrhoeae (see, e.g., Isabella et al., 2011). In some embodiments, the corresponding wild-type transcriptional regulator is left intact and retains wild-type activity. In alternate embodiments, the corresponding wild- type transcriptional regulator is deleted or mutated to reduce or eliminate wild-type activity.

[0250] In some embodiments, the genetically engineered bacterial cell comprises a wild-type oxygen-level dependent transcriptional regulator, e.g., FNR, ANR, or DNR, and corresponding promoter that is mutated relative to the wild-type promoter from bacteria of the same subtype. The mutated promoter enhances binding to the wild-type transcriptional regulator and increases the transcription of genes operably linked to said promoter, e.g., the gene encoding the payload and/or gene(s) encoding a kill-switch component, e.g.,

recombinase, anti-toxin, toxin, essential gene product, and/or other component of the kill- switch, in a low-oxygen or anaerobic environment, as compared to the wild-type promoter under the same conditions. In some embodiments, the engineered bacterial cell comprises a wild-type oxygen-level dependent promoter, e.g., FNR, ANR, or DNR promoter, and corresponding transcriptional regulator that is mutated relative to the wild-type transcriptional regulator from bacteria of the same subtype. The mutated transcriptional regulator enhances binding to the wild-type promoter and increases the transcription of genes operably linked to said promoter, e.g., the gene encoding the payload and/or gene(s) encoding a kill-switch component, e.g., recombinase, anti-toxin, toxin, essential gene product, and/or other component of the kill- switch, in a low-oxygen or anaerobic environment, as compared to the wild-type transcriptional regulator under the same conditions. In certain embodiments, the mutant oxygen- level dependent transcriptional regulator is an FNR protein comprising amino acid substitutions that enhance dimerization and FNR activity (see, e.g., Moore et al., 2006).

[0251] In some embodiments, the bacterial cells of the disclosure comprise multiple copies of the endogenous gene encoding the oxygen level- sensing transcriptional regulator, e.g., an FNR gene. In some embodiments, the gene encoding the oxygen level-sensing transcriptional regulator is present on a plasmid. In some embodiments, the gene encoding the oxygen level- sensing transcriptional regulator and the gene encoding the at least one heterologous gene, e.g., the payload, therapeutic gene, gene(s) encoding one or more kill- switch component(s), e.g., recombinase, toxin, anti-toxin, essential gene product and/or other component of the kill-switch, are present on different plasmids. In some embodiments, the gene encoding the oxygen level- sensing transcriptional regulator and the gene encoding the at least one heterologous gene, e.g., payload, therapeutic gene, gene(s) encoding one or more kill-switch component(s), e.g., recombinase, toxin, anti-toxin, essential gene product and/or other component of the kill-switch, are present on the same plasmid.

[0252] In some embodiments, the gene encoding the oxygen level- sensing

transcriptional regulator is present on a chromosome. In some embodiments, the gene encoding the oxygen level- sensing transcriptional regulator and the gene encoding the at least one heterologous gene, e.g., payload, therapeutic gene, gene(s) encoding one or more kill- switch component(s), e.g., recombinase, anti-toxin, toxin, essential gene product and/or other component of the kill-switch, are present on different chromosomes. In some embodiments, the gene encoding the oxygen level- sensing transcriptional regulator and the gene encoding the at least one heterologous gene, e.g., payload, therapeutic gene, gene(s) encoding one or more kill-switch component(s), e.g., recombinase, anti-toxin, toxin, essential gene product and/or other component of the kill-switch, are present on the same chromosome. In some instances, it may be advantageous to express the oxygen level- sensing transcriptional regulator under the control of an inducible promoter in order to enhance expression stability. In some embodiments, expression of the transcriptional regulator is controlled by a different promoter than the promoter that controls expression of the gene encoding the at least one heterologous gene, e.g., the payload, therapeutic gene, and/or gene(s) encoding one or more kill-switch component(s), e.g., recombinase, anti-toxin, toxin, essential gene product and/or other component of the kill-switch. In some embodiments, expression of the transcriptional regulator is controlled by the same promoter that controls expression of the gene encoding the at least one heterologous gene, e.g., payload, therapeutic gene, and/or gene(s) encoding one or more kill-switch component, e.g., a recombinase, anti-toxin, toxin, essential gene product, and/or other component of the kill- switch. In some embodiments, the transcriptional regulator and the gene encoding the at least one heterologous gene, e.g., payload, therapeutic gene, and/or gene(s) encoding one or more kill-switch component(s), e.g., a recombinase, anti-toxin, toxin, essential gene product, and/or other component of the kill-switch, are divergently transcribed from a promoter region.

[0253] B. Reactive Oxygen Species (ROS) Inducible Promoters

[0254] In other embodiments of the disclosure, the inducible promoter is an ROS- inducible regulatory region. Thus, in some embodiments, the genetically engineered bacteria comprises gene, gene(s), or gene cassettes for producing a payload, therapeutic, and/or one or more kill-switch component(s) that is expressed under the control of an inducible promoter that is activated by conditions of cellular damage. Reactive oxygen species are produced at sites of inflammation and are intimately associated with the disease process. Certain bacterial transcription factors have evolved to sense ROS and regulate the expression of a number of proteins that protect the bacterial DNA from their damaging effects. The disclosure takes advantage of this system by providing, inter alia, programmed bacterial cells that are functionally silent until they reach the site of celleular or tissue damage, or inflammation, e.g., in the gut, in which environment the expression of the heterologous gene, e.g., payload, therapeutic, and/or one or more kill-swicth components is induced. For example, the expression of at least one therapeutic gene and at least one recombinase gene may be induced, which recombinase ultimately flips a toxin gene, leading to the accumulation of the toxin and timed death of the recombinant bacterial cell. Therefore, local ROS regulates a transcription factor that directly or indirectly controls production of the at least one heterologous gene, e.g., payload, therapeutic gene, and/or one or more kill-switch component gene(s), e.g., encoding a recombinase, anti-toxin, toxin, essential gene product and/or other component of the kill- switch.

[0255] "Reactive oxygen species" and "ROS" are used interchangeably to refer to highly active molecules, ions, and/or radicals derived from molecular oxygen. ROS can be produced as byproducts of aerobic respiration or metal-catalyzed oxidation and may cause deleterious cellular effects such as oxidative damage. ROS includes, but is not limited to, hydrogen peroxide (H202), organic peroxide (ROOH), hydroxyl ion (OH-), hydroxyl radical (•OH), superoxide or superoxide anion (·02-), singlet oxygen (102), ozone (03), carbonate radical, peroxide or peroxyl radical (·02-2), hypochlorous acid (HOC1), hypochlorite ion (OC1-), sodium hypochlorite (NaOCl), nitric oxide (NO*), and peroxynitrite or peroxynitrite anion (ONOO-) (unpaired electrons denoted by ·).

[0256] Bacteria have evolved transcription factors that are capable of sensing ROS levels. Different ROS signaling pathways are triggered by different ROS levels and occur with different kinetics (Marinho et al., 2014). "ROS -inducible regulatory region" refers to a nucleic acid sequence to which one or more ROS -sensing transcription factors is capable of binding, wherein the binding and/or activation of the corresponding transcription factor activates downstream gene expression; in the presence of ROS, the transcription factor binds to and/or activates the regulatory region. In some embodiments, the ROS-inducible regulatory region comprises a promoter sequence. In some embodiments, the transcription factor senses ROS and subsequently binds to the ROS-inducible regulatory region, thereby activating downstream gene expression. In alternate embodiments, the transcription factor is bound to the ROS-inducible regulatory region in the absence of ROS; in the presence of ROS, the transcription factor undergoes a conformational change, thereby activating downstream gene expression. The ROS-inducible regulatory region may be operatively linked to at least one heterologous gene or gene(s) encoding a recombinase, anti-toxin, and/or other component of the kill-switch. For example, in the presence of ROS, a transcription factor, e.g., OxyR, senses ROS and activates a corresponding ROS-inducible regulatory region, thereby driving expression of an operatively linked gene or gene cassette. Thus, ROS induces expression of the gene, genes, or gene cassette.

[0257] "ROS-derepressible regulatory region" refers to a nucleic acid sequence to which one or more ROS-sensing transcription factors is capable of binding, wherein the binding of the corresponding transcription factor represses downstream gene expression; in the presence of ROS, the transcription factor does not bind to and does not repress the regulatory region. In some embodiments, the ROS-derepressible regulatory region comprises a promoter sequence. The ROS-derepressible regulatory region may be operatively linked to a gene, genes, or gene cassette, e.g., at least one heterologous gene or gene(s) encoding a payload or therapeutic, and/or encoding one or more kill-switch components, e.g., a recombinase, anti-toxin, toxin, essential gene product and/or other component of the kill- switch. For example, in the presence of ROS, a transcription factor, e.g., OhrR, senses ROS and no longer binds to and/or represses the regulatory region, thereby derepressing an operatively linked gene or gene cassette. Thus, ROS derepresses expression of the gene, genes, or gene cassette.

[0258] "ROS-repressible regulatory region" refers to a nucleic acid sequence to which one or more ROS-sensing transcription factors is capable of binding, wherein the binding of the corresponding transcription factor represses downstream gene expression; in the presence of ROS, the transcription factor binds to and represses the regulatory region. In some embodiments, the ROS-repressible regulatory region comprises a promoter sequence. In some embodiments, the transcription factor that senses ROS is capable of binding to a regulatory region that overlaps with part of the promoter sequence. In alternate

embodiments, the transcription factor that senses ROS is capable of binding to a regulatory region that is upstream or downstream of the promoter sequence. The ROS-repressible regulatory region may be operatively linked to a gene or gene cassette. For example, in the presence of ROS, a transcription factor, e.g., PerR, senses ROS and binds to a corresponding ROS-repressible regulatory region, thereby blocking expression of an operatively linked gene or gene cassette. Thus, ROS represses expression of the gene, genes, or gene cassette.

[0259] A "ROS -responsive regulatory region" refers to a ROS-inducible regulatory region, a ROS-repressible regulatory region, and/or a ROS-derepressible regulatory region. In some embodiments, the ROS -responsive regulatory region comprises a promoter sequence. Each regulatory region is capable of binding at least one corresponding ROS-sensing transcription factor. Examples of transcription factors that sense ROS and their

corresponding ROS -responsive genes, promoters, and/or regulatory regions include, but are not limited to, those shown in Table 4.

[0260] A "tunable regulatory region" refers to a nucleic acid sequence under direct or indirect control of a transcription factor and which is capable of activating, repressing, derepressing, or otherwise controlling gene expression relative to levels of an inducer. In some embodiments, the tunable regulatory region comprises a promoter sequence. The inducer may be ROS, and the tunable regulatory region may be a ROS -responsive regulatory region. The tunable regulatory region may be operatively linked to a gene or gene cassette, e.g., at least one heterologous gene or at least one recombinase. For example, the tunable regulatory region is a ROS-inducible regulatory region, and when ROS is present, a ROS- sensing transcription factor becomes oxidized and binds to and/or activates the regulatory region, thereby driving expression of the operatively linked gene or gene cassette. In this instance, the tunable regulatory region activates gene or gene cassette expression relative to ROS levels.

[0261] A gene or gene cassette may be operatively linked to a tunable regulatory region that is directly or indirectly controlled by a transcription factor that is capable of sensing at least one ROS. "Directly controlled" refers to a ROS-inducible or ROS- derepressible regulatory region, in which the regulatory region is operatively linked to said gene or gene cassette; in the presence of ROS, the therapeutic molecule is expressed.

"Indirectly controlled" refers to a ROS-repressible regulatory region, wherein a ROS-sensing repressor inhibits transcription of a second repressor, which inhibits the transcription of the gene or gene cassette for producing a therapeutic molecule; in the presence of ROS, the second repressor does not inhibit transcription of said gene or gene cassette, and the therapeutic molecule is expressed. "Operatively linked" refers a nucleic acid sequence, e.g., at least one heterologous gene, and/or at least one recombinase, that is joined to a regulatory region sequence in a manner which allows expression of the nucleic acid sequence, e.g., acts in cis.

Table 4. Examples of ROS-sensing transcription factors and ROS-responsive genes

[0262] In some embodiments, the genetically engineered bacterial cells of the disclosure comprise a tunable regulatory region that is directly or indirectly controlled by a transcription factor that is capable of sensing at least one reactive oxygen species. The tunable regulatory region is operatively linked to a gene or gene cassette capable of directly or indirectly driving the expression of at least one heterologous gene, e.g., payload gene, therapeutic gene, and/or gene(s) encoding one or more kill-switch component(s), e.g., a recombinase, anti-toxin, toxin, essential gene product and/or other component of the kill- switch, thus controlling expression of the gene(s) relative to ROS levels. For example, the tunable regulatory region is a ROS-inducible regulatory region, and the molecule is a payload; when ROS is present, e.g., in an inflamed tissue, a ROS-sensing transcription factor binds to and/or activates the regulatory region and drives expression of the gene sequence for the payload(s) and/or the gene sequence for one or more kill-switch components, thereby producing the payload(s) and the kill-switch (which may be designed to have a built-in delay), which allows production of the payload and subsequent demise of the bacteria. When inflammation is ameliorated, ROS levels are reduced, and payload production is decreased or eliminated.

[0263] In some embodiments, the tunable regulatory region is a ROS-inducible regulatory region; in the presence of ROS, a transcription factor senses ROS and activates the ROS-inducible regulatory region, thereby driving expression of an operatively linked gene, genes, or gene cassette. In some embodiments, the transcription factor senses ROS and subsequently binds to the ROS-inducible regulatory region, thereby activating downstream gene expression. In alternate embodiments, the transcription factor is bound to the ROS- inducible regulatory region in the absence of ROS; when the transcription factor senses ROS, it undergoes a conformational change, thereby inducing downstream gene expression.

[0264] In some embodiments, the tunable regulatory region is a ROS-inducible regulatory region, and the transcription factor that senses ROS is OxyR. OxyR "functions primarily as a global regulator of the peroxide stress response" and is capable of regulating dozens of genes, e.g., "genes involved in H202 detoxification (katE, ahpCF), heme biosynthesis (hemH), reductant supply (grxA, gor, trxC), thiol-disulfide isomerization (dsbG), Fe-S center repair (sufA-E, sufS), iron binding (yaaA), repression of iron import systems (fur)" and "OxyS, a small regulatory RNA" (Dubbs et al., 2012). The recombinant bacterial cells of the disclosure may comprise any suitable ROS -responsive regulatory region from a gene that is activated by OxyR. Genes that are capable of being activated by OxyR are known in the art (see, e.g., Zheng et al., 2001; Dubbs et al., 2012). In certain embodiments, the recombinant bacterial cells of the disclosure comprise a ROS-inducible regulatory region from oxyS that is operatively linked to a gene or gene cassette, e.g., at least one heterologous gene, gene(s) encoding a recombinase, anti-toxin, and/or other component of the kill-switch. In the presence of ROS, e.g., H202, an OxyR transcription factor senses ROS and activates to the oxyS regulatory region, thereby driving expression of the operatively linked gene(s) and producing their cognate proteins. In some embodiments, OxyR is encoded by an E. coli oxyR gene. In some embodiments, the oxyS regulatory region is an E. coli oxyS regulatory region. In some embodiments, the ROS-inducible regulatory region is selected from the regulatory region of katG, dps, and ahpC.

[0265] In alternate embodiments, the tunable regulatory region is a ROS-inducible regulatory region, and the corresponding transcription factor that senses ROS is SoxR. When SoxR is activated by oxidation of its [2Fe-2S] cluster, it increases the synthesis of SoxS, which then activates its target gene expression (Koo et al., 2003). SoxR is known to respond primarily to superoxide and nitric oxide (Koo et al., 2003), and is also capable of responding to H202. The recombinant bacterial cells of the disclosure may comprise any suitable ROS- responsive regulatory region from a gene that is activated by SoxR. Genes that are capable of being activated by SoxR are known in the art (see, e.g., Koo et al., 2003). In certain embodiments, the recombinant bacterial cells of the disclosure comprise a ROS-inducible regulatory region from soxS that is operatively linked to a gene or gene cassette, e.g., at least one heterologous gene, an anti-toxin gene, and/or at least one recombinase gene. In the presence of ROS, the SoxR transcription factor senses ROS and activates the soxS regulatory region, thereby driving expression of the operatively linked gene(s) and producing their cognate proteins.

[0266] In some embodiments, the tunable regulatory region is a ROS-derepressible regulatory region, and binding of a corresponding transcription factor represses downstream gene expression; in the presence of ROS, the transcription factor no longer binds to the regulatory region, thereby derepressing the operatively linked gene or gene cassette.

[0267] In some embodiments, the tunable regulatory region is a ROS-derepressible regulatory region, and the transcription factor that senses ROS is OhrR. OhrR binds to a pair of inverted repeat DNA sequences overlapping the ohrA promoter site and thereby represses the transcription event, but oxidized OhrR is unable to bind its DNA target (Duarte et al., 2010). OhrR is a transcriptional repressor [that] ... senses both organic peroxides and NaOCl (Dubbs et al., 2012) and is weakly activated by H202 but it shows much higher reactivity for organic hydroperoxides (Duarte et al., 2010). The recombinant bacterial cells of the disclosure may comprise any suitable ROS -responsive regulatory region from a gene that is repressed by OhrR. Genes that are capable of being repressed by OhrR are known in the art (see, e.g., Dubbs et al., 2012). In certain embodiments, the recombinant bacterial cells of the disclosure comprise a ROS-derepressible regulatory region from ohrA that is operatively linked to a gene or gene cassette, e.g., at least one heterologous gene, an anti-toxin gene, and/or at least one recombinase gene. In the presence of ROS, e.g., NaOCl, an OhrR transcription factor senses ROS and no longer binds to the ohrA regulatory region, thereby derepressing the operatively linked gene(s) cassette and producing their cognate proteins.

[0268] OhrR is a member of the MarR family of ROS -responsive regulators. Most members of the MarR family are transcriptional repressors and often bind to the -10 or -35 region in the promoter causing a steric inhibition of RNA polymerase binding (Bussmann et al., 2010). Other members of this family are known in the art and include, but are not limited to, OspR, MgrA, RosR, and SarZ. In some embodiments, the transcription factor that senses ROS is OspR, MgRA, RosR, and/or SarZ, and the recombinant bacterial cell of the disclosure comprises one or more corresponding regulatory region sequences from a gene that is repressed by OspR, MgRA, RosR, and/or SarZ. Genes that are capable of being repressed by OspR, MgRA, RosR, and/or SarZ are known in the art (see, e.g., Dubbs et al., 2012).

[0269] In some embodiments, the tunable regulatory region is a ROS-derepressible regulatory region, and the corresponding transcription factor that senses ROS is RosR. RosR is a MarR-type transcriptional regulator that binds to an 18-bp inverted repeat with the consensus sequence TTGTTGAYRYRTCAACWA and is reversibly inhibited by the oxidant H202 (Bussmann et al., 2010). RosR is capable of repressing numerous genes and putative genes, including but not limited to a putative polyisoprenoid-binding protein (eg 1322, gene upstream of and divergent from rosR), a sensory histidine kinase (cgtS9), a putative transcriptional regulator of the Crp/FNR family (cg3291), a protein of the glutathione S- transferase family (cgl426), two putative FMN reductases (cgl l50 and cgl850), and four putative monooxygenases (cg0823, cgl848, cg2329, and cg3084) (Bussmann et al., 2010). The recombinant bacterial cells of the disclosure may comprise any suitable ROS -responsive regulatory region from a gene that is repressed by RosR. Genes that are capable of being repressed by RosR are known in the art (see, e.g., Bussmann et al., 2010). In certain embodiments, the recombinant bacterial cells of the disclosure comprise a ROS-derepressible regulatory region from cgtS9 that is operatively linked to a gene or gene cassette, e.g., at least one heterologous gene, gene(s) encoding a recombinase, anti-toxin, and/or other component of the kill- switch,. In the presence of ROS, e.g., H202, a RosR transcription factor senses ROS and no longer binds to the cgtS9 regulatory region, thereby derepressing the operatively linked gene(s) and producing their cognate proteins.

[0270] In some embodiments, it is advantageous for the recombinant bacterial cells of the disclosure to express a ROS-sensing transcription factor that does not regulate the expression of a significant number of native genes in the bacteria. In some embodiments, the bacterium of the disclosure expresses a ROS-sensing transcription factor from a different species, strain, or substrain of bacteria, wherein the transcription factor does not bind to regulatory sequences in the bacterium of the disclosure. In some embodiments, the bacterium of the disclosure is Escherichia coli, and the ROS-sensing transcription factor is RosR, e.g., from Corynebacterium glutamicum, wherein the Escherichia coli does not comprise binding sites for said RosR. In some embodiments, the heterologous transcription factor minimizes or eliminates off-target effects on endogenous regulatory regions and genes in the engineered bacterial cells.

[0271] In some embodiments, the tunable regulatory region is a ROS-repressible regulatory region, and binding of a corresponding transcription factor represses downstream gene expression; in the presence of ROS, the transcription factor senses ROS and binds to the ROS-repressible regulatory region, thereby repressing expression of the operatively linked gene or gene cassette. In some embodiments, the ROS-sensing transcription factor is capable of binding to a regulatory region that overlaps with part of the promoter sequence. In alternate embodiments, the ROS-sensing transcription factor is capable of binding to a regulatory region that is upstream or downstream of the promoter sequence.

[0272] In some embodiments, the tunable regulatory region is a ROS-repressible regulatory region, and the transcription factor that senses ROS is PerR. In Bacillus subtilis, PerR "when bound to DNA, represses the genes coding for proteins involved in the oxidative stress response (katA, ahpC, and mrgA), metal homeostasis (hemAXCDBL, fur, and zoaA) and its own synthesis (perR)" (Marinho et al., 2014). PerR is a "global regulator that responds primarily to H202" (Dubbs et al., 2012) and "interacts with DNA at the per box, a specific palindromic consensus sequence (TTATAATNATTATAA) residing within and near the promoter sequences of PerR-controlled genes" (Marinho et al., 2014). PerR is capable of binding a regulatory region that "overlaps part of the promoter or is immediately downstream from it" (Dubbs et al., 2012). The genetically engineered bacteria of the invention may comprise any suitable ROS -responsive regulatory region from a gene that is repressed by PerR. Genes that are capable of being repressed by PerR are known in the art (see, e.g., Dubbs et al., 2012; Table 1).

[0273] In these embodiments, the genetically engineered bacteria may comprise a two repressor activation regulatory circuit, which is used to express a payload or kill- switch component gene. The two repressor activation regulatory circuit comprises a first ROS- sensing repressor, e.g., PerR, and a second repressor, e.g., TetR, which is operatively linked to a gene or gene cassette. In one aspect of these embodiments, the ROS-sensing repressor inhibits transcription of the second repressor, which inhibits the transcription of the gene or gene cassette. Examples of second repressors useful in these embodiments include, but are not limited to, TetR, CI, and LexA. In some embodiments, the ROS-sensing repressor is PerR. In some embodiments, the second repressor is TetR. In this embodiment, a PerR- repressible regulatory region drives expression of TetR, and a TetR-repressible regulatory region drives expression of the gene or gene cassette, e.g., an amino acid catabolism enzyme. In the absence of PerR binding (which occurs in the absence of ROS), tetR is transcribed, and TetR represses expression of the gene or gene cassette. In the presence of PerR binding (which occurs in the presence of ROS), tetR expression is repressed, and the gene or gene cassette is expressed.

[0274] A ROS -responsive transcription factor may induce, derepress, or repress gene expression depending upon the regulatory region sequence used in the genetically engineered bacteria. For example, although "OxyR is primarily thought of as a transcriptional activator under oxidizing conditions... OxyR can function as either a repressor or activator under both oxidizing and reducing conditions" (Dubbs et al., 2012), and OxyR "has been shown to be a repressor of its own expression as well as that of fhuF (encoding a ferric ion reductase) and flu (encoding the antigen 43 outer membrane protein)" (Zheng et al., 2001). The genetically engineered bacteria of the invention may comprise any suitable ROS -responsive regulatory region from a gene that is repressed by OxyR. In some embodiments, OxyR is used in a two repressor activation regulatory circuit, as described above. Genes that are capable of being repressed by OxyR are known in the art (see, e.g., Zheng et al., 2001; Table 1). Or, for example, although RosR is capable of repressing a number of genes, it is also capable of activating certain genes, e.g., the narKGHJI operon. In some embodiments, the genetically engineered bacteria comprise any suitable ROS -responsive regulatory region from a gene that is activated by RosR. In addition, "PerR- mediated positive regulation has also been observed... and appears to involve PerR binding to distant upstream sites" (Dubbs et al., 2012). In some embodiments, the genetically engineered bacteria comprise any suitable ROS -responsive regulatory region from a gene that is activated by PerR.

[0275] One or more types of ROS-sensing transcription factors and corresponding regulatory region sequences may be present in genetically engineered bacteria. For example, "OhrR is found in both Gram-positive and Gram-negative bacteria and can coreside with either OxyR or PerR or both" (Dubbs et al., 2012). In some embodiments, the genetically engineered bacteria comprise one type of ROS-sensing transcription factor, e.g., OxyR, and one corresponding regulatory region sequence, e.g., from oxyS. In some embodiments, the genetically engineered bacteria comprise one type of ROS-sensing transcription factor, e.g., OxyR, and two or more different corresponding regulatory region sequences, e.g., from oxyS and katG. In some embodiments, the genetically engineered bacteria comprise two or more types of ROS-sensing transcription factors, e.g., OxyR and PerR, and two or more corresponding regulatory region sequences, e.g., from oxyS and katA, respectively. One ROS -responsive regulatory region may be capable of binding more than one transcription factor. In some embodiments, the genetically engineered bacteria comprise two or more types of ROS-sensing transcription factors and one corresponding regulatory region sequence.

[0276] Nucleic acid sequences of several exemplary OxyR-regulated regulatory regions are shown in Table 5. OxyR binding sites are underlined and bolded. In some embodiments, genetically engineered bacteria comprise a nucleic acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% homologous to the DNA sequence of SEQ ID NO: 18, 19, 20, or 21, or a functional fragment thereof.

Table 5: Nucleotide sequences of exemplary OxyR- regulated regulatory regions

[0277] In some embodiments, the genetically engineered bacteria of the invention comprise a gene encoding a ROS-sensing transcription factor, e.g., the oxyR gene, that is controlled by its native promoter, an inducible promoter, a promoter that is stronger than the native promoter, e.g., the GlnRS promoter or the P(Bla) promoter, or a constitutive promoter. In some instances, it may be advantageous to express the ROS-sensing transcription factor under the control of an inducible promoter in order to enhance expression stability. In some embodiments, expression of the ROS-sensing transcription factor is controlled by a different promoter than the promoter that controls expression of the therapeutic molecule(s) and/or kill-switch component(s). In some embodiments, expression of the ROS-sensing

transcription factor is controlled by the same promoter that controls expression of the therapeutic molecule and/or kill-switch component(s). In some embodiments, the ROS- sensing transcription factor and therapeutic molecule are divergently transcribed from a promoter region.

[0278] In some embodiments, the recombinant bacteria of the disclosure comprise a gene for a ROS-sensing transcription factor from a different species, strain, or substrain of bacteria. In some embodiments, the recombinant bacteria comprise a ROS -responsive regulatory region from a different species, strain, or substrain of bacteria. In some embodiments, the recombinant bacteria comprise a ROS-sensing transcription factor and corresponding ROS -responsive regulatory region from a different species, strain, or substrain of bacteria. The heterologous ROS-sensing transcription factor and regulatory region may increase the transcription of genes operatively linked to said regulatory region in the presence of ROS, as compared to the native transcription factor and regulatory region from bacteria of the same subtype under the same conditions.

[0279] In some embodiments, the genetically engineered bacteria comprise a ROS- sensing transcription factor, OxyR, and corresponding regulatory region, oxyS, from

Escherichia coli. In some embodiments, the native ROS-sensing transcription factor, e.g., OxyR, is left intact and retains wild-type activity. In alternate embodiments, the native ROS- sensing transcription factor, e.g., OxyR, is deleted or mutated to reduce or eliminate wild- type activity.

[0280] In some embodiments, the genetically engineered bacteria of the invention comprise multiple copies of the endogenous gene encoding the ROS-sensing transcription factor, e.g., the oxyR gene. In some embodiments, the gene encoding the ROS-sensing transcription factor is present on a plasmid. In some embodiments, the gene encoding the ROS-sensing transcription factor and the gene or gene cassette for producing the therapeutic molecule are present on different plasmids. In some embodiments, the gene encoding the ROS-sensing transcription factor and the gene or gene cassette for producing the therapeutic molecule(s) and/or kill-switch component(s) are present on the same plasmid. In some embodiments, the gene encoding the ROS-sensing transcription factor is present on a chromosome. In some embodiments, the gene encoding the ROS-sensing transcription factor and the gene or gene cassette for producing the therapeutic molecule(s) and/or kill- switch component(s) are present on different chromosomes. In some embodiments, the gene encoding the ROS-sensing transcription factor and the gene or gene cassette for producing the therapeutic molecule(s) and/or kill- switch component(s) are present on the same chromosome.

[0281] In some embodiments, the genetically engineered bacteria comprise a wild- type gene encoding a ROS-sensing transcription factor, e.g., the soxR gene, and a

corresponding regulatory region, e.g., a soxS regulatory region, that is mutated relative to the wild-type regulatory region from bacteria of the same subtype. The mutated regulatory region increases the expression of the gene, gene(s), or gene cassettes for producing the therapeutic molecule(s) and/or kill-switch component(s) in the presence of ROS, as compared to the wild-type regulatory region under the same conditions. In some embodiments, the genetically engineered bacteria comprise a wild-type ROS -responsive regulatory region, e.g., the oxyS regulatory region, and a corresponding transcription factor, e.g., OxyR, that is mutated relative to the wild-type transcription factor from bacteria of the same subtype. The mutant transcription factor increases the expression of the gene, gene(s), or gene cassettes for producing the therapeutic molecule(s) and/or kill-switch component(s) in the presence of ROS, as compared to the wild-type transcription factor under the same conditions. In some embodiments, both the ROS-sensing transcription factor and corresponding regulatory region are mutated relative to the wild-type sequences from bacteria of the same subtype in order to increase expression of the therapeutic molecule(s) and/or kill-switch component(s) in the presence of ROS.

[0282] In some embodiments, the gene, gene(s), or gene cassettes for producing the payload(s) is present on a plasmid and operably linked to a promoter that is induced by ROS. In some embodiments, the gene, gene(s), or gene cassettes for producing the therapeutic molecule(s) and/or kill-switch component(s) is present in the chromosome and operably linked to a promoter that is induced by ROS. In some embodiments, the gene, gene(s), or gene cassettes for producing the payload(s) is present on a chromosome and operably linked to a promoter that is induced by exposure to tetracycline. In some embodiments, the gene, gene(s), or gene cassettes for producing the payload(s) is present on a plasmid and operably linked to a promoter that is induced by exposure to tetracycline. In some embodiments, expression is further optimized by methods known in the art, e.g., by optimizing ribosomal binding sites, manipulating transcriptional regulators, and/or increasing mRNA stability.

[0283] In some embodiments, the genetically engineered bacteria may comprise multiple copies of the gene, gene(s), or gene cassettes for producing the therapeutic molecule(s) and/or kill-switch component(s). In some embodiments, the gene, gene(s), or gene cassettes for producing the payload(s) is present on a plasmid and operatively linked to a ROS -responsive regulatory region. In some embodiments, the gene, gene(s), or gene cassettes for producing the payload(s) is present in a chromosome and operatively linked to a ROS -responsive regulatory region.

C. Reactive Nitrogen Species (RNS) Inducible Promoters

[0284] In other embodiments of the disclosure, the inducible promoter is an RNS- inducible regulatory region. Reactive nitrogen species (RNS), such as nitric oxide, are produced at sites of inflammation and are intimately associated with the disease process. Certain bacterial transcription factors have evolved to sense RNS and regulate the expression of a number of proteins that protect the bacterial DNA from their damaging effects. The disclosure takes advantage of this system by providing, inter alia, programmed recombinant bacterial cells that are functionally silent until they reach the site of inflammation, e.g., in the gut, in which environment the expression of the heterologous gene, e.g., payload, therapeutic, and/or one or more kill-switch component(s), is induced, For example, the expression of at least one therapeutic gene and at least one recombinase gene may be induced, which recombinase ultimately flip a toxin gene, leading to the accumulation of the toxin and timed death of the recombinant bacterial cell. Therefore, local RNS regulates a transcription factor that directly or indirectly controls production of the at least one heterologous gene, e.g., heterologous therapeutic gene, and the at least one recombinase gene.

[0285] "Reactive nitrogen species" and "RNS" are used interchangeably to refer to highly active molecules, ions, and/or radicals derived from molecular nitrogen. RNS can cause deleterious cellular effects such as nitrosative stress. RNS includes, but is not limited to, nitric oxide (NO*), peroxynitrite or peroxynitrite anion (ONOO-), nitrogen dioxide (•N02), dinitrogen trioxide (N203), peroxynitrous acid (ONOOH), and nitroperoxycarbonate (ONOOC02-) (unpaired electrons denoted by ·).

[0286] Bacteria have evolved transcription factors that are capable of sensing RNS levels. Different RNS signaling pathways are triggered by different RNS levels and occur with different kinetics. "RNS-inducible regulatory region" refers to a nucleic acid sequence to which one or more RNS-sensing transcription factors is capable of binding, wherein the binding and/or activation of the corresponding transcription factor activates downstream gene expression; in the presence of RNS, the transcription factor binds to and/or activates the regulatory region. In some embodiments, the RNS-inducible regulatory region comprises a promoter sequence. In some embodiments, the transcription factor senses RNS and subsequently binds to the RNS-inducible regulatory region, thereby activating downstream gene expression. In alternate embodiments, the transcription factor is bound to the RNS- inducible regulatory region in the absence of RNS; in the presence of RNS, the transcription factor undergoes a conformational change, thereby activating downstream gene expression. The RNS-inducible regulatory region may be operatively linked to a gene, genes, or gene cassette, e.g., at least one heterologous gene encoding a payload or therapeutic and/or gene(s) encoding one or more kill-switch components, e.g., a recombinase, anti-toxin, toxin, essential gene product and/or other component of the kill- switch. For example, in the presence of RNS, a transcription factor senses RNS and activates a corresponding RNS-inducible regulatory region, thereby driving expression of an operatively linked gene or gene cassette. Thus, RNS induces expression of the gene or gene cassette.

[0287] "RNS-derepressible regulatory region" refers to a nucleic acid sequence to which one or more RNS-sensing transcription factors is capable of binding, wherein the binding of the corresponding transcription factor represses downstream gene expression; in the presence of RNS, the transcription factor does not bind to and does not repress the regulatory region. In some embodiments, the RNS-derepressible regulatory region comprises a promoter sequence. The RNS-derepressible regulatory region may be operatively linked to a gene, genes, or gene cassette, e.g., at least one heterologous gene encoding a payload or therapeutic and/or gene(s) encoding one or more kill- switch components, e.g., a recombinase, anti-toxin, toxin, essential gene product and/or other component of the kill-switch. For example, in the presence of RNS, a transcription factor senses RNS and no longer binds to and/or represses the regulatory region, thereby derepressing an operatively linked gene or gene cassette. Thus, RNS derepresses expression of the gene or gene cassette.

[0288] "RNS-repressible regulatory region" refers to a nucleic acid sequence to which one or more RNS-sensing transcription factors is capable of binding, wherein the binding of the corresponding transcription factor represses downstream gene expression; in the presence of RNS, the transcription factor binds to and represses the regulatory region. In some embodiments, the RNS-repressible regulatory region comprises a promoter sequence. In some embodiments, the transcription factor that senses RNS is capable of binding to a regulatory region that overlaps with part of the promoter sequence. In alternate

embodiments, the transcription factor that senses RNS is capable of binding to a regulatory region that is upstream or downstream of the promoter sequence. The RNS-repressible regulatory region may be operatively linked to a gene, genes, or gene cassette. For example, in the presence of RNS, a transcription factor senses RNS and binds to a corresponding RNS- repressible regulatory region, thereby blocking expression of an operatively linked gene, genes, or gene cassette. Thus, RNS represses expression of the gene, genes, or gene cassette.

[0289] A "RNS -responsive regulatory region" refers to a RNS-inducible regulatory region, a RNS-repressible regulatory region, and/or a RNS-derepressible regulatory region. In some embodiments, the RNS -responsive regulatory region comprises a promoter sequence. Each regulatory region is capable of binding at least one corresponding RNS-sensing transcription factor. Examples of transcription factors that sense RNS and their

corresponding RNS -responsive genes, promoters, and/or regulatory regions include, but are not limited to, those shown in Table 6.

[0290] A "tunable regulatory region" refers to a nucleic acid sequence under direct or indirect control of a transcription factor and which is capable of activating, repressing, derepressing, or otherwise controlling gene expression relative to levels of an inducer. In some embodiments, the tunable regulatory region comprises a promoter sequence. The inducer may be RNS, and the tunable regulatory region may be a RNS -responsive regulatory region. The tunable regulatory region may be operatively linked to a gene or gene cassette, e.g., at least one heterologous gene, an anti-toxin gene, and/or at least one recombinase gene. For example, the tunable regulatory region is a RNS-derepressible regulatory region, and when RNS is present, a RNS-sensing transcription factor no longer binds to and/or represses the regulatory region, thereby permitting expression of the operatively linked gene or gene cassette. In this instance, the tunable regulatory region derepresses gene or gene cassette expression relative to RNS levels.

[0291] A gene, genes or gene cassette for producing the at least one heterologous gene, e.g., payload and/or kill-switch component gene of the disclosure may be operatively linked to a tunable regulatory region that is directly or indirectly controlled by a transcription factor that is capable of sensing at least one RNS. "Directly controlled" refers to a RNS- inducible or RNS-derepressible regulatory region, in which the regulatory region is operatively linked to said gene, genes or gene cassette; in the presence of RNS, the therapeutic molecule and/or kill-switch component is expressed. "Indirectly controlled" refers to a RNS-repressible regulatory region, wherein a RNS-sensing repressor inhibits transcription of a second repressor, which inhibits the transcription of the gene, genes or gene cassette for producing the heterologous molecule, e.g., payload and/or kill-switch component, in the presence of RNS, the second repressor does not inhibit transcription of said gene or gene cassette, and the therapeutic molecule and/or kill-switch component is expressed.

"Operatively linked" refers a nucleic acid sequence, e.g., at least one heterologous gene, e.g., payload and/or kill-switch component gene (e.g., an anti-toxin gene, toxin, and/or at least one recombinase gene, that is joined to a regulatory region sequence in a manner which allows expression of the nucleic acid sequence, e.g., acts in cis.

Table 6. Examples of RNS-sensing transcription factors and RNS-responsive genes

[0292] The recombinant bacterial cells of the disclosure may comprise a tunable regulatory region that is directly or indirectly controlled by a transcription factor that is capable of sensing at least one reactive nitrogen species. The tunable regulatory region is operatively linked to a gene, genes or gene cassette capable of directly or indirectly driving the expression of at least one heterologous gene, e.g., payload and/or kill-switch component gene (e.g. gene(s) encoding a recombinase, anti-toxin, toxin, and/or other component of the kill-switch), thus controlling expression of the gene(s) relative to RNS levels. For example, the tunable regulatory region is a RNS-inducible regulatory region, and the payload is, for example, a therapeutic molecule; when RNS is present, e.g., in an inflamed tissue, a RNS- sensing transcription factor binds to and/or activates the regulatory region and drives expression of the gene sequence for the payload(s) and/or the gene sequence for one or more kill-switch components, thereby producing the payload(s) and the kill-switch (which may be designed to have a built-in delay), which allows production of the payload and subsequent demise of the bacteria. When inflammation is ameliorated, RNS levels are reduced, and payload production is decreased or eliminated.

[0293] In some embodiments, the tunable regulatory region is a RNS-inducible regulatory region; in the presence of RNS, a transcription factor senses RNS and activates the RNS-inducible regulatory region, thereby driving expression of an operatively linked gene, genes, or gene cassette. In some embodiments, the transcription factor senses RNS and subsequently binds to the RNS-inducible regulatory region, thereby activating downstream gene expression. In alternate embodiments, the transcription factor is bound to the RNS- inducible regulatory region in the absence of RNS; when the transcription factor senses RNS, it undergoes a conformational change, thereby inducing downstream gene expression.

[0294] In some embodiments, the tunable regulatory region is a RNS-inducible regulatory region, and the transcription factor that senses RNS is NorR. NorR is an NO- responsive transcriptional activator that regulates expression of the norVW genes encoding flavorubredoxin and an associated flavoprotein, which reduce NO to nitrous oxide (Spiro 2006). The recombinant bacterial cells of the disclosure may comprise any suitable RNS- responsive regulatory region from a gene that is activated by NorR. Genes that are capable of being activated by NorR are known in the art (see, e.g., Spiro 2006; Vine et al., 2011;

Karlinsey et al., 2012). In certain embodiments, the recombinant bacterial cells of the disclosure comprise a RNS-inducible regulatory region from norVW that is operatively linked to a gene, genes, or gene cassette, e.g., at least one payload or therapeutic gene, and/or one or more kill-switch component gene(s), e.g., an anti-toxin gene, toxin gene, and/or at least one recombinase gene or other kill- witch component gene. In the presence of RNS, a NorR transcription factor senses RNS and activates to the norVW regulatory region, thereby driving expression of the operatively linked gene(s) and producing their cognate proteins.

[0295] In some embodiments, the tunable regulatory region is a RNS-inducible regulatory region, and the transcription factor that senses RNS is DNR. DNR (dissimilatory nitrate respiration regulator) promotes the expression of the nir, the nor and the nos genes in the presence of nitric oxide (Castiglione et al., 2009). The recombinant bacterial cells of the disclosure may comprise any suitable RNS -responsive regulatory region from a gene that is activated by DNR. Genes that are capable of being activated by DNR are known in the art (see, e.g., Castiglione et al., 2009; Giardina et al., 2008). In certain embodiments, the recombinant bacterial cells of the disclosure comprise a RNS-inducible regulatory region from norCB that is operatively linked to a gene, genes or gene cassette, e.g., at least one payload or therapeutic gene, and/or one or more kill-switch component gene(s), e.g., an antitoxin gene, toxin gene and/or at least one recombinase gene, or other kill- switch component gene. In the presence of RNS, a DNR transcription factor senses RNS and activates to the norCB regulatory region, thereby driving expression of the operatively linked gene cassette and producing the cognate proteins. In some embodiments, the DNR is Pseudomonas aeruginosa DNR. [0296] In some embodiments, the tunable regulatory region is a RNS-derepressible regulatory region, and binding of a corresponding transcription factor represses downstream gene expression; in the presence of RNS, the transcription factor no longer binds to the regulatory region, thereby derepressing the operatively linked gene, gene, or gene cassette.

[0297] In some embodiments, the tunable regulatory region is a RNS-derepressible regulatory region, and the transcription factor that senses RNS is NsrR. NsrR is an Rrf2-type transcriptional repressor [that] can sense NO and control the expression of genes responsible for NO metabolism (Isabella et al., 2009). The recombinant bacterial cells of the disclosure may comprise any suitable RNS -responsive regulatory region from a gene that is repressed by NsrR. In some embodiments, the NsrR is Neisseria gonorrhoeae NsrR. Genes that are capable of being repressed by NsrR are known in the art (see, e.g., Isabella et al., 2009; Dunn et al., 2010). In certain embodiments, the recombinant bacterial cells of the disclosure comprise a RNS-derepressible regulatory region from norB that is operatively linked to a gene, genes or gene cassette, e.g., at least one payload or therapeutic gene, and/or one or more kill-switch component genes, e.g., an anti-toxin gene, toxin gene, and/or at least one recombinase gene or other kill-switch compoenent gene. In the presence of RNS, an NsrR transcription factor senses RNS and no longer binds to the norB regulatory region, thereby derepressing the operatively linked gene, genes, or gene cassette and producing the cognate protein(s).

[0298] In some embodiments, it is advantageous for the recombinant bacterial cells to express a RNS-sensing transcription factor that does not regulate the expression of a significant number of native genes in the bacteria. In some embodiments, the genetically engineered bacterium of the disclosure expresses a RNS-sensing transcription factor from a different species, strain, or substrain of bacteria, wherein the transcription factor does not bind to regulatory sequences in the genetically engineered bacterium of the disclosure. In some embodiments, the genetically engineered bacterium of the disclosure is Escherichia coli, and the RNS-sensing transcription factor is NsrR, e.g., from is Neisseria gonorrhoeae, wherein the Escherichia coli does not comprise binding sites for said NsrR. In some embodiments, the heterologous transcription factor minimizes or eliminates off-target effects on endogenous regulatory regions and genes in the recombinant bacterial cells.

[0299] In some embodiments, the tunable regulatory region is a RNS-repressible regulatory region, and binding of a corresponding transcription factor represses downstream gene expression; in the presence of RNS, the transcription factor senses RNS and binds to the RNS-repressible regulatory region, thereby repressing expression of the operatively linked gene or gene cassette. In some embodiments, the RNS-sensing transcription factor is capable of binding to a regulatory region that overlaps with part of the promoter sequence. In alternate embodiments, the RNS-sensing transcription factor is capable of binding to a regulatory region that is upstream or downstream of the promoter sequence.

[0300] In these embodiments, the genetically engineered bacteria may comprise a two repressor activation regulatory circuit, which is used to express a payload and/or one or more kill-switch components. The two repressor activation regulatory circuit comprises a first RNS-sensing repressor and a second repressor, which is operatively linked to a gene, gene(s), or gene cassettes for producing the payload(s) and/or one or more kill-switch components. In one aspect of these embodiments, the RNS-sensing repressor inhibits transcription of the second repressor, which inhibits the transcription of the gene, genes or gene cassette.

Examples of second repressors useful in these embodiments include, but are not limited to, TetR, CI, and LexA. In the absence of binding by the first repressor (which occurs in the absence of RNS), the second repressor is transcribed, which represses expression of the gene, genes, or gene cassettes. In the presence of binding by the first repressor (which occurs in the presence of RNS), expression of the second repressor is repressed, and the gene, gene(s), or gene cassettes for producing the payload(s) and/or one or more kill- switch components is expressed.

[0301] A RNS -responsive transcription factor may induce, derepress, or repress gene expression depending upon the regulatory region sequence used in the genetically engineered bacteria. One or more types of RNS-sensing transcription factors and corresponding regulatory region sequences may be present in genetically engineered bacteria. In some embodiments, the genetically engineered bacteria comprise one type of RNS-sensing transcription factor, e.g., NsrR, and one corresponding regulatory region sequence, e.g., from norB. In some embodiments, the genetically engineered bacteria comprise one type of RNS- sensing transcription factor, e.g., NsrR, and two or more different corresponding regulatory region sequences, e.g., from norB and aniA. In some embodiments, the genetically engineered bacteria comprise two or more types of RNS-sensing transcription factors, e.g., NsrR and NorR, and two or more corresponding regulatory region sequences, e.g., from norB and norR, respectively. One RNS -responsive regulatory region may be capable of binding more than one transcription factor. In some embodiments, the genetically engineered bacteria comprise two or more types of RNS-sensing transcription factors and one corresponding regulatory region sequence. Nucleic acid sequences of several RNS-regulated regulatory regions are known in the art (see, e.g., Spiro 2006; Isabella et al., 2009; Dunn et al., 2010; Vine et al., 2011; Karlinsey et al., 2012).

[0302] In some embodiments, the genetically engineered bacteria of the invention comprise a gene encoding a RNS-sensing transcription factor, e.g., the nsrR gene, that is controlled by its native promoter, an inducible promoter, a promoter that is stronger than the native promoter, e.g., the GlnRS promoter or the P(Bla) promoter, or a constitutive promoter. In some instances, it may be advantageous to express the RNS-sensing transcription factor under the control of an inducible promoter in order to enhance expression stability. In some embodiments, expression of the RNS-sensing transcription factor is controlled by a different promoter than the promoter that controls expression of the therapeutic molecule and/or kill- switch component. In some embodiments, expression of the RNS-sensing transcription factor is controlled by the same promoter that controls expression of the therapeutic molecule and/or kill-switch component. In some embodiments, the RNS-sensing transcription factor and therapeutic molecule and/or killswitch component are divergently transcribed from a promoter region.

[0303] In some embodiments, the recombinant bacterial cells of the disclosure comprise a gene for a RNS-sensing transcription factor from a different species, strain, or substrain of bacteria. In some embodiments, the recombinant bacterial cells comprise a RNS- responsive regulatory region from a different species, strain, or substrain of bacteria. In some embodiments, the recombinant bacterial cells comprise a RNS-sensing transcription factor and corresponding RNS -responsive regulatory region from a different species, strain, or substrain of bacteria. The heterologous RNS-sensing transcription factor and regulatory region may increase the transcription of genes operatively linked to said regulatory region in the presence of RNS, as compared to the native transcription factor and regulatory region from bacteria of the same subtype under the same conditions.

[0304] In some embodiments, the recombinant bacterial cells comprise a RNS- sensing transcription factor, NsrR, and corresponding regulatory region, nsrR, from Neisseria gonorrhoeae. In some embodiments, the native RNS-sensing transcription factor, e.g., NsrR, is left intact and retains wild-type activity. In alternate embodiments, the native RNS-sensing transcription factor, e.g., NsrR, is deleted or mutated to reduce or eliminate wild-type activity. [0305] In some embodiments, the recombinant bacterial cells of the disclosure comprise multiple copies of the endogenous gene encoding the RNS-sensing transcription factor, e.g., the nsrR gene. In some embodiments, the gene encoding the RNS-sensing transcription factor is present on a plasmid. In some embodiments, the gene encoding the RNS-sensing transcription factor and the gene, genes, or gene cassette for producing the heterologous gene are present on different plasmids. In some embodiments, the gene encoding the RNS-sensing transcription factor and the gene, genes, or gene cassette for producing the heterologous gene are present on the same plasmid. In some embodiments, the gene encoding the RNS-sensing transcription factor is present on a chromosome. In some embodiments, the gene encoding the RNS-sensing transcription factor and the gene, genes, or gene cassette for producing the heterologous gene are present on different chromosomes. In some embodiments, the gene encoding the RNS-sensing transcription factor and the gene, genes, or gene cassette for producing the heterologous gene are present on the same chromosome.

[0306] In some embodiments, the recombinant bacterial cells comprise a wild-type gene encoding a RNS-sensing transcription factor, e.g., the NsrR gene, and a corresponding regulatory region, e.g., a norB regulatory region, that is mutated relative to the wild-type regulatory region from bacteria of the same subtype. The mutated regulatory region increases the expression of the at least one heterologous gene, e.g., payload or therapeutic gene, and/or one or more kill-switch component genes, e.g., an anti-toxin gene, toxin gene, and/or at least one recombinase gene or other kill- switch component gene in the presence of RNS, as compared to the wild-type regulatory region under the same conditions. In some

embodiments, the recombinant bacterial cells comprise a wild-type RNS -responsive regulatory region, e.g., the norB regulatory region, and a corresponding transcription factor, e.g., NsrR, that is mutated relative to the wild-type transcription factor from bacteria of the same subtype. The mutant transcription factor increases the expression of the payload molecule in the presence of RNS, as compared to the wild-type transcription factor under the same conditions. In some embodiments, both the RNS-sensing transcription factor and corresponding regulatory region are mutated relative to the wild-type sequences from bacteria of the same subtype in order to increase expression of the apayload molecule in the presence of RNS.

[0307] In some embodiments, the gene, genes or gene cassette for producing the anti- inflammation and/or gut barrier function enhancer molecule is present on a plasmid and operably linked to a promoter that is induced by RNS. In some embodiments, expression is further optimized by methods known in the art, e.g., by optimizing ribosomal binding sites, manipulating transcriptional regulators, and/or increasing mRNA stability.

[0308] In some embodiments, any of the gene(s) of the present disclosure may be integrated into the bacterial chromosome at one or more integration sites. For example, one or more copies of a payload(s) and/or kill-switch component(s) may be integrated into the bacterial chromosome. Having multiple copies of the gene or gene(s) integrated into the chromosome allows for greater production of the payload and/or kill-switch component and also permits fine-tuning of the level of expression. Alternatively, different circuits described herein, such as any of the secretion or exporter circuits, in addition to the therapeutic gene(s) or gene cassette(s) could be integrated into the bacterial chromosome at one or more different integration sites to perform multiple different functions.

[0309] Thus, in some embodiments, the genetically engineered bacteria or genetically engineered virus produce one or more amino acid catabolism enzymes under the control of an oxygen level-dependent promoter, a reactive oxygen species (ROS)-dependent promoter, or a reactive nitrogen species (RNS)-dependent promoter, and a corresponding transcription factor.

D. Arabinose Inducible Promoters

[0310] In other kill- switch circuits exemplified herein, a toxin is produced in the presence of an environmental factor or signal. In another aspect of kill- switch circuitry, a toxin may be repressed in the presence of an environmental factor (not produced) and then produced once the environmental factor is no longer present. Such kill switches are called repression-based kill switches and represent systems in which bacterial cells are viable only in the presence of an external factor or signal, such as arabinose or other sugar. Exemplary kill switch designs in which the toxin is repressed in the presence of an external factor or signal (and activated once the external signal is removed) is shown in Figures 1-3. The disclosure provides engineered bacterial cells which express one or more heterologous gene(s), e.g., payload or therapeutic gene, upon sensing arabinose or other sugar in the exogenous environment. In this aspect, the recombinant bacterial cells contain the araC gene, which encodes the AraC transcription factor, as well as one or more genes under the control of the araBAD promoter. In the absence of arabinose, the AraC transcription factor adopts a conformation that represses transcription of genes under the control of the araBAD promoter. In the presence of arabinose, the AraC transcription factor undergoes a conformational change that allows it to bind to and activate the AraBAD promoter, which induces expression of the desired gene. In some embodiments, in which the engineerd bacterial cell comprises kill-switch circuitry, in the presence of arabinose, the AraC transcription factor undergoes a conformational change that allows it to bind to and activate the AraBAD promoter, which induces expression of a kill-switch component genefor example, a repressor, such as tetR, which represses expression of another kill-switch component gene, for example, a toxin gene. Thus, in this embodiment, the toxin gene is repressed in the presence of arabinose or other sugar (by, e.g., tetR), and is not made. In an environment where arabinose is not present, the tetR gene is not activated and the toxin is expressed, thereby killing the bacteria. In some embodiments, the bacterial cell comprises one or more additional kill-switch components, e.g., a gene encoding an anti-toxin. In some embodiments, in the presence of arabinose, the AraC transcription factor undergoes a conformational change that allows it to bind to and activate the AraBAD promoter, which induces expression of one or more kill-switch component gene(s), for example, a repressor, such as tetR, which represses expression of a toxin gene and an anti-toxin. Thus, in this embodiment, the toxin gene is repressed in the presence of arabinose or other sugar (by, e.g., tetR), and is not made and the anti-toxin gene is expressed and therefore produced. In an environment where arabinose is not present, the tetR gene is not activated and the toxin is expressed, and also the anti-toxin is no longer made and can not neutralize the expressed toxin, resulting in the death of the bacteria. In some embodiments, the anti-toxin is produced under the control of a constitutive promoter.

[0311] The arabinose system can also be used to express an essential gene, in which the essential gene is only expressed in the presence of arabinose or other sugar and is not expressed when arabinose or other sugar is absent from the environment.

[0312] Thus, in some embodiments in which one or more heterologous gene(s) are expressed upon sensing arabinose in the exogenous environment, the one or more

heterologous genes are directly or indirectly under the control of the araBAD promoter. In some embodiments, the expressed heterologous gene is selected from one or more of the following: a therapeutic gene, a gene encoding an antitoxin, a gene encoding an toxin, a gene encoding a repressor protein or polypeptide, for example, a TetR repressor, a gene encoding a recombinase, a gene encoding an essential protein not found in the bacterial cell, and/or a gene encoding a regulatory protein or polypeptide. [0313] Arabinose inducible promoters are known in the art, including Para, ParaB, ParaC, and ParaBAD. In one embodiment, the arabinose inducible promoter is from E. coli. In some embodiments, the ParaC promoter and the ParaBAD promoter operate as a bidirectional promoter, with the ParaBAD promoter controlling expression of a heterologous gene(s) in one direction, and the ParaC (in close proximity to, and on the opposite strand from the ParaBAD promoter), controlling expression of a heterologous gene(s) in the other direction. In the presence of arabinose, transcription of both heterologous genes from both promoters is induced. However, in the absence of arabinose, transcription of both

heterologous genes from both promoters is not induced.

[0314] In one exemplary embodiment of the disclosure, the recombinant bacterial cell contains a kill-switch having at least the following sequences: a ParaBAD promoter operably linked to a heterologous gene encoding a repressor protein, e.g., a Tetracycline Repressor Protein (TetR), a ParaC promoter operably linked to a heterologous gene encoding AraC transcription factor, and a heterologous gene encoding a bacterial toxin operably linked to a promoter which is repressed by the repressor, e.g., Tetracycline Repressor Protein (PTetR). In the presence of arabinose, the AraC transcription factor activates the ParaBAD promoter, which activates transcription of the TetR protein which, in turn, represses transcription of the toxin. In the absence of arabinose, however, AraC suppresses transcription from the

ParaBAD promoter and no TetR protein is expressed. In this case, expression of the heterologous toxin gene is activated, and the toxin is expressed. The toxin builds up in the recombinant bacterial cell, and the recombinant bacterial cell is killed.

[0315] In one embodiment of the disclosure, the engineered bacterial cell further comprises an antitoxin under the control of a constitutive promoter.In this situation, in the presence of arabinose, the toxin is not expressed due to repression by TetR protein, and the antitoxin protein is expressed and builds-up in the cell. However, in the absence of arabinose, TetR protein is not expressed, and expression of the toxin is induced. The toxin begins to build-up within the engineered bacterial cell. The bacterial cell is no longer viable once the toxin protein is present at either equal or greater amounts than that of the anti-toxin protein in the cell, and the bacterial cell will be killed by the toxin. See, for example, Figure 1.

[0316] In another embodiment of the disclosure, the engineered bacterial cell further comprises an antitoxin under the control of the ParaBAD promoter. In this situation, in the presence of arabinose, TetR and the anti-toxin are expressed, the anti-toxin builds up in the cell, and the toxin is not expressed due to repression by TetR protein. However, in the absence of arabinose, both the TetR protein and the anti-toxin are not expressed, and expression of the toxin is induced. The toxin begins to build-up within the engineered bacterial cell. The bacterial cell is no longer viable once the toxin protein is expressed, and the bacterial cell will be killed by the toxin. See, for example, Figure 1-3.

[0317] In another exemplary embodiment of the disclosure, the recombinant bacterial cell contains a kill-switch having at least the following sequences: a ParaBAD promoter operably linked to a heterologous gene encoding an essential polypeptide not found in the recombinant bacterial cell (and required for survival), and a ParaC promoter operably linked to a heterologous gene encoding AraC transcription factor. In the presence of arabinose, the AraC transcription factor activates the ParaBAD promoter, which activates transcription of the heterologous gene encoding the essential polypeptide, allowing the recombinant bacterial cell to survive. In the absence of arabinose, however, AraC suppresses transcription from the ParaBAD promoter and the essential protein required for survival is not expressed. In this case, the recombinant bacterial cell dies in the absence of arabinose. In some embodiments, the sequence of ParaBAD promoter operably linked to a heterologous gene encoding an essential polypeptide not found in the recombinant bacterial cell can be present in the bacterial cell in conjunction with the TetR/toxin kill- switch system described directly above. In some embodiments, the sequence of ParaBAD promoter operably linked to a heterologous gene encoding an essential polypeptide not found in the recombinant bacterial cell can be present in the bacterial cell in conjunction with the TetR/toxin/anti- toxin kill- switch system described directly above. In any of the above-described embodiments, the recombinant bacterial cell further comprises a heterologous gene encoding one or more therapeutic polypeptides, which may be under the control of the araBAD promoter or a different inducible promoter.

[0318] In yet other embodiments, the bacteria may comprise a plasmid stability system with a plasmid that produces both a short-lived anti-toxin and a long-lived toxin. In this system, the bacterial cell produces equal amounts of toxin and anti-toxin to neutralize the toxin. However, if/when the cell loses the plasmid, the short-lived anti-toxin begins to decay. When the anti-toxin decays completely the cell dies as a result of the longer- lived toxin killing it.

[0319] Many other examples of inducible promoters are known in the art and would be understood to be encompassed by the present disclosure. [0320] In some embodiments, the genetically engineered bacteria comprise a stably maintained plasmid or chromosome carrying a gene, gene(s), or gene cassettes for producing the therapeutic molecule(s) and/or kill-switch component(s) such that the gene, gene(s), or gene cassettes for producing the therapeutic molecule(s) and/or kill-switch component(s) can be expressed in the host cell, and the host cell is capable of survival and/or growth in vitro, e.g., in medium, and/or in vivo. In some embodiments, a bacterium may comprise multiple copies of the gene, gene(s), or gene cassettes for producing the therapeutic molecule(s) and/or kill-switch component(s). In some embodiments, the gene, gene(s), or gene cassettes for producing the therapeutic molecule(s) and/or kill-switch component(s) is expressed on a low- copy plasmid. In some embodiments, the low-copy plasmid may be useful for increasing stability of expression. In some embodiments, the low-copy plasmid may be useful for decreasing leaky expression under non-inducing conditions. In some embodiments, the gene, gene(s), or gene cassettes for producing the therapeutic molecule(s) and/or kill-switch component(s) is expressed on a high-copy plasmid. In some embodiments, the high-copy plasmid may be useful for increasing expression of the gene, gene(s), or gene cassettes for producing the therapeutic molecule(s) and/or kill-switch component(s). In some

embodiments, the gene, gene(s), or gene cassettes for producing the therapeutic molecule(s) and/or kill-switch component(s) is expressed on a chromosome.

[0321] In some embodiments, the bacteria are genetically engineered to include multiple mechanisms of action (MOAs), e.g., circuits producing multiple copies of the same product (e.g., to enhance copy number) or circuits performing multiple different functions. For example, the genetically engineered bacteria may include four copies of the gene, gene(s), or gene cassettes for producing the therapeutic molecule(s) and/or kill-switch component(s) inserted at four different insertion sites. Alternatively, the genetically engineered bacteria may include three copies of the gene, gene(s), or gene cassettes for producing the therapeutic molecule(s) and/or kill-switch component(s) inserted at three different insertion sites and three copies of the gene, gene(s), or gene cassettes for producing the therapeutic molecule(s) and/or kill- switch component(s) inserted at three different insertion sites.

[0322] In some embodiments, under conditions where the gene, gene(s), or gene cassettes for producing the therapeutic molecule(s) and/or kill-switch component(s) is expressed, the genetically engineered bacteria of the disclosure produce at least about 1.5- fold, at least about 2-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 30-fold, at least about 50-fold, at least about 100-fold, at least about 200-fold, at least about 300-fold, at least about 400-fold, at least about 500-fold, at least about 600-fold, at least about 700-fold, at least about 800- fold, at least about 900- fold, at least about 1, 000- fold, or at least about 1, 500-fold more of the therapeutic molecule(s) and/or kill-switch component(s) as compared to unmodified bacteria of the same subtype under the same conditions.

[0323] In some embodiments, quantitative PCR (qPCR) is used to amplify, detect, and/or quantify mRNA expression levels of the gene, gene(s), or gene cassettes for producing the therapeutic molecule(s) and/or kill- switch component(s). Primers may be designed and used to detect mRNA in a sample according to methods known in the art. In some embodiments, a fluorophore is added to a sample reaction mixture that may contain payload RNA, and a thermal cycler is used to illuminate the sample reaction mixture with a specific wavelength of light and detect the subsequent emission by the fluorophore. The reaction mixture is heated and cooled to predetermined temperatures for predetermined time periods. In certain embodiments, the heating and cooling is repeated for a predetermined number of cycles. In some embodiments, the reaction mixture is heated and cooled to 90-100° C, 60- 70° C, and 30-50° C for a predetermined number of cycles. In a certain embodiment, the reaction mixture is heated and cooled to 93-97° C, 55-65° C, and 35-45° C for a

predetermined number of cycles. In some embodiments, the accumulating amplicon is quantified after each cycle of the qPCR. The number of cycles at which fluorescence exceeds the threshold is the threshold cycle (CT). At least one CT result for each sample is generated, and the CT result(s) may be used to determine mRNA expression levels of the payload(s).

[0324] In some embodiments, quantitative PCR (qPCR) is used to amplify, detect, and/or quantify mRNA expression levels of the therapeutic molecule(s) and/or kill- switch component(s). Primers may be designed and used to detect mRNA in a sample according to methods known in the art. In some embodiments, a fluorophore is added to a sample reaction mixture that may contain payload mRNA, and a thermal cycler is used to illuminate the sample reaction mixture with a specific wavelength of light and detect the subsequent emission by the fluorophore. The reaction mixture is heated and cooled to predetermined temperatures for predetermined time periods. In certain embodiments, the heating and cooling is repeated for a predetermined number of cycles. In some embodiments, the reaction mixture is heated and cooled to 90-100° C, 60-70° C, and 30-50° C for a predetermined number of cycles. In a certain embodiment, the reaction mixture is heated and cooled to 93- 97° C, 55-65° C, and 35-45° C for a predetermined number of cycles. In some embodiments, the accumulating amplicon is quantified after each cycle of the qPCR. The number of cycles at which fluorescence exceeds the threshold is the threshold cycle (CT). At least one CT result for each sample is generated, and the CT result(s) may be used to determine mRNA expression levels of the therapeutic molecule(s) and/or kill-switch component(s).

Recombinase s

[0325] In one aspect, the disclosure provides recombinant bacterial cells which express a heterologous gene, such as a heterologous therapeutic gene, and a first recombinase gene upon sensing an exogenous environmental condition and/or signal. The heterologous gene and the first recombinase gene are both under the control of an inducible promoter which may be the same or different. In some embodiments, the heterologous gene and the first recombinase gene are each individually under the control of the same inducible promoter (each gene has its own promoter). In some embodiments, the heterologous gene and the first recombinase gene are both under the control of the same inducible promoter (both genes have one promoter). In embodiments in which both genes are under the control of a single promoter, the first gene may have a termination signal. In some embodiments, the heterologous gene and the first recombinase gene are each individually under the control of a different inducible promoter (each gene has its own promoter). Once the first recombinase is expressed, the recombinase flips one or more inverted gene(s) in the recombinant bacterial cell, so that the gene(s) is then expressed. The flipped gene(s) may be under the control of an inducible promoter or a constitutive promoter. In some embodiments, the flipped gene is under the control of a constitutive promoter so that its expression remains constant. In some embodiments, the recombinase flips two or more inverted genes. In some embodiments, the one or more inverted gene(s) that is flipped by the recombinase is a bacterial toxin gene(s), for example, any of, but not limited to, the toxin genes provided herein. See Figure 1. After the recombinase event is completed, the level of toxin(s) builds up inside the recombinant bacterial cell and ultimately kills the recombinant bacterial cell. In some embodiments, the one or more inverted gene(s) that is flipped is an excision enzyme gene(s). After the recombinase event is completed, the excision enzyme(s) functions to excise one or more essential bacterial gene(s), ultimately killing the recombinant bacterial cell. See Figure 5.

[0326] Such programmed or engineered recombinant bacterial cells comprising the described inducible recombination event allows the design of recombinant bacterial cells which express a heterologous gene, such as a heterologous therapeutic gene, that are ultimately killed following expression of the therapeutic gene. The recombinant bacterial cells are killed or are non- viable after a certain amount of time, which is controllable, as discussed herein. For example, the recombinant bacterial cells are killed or are non-viable after the at least one recombination event occurs, and the inverted gene(s) encoding a polypeptide(s) that affects viability is expressed. Thus, the presently disclosed bacteria prevent the unintentional or uncontrolled spread of the recombinant bacterial strain after the heterologous gene is expressed. In other words, once the recombinant bacterial cell of the disclosure expresses the heterologous gene and the recombinase, the bacterial cell is no longer viable, and it is only a matter of time before the recombinant bacterial cell dies.

[0327] It is important that the recombinant bacteria engineered with one or more kill- switch component(s) remain viable long enough to have a therapeutic effect (e.g., long enough to express a sufficient amount of therapeutic protein and/or long enough to deliver the therapeutic protein to the desired target tissue). It is possible to extend the length of time the recombinant bacteria remain viable by engineering a series of multiple recombination events to take place within the bacterial cells. The greater the number of recombination events, the longer the recombinant bacterial cell will remain viable (the longer the death of the bacterial cell is delayed). Thus, in some embodiments, the disclosure provides recombinant bacterial cells which express a heterologous gene, such as a heterologous therapeutic gene, and more than one recombinase gene. In some embodiments, the disclosure provides recombinant bacterial cells which express a heterologous gene, such as a heterologous therapeutic gene, and two, three, four, five, six, seven, eight, nine, ten or more recombinase genes.

[0328] In some embodiments, the recombinant bacterial cells express a heterologous gene, such as a heterologous therapeutic gene, and two recombinase genes, the first of which is in the proper orientation for expression and the second of which is in an inverted orientation. The recombinant bacterial cells express a heterologous gene and the first recombinase gene upon sensing an exogenous environmental condition. The heterologous gene and the first recombinase gene are both under the control of an inducible promoter which may be the same or different. In some embodiments, the heterologous gene and the first recombinase gene are each individually under the control of the same inducible promoter. In some embodiments, the heterologous gene and the first recombinase gene are both under the control of the same inducible promoter. In embodiments in which both genes are under the control of a single promoter, the first gene may have a termination signal. In some embodiments, the heterologous gene and the first recombinase gene are each individually under the control of a different inducible promoter. Once the first recombinase is expressed, the recombinase flips the inverted second recombinase gene in the recombinant bacterial cell, so that the second recombinase is then expressed. The flipped second recombinase gene may be under the control of an inducible promoter or a constitutive promoter. In some embodiments, the flipped second recombinase gene is under the control of a constitutive promoter so that its expression remains constant. After the second recombinase is expressed, the second recombinase flips one or more inverted genes. In some

embodiments, the one or more flipped gene(s) is under the control of a constitutive promoter so that its expression remains constant. In some embodiments, the one or more inverted gene(s) that is flipped by the second recombinase is a bacterial toxin gene(s) whose protein product is capable of killing the bacterial cells, for example, any of, but not limited to, the toxin genes provided herein. See Figure 2. In some embodiments, the one or more inverted gene(s) that is flipped by the second recombinase is an excision enzyme gene(s), whose protein product is capable of excising an essential gene(s) of the bacterial cells, leading to their demise.

[0329] In some embodiments, the recombinant bacterial cells express a heterologous gene, such as a heterologous therapeutic gene, and three recombinase genes, the first of which is in the proper orientation for expression and the second and third of which are in an inverted orientation. The recombinant bacterial cells express a heterologous gene and the first recombinase upon sensing an exogenous environmental condition. The heterologous gene and the first recombinase gene are both under the control of an inducible promoter which may be the same or different. In some embodiments, the heterologous gene and the first recombinase gene are each individually under the control of the same inducible promoter. In some embodiments, the heterologous gene and the first recombinase gene are both under the control of the same inducible promoter. In embodiments in which both genes are under the control of a single promoter, the first gene may have a termination signal. In some embodiments, the heterologous gene and the first recombinase gene are each individually under the control of a different inducible promoter. Once the first recombinase is expressed, the recombinase flips the inverted second recombinase gene in the recombinant bacterial cell, so that the second recombinase is then expressed. The flipped second recombinase gene may be under the control of an inducible promoter or a constitutive promoter. In some embodiments, the flipped second recombinase gene is under the control of a constitutive promoter so that its expression remains constant. After the second recombinase is expressed, the second recombinase flips the inverted third recombinase gene in the recombinant bacterial cell, so that the third recombinase is then expressed. The flipped third recombinase gene may be under the control of an inducible promoter or a constitutive promoter. In some embodiments, the flipped third recombinase gene is under the control of a constitutive promoter so that its expression remains constant. After the third recombinase is expressed, the third recombinase flips one or more inverted genes. In some embodiments, the one or more flipped gene(s) is under the control of a constitutive promoter so that its expression remains constant. In some embodiments, the one or more inverted gene(s) that is flipped by the second recombinase is a bacterial toxin gene(s) whose protein product is capable of killing the bacterial cells, for example, any of, but not limited to, the toxin genes provided herein. In some embodiments, the one or more inverted gene(s) that is flipped by the second recombinase is an excision enzyme gene(s), whose protein product is capable of excising an essential gene(s) of the bacterial cells, leading to their demise.

[0330] Engineering the recombinant bacterial cells to undergo a series of

recombination events, i.e., more than one recombination event, allows the recombinant bacterial cells to remain viable for a longer period of time, permitting expression of a heterologous gene, such as a heterologous therapeutic gene, before they are killed. That is, the bacterial cells are killed after a time delay, i.e., after the at least three recombination events occur, and the polypeptide capable of killing the bacteria (e.g., a toxin or excision protein) is expressed. Thus, the present disclosure prevents the unintentional or uncontrolled spread of the recombinant bacterial strain after the therapeutic is produced and delivered. The use of recombinant bacteria engineered to have multiple recombinases allows for the control or "fine-tuning" of the length of time before the toxic protein (e.g., toxin, excision protein or other protein which effects cell death) is expressed to kill the recombinant bacterial cell. Thus, shorter time delays can be engineered using, for example, two recombinases, while longer time delays can be engineered using, for example, three or more recombinases. In one embodiment of the disclosure, the recombinant bacterial cells of the disclosure comprise at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten recombinases that are serially expressed. In another embodiment of the disclosure, the recombinant bacterial cells of the disclosure comprise at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30

recombinases that are serially expressed. As used herein "serially expressed," refers to the expression of recombinases one after the other. In some embodiments, expression of a first recombinase is induced, which flips a second inverted recombinase gene so that the second recombinase is constitutively expressed. The second recombinase may then, for example, flip a third inverted recombinase gene so that the third recombinase is constitutively expressed, and so on in the same manner. The advantages of the use of recombinases that mediate site-specific inversion for use in the various aspects of the disclosure include the binary dynamics, the sensitivity of the output, the efficiency of DNA usage, and the persistence of the DNA modification.

[0331] In any of the above-described embodiments in this section, the recombinant bacteria may also comprise one or more heterologous genes encoding one or more antitoxins. In some embodiments, the heterologous gene encoding the anti-toxin is under the control of a constitutive promoter. In some embodiments, the heterologous gene encoding the anti-toxin is under the control of an inducible promoter. In some embodiments, the heterologous gene encoding the anti-toxin is under the control of an inducible promoter that is the same as the inducible promoter driving expression of the heterologous therapeutic gene. In some embodiments, the heterologous gene encoding the anti-toxin is under the control of an inducible promoter that is different from the inducible promoter driving expression of the heterologous therapeutic gene. In some embodiments, the heterologous gene encoding the anti-toxin is under the control of an inducible promoter that is the same as the inducible promoter driving expression of the heterologous gene(s) encoding one or more of the other components of the kill- switch, for example, the one or more recombinase(s). In some embodiments, the heterologous gene encoding the anti-toxin is under the control of an inducible promoter that is different from the inducible promoter driving expression of the heterologous gene(s) encoding one or more of the other components of the kill- switch, for example, the one or more recombinase(s). In some embodiments, the heterologous gene encoding the anti-toxin is under the control of an inducible promoter that is the same as the inducible promoter driving expression of the heterologous therapeutic gene and the heterologous gene(s) encoding one or more of the other components of the kill- switch, for example, the one or more recombinase(s). In some embodiments, the heterologous gene encoding the anti-toxin is under the control of an inducible promoter that is different from the inducible promoter driving expression of the heterologous therapeutic gene and different from the inducible promoter driving expression of the heterologous gene(s) encoding one or more of the other components of the kill- switch, for example, the one or more recombinase(s).

[0332] A "recombinase", as defined herein, is a site-specific enzyme that recognizes short DNA sequence(s), which are typically between about 30 bp and 40 bp, and mediates the recombination between these recombinase recognition sequences that results in the excision, integration, inversion, or exchange of DNA fragments. In the embodiments described above, the inverted sequence to be flipped (e.g., toxin gene, excision gene, recombinase gene, etc.) contains a forward recognition site and a reverse recognition site on either end of the gene sequence.

[0333] Recombinases can be classified into two distinct families, the integrase and invertase/resolvase families, based on distinct biochemical properties. Members of the integrase family cleave one strand of each of the two DNA molecules involved, then exchange this strand, and subsequently cleave the second DNA strand. Integrase family recombinases use a conserved tyrosine residue to establish a transient covalent bond between the recombinase and the target DNA. Members of the invertase/resolvase family of recombinases cleave all 4 DNA strands and then exchange them, and initiate DNA cleavage by utilizing a serine residue as the catalytic residue. Recombinases have been used for numerous standard biological applications, including the creation of gene knockouts and the solving of sorting problems (N. J. Kilby, Trends Genet. 9, 413 (December, 1993); K. A. Haynes, J Biol Eng 2, 8 (2008); T. S. Ham, Biotechnol Bioeng 94, 1 (2006); K. A. Datsenko, Proc Natl Acad Sci USA 97, 6640 (2000)).

[0334] Upon recombinase expression following activation of an upstream inducible promoter, the recombinase causes a single inversion of the DNA between its cognate recognition sites (i.e., its forward recombinase recognition site and its reverse recombinase recognition site). Inversion recombination happens between two short inverted repeated DNA sequences, typically less than 30 bp long. The recombinases bind to these inverted repeated sequences, which are specific to each recombinase, and are defined herein as "recombinase recognition sequences" or "recombinase recognition sites." Thus, as used herein, a recombinase is "specific for" a recombinase recognition sequence when the recombinase can mediate an inversion between the inverted repeat DNA sequences. As used herein, a recombinase can also be said to recognize its "cognate recombinase recognition sites." A DNA loop formation, assisted by DNA bending proteins, brings the two repeat sequences together, at which point DNA cleavage and ligation occur. This reaction is ATP independent and requires supercoiled DNA. The end result of such an inversion recombination event is that the stretch of DNA between the repeated site inverts, i.e., the stretch of DNA reverses orientation, such that what was the coding strand is now the non- coding strand and vice versa. In such reactions, the DNA is conserved with no net gain or no loss of DNA.

[0335] The recombinases provided herein are not meant to be an exclusive listing. Other examples of recombinases that are useful are known to those of skill in the art.

[0336] In one embodiment, the recombinase is Bxbl, PhiC31, TP901, Bxbl, PhiC31, TP901, HK022, HP1, R4, Intl, Int2, Int3, Int4, Int5, Int6, Int7, Int8, Int9, IntlO, Intl l, Intl2, Intl3, Intl4, Intl5, Intl6, Intl7, Intl8, Intl9, Int20, Int21, Int22, Int23, Int24, Int25, Int26, Int27, Int28, Int29, Int30, Int31, Int32, Int33, and Int34, or a biologically active fragment thereof. In one embodiment, the recombinase is Bxbl, or a biologically active fragment thereof. In one embodiment, the recombinase is PhiC31, or a biologically active fragment thereof. In one embodiment, the recombinase is TP901, or a biologically active fragment thereof. In one embodiment, the recombinase is Bxbl, or a biologically active fragment thereof. In one embodiment, the recombinase is PhiC31, or a biologically active fragment thereof. In one embodiment, the recombinase is TP901, or a biologically active fragment thereof. In one embodiment, the recombinase is HK022, or a biologically active fragment thereof. In one embodiment, the recombinase is HP1, or a biologically active fragment thereof. In one embodiment, the recombinase is R4, or a biologically active fragment thereof. In one embodiment, the recombinase is Intl, or a biologically active fragment thereof. In one embodiment, the recombinase is Int2, or a biologically active fragment thereof. In one embodiment, the recombinase is Int3, or a biologically active fragment thereof. In one embodiment, the recombinase is Int4, or a biologically active fragment thereof. In one embodiment, the recombinase is Int5, or a biologically active fragment thereof. In one embodiment, the recombinase is Int6, or a biologically active fragment thereof. In one embodiment, the recombinase is Int7, or a biologically active fragment thereof. In one embodiment, the recombinase is Int8, or a biologically active fragment thereof. In one embodiment, the recombinase is Int9, or a biologically active fragment thereof. In one embodiment, the recombinase is IntlO, or a biologically active fragment thereof. In one embodiment, the recombinase is Intl 1, or a biologically active fragment thereof. In one embodiment, the recombinase is Intl2, or a biologically active fragment thereof. In one embodiment, the recombinase is Intl 3, or a biologically active fragment thereof. In one embodiment, the recombinase is Intl4, or a biological iy acl tive fragment thereof. In one embodiment, the recombinase is Intl5, or a biological iy acl tive fragment thereof. In one embodiment, the recombinase is Intl6, or a biological iy acl tive fragment thereof. In one embodiment, the recombinase is Intl7, or a biological iy acl tive fragment thereof. In one embodiment, the recombinase is Intl8, or a biological iy acl tive fragment thereof. In one embodiment, the recombinase is Intl9, or a biological iy acl tive fragment thereof. In one embodiment, the recombinase is Int20, or a biological iy acl tive fragment thereof. In one embodiment, the recombinase is Int21, or a biological iy acl tive fragment thereof. In one embodiment, the recombinase is Int22, or a biological iy acl tive fragment thereof. In one embodiment, the recombinase is Int23, or a biological iy acl tive fragment thereof. In one embodiment, the recombinase is Int24, or a biological iy acl tive fragment thereof. In one embodiment, the recombinase is Int25, or a biological iy acl tive fragment thereof. In one embodiment, the recombinase is Int26, or a biological iy acl tive fragment thereof. In one embodiment, the recombinase is Int27, or a biological iy acl tive fragment thereof. In one embodiment, the recombinase is Int28, or a biological iy acl tive fragment thereof. In one embodiment, the recombinase is Int29, or a biological iy acl tive fragment thereof. In one embodiment, the recombinase is Int30, or a biological iy acl tive fragment thereof. In one embodiment, the recombinase is Int31, or a biological iy acl tive fragment thereof. In one embodiment, the recombinase is Int32, or a biological iy acl tive fragment thereof. In one embodiment, the recombinase is Int33, or a biological iy acl tive fragment thereof. In one embodiment, the recombinase is Int34, or a biological iy acl tive fragment thereof.

[0337] In other embodiments, the recombinase comprises the sequence of Cre recombinase of Pubmed Gene ID #277747, and the corresponding loxP recombinase recognition sequences, which are known in the art. In some embodiments, the recombinase is Flp recombinase comprising the sequences of GenBank ID U46493 or NC_001398. In another embodiment, the recombinase is an enhanced Flp recombinase as described at least in U.S. Patent No. 8,645,115, the entire contents of which are expressly incorporated herein by reference. In some embodiments, minimal FRT recombinase recognition sites are used. In some embodiments, the recombinase is R recombinase comprising the sequence of GenBank ID # X02398 and the corresponding recombinase recognition sequence. In some

embodiments, the recombinase comprises the bidirectional FimB recombinase of GenelD: 948832 and the corresponding recombinase recognition sequences. In some embodiments, the recombinase is the unidirectional FimE recombinase of GenelD: 948836 and the corresponding recombinase recognition sequences. In some embodiments, the recombinase is an Int recombinase. In some embodiments, the Int recombinase comprises a sequence that encodes for an Int recombinase selected from the group consisting of intE, HP1 Int, and HK022 Int. In some embodiments, the recombinase is the XerC/XerD recombinase comprising the sequence of GenelD: 5387246 and the corresponding recombinase recognition sequences comprise cer and dif. In one embodiment, the recombinase is

Salmonella Hin recombinase comprising the sequence of GenelD: 1254295 and the corresponding recombinase recognition sequences comprise hixL and hixR.

[0338] In another embodiment, a recombinase of the disclosure is the Cre protein, which catalyzes the cleavage of the lox site within the spacer region and creates a six base- pair staggered cut (Hoess and Abremski (1985) J. Mol. Biol. 181:351). Two 13 bp inverted repeat domains of the lox site represent binding sites for the Cre protein. If two lox sites differ in their spacer regions in such a manner that the overhanging ends of the cleaved DNA cannot reanneal with one another, Cre cannot efficiently catalyze a recombination event using the two different lox sites. For example, it has been reported that Cre cannot recombine (at least not efficiently) a loxP site and a loxP511 site; these two lox sites differ in the spacer region. Two lox sites which differ due to variations in the binding sites (i.e., the 13 bp inverted repeats) may be recombined by Cre provided that Cre can bind to each of the variant binding sites; the efficiency of the reaction between two different lox sites (varying in the binding sites) may be less efficient that between two lox sites having the same sequence (the efficiency will depend on the degree and the location of the variations in the binding sites). For example, the loxC2 site can be efficiently recombined with the loxP site; these two lox sites differ by a single nucleotide in the left binding site. Cre also recognizes a number of variant or mutant lox sites (variant relative to the loxP sequence), including the loxB, loxL, loxR, loxA86, and 1οχΔ117 sites which are found in the E. coli chromosome (Hoess et al. (1982)), as well as loxP511; (Hoess et al. (1986)), loxC2 (U.S. Pat. No. 4,959,317), lox66, lox 71, and lox BBa_J61046.

[0339] Other alternative site-specific recombinases include the FLP recombinase of the 2 pi plasmid of Saccharomyces cerevisiae (Cox (1983), Proc. Natl. Acad. Sci. USA 80:4223) which recognize the frt site which, like the loxP site, comprises two 13 bp inverted repeats separated by an 8 bp spacer. The FLP gene has been cloned and expressed in E. coli (Cox, supra) and in mammalian cells (PCT International Patent Application

PCT/US92/01899, Publication No.: WO 92/15694, the entire contents of which are hereby incorporated by reference); the integrase of Streptomyces phage PHI C31 that carries out efficient recombination between the attP site of the phage genome and the attB site of the host chromosome (Groth et al., 2000 Proc. Natl. Acad. Sci. USA, 97: 5995); the Int recombinase of bacteriophage lambda (lambda- int/attP) (with or without Xis) which recognizes att sites (Weisberg et al. In: Lambda II, supra, pp. 211-250); the xerC and xerD recombinases of E. coli which together form a recombinase that recognizes the 28 bp dif site (Leslie and Sherratt (1995) EMBO J. 14: 1561); the Int protein from the conjugative transposon Tn916 (Lu and Churchward (1994) EMBO J. 13: 1541); Tpnl and the β-lactamase transposons (Levesque (1990) J. Bacteriol. 172:3745); the Tn3 resolvase (Flanagan et al. (1989) J. Mol. Biol. 206:295 and Stark et al. (1989) Cell 58:779); the SpoIVC recombinase of Bacillus subtilis (Sato et al. J. Bacteriol. 172: 1092); the Hin recombinase (Galsgow et al. (1989) J. Biol. Chem. 264: 10072); the Cin recombinase (Hafter et al. (1988) EMBO J.

7:3991); the immunoglobulin recombinases (Malynn et al. Cell (1988) 54:453); and the FIMB and FIME recombinases (Blomfield et al., 1997 Mol. Microbiol. 23:705).

[0340] A recombinase of the disclosure may also be the Hin DNA recombinase. In Salmonella, the Hin DNA recombinase (BBa_J31000, BBa_J31001) catalyzes an inversion reaction that regulates the expression of alternative flagellin genes by switching the orientation of a promoter located on a 1 kb invertible DNA segment. The asymmetrical palindromic sequences hixL and hixR flank the invertible DNA segment and serve as the recognition sites for cleavage and strand exchange. An approximately 70 bp cis-acting recombinational enhancer (RE) increases efficiency of protein-DNA complex formation. In some embodiments, rather than hixL and hixR, hixC (BBa_J44000), a composite 26 bp symmetrical hix site that shows higher binding affinity for Hin and a 16-fold slower inversion rate than wild type sites hixL and hixR can be used. In addition, a modified Hin/hix DNA recombination system can be used in vivo to manipulate at least two adjacent hixC-flanked DNA segments. Hin recombinase fused to a C-terminus LVA degradation tag (BBa_J31001) and hixC (BBa_J44000) are sufficient for DNA inversion activity.

[0341] Bacteriophage λ has long served as a model system for studies of regulated site-specific recombination. In conditions favorable for bacterial growth, the phage genome is inserted into the Escherichia coli genome by an integrative recombination reaction, which takes place between DNA attachment sites called attP and attB in the phage and bacterial genomes, respectively. As a result, the integrated λ DNA is bounded by hybrid attachment sites, termed attL and attR. In response to the physiological state of the bacterial host or to DNA damage, λ phage DNA excises itself from the host chromosome. This excision reaction recombines attL with attR to precisely restore the attP and attB sites on the circular λ and E. coli DNAs. The phage-encoded λ integrase protein (Int), a tyrosine recombinase, splices together bacterial and phage attachment sites. Int is required for both integration and excision of the λ prophage.

[0342] λ recombination has a strong directional bias in response to environmental conditions. Accessory factors, whose expression levels change in response to host physiology, control the action of Int and determine whether the phage genome will remain integrated or be excised. Int has two DNA-binding domains: a C-terminal domain, consisting of a catalytic domain and a core-binding (CB) domain, that interacts with the core recombining sites and an N-terminal domain (N-domain) that recognizes the regulatory arm DNA sites. The heterobivalent Int molecules bridge distant core and arm sites with the help of accessory proteins, such as integration host factor (IHF), which bend the DNA at intervening sites, and appose arm and core sequences for interaction with the Int

recombinase. Five arm DNA sites in the regions flanking the core of attP are differentially occupied during integration and excision reactions. The integration products attL and attR cannot revert back to attP and attB without assistance from the phage-encoded factor X is, which bends DNA on its own or in combination with the host-encoded factor Fis. X is also inhibits integration, and prevents the attP and attB products of excision from reverting the attP and attB products of excision from reverting to attL and attR. Because the cellular levels of IHF and Fis proteins respond to growth conditions, these host-encoded factors have been proposed as the master signals for integration and excision. Exemplary λ recombination recognition sequences are known in the art.

[0343] In one embodiment, the recombinase of the disclosure is a P22 recombinase. Bacteriophage P22 is a lambdoid phage which infects Salmonella typhimurium. P22 can integrate into and excise out of its host chromosome via site-specific recombination. Both integration and excision reactions require the phage-encoded int gene, and excision is dependent on the xis gene as well. P22 Int is a member of the λ integrase family. The Int proteins of λ and P22 are composed of two domains. The catalytic domain binds to the core region of the phage recombination site, attP, where the actual recombination reactions occur. The smaller amino-terminal domain binds to arm-type sequences which are located on either site of the core within the attP. The active components of λ integrative and excisive recombination are nucleosome-like structures, called intasomes, in which DNA is folded around several molecules of Int and integration host factor (IHF). It has been demonstrated that one monomer of λ integrase can simultaneously occupy both a core-type binding site and an arm-type binding site. Formation of these bridges is facilitated by IHF, which binds to specific sequences and imparts a substantial bend to the DNA.

[0344] The attP regions of P22 and λ are also similar in that both contain arm regions, known as the P and P' arms, which contain Int arm-type binding sites and IHF binding sites. However, the arrangement, spacing, and orientation of the Int and IHF binding sites are distinct. The attP region of λ contains two Int arm-type binding sites on the P arm and three on the P' arm. The P arm contains two IHF binding sites, and the P' arm contains a single site. The attP region of P22 contains three Int arm-type binding sites on the P arm and two sites on the P' arm. In addition, IHF binding sites, called H and H', are located on each arm of the P22 attP. The Escherichia coli IHF can recognize and bind to these P22 IHF binding sites in vitro. The maximum amount of P22 integrative recombination occurs in the presence of E. coli IHF in vitro, whereas in its absence, recombination is detectable but depressed.

[0345] Although the attP region of P22 contains strong IHF binding sites, in vivo measurements of integration and excision frequencies showed that infecting P22 phages can perform site-specific recombination to its maximum efficiency in the absence of IHF. In addition, a plasmid integration assay showed that integrative recombination occurs equally well in wild-type and ihfA mutant cells. P22 integrative recombination is also efficient in Escherichia coli in the absence of functional IHF.

[0346] In another embodiment, the FLP system of the yeast 2 mm plasmid can also be used as a recombinase of the disclosure. The Flp system has been used to construct specific genomic deletions and gene duplications, study gene function, promote chromosomal translocations, promote site-specific chromosome cleavage, and facilitate the construction of genomic libraries in organisms including bacteria, yeast, insects, plants, mice, and humans. Site- specific recombination catalyzed by the FLP recombinase occurs readily in bacterial cells.

[0347] In yeast, the only requirements for FLP recombination are the FLP protein and the FLP recombination target (FRT) sites on the DNA substrates. The minimal functional FRT site contains only 34 base pairs. The FLP protein can promote both inter- and intramolecular recombination. Exemplary recombination recognition sequences for use with the yeast FLP system are known in the art.

-I l l- [0348] The separation and segregation of newly replicated E. coli circular chromosomes can also be prevented by the formation of circular chromosome dimers, which can arise during crossing over by homologous recombination. In E. coli, these dimers, which arise about once every six generations, are resolved to monomers by the action of the FtsK- XerCD-dif chromosome dimer resolution machinery. Two site-specific recombinases of the tyrosine recombinase family, XerCD, act at a 28 bp recombination site, dif, located in the replication terminus region of the E. coli chromosome to remove the crossover introduced by dimer formation, thereby converting dimers to monomers. A complete dimer resolution reaction during recombination at dif requires the action of the C-terminal domain of FtsK (FtsKC). FtsK is a multifunctional protein whose N-terminal domain acts in cell division, while the C-terminal domain functions in chromosome segregation. Therefore, FtsK is well suited to coordinate chromosome segregation and cell division. A purified protein, FtsK50C, containing a functional C-terminal domain, can translocate DNA in an ATP-dependent manner and activate Xer recombination at the recombination site dif, thereby reconstituting in vitro the expected in vivo activities of the C-terminal domain of the complete FtsK protein. Additional exemplary recombination recognition sequences for use with the XerCD system are known in the art.

[0349] In another embodiment, a recombinase of the disclosure is the fim switch (fimS). The fim switch (fimS) consists of a 314 base pair DNA element that can be inverted by site-specific recombinases FimB and FimE. In the natural system, fimSc contains a promoter, that when switched to the on orientation, drives transcription of the fim operon. The fim operon is needed for export and structural assembly of type 1 fimbriae. FimB and FimE, required to invert fimS, are members of the λ integrase family of site-specific recombinases. Recombination of fimS is distinct from the related Xer-mediated

recombination in that the recombinases act independently to invert fimS. Each inverted repeat (IR) is flanked by overlapping FimB and FimE binding sites, and following occupancy of these sites they recombine the switch within the IR sequence. As for λ phage chromosomal integration and excision, fim recombination also requires accessory proteins, specifically integration host factor (IHF) and the leucine-responsive regulatory protein (Lrp). These proteins are believed to contribute to the overall architecture of the fim switch that facilitates synapse of the 9 bp IRs.

[0350] FimB catalyzes inversion in both directions, although with a slight bias for the off-to-on orientation, while FimE predominantly catalyzes on-to-off inversion. Control of FimE expression is important in bringing about its orientation bias; as the fim switch is located at the end of fimE, the orientation of fimS determines the length and 3' sequence of the fimE transcript. As a consequence, fimE mRNA is likely to be subject to more rapid 3' to 5' degradation when the switch is in the off orientation than when it is in the on orientation. In addition, FimE preferentially binds to fimS in the on orientation, as has been demonstrated in vitro and in vivo, which adds to the directional bias. A further difference between FimB and FimE is that FimB inversion frequencies are markedly lower than those exhibited by FimE, both in vitro and in vivo. Additional exemplary recombination recognition sequences and recombinases for use with the FimB and FimE system are known in the art.

Toxins and Toxin/ Antitoxin Combinations

[0351] In one aspect, the disclosure provides engineered bacterial cells having kill- switch circuitry which is activated or turned on in response to certain environmental conditions or certain environmental cue(s) or signal(s), e.g., when th bacteria are present in the gut. For example, in some embodiments, the disclosure provides engineered bacterial cells which express a gene of interest, such as a therapeutic gene, and one or more recombinase genes upon sensing an exogenous environmental condition and/or signal(s). In such bacterial cells, once the recombinase is expressed, the recombinase (or series of recombinases) ultimately flip(s) an inverted toxin gene in the recombinant bacterial cell so that the toxin is then expressed and kills the recombinant bacterial cell. In some

embodiments, the recombinant bacterial cell may further express an antitoxin, which may be expressed upon sensing an exogenous environmental condition and/or signal(s) (e.g., under the control of an inducible promoter) or may be constitutively expressed.

[0352] In another aspect, the disclosure provides engineered bacterial cells having kill- switch circuitry which is activated in the absence of an environmental signal. In this aspect, the kill-switch is repressed or turned off in certain environmental conditions, or in the presence of certain environmental cues or signals, e.g., in the gut, and activated only when the environmental condition or cues are no longer present, or when the bacteria are removed from the environment. In some embodiments, the disclosure provides engineered bacterial cells which express a gene of interest, such as a therapeutic gene, a gene encoding one or more transcription factors (activators and/or repressors) and a gene encoding a toxin, upon sensing an exogenous environmental condition and/or signal(s) (or the absence of such condition or signal). In such embodiments, the expression of the toxin is dependent upon the expression of one or more transcriptional activators and/or repressors, which activators and/or repressors are responsive to the external environment and/or environmental signals. In some embodiments, the bacterial cells contain kill-switch components that are responsive to arabinose or another sugar. For example, in one embodiment, the bacterial cell comprises a gene encoding the AraC transcription factor under the control of the araC promoter, a gene encoding a Tet repressor (or other antibiotic repressor) under the control of the araBAD promoter and a gene encoding a toxin under the control of the Tet promoter. In the absence of arabinose, the AraC transcription factor adopts a conformation that represses transcription from the araBAD promoter. In this case, the Tet repressor is not made and the toxin is expressed. In the presence of arabinose, the AraC transcription factor undergoes a

conformational change that allows it to bind to and activate the AraBAD promoter, which induces expression of TetR (tet repressor), which prevents expression of a toxin (which is under the control of a promoter having a TetR binding site). In some embodiments, the bacterial cell may further express an antitoxin, which may be expressed in the presence of arabinose or other sugar, or another exogenous environmental condition and/or signal(s) (e.g., under the control of an inducible promoter, such as araBAD or any of the other inducible promoters provided herein) or may be constitutively expressed.

[0353] Bacterial toxins and anti-toxins are known in the art. For example, numerous toxins and anti-toxins are provided in: Park, et al., Biochim Biophys Acta (2013), 1834:

1155-1167; Yamaguchi, Y. et al., Nat. Rev. (2011), 9:779-790; Yamaguchi, Y., Ann Rev Genet. (2011), 45:61-79; Mruk, I., et al., Nuc Acids res (2014), 42:70-86; Schuster, C, et al., FEMS Microbiol Lett (203), 340:73-85; and Hayes, F., et al., Crit rev Biochem Mol Biol (2011), 46: 386-408, all of which are incorportated by reference in their entireties. In some embodiments, the toxin is a toxin that cleaves DNA. In some embodiments, the toxin is a toxin that cleaves RNA. In some embodiments, the toxin is a toxin that transfers phosphate groups. In some embodiments, the toxin is a toxin that phosphorylates proteins. In some embodiments, the toxin is a toxin that inhibits ATP synthesis. In one embodiment of the disclosure, the toxin is a bacteriocin, or a biologically active fragment thereof. In one embodiment of the disclosure, the toxin is a colicin, or a biologically active fragment thereof. In one embodiment of the disclosure, the toxin is a microcin, or a biologically active fragment thereof. In one embodiment of the disclosure, the toxin is a lytic protein, or a biologically active fragment thereof. In one embodiment of the disclosure, the toxin is a gyrase inhibitor, or a biologically active fragment thereof. In one embodiment of the disclosure the toxin is a transcription inhibitor, or a biologically active fragment thereof. In one embodiment of the disclosure the toxin is a polymerase inhibitor, or a biologically active fragment thereof. In one embodiment of the disclosure, the toxin is a transcription inhibitor, or a biologically active fragment thereof. In one embodiment of the disclosure, the toxin is an endoribonuclease, or a biologically active fragment thereof. In one embodiment of the disclosure, the toxin is an exoribo nuclease, or a biologically active fragment thereof. In one embodiment of the disclosure to toxin is a DNase, or a biologically active fragment thereof. In one embodiment of the disclosure, the toxin is an RNase, or a biologically active fragment thereof.

[0354] In another embodiment of the disclosure, the bacterial cell also expresses a heterologous gene encoding an anti-toxin which has the capability to bind to a toxin that is expressed and maintain bacterial cell viability. However, once the bacterial either fails to produce any additional anti-toxin or levels of the toxin exceed levels of the anti-toxin, the levels of toxin will build-up inside the bacterial cell, ultimately neutralizing and/or killing the bacterial cell. In one embodiment, the bacterial cell is no longer viable once the toxin protein is present at either equal or greater amounts than that of the anti-toxin protein in the cell. The presence of an anti- toxin allows another measure of control in the length of time that a bacterium remains viable. For example, if the anti-toxin is under the control of a "weak" promoter (i.e., less anti-toxin is produced), the level of toxin will be greater than that of the anti-toxin and will kill the recombinant bacteria in less time. Thus, by choosing the strength of the promoter driving expression of the anti-toxin, as well as choosing the particular antitoxin (some anti-toxins may be more potent or effective than others in counteracting the effects of a particular toxin), the length of time that a recombinant bacterial cell remains viable can be controlled. The sequence of the anti-toxin may also be altered, e.g., mutated, to alter the potency, activity, and/or function of the anti-toxin.

[0355] In some embodiments, the disclosure provides an engineered bacterial cell comprising a gene encoding a toxin (e.g., as described herein, without its cognate antitoxin) after sensing the presence or absence of an exogenous environmental condition(s), as described herein. In other embodiments, the disclosure provides an engineered bacterial cell comprising a gene encoding a toxin, and a gene encoding a cognate anti-toxin after sensing the presence or absence of an exogenous environmental condition(s), as described herein. Thus, in one embodiment, the bacterial cell of the disclosure may comprise a toxin gene, as described herein, without its cognate antitoxin. In another embodiment, the bacterial cell of the disclosure may comprise a gene encoding a toxin and a s gene encoding a cognate antitoxin.

[0356] Many bacterial toxin/antitoxin (TA) systems have been characterized in prokaryotes (van Melderen and Saavedra de Bast, PLOS Genetics 5(3): el000437 (2009); Brantl and Jahn, FEMS Microbiol. Rev. 39: 413-27 (2015)). Bacterial TA systems are typically comprised of two components, a toxin capable of either killing its host cell or conferring growth stasis, and an antitoxin that neutralizes the action of the toxin or inhibits its expression. In all bacterial TA systems identified to date, the toxin is either a peptide or protein. However, the nature of the antitoxin varies greatly among different systems. In type I TA systems, the antitoxin is a RNA molecule which regulates toxin expression by inhibiting the translation of the toxin mRNA. In type II TA systems, the antitoxin is a protein which inhibits the toxin via a protein-protein interaction. In type III TA systems, the antitoxin is a RNA molecule that inhibits the toxin protein by interacting with the it directly. In type IV TA systems, the antitoxin is a protein that interferes with binding of the toxin protein to its target. Finally, in type V TA systems, the antitoxin is an RNAse that cleaves the toxin mRNA, thus preventing its expression.

[0357] Accordingly, in one aspect, the bacterial cell of the disclosure comprises a gene encoding a type I toxin/antitoxin system component. In another aspect, the bacterial cell of the disclosure comprises a gene encoding a type II toxin- antitoxin system component. In another embodiment, the bacterial cell of the disclosure comprises a gene encoding a type III toxin-antitoxin system component. In another embodiment, the bacterial cell of the disclosure comprises a gene encoding a type IV toxin-antitoxin system component. In another embodiment, the bacterial cell of the disclosure comprises a gene encoding a type V toxin-antitoxin system component. Other toxins/antitoxin pairs are described in

U.S. 2013/0023035, the entire contents of which are expressly incorporated herein by reference.

[0358] In one aspect of the disclosure the bacterial cell comprises a gene encoding at least one component of the Kid-Kis toxin/antitoxin system (see Lopez- Villarejo et al., Toxins 7: 478-492 (2015)). The toxin Kid (killing determinant), encoded by the gene kid, is an RNase that cleaves RNA at sites containing the core sequence 5'-UA(A/C/U)-3'. The antitoxin Kis, encoded by the gene kis, is a protein that interacts with Kid, thus neutralizing its activity. [0359] In one aspect of the disclosure, the bacterial cell comprises a gene encoding at least one component of the LdrD-RdlD toxin/antitoxin system (see Kawano et al., Mol.

Microbiol. 45(2): 333-49 (2002); Kawano, RNA Biology 9: 1520-7 (2012)). The toxin LdrD, encoded by the gene ldrD, is a small toxic protein (35 amino acids) whose ectopic

overexpression causes rapid growth inhibition, nucleoid condensation, global translation inhibition, and cell death. The specific molecular target of LdrD remains to be elucidated (Kawano 2012). The antitoxin RdlD, encoded by the gene rdlD, is a small unstable antisense RNA that overlaps the 5' untranslated region of ldrD mRNA (Wen and Fozo, Toxins 6: 2310- 35 (2014)). It has been proposed that RdlD blocks translation of ldrD by base pairing to ldrdD mRNA.

[0360] In one aspect of the disclosure, the bacterial cell comprises a gene encoding at least one component of the SymE-SymR toxin/antitoxin system (see Kawano et al., Mol. Microbiol. 64: 738-54 (2007); Kawano 2012)). The toxin SymE (SOS-induced yjiW gene with similarity to MazE), encoded by the gene symE, is suggested to act as an

endoribonuclease of mRNAs and non-coding RNAs (Kawano 2007). The antitoxin SymR (symbiotic RNA), encoded by symR, is an RNA molecule that represses symE mRNA translation by directly blocking its Shine Dalgarno sequence (Brantl and Jahn 2015).

[0361] In one aspect of the disclosure, the bacterial cell comprises a gene encoding at least one component of the MazF-MazE toxin/antitoxin system. The toxin MazF, encoded by the mazF gene is a an endoribonuclease (also known as an interferase) that cleaves mRNA at specific sites, and cleaves C-terminal nucleotides of 16S rRNA within 30S ribosomal subunits (Zhang et al., Mol. Cell 12: 913-23 (2003); Vesper et al, Cell 147: 147-57

(2011)). The MazF toxin in neutralized by the antitoxin MazE, encoded by the mazE gene, which binds to and prevents mRNA binding and cleavage by MazF (Simanshu et al., Mol. Cell. 52: 447-58 (2013)).

[0362] In one aspect of the disclosure, the bacterial cell comprises a gene encoding at least one component of the CcdB-CcdA toxin/antitoxin system. The toxin CcdB, encoded by the ccdB gene, is a bacterial gyrase inhibitor that can inhibit gyrase function by either forming a ternary complex with a DNA-gyrase complex, thus blocking transcription by RNA polymerase, or by forming a complex with gyrase in the absence of DNA (Critchlow et al., J. Mol. Biol. 273: 826-39 (1997); Maki et al., J. Biol. Chem. 267: 12244-51 (1992); Maki et al. J. Mol. Biol. 256: 473-82 (1996)). The antitoxin CcdA, encoded by the ccdA gene, can reactivate gyrase from either the ternary complex (i.e., DNA:gyrase:CcdB) or from the direct DNA:CcdB complex, by extracting the bound CcdB and sequestering it in a non-covalent complex (Maki et al. 1996; Bernard et al. J. Mol. Biol. 234: 534-41 (1993); De Jonge et al., Mol. Cell. 35: 154-63 (2009)).

[0363] In one aspect of the disclosure, the bacterial cell comprises a gene encoding at least one component of the ParE-ParD toxin-antitoxin system. The toxin ParE, encoded by the parE gene, inhibits DNA gyrase thereby blocking DNA replication (Jiang et al., Mol. Microbiol. 44: 971-79 (2002)). The antitoxin ParD, encoded by the parD gene, neutralizes ParE by forming a tight complex with the toxin (Johnson et al. J. Bacteriol. 178: 1420-9 (1996)).

[0364] In one aspect of the disclosure, the bacterial cell comprises a gene encoding at least one component of the Zeta-Epsilon toxin/antitoxin system. Zeta-Epsilon systems are widespread among various bacterial species. The bacterial toxin Zeta is an enzyme that disrupts bacterial cell wall synthesis and eventually triggers autolysis (see Mutschler and Meinhart, J. Mol. Med. (Berl.) 89: 1183-94 (2011), the entire contents of which are expressly incorporated herein by reference). The antitoxin Epsilon inhibits the toxin Zeta presumably by blocking the enzyme's ATP/GTP binding site (Meinhart et al., Proc. Natl. Acad. Sci. USA 100: 1661-6 (2003)).

[0365] In one aspect of the disclosure, the bacterial cell comprises a gene encoding at least one component of the Kid/Kis toxin/antitoxin system.

[0366] In one aspect of the disclosure, the bacterial cell comprises a gene encoding at least one component of the Doc-PhD toxin/antitoxin system.

[0367] In one aspect of the disclosure, the bacterial cell comprises a gene encoding at least one component of the RelB/RelE toxin/antitoxin system.

[0368] In one aspect of the disclosure, the bacterial cell comprises a gene encoding at least one component of the VapC/VapB toxin/antitoxin system.

[0369] In one aspect of the disclosure, the bacterial cell comprises a heterologous gene encoding at least one component of an antitoxin/toxin system as disclosed in Table 7.

Table 7. Exemplary Bacterial Toxin- Antitoxin Systems

[0370] As discussed above, in one embodiment, the bacterial cell may comprise a gene encoding a bacterial toxin by itself, i.e., without its cognate antitoxin. In one embodiment, the bacterial toxin is selected from the group consisting of Hok, Fst, TisB, LdrD, Kid, SymE, MazF, FlmA, lbs, XCV2162, dinJ, CcdB, ParE, YafO, Zeta, hicB, relB, yhaV, yoeB, chpBK, VapC, Doc, hip A, Rv0301, RelK, FitB, Tsel, VbhtT, Epsilon, ToxN, SpollSA, PezT, ldrD, symE, ibsC, txnA, srnB, pndA, shoB, bsrG, cbtA, ghoT, MosT, YeeV, PasB, ζ, dinJ, rnlA, mqsR, ygiM, yafW, yeeU, VapD, GinA, GinB, GinC, GinD, EndoA, HigB, Paml, RatA, CbtA, Ykfl, YpjF, GnsA, YjhX, and YdaS. Other toxins are described in Wright et al., (2015), ACS Synthetic Biology, 4:307-316. In some embodiments, the bacterial cell comprises a gene encoding a toxin selected from MazF, CcdB, ParE, relB, VapC, Doc, hipA, and Kid.

[0371] As discussed above, in one embodiment, the bacterial cell comprises a gene encoding a bacterial toxin and also comprises a gene encoding the toxin's cognate anti-toxin. Upon sensing an exogenous environmental condition, the anti-toxin protein levels increase in the cell and the anti-toxin binds to it's cognate toxin that is expressed after the toxin gene is either expressed or flipped by a recombinase. Thus, in one embodiment, the bacterial antitoxin is selected from the group consisting of Sok, RNAII, IstR, RdlD, Kis, SymR, MazE, FlmB, Sib, ptaRNAl, yafQ, CcdA, ParD, yaf , Epsilon, HicA, relE, prlF, yefM, chpBI, VapB, PhD, hipB, RV0300, Relj, FitA, Tsil, VbhA, Zeta, Toxl, SpollSB, PezA, rdlD, symR, sibC, ratA, srnC, pndB, ohsC, SR4, cbeA, ghoS, MosA, YeeU, PasC, ε, yafQ, rnlB, mqsA, ygiN, ykfl, yeeV, YdcD, HigA, pemK, YfjF, YeeU, YafW, YfjZ, YmcE, YjhQ, and YdaT. In some embodiments, the bacterial cell comprises a gene encoding an anti-toxin selected from MazE, CcdA, ParD, relE, VapB, PhD, hipB, and Kis.

[0372] In some embodiments, the bacterial cell comprises genes encoding a toxin and anti-toxin selected from MazFE, CcdBA, ParED, relBE, VapCB, DocPhD, hipAB, and KidKis.

[0373] In another embodiment, the bacterial toxin is a bacteriocin. As used herein, the term "bacteriocin" refers to a peptide or polypeptide expressed by a host cell capable of neutralizing said host cell, as well as other cells if secreted, including cells clonally related to the host cell and other microbial cells. Bacteriocins can include polypeptides that neutralize the host cell, and other cells, by arresting microbial replication or reproduction, or by having cytotoxic activity. Some bacteriocins have cytostatic activity and as such can inhibit replication or reproduction of the microbial cell, by, e.g., arresting cell cycle. Bacteriocin nomenclature is based on the name of the bacterial species producing the compound, followed by the suffix -cin. Thus, pyocins are named after Pseudomonas pyogenes strains, cloacins after Enterobacter coacae strains, macescins after Serratia marcescens strains, megacins after Bacillus megateriu strains, colicins after Escherichia coli strains, etc. Some bacteriocins can be derived from a polypeptide precursor. The polypeptide precursor can be cleaved (e.g., after being processed by a protease) to yield the active bacteriocin polypeptide. As such, in some embodiments, a bacteriocin is produced from a precursor polypeptide. Some bacteriocins undergo extensive post-translational modifications in order to be in their active state. As such, in some embodiments, the bacterial cell of the disclosure will comprise at least one heterologous genes expressing polypeptides necessary to post-translationally modify the bacteriocin. Many bacteriocins have been characterized and are readily ascertainable by those of ordinary skill in the art (see e.g., US 2015/0050253 Al, the entire contents of which are expressly incorporated herein by reference).

[0374] In some embodiments, the bacterial cell of the disclosure comprises at least one heterologous gene encoding a bacteriocin. In some embodiments, the bacterial cell of the disclosure comprises at least one gene encoding a bacteriocin selected from the group consisting of a colicin and a microcin. In some embodiments, the bacterial cell of the disclosure comprises at least one gene encoding a precursor polypeptide of a bacteriocin. In some embodiments, the bacterial cell of the disclosure comprises at least one gene encoding a precursor polypeptide of a colicin. In some embodiments, the bacterial cell of the disclosure comprises at least one gene encoding a precursor polypeptide of a microcin. In some embodiments, the bacterial cell of the disclosure comprises at least one gene encoding a precursor polypeptide of a bacteriocin and at least one gene encoding a protease capable of processing a precursor polypeptide of a bacteriocin. In some embodiments, the bacterial cell of the disclosure comprises at least one gene encoding a precursor polypeptide of a colicin and at least one gene encoding a protease capable of processing a precursor polypeptide of a colicin. In some embodiments, the bacterial cell of the disclosure comprises at least one gene encoding a precursor polypeptide of a microcin and at least one gene encoding a protease capable of processing a precursor polypeptide of a microcin.

[0375] In some embodiments, the bacterial toxin is a colicin. In some embodiments, the bacterial cell of the disclosure comprises at least one gene encoding a colicin. Colicins are bacteriocins produced by some strains of Escherichia coli, as well as other enteric bacteria, including Shigella and Citrobacter, with typical molecular weight between 25 and 80 kDa (see, Cascales et al., Microbiol. Mol. Biol. Rev. 71: 158-229 (2007), the entire contents of which are expressly incorporated herein by reference). Colicins neutralize cells using various mechanisms including membrane pore formation (i.e., permeabilization of a cell membrane), nuclease activity (e.g., hydrolases or transferases targeting genomic DNA (DNAses), 16S rRNA (RNases), or tRNases (referred to as "nuclease colicins"), or inhibition of peptidoglycan and lipopolysaccharide ("LPS") O-antigen synthesis. In one aspect of the disclosure, the bacterial cell of the disclosure comprises at least one heterologous gene encoding a colicin having neutralizing activity selected from the group consisting of pore formation, DNase, 16S RNase, tRNase, and inhibition of peptidoglycan and LPS synthesis. In one aspect of the disclosure, the bacterial cell of the disclosure comprises at least one heterologous gene encoding a colicin selected from the group consisting of colicin A, colicin El, colicin K, colicin N, colicin U, colicin B, colicin la, colicin lb, colicin 5, colicinlO, colicin S4, colicin Y, colicin E2, colicin E7, colicin E8, colicin E9, colicin E3, colicin E4, colicin E6; colicin E5, colicin D, and colicin M. In one aspect of the disclosure, the bacterial cell of the disclosure comprises at least one heterologous gene encoding a cloacin DF13. Table 8. Exemplary Colicins

[0376] In some embodiments, the toxin is a microcin. In some embodiments, the bacterial cell comprises at least one gene encoding a microcin. Microcins are bacteriocins of low molecular weight produced by enterobacteria (e.g., Escherichia coli), typically having a molecular weight of less than 10 kDa (see Jack and Jung, Curr. Opin. Chem. Biol. 4: 310-7 (2000); Severinov et al., Mol. Microbiol. 65: 1380-94 (2007); the entire contents of each are expressly incorporated herein by reference). Microcins have been classified according to their post-translational modifications, gene cluster organization, and leader peptide sequences. Class I microcins are peptides (typically < 5 kDa) that are subject to extensive post translational modifications (e.g., B 17, C7, and J25). Class II microcins are larger peptides (typically 5- 10 kDa), subdivided into two classes: class Ila microcins which may contain disulfide bonds but no further post-translational modifications (e.g., ColV, 24 and L), and class lib microcins which may have a C-terminal siderophore, such as catechol of the salmochelin type (e.g., E492, H47, 147, and M) (see Duquesne et al. Nat. Prod. Rep. 24: 708- 34 (2007)) In some embodiments, the bacterial cell comprises at least one gene encoding a toxin selected from microcin B, microcin B 17, microcin C, microcin C7-C51, microcin J25, microcin ColV, microcin 24, microcin L, microcin D93, microcin L, microcin E492, microcin H47, microcin 147, and microcin M.

[0377] In some embodiments, the bacterial cell comprises a gene encoding a microcin J. In some embodiments, the bacterial cell comprises a gene encoding microcin J25.

Microcin J25 (also known as MccJ25) is a 21 amino acid peptide produced from pro-MccJ25, a 58 amino acid peptide, product of the mcjA gene (Solbiati et al., J. Bacteriol. 181: 2659-62 (1999)). The maturation enzymes McjB and McjC, encoded by the genes mcjB and mcjC, respectively, are required for production of MccJ25 from pro-MccJ25. Cells producing MccJ25 are resistant to internally-produced and externally- added MccJ25 due to the action of the ABC transporter McjD, encoded by the gene mcjD (Solbiati et al. J. Bacteriol. 178: 3661- 3 (1996)). MccJ25 appears to target RNA polymerase β' subunit, thus preventing

transcription (Delgado et al., J. Bacteriol. 183: 4543-50 (2001)). In some embodiments, the bacterial cell comprises at least one gene encoding microcin J25 and at least one gene encoding McjB. In some embodiments, the bacterial cell comprises at least one gene encoding microcin J25 and at least one gene encoding McjC. In some embodiments, the bacterial cell comprises at least one gene encoding microcin J25, at least one gene encoding McjB and at least one gene encoding McjC. In some embodiments, the bacterial cell comprises at least one mcjA gene. In some embodiments, the bacterial cell comprises at least one mcjA gene and at least one mcjB gene. In some embodiments, the bacterial cell comprises at least one mcjA gene and at least one mcjC gene. In some embodiments, the bacterial cell comprises at least one mcjA gene, at least one mcjB gene, and at least one mcjC gene.

[0378] In some embodiments, the bacterial cell comprises a gene encoding a microcin B. In some embodiments, the bacterial cell comprises a gene encoding microcin B 17 (also known as "MccB 17"). Microcin B 17 is synthesized from the 69 amino acid pro-MccB 17, a product of the mcbA gene (Severinov et al., 2007). The proteins TldE and TldD (encoded by the tldE and tldD genes, respectively) are required for pro-MccB 17 processing (Allali et al., J. Bacteriol., 184: 3224-31 (2002); Rodriguez-Sainz et al., Mol. Microbiol. 4: 1921-32 (1990)). MccB 17 contains oxazole and thiazole heterocycles formed by the post-translational modification of four cysteine and four serine residues by the McbBCD synthase, encoded by the genes mcbB, mcbC, and mcbD (Yorgey et al., Proc. Natl. Acad. Sci. USA 91: 4519-4523 (1994); Ghilarov et al., J. Biol. Chem. 286: 26308-18 (2011)). MccB 17 targets DNA gyrase (Vizan et al., EMBO J.: 10:467-76 (1991)). The mechanism of MccB 17 inhibition of gyrase activity is not fully understood, however, the accumulation of complexes of gyrase bound to cleaved DNA appears to be responsible for the neutralizing effects of MccB 17. Immunity to MccB 17 is conferred by three genes: mcbE, mcbF and mcbG, which appear to be involved in the secretion of MccB 17 from the cell (Garrido et al., EMBO J. 7: 1853-62 (1988)). In some embodiments, the bacterial cell comprises at least one gene encoding microcin B 17 and at least one heterologous gene encoding TldE. In some embodiments, the bacterial cell comprises at least one gene encoding microcin B 17 and at least one gene encoding TldD. In some embodiments, the bacterial cell comprises at least one gene encoding microcin B 17, at least one gene encoding TldD and at least one gene encoding TldE. In some embodiments, the bacterial cell comprises at least one mcbA gene. In some embodiments, the bacterial cell comprises at least one mcbA gene and at least one tldE gene. In some embodiments, the bacterial cell comprises at least one mcbA gene and at least one tldD gene. In some embodiments, the bacterial cell comprises at least one mcbA gene, at least one tldD gene, and at least one tldE gene. In some embodiments, the bacterial cell comprises at least one gene encoding microcin B 17 and at least one gene encoding McbBCD synthase. In some embodiments, the bacterial cell comprises at least one gene encoding microcin B 17, at least one gene encoding McbBCD synthase, and at least one gene encoding a protein selected from the group consisting of TldD and TldE. In some embodiments, the bacterial cell comprises at least one mcbA gene and at least one gene selected from the group consisting of mcbB, mcbC, and mcbD. In some embodiments, the bacterial cell comprises at least one mcbA gene, at least one gene selected from the group consisting of mcbB, mcbC, and mcbD, and at least one gene selected from the group consisting of tldD and tldE.

[0379] In some embodiments, the bacterial cell comprises a gene encoding a microcin C. In some embodiments, the bacterial cell comprises a gene encoding microcin C7-C51 (also known as "MccC7-MccC51"). Microcin C7-C51 is a heptapeptide, encoded by the mccA gene, which is subject to complex post-translational modifications (see Severinov et al., 2007; Gonzalez-Pastor et al., Nature 369: 281 (1994)). Interestingly, although the last residue of the peptide moiety of MccC7-MccC51 is an aspartic acid, the last codon of mccA codes for an asparagine. The proteins MccB, MccD and MccE (encoded by the mccB, mccD, and mccE genes) are required for processing of active MccC7-MccC51 (Severinov and Nair, Future Microbiol. 7: 281-9 (2012)). The N-terminal domain of MccE (MccENTD) is believed to be the region of MccE necessary for the post-translational modification activity of MccE. (Severinov and Nair, Future Microbiol. 7: 281-9 (2012)). Once processed, MccC7- MccC51 becomes a structural analogue of aspartyl-adenylate, an intermediate of the reaction catalyzed by aspartyl-tRNA synthetase. Processed MccC7-MccC51 prevents the synthesis of aminoacylated tRNAAsp by aspartyl-tRNA synthetase, thus inhibiting translation

(Metlitskaya et al., J. Biol. Chem. 281: 18033-42 (2006)). Immunity to MccC7-MccC51 is granted by the MccE and MccF proteins (encoded by the mccE and mccF genes,

respectively). The C-terminal domain of MccE (MccECTD) is an acetyl-CoA-dependent acetyltransferase that acetylates the primary amino group of the aminoacyl moiety of processed MccC7-MccC51, which can then no loner inhibit aspartyl-tRNA synthetase (Vondenhoff et al., J. Bacteriol. 193: 3618-23 (2011); Novikova et al., J. Biol. Chem. 285: 12662-9 (2010); the entire contents of each of which are expressly incorporated herein by reference). MccF is a serine protease that hydro lyses the isopeptide bond linking the aspartate residue to the AMP moiety of processed MccC7-MccC51 (Tikhonov et al. J. Biol. Chem. 285: 12662-9 (2010)). MccC7-MccC51 is secreted from bacterial cells by the MccC protein, encoded by mccC (Severinov and Nair, 2012). In some embodiments, the bacterial cell of the disclosure comprises at least one gene encoding microcin C7-C51and at least one gene encoding MccB. In some embodiments, the bacterial cell of the disclosure comprises at least one gene encoding microcin C7-C51 and at least one gene encoding MccD. In some embodiments, the bacterial cell of the disclosure comprises at least one gene encoding microcin C7-C51 and at least one gene encoding MccE. In some embodiments, the bacterial cell of the disclosure comprises at least one gene encoding microcin C7-C51 and at least one gene encoding MccENTD. In some embodiments, the bacterial cell of the disclosure comprises at least one gene encoding microcin C7-C51, at least one gene encoding MccB and at least one gene encoding MccD. In some embodiments, the bacterial cell of the disclosure comprises at least one gene encoding microcin C7-C51, at least one gene encoding MccB and at least one gene encoding MccE. In some embodiments, the bacterial cell of the disclosure comprises at least one gene encoding microcin C7-C51, at least one gene encoding MccB and at least one gene encoding MccENTD. In some embodiments, the bacterial cell of the disclosure comprises at least one gene encoding microcin C7-C51, at least one gene encoding MccD and at least one gene encoding MccE. In some embodiments, the bacterial cell of the disclosure comprises at least one gene encoding microcin C7-C51, at least one gene encoding MccD and at least one gene encoding MccENTD. In some embodiments, the bacterial cell of the disclosure comprises at least one gene encoding microcin C7-C51, at least one gene encoding MccB, at least one gene encoding MccD, and at least one gene encoding MccE. In some embodiments, the bacterial cell of the disclosure comprises at least one gene encoding microcin C7-C51, at least one gene encoding MccB, at least one gene encoding MccD, and at least one gene encoding MccENTD. In some embodiments, the bacterial cell of the disclosure comprises at least one mccA gene. In some embodiments, the bacterial cell of the disclosure comprises at least one mccA gene and at least one mccB gene. In some embodiments, the bacterial cell of the disclosure comprises at least one mccA gene and at least one mccD gene. In some embodiments, the bacterial cell of the disclosure comprises at least one mccA gene and at least one mccE gene. In some embodiments, the bacterial cell of the disclosure comprises at least one mccA gene, at least one mccB gene, and at least one mccD gene. In some embodiments, the bacterial cell of the disclosure comprises at least one mccA gene, at least one mccB gene, and at least one mccE gene. In some embodiments, the bacterial cell of the disclosure comprises at least one mccA gene, at least one mccD gene, and at least one mccE gene. In some embodiments, the bacterial cell of the disclosure comprises at least one mccA gene, at least one mccB gene, at least one mccD gene, and at least one mccE gene. In some embodiments, the bacterial cell of the disclosure further comprises an antitoxin selected from a heterologous gene encoding MccE, MccECTD, and MccF.

[0380] In some embodiments of the disclosure, the anti- toxin is an immunity protein. As used herein, the term "immunity modulator" or "immunity protein" refers to a peptide or polypeptide which confers a cell immunity from a particular bacteriocin or a group of bacteriocins. Bacteriocins can typically neutralize a cell producing a bacteriocin as long as the cell does not produce an appropriate immunity modulator. In some embodiments, the bacterial cell of the disclosure comprises at least one heterologous gene encoding an immunity modulator which confers the cell immunity from a bacteriocin. In some embodiments, the bacterial cell of the disclosure comprises at least one heterologous gene encoding a bacteriocin and at least one heterologous gene encoding an immunity modulator that confers the cell immunity from said bacteriocin.

[0381] In some embodiments, the bacterial cell of the disclosure comprises at least one gene encoding a colicin immunity protein. In some embodiments the bacterial cell of the disclosure comprises at least one gene encoding a colicin immunity protein that neutralizes the activity of a colicin expressed in the cell. For example, if the recombinant bacterial cell comprises a gene encoding a colicin with pore forming activity, the bacterial cell of the disclosure can also comprise a gene encoding an immunity protein conferring immunity to said pore forming colicin. Many colicin immunity proteins have been characterized (see, Cascales et al. 2007 and US 2009/0233343, the entire contents of each of which are expressly incorporated herein by reference). Genes encoding immunity proteins conferring immunity to pore forming colicins are classified into two prospective classes: the A type (conferring immunity to, e.g., colicins A, B, N, and U), and the El type, conferring immunity to, e.g., colicins El, 5, K, 10, la, and lb) (Cascales et al. 2007). In one embodiment, the bacterial cell comprises at least one gene encoding an A type immunity protein. In one embodiment, the bacterial cell comprises at least one gene encoding an El type immunity protein. Immunity modulators conferring resistance to colicins having nuclease activity are called "nuclease- specific immunity proteins" (Ims or Imms). Ims confer immunity by binding to the C- terminal nuclease domain of the colicin having to form a heterodimer, thus inactivating the colicin having nuclease activity (Cascales et al. 2007). For example, the immunity protein Im9 binds the endonuclease domain of colicin E9 with extremely high affinity (Wallis et al., Biochem. 34: 13743-50 (1995)). Another example of an immunity protein is Im3, which binds to the ribonuclease domain of colicin E3 (Wallis et al., Biochem. 42: 4161-71 (2003)) Similarly, colicin M is neutralized by the immunity protein Cmi. The mode of action of Cmi remains to be elucidated (Gerard et al., J. Bacteriol. 193: 205-14 (2011)). In some embodiments of the disclosure, the bacterial cell comprises at least one gene encoding a colicin immunity protein selected from the group consisting of colicin A (Cai), colicin El (ImmEl), colicin K (Cki), colicin N (Cni), colicin U (Cui), colicin B (Cbi), colicin la (Iia), colicin lb (Imm), colicin 5 (Cfi), colicinlO (ImlO), colicin S4 (Csi), colicin Y (Cyi), colicin E2 (Im2), colicin E7 (Im7), colicin E8 (Im8), colicin E9 (Im9), colicin E3 (Im3), colicin E4 (Im4), colicin E6 (ImmE6), cloacin DF13 (cloacin immunity protein; Cim), colicin E5 (ImmE5), colicin D (ImmD), and colicin M (Cmi) immunity protein.

[0382] In any of these embodiments, the engineered bacteria may have more than one copy of the gene(s) encoding the toxin and/or anti-toxin. In any of these embodiments, the engineered bacteria may have more than one gene(s) encoding a toxin and/or anti-toxin (e.g., may have gene sequence encoding two or more toxins and/or anti-toxins). In any of thes embodiments, the gene(s) encoding the toxin(s) and/or anti-toxin(s)may be under the control of an inducible promoter such as any of the inducible promoters described herein. ). In any of thes embodiments, the gene(s) encoding the anti-toxin(s)may be under the control of a constitutive promoter.

Excision Enzymes

[0383] Higher rate of mutations throughout the genome of an organism may contribute to the development of cancer. Therefore, different DNA repair pathways have been developed to fix different genome mutations to protect the cell from cancer predisposition. Base excision repair (BER) is responsible to remove a modified base from DNA while nucleotide excision repair (NER) is responsible to remove the damaged bases from DNA as an oligonuicleotide. BER is initiated by a DNA glycolyase which removes the modified base by hydrolyzing the N-glycosylic bond between the deoxyribose and the base. This forms an AP (apurinic or apyrimidinic) abasic site which are then cleaved by an AP endonuclease. The resulting nick is filled with the correct nucleotide by the joint action of DNA polymerase and ligase.

[0384] DNA glycosylases are responsible for initial recognition of the modified base. DNA glycolyases are small enzymes with a narrow substrate specificity and require no cofactor. The different families of DNA glycolyases include the alkylpurine-DNA glycosylases (human: MPG; S. cerevisiae: Magi) which do not possess lyase activity. The endonuclease Ill-like /V-glycosylase family (human: NTHL1 ; S. cerevisiae: Ntgl, Ntg2) is responsible for repairing a wide array of oxidative lesions in double- stranded DNA, primarily oxidized pyrimidines. The endonuclease Vlll-like A/-glycosylase family (Human: NEIL1, NEIL2, NEIL3). This family of enzymes possesses AP lyase activity. The 8-oxoguanine- DNA glycosylase family (human: OGG1 ; S. cerevisiae: Oggl) is responsible for excising G oxidation products with intact ring systems. The uracil-DNA glycosylase superfamily is one of the most highly conserved and diverse families of BER enzymes (human: UNG; S.

cerevisiae: Ungl). The MutY family is a G mismatch- specific adenine-DNA glycosylase (human: MUTYH). (see, for example, Bauer et al., Nucleic Acid Res., 43(21): 10083-10101, 2015). Another example of excision enzymes is the bacteriophage lambda excisionase (Xis) which is sequence- specific binding protein required efficient excision of the bacterial genome, (see, for example, Cho et al., Journal Bact., 182(20):5807-5812, 2000). Xis works with phage integrases so the phage can switch between the lytic cycle, rapid self-replication cycle, and the lysogenic cycle, where the phage remains essentially dormant for a period of time inside the host. Phage integrases, e.g. serine or tyrosine integrases, integrate the phage genome into the host genome through site-specific recombination, hence the phage remain dormant inside the host cell. Upon switching to the lytic cycle, reverse reactions take place that lead to the excision of the phage genome through the activity of excisionases (Xis) and their cognate integrases. Other excision enzymes are known in the art, see for example, Fogg et al., J. Mol. Biol., 426: 2703-2716 (2014).

[0385] AP endonuclease enzymes hydrolyze the phosphodiester bond 5' to 3' to an abasic deoxyribose in DNA, e.g. E. coli. exonuclease III (APEX1, APEX2 and Apn2), E. coli. endonuclease IV, E. coli. endonuclease V, Human endonucleases, and deoxyribose phosphatases, (see, for example, Sancar et al., Ann. Rev. Biochem., 57:29-67, 1988). Bauer et al. states that other end-trimming enzymes include "Tyrosyl-DNA phosphodiesterase 1 (human: TDP1; S. cerevisiae: Tdpl) directly catalyzes the release of a cross-linked topoisomerase 1 from the end-group phosphate. PNKP/Tppl then removes the 3 '-phosphate and adds a 5'-phosphate to the break site. Topoisomerase II lesions are removed by TDP2 (5. cerevisiae: not present), leaving a 5'-phosphate. Aprataxin deadenylase (human: APTX; S. cerevisiae: Hnt3) directly removes the 5'-5' AMP left behind by an aborted ligation .

TDP1/TDP2/Tdpl and APTX/Hnt3 have all been found in both the nucleus and

mitochondria." (see, for example, Bauer et al., Nucleic Acid Res., 43(21): 10083- 10101, 2015).

Regulation of expression

[0386] The genetically engineered bacteria of the invention comprise a gene, genes, or gene cassette for producing a pay load and/or one or more kill- switch components, wherein the gene, genes or gene cassette is operably linked to a directly or indirectly inducible promoter that is controlled by exogenous environmental condition(s). In some embodiments, the inducible promoter is an oxygen level-dependent promoter and the payload and/or kill- switch component(s) is expressed in low-oxygen, microaerobic, or anaerobic conditions. For example, in low oxygen conditions, the oxygen level-dependent promoter is activated by a corresponding oxygen level- sensing transcription factor, thereby driving production of the payload and/or kill- switch component(s).

[0387] Bacteria have evolved transcription factors that are capable of sensing oxygen levels. Different signaling pathways may be triggered by different oxygen levels and occur with different kinetics. An oxygen level-dependent promoter is a nucleic acid sequence to which one or more oxygen level- sensing transcription factors is capable of binding, wherein the binding and/or activation of the corresponding transcription factor activates downstream gene expression. In one embodiment, the genetically engineered bacteria comprise a gene, genes, or gene cassette for producing a payload under the control of an oxygen level- dependent promoter. In a more specific aspect, the genetically engineered bacteria comprise a gene, genes or gene cassette for producing a payload under the control of an oxygen level- dependent promoter that is activated under low-oxygen or anaerobic environments, such as the environment of the mammalian gut.

[0388] In certain embodiments, the genetically engineered bacteria comprise the gene, genes, or gene cassette for producing the payload and/or kill- switch component(s) expressed under the control of the fumarate and nitrate reductase regulator (FNR). In E. coli, FNR is a major transcriptional activator that controls the switch from aerobic to anaerobic metabolism (Unden et al., 1997). In the anaerobic state, FNR dimerizes into an active DNA binding protein that activates hundreds of genes responsible for adapting to anaerobic growth. In the aerobic state, FNR is prevented from dimerizing by oxygen and is inactive. In alternate embodiments, the genetically engineered bacteria comprise a gene or gene cassette for producing the payload and/or kill-switch component expressed under the control of an alternate oxygen level-dependent promoter, e.g., an anaerobic regulation of arginine deiminiase and nitrate reduction ANR promoter (Ray et al., 1997), a dissimilatory nitrate respiration regulator DNR promoter (Trunk et al., 2010). In these embodiments, expression of the payload is particularly activated in a low-oxygen or anaerobic environment, such as in the gut.

[0389] In another embodiment, the genetically engineered bacteria comprise the gene, genes, or gene cassette for producing the payload and/or kill-switch component(s) expressed under the control of anaerobic regulation of arginine deiminiase and nitrate reduction transcriptional regulator (ANR). In P. aeruginosa, ANR is "required for the expression of physiological functions which are inducible under oxygen-limiting or anaerobic conditions" (Winteler et al., 1996; Sawers 1991). P. aeruginosa ANR is homologous with E. coli FNR, and "the consensus FNR site (TTGAT— ATCAA) was recognized efficiently by ANR and FNR" (Winteler et al., 1996). Like FNR, in the anaerobic state, ANR activates numerous genes responsible for adapting to anaerobic growth. In the aerobic state, ANR is inactive. Pseudomonas fluorescens, Pseudomonas putida, Pseudomonas syringae, and Pseudomonas mendocina all have functional analogs of ANR (Zimmermann et al., 1991). Promoters that are regulated by ANR are known in the art, e.g., the promoter of the arcDABC operon (see, e.g., Hasegawa et al., 1998).

[0390] In another embodiment, the genetically engineered bacteria comprise the gene, genes, or gene cassette for producing the payload and/or kill-switch component expressed under the control of the dissimilatory nitrate respiration regulator (DNR). DNR is a member of the FNR family (Arai et al., 1995) and is a transcriptional regulator that is required in conjunction with ANR for "anaerobic nitrate respiration of Pseudomonas aeruginosa" (Hasegawa et al., 1998). For certain genes, the FNR-binding motifs "are probably recognized only by DNR" (Hasegawa et al., 1998). Any suitable transcriptional regulator that is controlled by exogenous environmental conditions and corresponding regulatory region may be used. Non- limiting examples include ArcA/B, ResD/E, NreA/B/C, and AirSR, and others are known in the art.

[0391] In some embodiments, the genetically engineered bacteria comprise the gene, genes, or gene cassette for producing the payload and/or kill-switch component(s) expressed under the control of an inducible promoter that is responsive to specific molecules or metabolites in the environment, e.g., the mammalian gut. For example, the short-chain fatty acid propionate is a major microbial fermentation metabolite localized to the gut (Hosseini et al., 2011). In one embodiment, the gene or gene cassette for producing the payload and/or kill- switch component(s) is under the control of a propionate-inducible promoter. In a more specific embodiment, the gene, genes or gene cassette for producing the payload and/or kill- switch component(s) is under the control of a propionate-inducible promoter that is activated by the presence of propionate in the mammalian gut. Any molecule or metabolite found in the mammalian gut, in a healthy and/or disease state, may be used to induce payload and/or kill- switch component(s) expression. Any molecule or metabolite found in the mammalian gut, in a healthy and/or disease state, may be used to induce payloadand/or kill-switch component(s) expression. In other embodiments, any molecule or metabolite not normally present in the mammalian gut may be used to induce payload and/or kill- switch component(s) expression, for example, such molecules may be administered to a subject. In some embodiments, any molecule or metabolite transiently present in the mammalian gut may be used to induce payload and/or kill-switch component(s) expression, for example, such molecules may be present as a result of food, drink, or medicine consumption. Non- limiting examples of inducers include propionate, bilirubin, aspartate aminotransferase, alanine aminotransferase, blood coagulation factors II, VII, IX, and X, alkaline phosphatase, gamma glutamyl transferase, hepatitis antigens and antibodies, alpha fetoprotein, anti-mitochondrial, smooth muscle, and anti-nuclear antibodies, sugars, iron, transferrin, ferritin, copper, ceruloplasmin, ammonia, manganese, peptides, peptide hormones, antibiotics and antibiotic analogues, and antibiotic resistance inducers. In alternate embodiments, the gene, genes or gene cassette for producing the metabolic and/or satiety effector molecule is under the control of a pBAD promoter, which is activated in the presence of the sugar arabinose.

[0392] In some embodiments, the gene, genes, or gene cassette for producing the payload and/or kill- switch component(s) is present on a plasmid and operably linked to a promoter that is induced under low-oxygen or anaerobic conditions. In some embodiments, the gene, genes or gene cassette for producing the payload and/or kill-switch component(s) is present in the chromosome and operably linked to a promoter that is induced under low- oxygen or anaerobic conditions. In some embodiments, the gene, genes or gene cassette for producing the payload and/or kill- switch component(s) is present on a plasmid and operably linked to a promoter that is induced by molecules or metabolites that are present in the mammalian gut. In some embodiments, the gene, genes or gene cassette for producing the payload and/or kill- switch component(s) is present on a plasmid and operably linked to a promoter that is induced by molecules or metabolites that are not normally present in the mammalian gut or are transiently present in the mammalian gut. In some embodiments, the gene, genes or gene cassette for producing the payload and/or kill- switch component(s) is present on a plasmid and operably linked to a promoter that is induced by molecules or metabolites that are specific to the mammalian gut. In some embodiments, the gene, genes or gene cassette for producing the payload and/or kill- switch component(s) is present on a chromosome and operably linked to a promoter that is induced by molecules or metabolites that are present in the mammalian gut. In some embodiments, the gene, genes or gene cassette for producing the payload and/or kill-switch component(s) is present on a

chromosome and operably linked to a promoter that is induced by molecules or metabolites that are not normally present in the mammalian gut or are transiently present in the mammalian gut. In some embodiments, the gene, genes or gene cassette for producing the payload and/or kill-switch component(s) is present on a chromosome and operably linked to a promoter that is induced by molecules or metabolites that are specific to the mammalian gut. In some embodiments, the gene, genes or gene cassette for producing the payload and/or kill- switch component(s) is present on a chromosome and operably linked to a promoter that is induced by exposure to tetracycline. In some embodiments, the gene or gene cassette for producing the payload and/or kill- switch component(s) is present on a plasmid and operably linked to a promoter that is induced by exposure to tetracycline. In some embodiments, expression is further optimized by methods known in the art, e.g., by optimizing ribosomal binding sites, manipulating transcriptional regulators, and/or increasing mRNA stability.

[0393] In some embodiments, the genetically engineered bacteria comprise a variant or mutated oxygen level-dependent transcriptional regulator, e.g., FNR, ANR, or DNR, in addition to the corresponding oxygen level-dependent promoter. The variant or mutated oxygen level-dependent transcriptional regulator increases the transcription of operably linked genes in a low-oxygen or anaerobic environment. In some embodiments, the corresponding wild-type transcriptional regulator retains wild-type activity. In alternate embodiments, the corresponding wild-type transcriptional regulator is deleted or mutated to reduce or eliminate wild-type activity. In certain embodiments, the mutant oxygen level- dependent transcriptional regulator is a FNR protein comprising amino acid substitutions that enhance dimerization and FNR activity (see, e.g., Moore et al., 2006).

[0394] In some embodiments, the genetically engineered bacteria comprise an oxygen level-dependent transcriptional regulator from a different bacterial species. In certain embodiments, the mutant oxygen level-dependent transcriptional regulator is a FNR protein from N. gonorrhoeae (see, e.g., Isabella et al., 2011). In some embodiments, the

corresponding wild-type transcriptional regulator is left intact and retains wild-type activity. In alternate embodiments, the corresponding wild-type transcriptional regulator is deleted or mutated to reduce or eliminate wild-type activity.

[0395] In some embodiments, the genetically engineered bacteria express the gene, genes or gene cassette for producing the payload and/or kill-switch component(s) on a plasmid and/or a chromosome. In some embodiments, the gene, genes or gene cassette is expressed under the control of a constitutive promoter. In some embodiments, the gene, genes or gene cassette is expressed under the control of an inducible promoter. In one embodiment, the gene, genes or gene cassette is expressed under the control of an oxygen level-dependent promoter that is activated under low-oxygen or anaerobic environments, e.g., a FNR-responsive promoter.

[0396] FNR-responsive promoter sequences are known in the art, and any suitable FNR-responsive promoter sequence(s) may be used in the genetically engineered bacteria of the invention. Any suitable FNR-responsive promoter(s) may be combined with any suitable gene(s) of interest and/or kill-switch component(s). Non-limiting FNR-responsive promoter sequences are provided herein.

[0397] In other embodiments, the gene, genes or gene cassette for producing the payload and/or kill- switch component(s) is expressed under the control of an oxygen level- dependent promoter fused to a binding site for a transcriptional activator, e.g., CRP. CRP (cyclic AMP receptor protein or catabolite activator protein or CAP) plays a major regulatory role in bacteria by repressing genes responsible for the uptake, metabolism and assimilation of less favorable carbon sources when rapidly metabolizable carbohydrates, such as glucose, are present (Wu et al., 2015). This preference for glucose has been termed glucose repression, as well as carbon catabolite repression (Deutscher, 2008; Gorke and Stiilke, 2008). In some embodiments, expression of the gene or gene cassette is controlled by an oxygen level-dependent promoter fused to a CRP binding site. In some embodiments, expression of the gene or gene cassette is controlled by a FNR promoter fused to a CRP binding site. In these embodiments, cyclic AMP binds to CRP when no glucose is present in the environment. This binding causes a conformational change in CRP, and allows CRP to bind tightly to its binding site. CRP binding then activates transcription of the gene or gene cassette by recruiting RNA polymerase to the FNR promoter via direct protein-protein interactions. In the presence of glucose, cyclic AMP does not bind to CRP and gene transcription is repressed. In some embodiments, an oxygen level-dependent promoter (e.g., a FNR-responsive promoter) fused to a binding site for a transcriptional activator is used to ensure that the gene or gene cassette is not expressed under anaerobic conditions when sufficient amounts of glucose are present, e.g., by adding glucose to growth media in vitro.

[0398] In some embodiments, the genetically engineered bacteria comprise a stably maintained plasmid or chromosome carrying the gene, genes or gene cassette for producing the payload and/or kill-switch component(s), such that the gene, genes or gene cassette can be expressed in the host cell, and the host cell is capable of survival and/or growth in vitro, e.g., in medium, and/or in vivo, e.g., in the gut. In some embodiments, a bacterium may comprise multiple copies of the gene, gene or gene cassette for producing the metabolic and/or satiety effector molecule. In some embodiments, gene, genes or gene cassette for producing the payload is expressed on a low-copy plasmid. In some embodiments, the low-copy plasmid may be useful for increasing stability of expression. In some embodiments, the low-copy plasmid may be useful for decreasing leaky expression under non-inducing conditions. In some embodiments, gene, genes or gene cassette for producing the payload and/or kill- switch component(s) is expressed on a high-copy plasmid. In some embodiments, the high-copy plasmid may be useful for increasing gene, genes or gene cassette expression. In some embodiments, gene, genes or gene cassette for producing the payload and/or kill- switch component(s) is expressed on a chromosome.

[0399] In some embodiments, the bacteria are genetically engineered to include multiple mechanisms of action (MOAs), e.g., circuits producing multiple copies of the same product (e.g., to enhance copy number) or circuits performing multiple different functions. Examples of insertion sites include, but are not limited to, malE/K, insB/I, araC/BAD, lacZ, dap A, cea, and other shown in Fig. 14. For example, the genetically engineered bacteria may include four copies of the payload and/or kill-switch component(s) inserted at four different insertion sites, e.g., malE/K, insB/I, araC/BAD, and lacZ. Alternatively, the genetically engineered bacteria may include three copies of the payload inserted at three different insertion sites, e.g., malE/K, insB/I, and lacZ, and three copies of a kill-switch component(s) inserted at three different insertion sites, e.g., dapA, cea, and araC/BAD.

[0400] In some embodiments, the genetically engineered bacteria produce at least about 1.5-fold, at least about 2-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 30-fold, at least about 50-fold, at least about 100-fold, at least about 200-fold, at least about 300-fold, at least about 400-fold, at least about 500-fold, at least about 600-fold, at least about 700-fold, at least about 800-fold, at least about 900-fold, at least about 1,000- fold, or at least about 1,500- fold more of a payload and/or kill-switch component(s) under inducing conditions than unmodified bacteria of the same subtype under the same conditions.

Mutagenesis

[0401] In some embodiments, an inducible promoter is operably linked to a detectable product, e.g., GFP, and can be used to screen for mutants. In some embodiments, an oxygen level-dependent promoter is operably linked to a detectable product, e.g., GFP, and can be used to screen for mutants. In some embodiments, the oxygen level-dependent promoter is mutagenized, and mutants are selected based upon the level of detectable product, e.g., by flow cytometry, fluorescence-activated cell sorting (FACS) when the detectable product fluoresces. In some embodiments, one or more transcription factor binding sites is mutagenized to increase or decrease binding. In alternate embodiments, the wild-type binding sites are left intact and the remainder of the regulatory region is subjected to mutagenesis. In some embodiments, the mutant promoter is inserted into the genetically engineered bacteria of the invention to increase expression of the payload and/or kill- switch component(s) in low-oxygen conditions, as compared to unmutated bacteria of the same subtype under the same conditions. In some embodiments, the oxygen level-sensing transcription factor and/or the oxygen level-dependent promoter is a synthetic, non-naturally occurring sequence.

[0402] In some embodiments, the gene encoding a payload and/or kill-switch component(s) is mutated to increase expression and/or stability of said molecule in low oxygen conditions, as compared to unmutated bacteria of the same subtype under the same conditions. In some embodiments, one or more of the genes in a gene cassette for producing a payload and/or kill-switch component(s) is mutated to increase expression of said molecule in low oxygen conditions, as compared to unmutated bacteria of the same subtype under the same conditions.

Multiple mechanisms of action

[0403] In some embodiments, the bacteria are genetically engineered to include multiple mechanisms of action (MOAs), e.g., circuits producing multiple copies of the same product (e.g., to enhance copy number) or circuits performing multiple different functions. In some embodiments, any of the gene(s) or gene cassette(s) of the present disclosure may be integrated into the bacterial chromosome at one or more integration sites. One or more copies of a gene, genes, or gene cassette of interest may be integrated into the bacterial chromosome. Having multiple copies of a gene of interest integrated into the chromosome allows for greater production of the molecule of interest and also permits fine-tuning of the level of expression. Alternatively, different circuits described herein, such as any of the kill- switch circuits, in addition to the therapeutic gene(s) or gene cassette(s) could be integrated into the bacterial chromosome at one or more different integration sites to perform multiple different functions.

[0404] For example, Fig. 14 depicts a map of integration sites within the E. coli Nissle chromosome. Fig. 15 depicts three bacterial strains wherein the RFP gene has been successfully integrated into the bacterial chromosome at an integration site. Examples of insertion sites include, but are not limited to, malE/K, insB/I, araC/BAD, lacZ, dapA, cea, and other shown in Fig. 14. For example, the genetically engineered bacteria may include four copies of a gene of interest inserted at four different insertion sites, e.g., malE/K, insB/I, araC/BAD, and lacZ. Alternatively, the genetically engineered bacteria may include three copies of a gene of interst inserted at three different insertion sites, e.g., malE/K, insB/I, and lacZ, and three copies of a kill- switch component inserted at three different insertion sites, e.g., dap A, cea, and araC/BAD.

Secretion

[0405] In some embodiments, the genetically engineered bacteria further comprise a native secretion mechanism (e.g., gram positive bacteria) or non-native secretion mechanism (e.g., gram negative bacteria) that is capable of secreting a molecule from the bacterial cytoplasm. Many bacteria have evolved sophisticated secretion systems to transport substrates across the bacterial cell envelope. Substrates, such as small molecules, proteins, and DNA, may be released into the extracellular space or periplasm (such as the gut lumen or other space), injected into a target cell, or associated with the bacterial membrane.

[0406] In Gram-negative bacteria, secretion machineries may span one or both of the inner and outer membranes. In some embodiments, the genetically engineered bacteria further comprise a non-native double membrane- spanning secretion system. Double membrane- spanning secretion systems include, but are not limited to, the type I secretion system (TISS), the type II secretion system (T2SS), the type III secretion system (T3SS), the type IV secretion system (T4SS), the type VI secretion system (T6SS), and the resistance- nodulation-division (RND) family of multi-drug efflux pumps (Pugsley 1993; Gerlach et al., 2007; Collinson et al., 2015; Costa et al., 2015; Reeves et al., 2015; WO2014138324A1, incorporated herein by reference). Examples of such secretion systems are shown in Figures 3-6. Mycobacteria, which have a Gram-negative-like cell envelope, may also encode a type VII secretion system (T7SS) (Stanley et al., 2003). With the exception of the T2SS, double membrane- spanning secretions generally transport substrates from the bacterial cytoplasm directly into the extracellular space or into the target cell. In contrast, the T2SS and secretion systems that span only the outer membrane may use a two-step mechanism, wherein substrates are first translocated to the periplasm by inner membrane- spanning transporters, and then transferred to the outer membrane or secreted into the extracellular space. Outer membrane- spanning secretion systems include, but are not limited to, the type V secretion or autotransporter system (T5SS), the curli secretion system, and the chaperone-usher pathway for pili assembly (Saier, 2006; Costa et al., 2015). [0407] In some embodiments, the genetically engineered bacteria of the invention further comprise a type III or a type Ill-like secretion system (T3SS) from Shigella,

Salmonella, E. coli, Bivrio, Burkholderia, Yersinia, Chlamydia, or Pseudomonas. The T3SS is capable of transporting a protein from the bacterial cytoplasm to the host cytoplasm through a needle complex. The T3SS may be modified to secrete the molecule from the bacterial cytoplasm, but not inject the molecule into the host cytoplasm. Thus, the molecule is secreted into the gut lumen or other extracellular space. In some embodiments, the genetically engineered bacteria comprise said modified T3SS and are capable of secreting the molecule of interest from the bacterial cytoplasm. In some embodiments, the secreted molecule, such as a heterologouse protein or peptide comprises a type III secretion sequence that allows the molecule of interest to be secreted from the bacteria.

[0408] In some embodiments, a flagellar type III secretion pathway is used to secrete the molecule of interest. In some embodiments, an incomplete flagellum is used to secrete a therapeutic peptide of interest by recombinantly fusing the peptide to an N-terminal flagellar secretion signal of a native flagellar component. In this manner, the intracellularly expressed chimeric peptide can be mobilized across the inner and outer membranes into the surrounding host environment.

[0409] In some embodiments, a Type V Autotransporter Secretion System is used to secrete the molecule of interest, e.g., therapeutic peptide. Due to the simplicity of the machinery and capacity to handle relatively large protein fluxes, the Type V secretion system is attractive for the extracellular production of recombinant proteins. As shown in Figure 10, a therapeutic peptide (star) can be fused to an N-terminal secretion signal, a linker, and the beta-domain of an autotransporter. The N-terminal signal sequence directs the protein to the SecA-YEG machinery which moves the protein across the inner membrane into the periplasm, followed by subsequent cleavage of the signal sequence. The Beta-domain is recruited to the Bam complex ('Beta-barrel assembly machinery') where the beta-domain is folded and inserted into the outer membrane as a beta-barrel structure. The therapeutic peptide is thread through the hollow pore of the beta-barrel structure ahead of the linker sequence. Once exposed to the extracellular environment, the therapeutic peptide can be freed from the linker system by an autocatalytic cleavage (left side of Bam complex) or by targeting of a membrane-associated peptidase (black scissors; right side of Bam complex) to a complimentary protease cut site in the linker. Thus, in some embodiments, the secreted molecule, such as a heterologouse protein or peptide comprises an N-terminal secretion signal, a linker, and beta-domain of an autotransporter so as to allow the molecule to be secreted from the bacteria.

[0410] In some embodiments, a Hemolysin-based Secretion System is used to secrete the molecule of interest, e.g., therapeutic peptide. Type I Secretion systems offer the advantage of translocating their passenger peptide directly from the cytoplasm to the extracellular space, obviating the two-step process of other secretion types. Figure 11 shows the alpha-hemolysin (HlyA) of uropathogenic Escherichia coli. This pathway uses HlyB, an ATP-binding cassette transporter; HlyD, a membrane fusion protein; and TolC , an outer membrane protein. The assembly of these three proteins forms a channel through both the inner and outer membranes. Natively, this channel is used to secrete HlyA, however, to secrete the therapeutic peptide of the present disclosure, the secretion signal-containing C- terminal portion of HlyA is fused to the C-terminal portion of a therapeutic peptide (star) to mediate secretion of this peptide.

[0411] In alternate embodiments, the genetically engineered bacteria further comprise a non-native single membrane- spanning secretion system. Single membrane- spanning transporters may act as a component of a secretion system, or may export substrates independently. Such transporters include, but are not limited to, ATP-binding cassette translocases, flagellum/virulence-related translocases, conjugation-related translocases, the general secretory system (e.g., the SecYEG complex in E. coli), the accessory secretory system in mycobacteria and several types of Gram-positive bacteria (e.g., Bacillus anthracis, Lactobacillus johnsonii, Corynebacterium glutamicum, Streptococcus gordonii,

Staphylococcus aureus), and the twin-arginine translocation (TAT) system (Saier, 2006; Rigel and Braunstein, 2008; Albiniak et al., 2013). It is known that the general secretory and TAT systems can both export substrates with cleavable N-terminal signal peptides into the periplasm, and have been explored in the context of biopharmaceutical production. The TAT system may offer particular advantages, however, in that it is able to transport folded substrates, thus eliminating the potential for premature or incorrect folding. In certain embodiments, the genetically engineered bacteria comprise a TAT or a TAT-like system and are capable of secreting the molecule of interest from the bacterial cytoplasm. One of ordinary skill in the art would appreciate that the secretion systems disclosed herein may be modified to act in different species, strains, and subtypes of bacteria, and/or adapted to deliver different payloads. [0412] In order to translocate a protein, e.g., therapeutic polypeptide, to the extracellular space, the polypeptide must first be translated intracellularly, mobilized across the inner membrane and finally mobilized across the outer membrane. Many effector proteins (e.g., therapeutic polypeptides) - particularly those of eukaryotic origin - contain disulphide bonds to stabilize the tertiary and quaternary structures. While these bonds are capable of correctly forming in the oxidizing periplasmic compartment with the help of periplasmic chaperones, in order to translocate the polypeptide across the outer membrane the disulphide bonds must be reduced and the protein unfolded again.

[0413] One way to secrete properly folded proteins in gram-negative bacteria- particularly those requiring disulphide bonds - is to target the periplasm in a bacteria with a destabilized outer membrane. In this manner the protein is mobilized into the oxidizing environment and allowed to fold properly. In contrast to orchestrated extracellular secretion systems, the protein is then able to escape the periplasmic space in a correctly folded form by membrane leakage. These "leaky" gram-negative mutants are therefore capable of secreting bioactive, properly disulphide-bonded polypeptides. In some embodiments, the genetically engineered bacteria have a "leaky" or de-stabilized outer membrane. Destabilizing the bacterial outer membrane to induce leakiness can be accomplished by deleting or

mutagenizing genes responsible for tethering the outer membrane to the rigid peptidoglycan skeleton, including for example, lpp, ompC, ompA, ompF, tolA, to IB, pal, degS, degP, and nlpl. Lpp is the most abundant polypeptide in the bacterial cell existing at -500,000 copies per cell and functions as the primary 'staple' of the bacterial cell wall to the peptidoglycan. 1.

Silhavy, T. J., Kahne, D. & Walker, S. The bacterial cell envelope. Cold Spring Harb Perspect Biol 2, a000414 (2010). TolA-PAL and OmpA complexes function similarly to Lpp and are other deletion targets to generate a leaky phenotype. Additionally, leaky phenotypes have been observed when periplasmic proteases are deactived. The periplasm is very densely packed with protein and therefore encode several periplasmic proteins to facilitate protein turnover. Removal of periplasmic proteases such as degS, degP or nlpl can induce leaky phenotypes by promoting an excessive build-up of periplasmic protein. Mutation of the proteases can also preserve the effector polypeptide by preventing targeted degradation by these proteases. Moreover, a combination of these mutations may synergistically enhance the leaky phenotype of the cell without major sacrifices in cell viability. Thus, in some embodiments, the engineered bacteria have one or more deleted or mutated membrane genes. In some embodiments, the engineered bacteria have a deleted or mutated lpp gene. In some embodiments, the engineered bacteria have one or more deleted or mutated gene(s), selected from ompA, ompA, and ompF genes. In some embodiments, the engineered bacteria have one or more deleted or mutated gene(s), selected from tolA, tolB, and pal genes, in some embodiments, the engineered bacteria have one or more deleted or mutated periplasmic protease genes. In some embodiments, the engineered bacteria have one or more deleted or mutated periplasmic protease genes selected from degS, degP, and nlpl. In some

embodiments, the engineered bacteria have one or more deleted or mutated gene(s), selected from lpp, ompA, ompA, ompF, tolA, tolB, pal, degS, degP, and nlpl genes.

[0414] To minimize disturbances to cell viability, the leaky phenotype can be made inducible by placing one or more membrane or periplasmic protease genes, e.g., selected from lpp, ompA, ompA, ompF, tolA, to IB, pal, degS, degP, and nlpl, under the control of an inducible promoterFor example, expression of lpp or other cell wall stability protein or periplasmic protease can be repressed in conditions where the therapeutic polypeptide needs to be delivered (secreted). For instance, under inducing conditions a transcriptional repressor protein or a designed antisense RNA can be expressed which reduces transcription or translation of a target membrane or periplasmic protease gene. Conversely, overexpression of certain peptides can result in a destabilized phenotype, e.g., ove expression of colicins or the third topological domain of TolA, which peptide overexpression can be induced in conditions in which the therapeutic polypeptide needs to be delivered (secreted). These sorts of strategies would decouple the fragile, leaky phenotypes from biomass production. Thus, in some embodiments, the engineered bacteria have one or more membrane and/or periplasmic protease genes under the control of an inducible promoter.

The tables below list secretion systems for Gram positive bacteria and Gram negative bacteria.

Table 9. Secretion systems for gram positive bacteria

Table 10. Secretion Systems for Gram negative bacteria

translocase

Bcl-2 Eukaryotic 1.A.2 + 1? None

Bcl-2 family 1

(programmed

cell death)

Gram-negative bacterial outer membrane channel-forming translocases

MTB Main 3.A.1 - 14 ATP;

(IISP) terminal 5 PMF

branch of the

general

secretory

translocase

FUP AT-1 Fimbrial 1.B.1 +^b None

usher protein 1 +^b - None

^!

Autotransport 1.B.1

er-1 2

AT-2 Autotransport 1.B.4 +^b None

OMF er-2 0 +^b +(?) None

^!

(ISP) 1.B.1

7

TPS 1.B.2 + + None

Secretin 0 +^b None

^!

(IISP and 1.B.2

IISP) 2

OmpIP Outer 1.B.3 + + >4 None

membrane 3 (mitochon ?

insertion dria;

porin chloroplast

s)

[0415] The above tables for gram positive and gram negative bacteria list secretion systems that can be used to secrete polypeptides and other molecules from the engineered bacteria, which are reviewed in Milton H. Saier, Jr. Microbe / Volume 1, Number 9, 2006 "Protein Secretion Systems in Gram-Negative Bacteria Gram-negative bacteria possess many protein secretion-membrane insertion systems that apparently evolved independently", the contents of which is herein incorporated by reference in its entirety.

Essential genes and auxotrophs

[0416] As used herein, the term "essential gene" refers to a gene which is necessary to for cell growth and/or survival. Bacterial essential genes are well known to one of ordinary skill in the art, and can be identified by directed deletion of genes and/or random mutagenesis and screening (see, e.g., Zhang and Lin, 2009, DEG 5.0, a database of essential genes in both prokaryotes and eukaryotes, Nucl. Acids Res., 37:D455-D458 and Gerdes et al., Essential genes on metabolic maps, Curr. Opin. Biotechnol., 17(5):448-456, the entire contents of each of which are expressly incorporated herein by reference).

[0417] An "essential gene" may be dependent on the circumstances and environment in which an organism lives. For example, a mutation of, modification of, or excision of an essential gene may result in the genetically engineered bacteria of the disclosure becoming an auxotroph. An auxotrophic modification is intended to cause bacteria to die in the absence of an exogenously added nutrient essential for survival or growth because they lack the gene(s) necessary to produce that essential nutrient.

[0418] An auxotrophic modification is intended to cause bacteria to die in the absence of an exogenously added nutrient essential for survival or growth because they lack the gene(s) necessary to produce that essential nutrient. In some embodiments, any of the genetically engineered bacteria described herein also comprise a deletion or mutation in a gene required for cell survival and/or growth. In one embodiment, the essential gene is a DNA synthesis gene, for example, thyA. In another embodiment, the essential gene is a cell wall synthesis gene, for example, dapA. In yet another embodiment, the essential gene is an amino acid gene, for example, serA or MetA. Any gene required for cell survival and/or growth may be targeted, including but not limited to, cysE, glnA, ilvD, leuB, lysA, serA, metA, glyA, hisB, ilvA, pheA, pro A, thrC, trpC, tyrA, thyA, uraA, dap A, dapB, dapD, dapE, dapF, flhD, metB, metC, proAB, and thil, as long as the corresponding wild-type gene product is not produced in the bacteria. For example, thymine is a nucleic acid that is required for bacterial cell growth; in its absence, bacteria undergo cell death. The thyA gene encodes thimidylate synthetase, an enzyme that catalyzes the first step in thymine synthesis by converting dUMP to dTMP (Sat et al., 2003). In some embodiments, the bacterial cell of the disclosure is a thyA auxotroph in which the thyA gene is deleted and/or replaced with an unrelated gene. A thyA auxotroph can grow only when sufficient amounts of thymine are present, e.g., by adding thymine to growth media in vitro, or in the presence of high thymine levels found naturally in the human gut in vivo. In some embodiments, the bacterial cell of the disclosure is auxotrophic in a gene that is complemented when the bacterium is present in the mammalian gut. Without sufficient amounts of thymine, the thyA auxotroph dies. In some embodiments, the auxotrophic modification is used to ensure that the bacterial cell does not survive in the absence of the auxotrophic gene product (e.g., outside of the gut). [0419] Diaminopimelic acid (DAP) is an amino acid synthetized within the lysine biosynthetic pathway and is required for bacterial cell wall growth (Meadow et al., 1959; Clarkson et al., 1971). In some embodiments, any of the genetically engineered bacteria described herein is a dapD auxotroph in which dapD is deleted and/or replaced with an unrelated gene. A dapD auxotroph can grow only when sufficient amounts of DAP are present, e.g., by adding DAP to growth media in vitro. Without sufficient amounts of DAP, the dapD auxotroph dies. In some embodiments, the auxotrophic modification is used to ensure that the bacterial cell does not survive in the absence of the auxotrophic gene product (e.g., outside of the gut).

[0420] In other embodiments, the genetically engineered bacterium of the present disclosure is a uraA auxotroph in which uraA is deleted and/or replaced with an unrelated gene. The uraA gene codes for UraA, a membrane-bound transporter that facilitates the uptake and subsequent metabolism of the pyrimidine uracil (Andersen et al., 1995). A uraA auxotroph can grow only when sufficient amounts of uracil are present, e.g., by adding uracil to growth media in vitro. Without sufficient amounts of uracil, the uraA auxotroph dies. In some embodiments, auxotrophic modifications are used to ensure that the bacteria do not survive in the absence of the auxotrophic gene product (e.g., outside of the gut).

[0421] In complex communities, it is possible for bacteria to share DNA. In very rare circumstances, an auxotrophic bacterial strain may receive DNA from a non-auxotrophic strain, which repairs the genomic deletion and permanently rescues the auxotroph.

Therefore, engineering a bacterial strain with more than one auxotroph may greatly decrease the probability that DNA transfer will occur enough times to rescue the auxotrophy. In some embodiments, the genetically engineered bacteria of the invention comprise a deletion or mutation in two or more genes required for cell survival and/or growth.

[0422] Other examples of essential genes include, but are not limited to yhbV, yagG, hemB, secD, secF, ribD, ribE, thiL, dxs, ispA, dnaX, adk, hemH, IpxH, cysS, fold, rplT, infC, thrS, nadE, gap A, yeaZ, aspS, argS, pgsA, yefM, metG, folE, yejM, gyrA, nrdA, nrdB, folC, accD, fabB, gltX, ligA, zip A, dapE, dap A, der, hisS, ispG, suhB, tadA, acpS, era, rnc, ftsB, eno, pyrG, chpR, lgt, fbaA, pgk, yqgD, metK, yqgF, plsC, ygiT, pare, ribB, cca, ygjD, tdcF, yraL, yihA, ftsN, murl, murB, birA, secE, nusG, rplJ, rplL, rpoB, rpoC, ubiA, plsB, lexA, dnaB, ssb, alsK, groS, psd, orn, yjeE, rpsR, chpS, ppa, valS, yjgP, yjgQ, dnaC, ribF, IspA, ispH, dapB, folA, imp, yabQ, ftsL, ftsl, murE, murF, mraY, murD, ftsW, murG, murC, ftsQ, ftsA, ftsZ, lpxC, secM, sec A, can, folK, hemL, yadR, dapD, map, rpsB, infB ,nusA, ftsH, obgE, rpmA, rplU, ispB, murA, yrbB, yrbK, yhbN, rpsl, rplM, degS, mreD, mreC, mreB, accB, accC, yrdC, def, fmt, rplQ, rpoA, rpsD, rpsK, rpsM, entD, mrdB, mrdA, nadD, hlepB, rpoE, pssA, yfiO, rplS, trmD, rpsP, ffh, grpE, yfjB, csrA, ispF, ispD, rplW, rplD, rplC, rpsJ, fusA, rpsG, rpsL, trpS, yrfF, asd, rpoH, ftsX, ftsE, ftsY, frr, dxr, ispU, rfaK, kdtA, coaD, rpmB, dip, dut, gmk, spot, gyrB, dnaN, dnaA, rpmH, rnpA, yidC, tnaB, glmS, glmU, wzyE, hemD, hemC, yigP, ubiB, ubiD, hemG, secY, rplO, rpmD, rpsE, rplR, rplF, rpsH, rpsN, rplE, rplX, rplN, rpsQ, rpmC, rplP, rpsC, rplV, rpsS, rplB, cdsA, yaeL, yaeT, lpxD, fabZ, lpxA, lpxB, dnaE, accA, tilS, proS, yafF, tsf, pyrH, olA, rlpB, leuS, lnt, glnS, lldA, cydA, infA, cydC, ftsK, lolA, serS, rpsA, msbA, lpxK, kdsB, mukF, mukE, mukB, asnS, fab A, mviN, rne, yceQ, fabD, fabG, acpP, tmk, ho IB, lolC, lolD, lolE, purB, ymfK, minE, mind, pth, rsA, ispE, lolB, hemA, prfA, prmC, kdsA, top A, rib A, fabl, racR, die A, ydfB, tyrS, ribC, ydiL, pheT, pheS, yhhQ, bcsB, glyQ, yibJ, and gpsA. Other essential genes are known to those of ordinary skill in the art.

[0423] In some embodiments, the genetically engineered bacterium of the present disclosure is a synthetic ligand-dependent essential gene (SLiDE) bacterial cell. SLiDE bacterial cells are synthetic auxotrophs with a mutation in one or more essential genes that only grow in the presence of a particular ligand (see Lopez and Anderson "Synthetic

Auxotrophs with Ligand-Dependent Essential Genes for a BL21 (DE3 Biosafety Strain, "ACS Synthetic Biology (2015) DOI: 10.1021/acssynbio.5b00085, the entire contents of which are expressly incorporated herein by reference).

[0424] In some embodiments, the SLiDE bacterial cell comprises a mutation in an essential gene. In some embodiments, the essential gene is selected from the group consisting of pheS, dnaN, tyrS, metG, and adk. In some embodiments, the essential gene is dnaN comprising one or more of the following mutations: H191N, R240C, I317S, F319V, L340T, V347I, and S345C. In some embodiments, the essential gene is dnaN comprising the mutations H191N, R240C, I317S, F319V, L340T, V347I, and S345C. In some

embodiments, the essential gene is pheS comprising one or more of the following mutations: F125G, P183T, P184A, R186A, and I188L. In some embodiments, the essential gene is pheS comprising the mutations F125G, P183T, P184A, R186A, and I188L. In some embodiments, the essential gene is tyrS comprising one or more of the following mutations: L36V, C38A and F40G. In some embodiments, the essential gene is tyrS comprising the mutations L36V, C38A and F40G. In some embodiments, the essential gene is metG comprising one or more of the following mutations: E45Q, N47R, I49G, and A51C. In some embodiments, the essential gene is metG comprising the mutations E45Q, N47R, I49G, and A51C. In some embodiments, the essential gene is adk comprising one or more of the following mutations: I4L, L5I and L6G. In some embodiments, the essential gene is adk comprising the mutations I4L, L5I and L6G.

[0425] In some embodiments, the genetically engineered bacterium is complemented by a ligand. In some embodiments, the ligand is selected from the group consisting of benzothiazole, indole, 2-aminobenzothiazole, indole-3-butyric acid, indole-3-acetic acid, and L-histidine methyl ester. For example, bacterial cells comprising mutations in metG (E45Q, N47R, I49G, and A51C) are complemented by benzothiazole, indole, 2-aminobenzothiazole, indole- 3 -butyric acid, indole- 3 -acetic acid or L-histidine methyl ester. Bacterial cells comprising mutations in dnaN (H191N, R240C, I317S, F319V, L340T, V347I, and S345C) are complemented by benzothiazole, indole or 2-aminobenzothiazole. Bacterial cells comprising mutations in pheS (F125G, P183T, P184A, R186A, and I188L) are

complemented by benzothiazole or 2-aminobenzothiazole. Bacterial cells comprising mutations in tyrS (L36V, C38A, and F40G) are complemented by benzothiazole or 2- aminobenzothiazole. Bacterial cells comprising mutations in adk (I4L, L5I and L6G) are complemented by benzothiazole or indole.

[0426] In some embodiments, the genetically engineered bacterium comprises more than one mutant essential gene that renders it auxotrophic to a ligand. In some embodiments, the bacterial cell comprises mutations in two essential genes. For example, in some embodiments, the bacterial cell comprises mutations in tyrS (L36V, C38A, and F40G) and metG (E45Q, N47R, I49G, and A51C). In other embodiments, the bacterial cell comprises mutations in three essential genes. For example, in some embodiments, the bacterial cell comprises mutations in tyrS (L36V, C38A, and F40G), metG (E45Q, N47R, I49G, and A51C), and pheS (F125G, P183T, P184A, R186A, and I188L).

[0427] In some embodiments, the genetically engineered bacterium is a conditional auxotroph whose essential gene(s) is replaced using the arabinose system shown in Fig 1.

[0428] In some embodiments, the genetically engineered bacterium of the disclosure is an auxotroph and also comprises kill-switch circuitry, such as any of the kill-switch components and systems described herein. For example, the genetically engineered bacteria may comprise a deletion or mutation in an essential gene required for cell survival and/or growth, for example, in a DNA synthesis gene, for example, thyA, cell wall synthesis gene, for example, dapA and/or an amino acid gene, for example, serA or MetA and may also comprise a toxin gene that is regulated by one or more transcriptional activators that are expressed in response to an environmental condition(s) and/or signal(s) (such as the described arabinose system) or regulated by one or more recombinases that are expressed upon sensing an exogenous environmental condition(s) and/or signal(s) (such as the recombinase systems described herein). Other embodiments are described in Wright et al., "GeneGuard: A Modular Plasmid System Designed for Biosafety," ACS Synthetic Biology (2015) 4: 307-16, the entire contents of which are expressly incorporated herein by reference). In some embodiments, the genetically engineered bacterium of the disclosure is an auxotroph and also comprises kill-switch circuitry, such as any of the kill-switch components and systems described herein, as well as another biosecurity system, such a conditional origin of replication (Wright et al., 2015). In other embodiments, auxotrophic modifications may also be used to screen for mutant bacteria that produce the payload molecule.

Table 11. Non-limiting Examples of Bacterial gens Useful for Generation of an Auxotroph

[0429] Table 11 shows the survival of various amino acid auxotrophs in the mouse gut, as detected 24 hrs and 48 hrs post-gavage. These auxotrophs were generated using BW25113, a non-Nissle strain of E. coli.

Table 12. Survival of amino acid auxotrophs in the mouse

Genetic regulatory circuits

[0430] In some embodiments, the genetically engineered bacteria comprise multi- layered genetic regulatory circuits for expressing the constructs described herein (see, e.g., U.S. Provisional Application No. 62/184,811, incorporated herein by reference in its entirety). The genetic regulatory circuits are useful to screen for mutant bacteria that produce a gene of interest or rescue an auxotroph. In certain embodiments, the invention provides methods for selecting genetically engineered bacteria that produce one or more genes of interest.

[0431] In some embodiments, the invention provides genetically engineered bacteria comprising a gene, genes or gene cassette for producing one or more payload(s) and/or one or more kill-switch component(s) and a T7 polymerase-regulated genetic regulatory circuit. For example, the genetically engineered bacteria comprise a first gene encoding a T7 polymerase, wherein the first gene is operably linked to a fumarate and nitrate reductase regulator (FNR)- responsive promoter; a second gene or gene cassette for producing a payload and/or kill- switch component, wherein the second gene or gene cassette is operably linked to a T7 promoter that is induced by the T7 polymerase; and a third gene encoding an inhibitory factor, lysY, that is capable of inhibiting the T7 polymerase. In the presence of oxygen, FNR does not bind the FNR-responsive promoter, and the payload and/or kill-switch component is not expressed. LysY is expressed constitutively (P-lac constitutive) and further inhibits T7 polymerase. In the absence of oxygen, FNR dimerizes and binds to the FNR-responsive promoter, T7 polymerase is expressed at a level sufficient to overcome lysY inhibition, and the payload and/or kill-switch component is expressed. In some embodiments, the lysY gene is operably linked to an additional FNR binding site. In the absence of oxygen, FNR dimerizes to activate T7 polymerase expression as described above, and also inhibits lysY expression.

[0432] In some embodiments, the invention provides genetically engineered bacteria comprising a gene, genes or gene cassette for producing one or more payload(s) and/or one or more kill-switch component(s) and a protease-regulated genetic regulatory circuit. For example, the genetically engineered bacteria comprise a first gene encoding an mf-lon protease, wherein the first gene is operably linked to a FNR-responsive promoter; a second gene or gene cassette for producing a payload and/or kill- switch component operably linked to a tet regulatory region (tetO); and a third gene encoding an mf-lon degradation signal linked to a tet repressor (tetR), wherein the tetR is capable of binding to the tet regulatory region and repressing expression of the second gene or gene cassette. The mf-lon protease is capable of recognizing the mf-lon degradation signal and degrading the tetR. In the presence of oxygen, FNR does not bind the FNR-responsive promoter, the repressor is not degraded, and the payload and/or kill-switch component is not expressed. In the absence of oxygen, FNR dimerizes and binds the FNR-responsive promoter, thereby inducing expression of mf- lon protease. The mf-lon protease recognizes the mf-lon degradation signal and degrades the tetR, and the metabolic or satiety effector molecule is expressed.

[0433] In some embodiments, the invention provides genetically engineered bacteria comprising a gene or gene cassette for producing one or more payload(s) and/or one or more kill- switch component(s) and a repressor-regulated genetic regulatory circuit. For example, the genetically engineered bacteria comprise a first gene encoding a first repressor, wherein the first gene is operably linked to a FNR-responsive promoter; a second gene or gene cassette for producing a payload and/or kill-switch component operably linked to a first regulatory region comprising a constitutive promoter; and a third gene encoding a second repressor, wherein the second repressor is capable of binding to the first regulatory region and repressing expression of the second gene or gene cassette. The third gene is operably linked to a second regulatory region comprising a constitutive promoter, wherein the first repressor is capable of binding to the second regulatory region and inhibiting expression of the second repressor. In the presence of oxygen, FNR does not bind the FNR-responsive promoter, the first repressor is not expressed, the second repressor is expressed, and the payload and/or kill- switch component is not expressed. In the absence of oxygen, FNR dimerizes and binds the FNR-responsive promoter, the first repressor is expressed, the second repressor is not expressed, and the payload and/or kill-switch component is expressed.

[0434] Examples of repressors useful in these embodiments include, but are not limited to, ArgR, TetR, ArsR, AscG, Lad, CscR, DeoR, DgoR, FruR, GalR, GatR, CI, LexA, RafR, QacR, and PtxS (US20030166191).

[0435] In some embodiments, the invention provides genetically engineered bacteria comprising a gene or gene cassette for producing a one or more payload(s) and/or one or more kill-switch component(s) and a regulatory RNA-regulated genetic regulatory circuit. For example, the genetically engineered bacteria comprise a first gene encoding a regulatory RNA, wherein the first gene is operably linked to a FNR-responsive promoter, and a second gene or gene cassette for producing a payload and/or kill- switch component. The second gene or gene cassette is operably linked to a constitutive promoter and further linked to a nucleotide sequence capable of producing an mRNA hairpin that inhibits translation of the metabolic or satiety effector molecule. The regulatory RNA is capable of eliminating the mRNA hairpin and inducing translation via the ribosomal binding site. In the presence of oxygen, FNR does not bind the FNR-responsive promoter, the regulatory RNA is not expressed, and the mRNA hairpin prevents the metabolic or satiety effector molecule from being translated. In the absence of oxygen, FNR dimerizes and binds the FNR-responsive promoter, the regulatory RNA is expressed, the mRNA hairpin is eliminated, and the payload and/or kill-switch component is expressed.

[0436] In some embodiments, the invention provides genetically engineered bacteria comprising a gene or gene cassette for producing one or more payload(s) and/or one or more kill- switch component(s) and a CRIS PR-regulated genetic regulatory circuit. For example, the genetically engineered bacteria comprise a Cas9 protein; a first gene encoding a CRISPR guide RNA, wherein the first gene is operably linked to a FNR-responsive promoter; a second gene or gene cassette for producing a payload and/or kill-switch component, wherein the second gene or gene cassette is operably linked to a regulatory region comprising a constitutive promoter; and a third gene encoding a repressor operably linked to a constitutive promoter, wherein the repressor is capable of binding to the regulatory region and repressing expression of the second gene or gene cassette. The third gene is further linked to a CRISPR target sequence that is capable of binding to the CRISPR guide RNA, wherein said binding to the CRISPR guide RNA induces cleavage by the Cas9 protein and inhibits expression of the repressor. In the presence of oxygen, FNR does not bind the FNR-responsive promoter, the guide RNA is not expressed, the repressor is expressed, and payload and/or kill-switch component is not expressed. In the absence of oxygen, FNR dimerizes and binds the FNR- responsive promoter, the guide RNA is expressed, the repressor is not expressed, and the payload and/or kill-switch component is expressed.

[0437] In some embodiments, the invention provides genetically engineered bacteria comprising a gene, genes, or gene cassette for producing one or more payload(s) and/or one or more kill-switch component(s) and a recombinase-regulated genetic regulatory circuit. For example, the genetically engineered bacteria comprise a first gene encoding a recombinase, wherein the first gene is operably linked to a FNR-responsive promoter, and a second gene or gene cassette for producing a payload and/or kill-switch component operably linked to a constitutive promoter. The second gene or gene cassette is inverted in orientation (3' to 5') and flanked by recombinase binding sites, and the recombinase is capable of binding to the recombinase binding sites to induce expression of the second gene or gene cassette by reverting its orientation (5' to 3'). In the presence of oxygen, FNR does not bind the FNR- responsive promoter, the recombinase is not expressed, the gene or gene cassette remains in the 3' to 5' orientation, and no functional payload and/or kill-switch component is produced. In the absence of oxygen, FNR dimerizes and binds the FNR-responsive promoter, the recombinase is expressed, the gene or gene cassette is reverted to the 5' to 3' orientation, and functional payload and/or kill- switch component is produced.

[0438] In some embodiments, the invention provides genetically engineered bacteria comprising a gene or gene cassette for producing one or more payload(s) and/or one or more kill- switch component(s) and a polymerase- and recombinase-regulated genetic regulatory circuit. For example, the genetically engineered bacteria comprise a first gene encoding a recombinase, wherein the first gene is operably linked to a FNR-responsive promoter; a second gene or gene cassette for producing a payload and/or kill-switch component operably linked to a T7 promoter; a third gene encoding a T7 polymerase, wherein the T7 polymerase is capable of binding to the T7 promoter and inducing expression of the payload and/or kill- switch component. The third gene encoding the T7 polymerase is inverted in orientation (3' to 5') and flanked by recombinase binding sites, and the recombinase is capable of binding to the recombinase binding sites to induce expression of the T7 polymerase gene by reverting its orientation (5' to 3'). In the presence of oxygen, FNR does not bind the FNR-responsive promoter, the recombinase is not expressed, the T7 polymerase gene remains in the 3' to 5' orientation, and the payload and/or kill- switch component is not expressed. In the absence of oxygen, FNR dimerizes and binds the FNR-responsive promoter, the recombinase is expressed, the T7 polymerase gene is reverted to the 5' to 3' orientation, and the payload and/or kill-switch component is expressed.

Host-plasmid mutual dependency

[0439] In some embodiments, the genetically engineered bacteria of the invention also comprise a plasmid that has been modified to create a host-plasmid mutual dependency. In certain embodiments, the mutually dependent host-plasmid platform is GeneGuard (Wright et al., 2015). In some embodiments, the GeneGuard plasmid comprises (i) a conditional origin of replication, in which the requisite replication initiator protein is provided in trans; (ii) an auxotrophic modification that is rescued by the host via genomic translocation and is also compatible for use in rich media; and/or (iii) a nucleic acid sequence which encodes a broad- spectrum toxin. The toxin gene may be used to select against plasmid spread by making the plasmid DNA itself disadvantageous for strains not expressing the antitoxin (e.g., a wild-type bacterium). In some embodiments, the GeneGuard plasmid is stable for at least 100 generations without antibiotic selection. In some embodiments, the

GeneGuard plasmid does not disrupt growth of the host. The GeneGuard plasmid is used to greatly reduce unintentional plasmid propagation in the genetically engineered bacteria of the invention.

[0440] The mutually dependent host-plasmid platform may be used alone or in combination with other biosafety mechanisms, such as those described herein (e.g., kill switches, auxo trophies). In some embodiments, the genetically engineered bacteria comprise a GeneGuard plasmid. In other embodiments, the genetically engineered bacteria comprise a GeneGuard plasmid and/or one or more kill switches. In other embodiments, the genetically engineered bacteria comprise a GeneGuard plasmid and/or one or more auxotrophies. In still other embodiments, the genetically engineered bacteria comprise a GeneGuard plasmid, one or more kill switches, and/or one or more auxotrophies.

[0441] Synthetic gene circuits express on plasmids may function well in the short term but lose ability and/or function in the long term (Danino et al., 2015). In some embodiments, the genetically engineered bacteria comprise stable circuits for expressing genes of interest over prolonged periods. In some embodiments, the genetically engineered bacteria are capable of producing a payload and/or kill-switch component and further comprise a toxin-antitoxin system that simultaneously produces a toxin (hok) and a shortlived antitoxin (sok), wherein loss of the plasmid causes the cell to be killed by the long-lived toxin (Danino et al., 2015; Fig. 7). In some embodiments, the genetically engineered bacteria further comprise alp7 from B. subtilis plasmid pL20 and produces filaments that are capable of pushing plasmids to the poles of the cells in order to ensure equal segregation during cell division (Danino et al., 2015).

Isolated Plasmids/Vectors

[0442] In other embodiments, the disclosure provides an isolated plasmid comprising one of more sequences selected from: one or more gene(s) of interest, one or more gene(s) encoding an anti-toxin, one or more gene(s) encoding a toxin, one or more gene(s) encoding a recombinase, one or more genes encoding an excision protein or polypeptide, one or more genes encoding an essential protein or polypeptide, one or more genes encoding a positive regulatory protein or polypeptide (e.g., positive transcription factor), one or more genes encoding a negative regulatory protein or polypeptide (e.g., a repressor protein), one or more gene encoding antibiotic resistance, and combinations thereof. In one exemplary

embodiment, the disclosure provides an isolated plasmid comprising at least one gene of interest, e.g., a therapeutic gene, a gene encoding a toxin, and a gene encoding one or more recombinases. In another embodiment, the isolated plasmid further comprises a gene encoding an anti-toxin. In another exemplary embodiment, the disclosure provides an isolated plasmid comprising at least one gene of interest, e.g., a therapeutic gene, and a gene encoding one or more essential genes. In another exemplary embodiment, the disclosure provides an isolated plasmid comprising at least one gene of interest, e.g., a therapeutic gene, a gene encoding one or more excision proteins, and a gene encoding one or more essential genes. In yet another exemplary embodiment, the disclosure provides an isolated plasmid comprising at least one gene of interest, e.g., a therapeutic gene, a gene encoding a toxin, a gene encoding a negative repressor protein (for example, TetR), and a gene encoding a positive transcription factor (for example AraC) in which expression of the negative repressor protein is under control of a promoter regulated by the positive transcription factor and the expression of the toxin is under control of promoter regulated by the repressor protein. In a further

embodiment, the isolated plasmid further comprises a gene encoding an anti-toxin, which may be under the control of a constitutive or inducicble promoter (e.g., promoter regulated by the positive transcription factor used to regulate the repressor protein).

[0443] In one embodiment, the isolated plasmid comprises first nucleic acid encoding a gene of interest, e.g., a therapeutic molecule, operably linked to a first inducible promoter. In some embodiments, the isolated plasmid further comprises a second nucleic acid encoding at least one recombinase. In one embodiment, the first nucleic acid and the second nucleic acid are operably linked to the first inducible promoter, which may be the same copy of the inducible promoter or may be two separate copies of the same promoter. In another embodiment, the second nucleic acid is operably linked to a second inducible promoter which is different from the first inducible promoter. Thus, in one embodiment, the first inducible promoter and the second inducible promoter are separate copies of the same inducible promoter. In another embodiment, the first inducible promoter and the second inducible promoter are different inducible promoters. In one embodiment, the first promoter, the second promoter, or the first promoter and the second promoter, are each directly or indirectly induced by low-oxygen or anaerobic conditions. In another embodiment, the first promoter, the second promoter, or the first promoter and the second promoter, are each a fumarate and nitrate reduction regulator (FNR) responsive promoter. In another embodiment, the first promoter, the second promoter, or the first promoter and the second promoter, are each a ROS-inducible regulatory region. In another embodiment, the first promoter, the second promoter, or the first promoter and the second promoter, are each a RNS-inducible regulatory region.

[0444] In other embodiments, the disclosure provides an isolated plasmid comprising a first nucleic acid encoding at least one gene of interest, e.g., a therapeutic gene, operably linked to a first inducible promoter, a second nucleic acid encoding at least one recombinase, and a third nucleic acid encoding an anti-toxin. In one embodiment, the first nucleic acid and the second nucleic acid are operably linked to the first inducible promoter, and the third nucleic acid is operably linked to a second inducible promoter. In another embodiment, second nucleic acid and the third nucleic acid are operably linked to a second inducible promoter. In another embodiment, the second nucleic acid is operably linked to a second inducible promoter, and the third nucleic acid is operably linked to a third inducible promoter.

[0445] In another embodiment, the first inducible promoter, the second inducible promoter, and the third inducible promoter are different inducible promoters. In one embodiment, the first promoter, the second promoter, the third promoter, the first promoter and the second promoter, the first promoter and the third promoter, the second promoter and the third promoter, or the first promoter and second promoter and third promoter are each directly or indirectly induced by low-oxygen or anaerobic conditions. In another

embodiment, the first promoter, the second promoter, the third promoter, the first promoter and the second promoter, the first promoter and the third promoter, the second promoter and the third promoter, or the first promoter and second promoter and third promoter are each a fumarate and nitrate reduction regulator (FNR) responsive promoter. In another embodiment, the first promoter, the second promoter, the third promoter, the first promoter and the second promoter, the first promoter and the third promoter, the second promoter and the third promoter, or the first promoter and second promoter and third promoter are each a ROS- inducible regulatory region. In another embodiment, the first promoter, the second promoter, the third promoter, the first promoter and the second promoter, the first promoter and the third promoter, the second promoter and the third promoter, or the first promoter and second promoter and third promoter are each a RNS -inducible regulatory region.

[0446] In another embodiment, the heterologous gene encoding the anti-toxin is operably linked to a constitutive promoter.

[0447] In other embodiments, the disclosure provides an isolated plasmid comprising a first nucleic acid encoding at least one gene of interest, e.g., a therapeutic gene, operably linked to a first inducible promoter, a second nucleic acid encoding at least one recombinase, and a third nucleic acid encoding an excision enzyme. In one embodiment, the first nucleic acid and the second nucleic acid are operably linked to the first inducible promoter, and the third nucleic acid is operably linked to a constitutive promoter. In one embodiment, the constitutive promoter is a lac promoter. In another embodiment, the constitutive promoter is a tet promoter. In another embodiment, the constitutive promoter is a constitutive Escherichia coli σ32 promoter. In another embodiment, the constitutive promoter is a constitutive Escherichia coli σ70 promoter. In another embodiment, the constitutive promoter is a constitutive Bacillus subtilis σΑ promoter. In another embodiment, the constitutive promoter is a constitutive Bacillus subtilis σΒ promoter. In another embodiment, the constitutive promoter is a Salmonella promoter. In another embodiment, the constitutive promoter is a bacteriophage T7 promoter. In another embodiment, the constitutive promoter is a bacteriophage SP6 promoter. In another embodiment, the second nucleic acid is operably linked to a second inducible promoter, and the third nucleic acid is operably linked to a constitutive promoter. In another embodiment, the first inducible promoter and the second inducible promoter are the same inducible promoters, e.g., may be the same copy of the same promoter or different copies of the same promoter. In another embodiment, the first inducible promoter and the second inducible promoter are different inducible promoters. In one embodiment, the first promoter, the second promoter, or the first promoter and second promoter are each directly or indirectly induced by low-oxygen or anaerobic conditions. In another embodiment, the first promoter, the second promoter, or the first promoter and second promoter are each a fumarate and nitrate reduction regulator (FNR) responsive promoter. In another embodiment, the first promoter, the second promoter, or the first promoter and second promoter are each a ROS-inducible regulatory region. In another embodiment, the first promoter, the second promoter, or the first promoter and second promoter are each a RNS-inducible regulatory region. In another embodiment, the plasmid further comprises a fourth nucleic acid encoding one or more essential gene product(s). In another embodiment, the plasmid further comprises a fifth nucleic acid encoding one or more essential gene product(s), which may be operably linked to a constitutive promoter or an inducible promoter. In another embodiment, the plasmid further comprises a sixth, seventh, eighth, ninth, ten or more nucleic acid encoding one or more essential gene product(s), which may be operably linked to a constitutive promoter or an inducible promoter.

[0448] In any of the above-described embodiments, the plasmid further comprises a gene encoding a toxin, which may be operably linked to a constitutive promoter or an inducible promoter.

[0449] In one embodiment, the isolated plasmid comprises at least one gene of interest, e.g., a therapeutic gene, operably linked to a first inducible promoter; a gene encoding a TetR protein operably linked to a ParaBAD promoter, a gene encoding AraC operably linked to a ParaC promoter, a gene encoding an antitoxin operably linked to a constitutive promoter, and a gene encoding a toxin operably linked to a PTetR promoter. In another embodiment, the isolated plasmid comprises at least one gene of interest, e.g., a therapeutic gene, operably linked to a first inducible promoter; a gene encoding a TetR protein and an anti-toxin operably linked to a ParaBAD promoter, a gene encoding AraC operably linked to a ParaC promoter, and a gene encoding a toxin operably linked to a PTetR promoter.

[0450] In any of the above-described embodiments, the plasmid is a high-copy plasmid. In another embodiment, the plasmid is a low-copy plasmid.

[0451] In another aspect, the disclosure provides a bacterial cell comprising an isolated plasmid described herein. In another embodiment, the disclosure provides a pharmaceutical composition comprising the bacterial cell.

[0452] In some embodiments, the bacterial cell comprises a GeneGuard vector expressing the at least one gene of interest. GeneGuard vectors comprise three functional features: a conditional origin of replication, which allows for the plasmid replication initiator protein to be provided in trans; a gene encoding a protein required for complementation of a host cell auxotrophy, preferably a rich-media compatible auxotrophy; and a gene encoding a toxin, which can be countered by an antitoxin expressed by the host cell (see, e.g., Wright et al., "GeneGuard: A Modular Plasmid System Designed for Biosafety," ACS Synthetic Biology (2015) 4: 307-16, the entire contents of which are expressly incorporated herein by reference).

[0453] In some embodiments, the vector comprises a conditional origin of replication. In some embodiments, the conditional origin of replication is a R6K or ColE2- P9. In embodiments where the plasmid comprises the conditional origin of replication R6K, the host cell expresses the replication initiator protein π. In embodiments where the plasmid comprises the conditional origin or replication ColE2, the host cell expresses the replication initiator protein RepA. It is understood by those of skill in the art that the expression of the replication initiator protein may be regulated so that a desired expression level of the protein is achieved in the host cell to thereby control the replication of the plasmid. For example, in some embodiments, the expression of the gene encoding the replication initiator protein may be placed under the control of a strong, moderate, or weak promoter to regulate the expression of the protein.

[0454] In some embodiments, the vector comprises a gene encoding a protein required for complementation of a host cell auxotrophy, preferably a rich-media compatible auxotrophy. In some embodiments, the host cell is auxotrophic for thymidine (AthyA), and the vector comprises the thymidylate synthase (thy A) gene. In some embodiments, the host cell is auxotrophic for diaminopimelic acid (AdapA) and the vector comprises the 4-hydroxy- tetrahydrodipicolinate synthase (dapA) gene. It is understood by those of skill in the art that the expression of the gene encoding a protein required for complementation of the host cell auxotrophy may be regulated so that a desired expression level of the protein is achieved in the host cell.

[0455] In some embodiments, the vector comprises a toxin gene. In some

embodiments, the host cell comprises an anti-toxin gene encoding and/or required for the expression of an anti-toxin. In some embodiments, the toxin is Zeta and the anti-toxin is Epsilon. In some embodiments, the toxin is Kid, and the anti-toxin is Kis. In preferred embodiments, the toxin is bacteriostatic. Any of the toxin/antitoxin pairs described herein may be used in the vector systems of the present disclosure. It is understood by those of skill in the art that the expression of the gene encoding the toxin may be regulated using art known methods to prevent the expression levels of the toxin from being deleterious to a host cell that expresses the anti-toxin. For example, in some embodiments, the gene encoding the toxin may be regulated by a moderate promoter. In other embodiments, the gene encoding the toxin may be cloned adjacent to ribosomal binding site of interest to regulate the expression of the gene at desired levels (see, e.g., Wright et al. (2015)).

Pharmaceutical Compositions

[0456] The present disclosure further provides pharmaceutical compositions comprising the engineered microorganisms, e.g., bacteria and viruses of the present disclosure. In one embodiment, the pharmaceutical composition comprises a

pharmaceutically acceptable carrier. These pharmaceutical compositions may be used to treat, manage, ameliorate, and/or prevent diseases or disorders in a subject. Pharmaceutical compositions of the disclosure comprising one or more engineered microorganisms, e.g., bacteria and viruses, alone or in combination with prophylactic agents, therapeutic agents, and/or and pharmaceutically acceptable carriers are also provided.

[0457] In certain embodiments, the pharmaceutical composition comprises one species, strain, or subtype of bacteria. In alternate embodiments, the pharmaceutical composition comprises two or more species, strains, and/or subtypes of bacteria. In some embodiments, the pharmaceutical composition further comprises one species, strain, or subtype of bacteria that are engineered to express a gene of interest, e.g., a therapeutic gene. In some embodiments, the pharmaceutical composition further comprises two or more species, strain, or subtype of bacteria that are engineered to express a gene of interest, e.g., a therapeutic gene. In another embodiment, the pharmaceutical composition of the disclosure is engineered to express at least one species, strain, or subtype of bacteria that express a gene of interest, e.g., a therapeutic gene, and at least one species, strain, or subtype of bacteria that express a reporter gene, as discussed in the Theranostics section, herein.

[0458] The pharmaceutical compositions of the disclosure may be formulated in a conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into

compositions for pharmaceutical use. Methods of formulating pharmaceutical compositions are known in the art (see, e.g., "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, PA). In some embodiments, the pharmaceutical compositions are subjected to tableting, lyophilizing, direct compression, conventional mixing, dissolving, granulating, levigating, emulsifying, encapsulating, entrapping, or spray drying to form tablets, granulates, nanoparticles, nanocapsules, microcapsules, microtablets, pellets, or powders, which may be enterically coated or uncoated. Appropriate formulation depends on the route of

administration. In one embodiment, the pharmaceutical compositions of the disclosure comprise a liquid bacterial suspension.

[0459] The genetically engineered bacteria of the invention may be formulated into pharmaceutical compositions in any suitable dosage form (e.g., liquids, capsules, sachet, hard capsules, soft capsules, tablets, enteric coated tablets, suspension powders, granules, or matrix sustained release formations for oral administration) and for any suitable type of administration (e.g., oral, topical, immediate-release, pulsatile-release, delayed-release, or sustained release). Suitable dosage amounts for the genetically engineered bacteria may range from about 105 to 1012 bacteria, e.g., approximately 105 bacteria, approximately 106 bacteria, approximately 107 bacteria, approximately 108 bacteria, approximately 109 bacteria, approximately 1010 bacteria, approximately 1011 bacteria, or approximately 1011 bacteria. The composition may be administered once or more daily, weekly, or monthly. The composition may be administered before, during, or following a meal. In one

embodiment, the pharmaceutical composition is administered before the subject eats a meal. In one embodiment, the pharmaceutical composition is administered currently with a meal. In one embodiment, the pharmaceutical composition is administered after the subject eats a meal.

[0460] The genetically engineered bacteria may be formulated into pharmaceutical compositions comprising one or more pharmaceutically acceptable carriers, thickeners, diluents, buffers, surface active agents, neutral or cationic lipids, lipid complexes, liposomes, penetration enhancers, carrier compounds, and other pharmaceutically acceptable carriers or agents. For example, the pharmaceutical composition may include, but is not limited to, the addition of calcium bicarbonate, sodium bicarbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils, polyethylene glycols, and surfactants, including, for example, polysorbate 20. In some embodiments, the genetically engineered bacteria may be formulated in a solution of sodium bicarbonate, e.g., 1 molar solution of sodium bicarbonate (to buffer an acidic cellular environment, such as the stomach, for example). The genetically engineered bacteria may be administered and formulated as neutral or salt forms. Pharmaceutically acceptable salts include those formed with anions such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with cations such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine, procaine, etc.

[0461] The genetically engineered bacteria of the invention may be administered topically and formulated in the form of an ointment, cream, transdermal patch, lotion, gel, shampoo, spray, aerosol, solution, emulsion, or other form well-known to one of skill in the art. See, e.g., "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, PA. In an embodiment, for non-sprayable topical dosage forms, viscous to semi-solid or solid forms comprising a carrier or one or more excipients compatible with topical application and having a dynamic viscosity greater than water are employed. Suitable formulations include, but are not limited to, solutions, suspensions, emulsions, creams, ointments, powders, liniments, salves, etc., which may be sterilized or mixed with auxiliary agents (e.g., preservatives, stabilizers, wetting agents, buffers, or salts) for influencing various properties, e.g., osmotic pressure. Other suitable topical dosage forms include sprayable aerosol preparations wherein the active ingredient in combination with a solid or liquid inert carrier, is packaged in a mixture with a pressurized volatile (e.g., a gaseous propellant, such as freon) or in a squeeze bottle. Moisturizers or humectants can also be added to pharmaceutical compositions and dosage forms. Examples of such additional ingredients are well known in the art. In one embodiment, the pharmaceutical composition comprising the engineered bacteria may be formulated as a hygiene product. For example, the hygiene product may be an antibacterial formulation, or a fermentation product such as a fermentation broth. Hygiene products may be, for example, shampoos, conditioners, creams, pastes, lotions, and lip balms.

[0462] The genetically engineered bacteria of the invention may be administered orally and formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, etc. Pharmacological compositions for oral use can be made using a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries if desired, to obtain tablets or dragee cores. Suitable excipients include, but are not limited to, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose compositions such as maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carbomethylcellulose; and/or physiologically acceptable polymers such as polyvinylpyrrolidone (PVP) or polyethylene glycol (PEG). Disintegrating agents may also be added, such as cross-linked polyvinylpyrrolidone, agar, alginic acid or a salt thereof such as sodium alginate.

[0463] Tablets or capsules can be prepared by conventional means with

pharmaceutically acceptable excipients such as binding agents (e.g., pregelatinised maize starch, polyvinylpyrrolidone, hydro xypropyl methylcellulose, carboxymethylcellulose, polyethylene glycol, sucrose, glucose, sorbitol, starch, gum, kaolin, and tragacanth); fillers (e.g., lactose, microcrystalline cellulose, or calcium hydrogen phosphate); lubricants (e.g., calcium, aluminum, zinc, stearic acid, polyethylene glycol, sodium lauryl sulfate, starch, sodium benzoate, L-leucine, magnesium stearate, talc, or silica); disintegrants (e.g., starch, potato starch, sodium starch glycolate, sugars, cellulose derivatives, silica powders); or wetting agents (e.g., sodium lauryl sulphate). The tablets may be coated by methods well known in the art. A coating shell may be present, and common membranes include, but are not limited to, polylactide, polyglycolic acid, polyanhydride, other biodegradable polymers, alginate-polylysine-alginate (APA), alginate-polymethylene-co-guanidine-alginate (A- PMCG-A), hydro ymethylacry late- methyl methacrylate (HEMA-MMA), multilayered HEMA-MMA-MAA, polyacrylonitrilevinylchloride (PAN-PVC), acrylonitrile/sodium methallylsulfonate (AN-69), polyethylene glycol/poly

pentamethylcyclopentasiloxane/polydimethylsiloxane (PEG/PD5/PDMS), poly N,N- dimethyl acrylamide (PDMAAm), siliceous encapsulates, cellulose sulphate/sodium alginate/polymethylene-co-guanidine (CS/A/PMCG), cellulose acetate phthalate, calcium alginate, k-carrageenan- locust bean gum gel beads, gellan-xanthan beads, poly(lactide-co- glycolides), carrageenan, starch poly-anhydrides, starch polymethacrylates, polyamino acids, and enteric coating polymers.

[0464] In some embodiments, the genetically engineered bacteria are enterically coated for release into the gut or a particular region of the gut, for example, the small or large intestines. The typical pH profile from the stomach to the colon is about 1-4 (stomach), 5.5-6 (duodenum), 7.3-8.0 (ileum), and 5.5-6.5 (colon). In some diseases, the pH profile may be modified. In some embodiments, the coating is degraded in specific pH environments in order to specify the site of release. In some embodiments, at least two coatings are used. In some embodiments, the outside coating and the inside coating are degraded at different pH levels.

[0465] Liquid preparations for oral administration may take the form of solutions, syrups, suspensions, or a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations may be prepared by conventional means with

pharmaceutically acceptable agents such as suspending agents (e.g., sorbitol syrup, cellulose derivatives, or hydrogenated edible fats); emulsifying agents (e.g., lecithin or acacia); nonaqueous vehicles (e.g., almond oil, oily esters, ethyl alcohol, or fractionated vegetable oils); and preservatives (e.g., methyl or propyl-p-hydroxybenzoates or sorbic acid). The

preparations may also contain buffer salts, flavoring, coloring, and sweetening agents as appropriate. Preparations for oral administration may be suitably formulated for slow release, controlled release, or sustained release of the genetically engineered bacteria described herein.

[0466] In one embodiment, the genetically engineered bacteria of the disclosure may be formulated in a composition suitable for administration to pediatric subjects. As is well known in the art, children differ from adults in many aspects, including different rates of gastric emptying, pH, gastrointestinal permeability, etc. (Ivanovska et al., Pediatrics,

134(2):361-372, 2014). Moreover, pediatric formulation acceptability and preferences, such as route of administration and taste attributes, are critical for achieving acceptable pediatric compliance. Thus, in one embodiment, the composition suitable for administration to pediatric subjects may include easy-to- swallow or dissolvable dosage forms, or more palatable compositions, such as compositions with added flavors, sweeteners, or taste blockers. In one embodiment, a composition suitable for administration to pediatric subjects may also be suitable for administration to adults.

[0467] In one embodiment, the composition suitable for administration to pediatric subjects may include a solution, syrup, suspension, elixir, powder for reconstitution as suspension or solution, dispersible/effervescent tablet, chewable tablet, gummy candy, lollipop, freezer pop, troche, chewing gum, oral thin strip, orally disintegrating tablet, sachet, soft gelatin capsule, sprinkle oral powder, or granules. In one embodiment, the composition is a gummy candy, which is made from a gelatin base, giving the candy elasticity, desired chewy consistency, and longer shelf-life. In some embodiments, the gummy candy may also comprise sweeteners or flavors.

[0468] In one embodiment, the composition suitable for administration to pediatric subjects may include a flavor. As used herein, "flavor" is a substance (liquid or solid) that provides a distinct taste and aroma to the formulation. Flavors also help to improve the palatability of the formulation. Flavors include, but are not limited to, strawberry, vanilla, lemon, grape, bubble gum, and cherry.

[0469] In certain embodiments, the genetically engineered bacteria of the invention may be orally administered, for example, with an inert diluent or an assimilable edible carrier. The compound may also be enclosed in a hard or soft shell gelatin capsule, compressed into tablets, or incorporated directly into the subject's diet. For oral therapeutic administration, the compounds may be incorporated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. To administer a compound of the invention by other than parenteral administration, it may be necessary to coat the compound with, or co-administer the compound with, a material to prevent its inactivation.

[0470] In another embodiment, the pharmaceutical composition comprising the engineered bacteria may be a comestible product, for example, a food product. In one embodiment, the food product is milk, concentrated milk, fermented milk (yogurt, sour milk, frozen yogurt, lactic acid bacteria- fermented beverages), milk powder, ice cream, cream cheeses, dry cheeses, soybean milk, fermented soybean milk, vegetable-fruit juices, fruit juices, sports drinks, confectionery, candies, infant foods (such as infant cakes), nutritional food products, animal feeds, or dietary supplements. In one embodiment, the food product is a fermented food, such as a fermented dairy product. In one embodiment, the fermented dairy product is yogurt. In another embodiment, the fermented dairy product is cheese, milk, cream, ice cream, milk shake, or kefir. In another embodiment, the engineered bacteria are combined in a preparation containing other live bacterial cells intended to serve as probiotics. In another embodiment, the food product is a beverage. In one embodiment, the beverage is a fruit juice-based beverage or a beverage containing plant or herbal extracts. In another embodiment, the food product is a jelly or a pudding. Other food products suitable for administration of the engineered bacteria are well known in the art. For example, see U.S. 2015/0359894 and US 2015/0238545, the entire contents of each of which are expressly incorporated herein by reference. In yet another embodiment, the pharmaceutical

composition is injected into, sprayed onto, or sprinkled onto a food product, such as bread, yogurt, or cheese.

[0471] In some embodiments, the composition is formulated for intraintestinal administration, intrajejunal administration, intraduodenal administration, intraileal administration, gastric shunt administration, or intracolic administration, via nanoparticles, nanocapsules, microcapsules, or microtablets, which are enterically coated or uncoated. The pharmaceutical compositions of the present disclosure may also be formulated in rectal compositions such as suppositories or retention enemas, using, e.g., conventional suppository bases such as cocoa butter or other glycerides. The compositions may be suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain suspending, stabilizing and/or dispersing agents.

[0472] The genetically engineered bacteria of the invention may be administered intranasally, formulated in an aerosol form, spray, mist, or in the form of drops, and conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebuliser, with the use of a suitable propellant (e.g., dichlorodifluoromethane,

trichlorofluoro methane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas). Pressurized aerosol dosage units may be determined by providing a valve to deliver a metered amount. Capsules and cartridges (e.g., of gelatin) for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.

[0473] The genetically engineered bacteria of the invention may be administered and formulated as depot preparations. Such long acting formulations may be administered by implantation or by injection. For example, the compositions may be formulated with suitable polymeric or hydrophobic materials (e.g., as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives (e.g., as a sparingly soluble salt). [0474] In some embodiments, the disclosure provides pharmaceutically acceptable compositions in single dosage forms. Single dosage forms may be in a liquid or a solid form. Single dosage forms may be administered directly to a patient without modification or may be diluted or reconstituted prior to administration. In certain embodiments, a single dosage form may be administered in bolus form, e.g., single injection, single oral dose, including an oral dose that comprises multiple tablets, capsule, pills, etc. In alternate embodiments, a single dosage form may be administered over a period of time, e.g., by infusion.

[0475] Single dosage forms of the pharmaceutical composition of the disclosure may be prepared by portioning the pharmaceutical composition into smaller aliquots, single dose containers, single dose liquid forms, or single dose solid forms, such as tablets, granulates, nanoparticles, nanocapsules, microcapsules, microtablets, pellets, or powders, which may be enterically coated or uncoated. A single dose in a solid form may be reconstituted by adding liquid, typically sterile water or saline solution, prior to administration to a patient.

[0476] Dosage regimens may be adjusted to provide a therapeutic response. For example, a single bolus may be administered at one time, several divided doses may be administered over a predetermined period of time, or the dose may be reduced or increased as indicated by the therapeutic situation. The specification for the dosage is dictated by the unique characteristics of the active compound and the particular therapeutic effect to be achieved. Dosage values may vary with the type and severity of the condition to be alleviated. For any particular subject, specific dosage regimens may be adjusted over time according to the individual need and the professional judgment of the treating clinician.

[0477] In another embodiment, the composition can be delivered in a controlled release or sustained release system. In one embodiment, a pump may be used to achieve controlled or sustained release. In another embodiment, polymeric materials can be used to achieve controlled or sustained release of the therapies of the present disclosure (see e.g., U.S. Patent No. 5,989,463). Examples of polymers used in sustained release formulations include, but are not limited to, poly(2-hydroxy ethyl methacrylate), poly(methyl

methacrylate), poly( acrylic acid), poly(ethylene-co- vinyl acetate), poly(methacrylic acid), polyglycolides (PLG), polyanhydrides, poly(N- vinyl pyrrolidone), poly( vinyl alcohol), polyacrylamide, poly( ethylene glycol), polylactides (PLA), poly(lactide-co-glycolides) (PLGA), and polyorthoesters. The polymer used in a sustained release formulation may be inert, free of leachable impurities, stable on storage, sterile, and biodegradable. In some embodiments, a controlled or sustained release system can be placed in proximity of the prophylactic or therapeutic target, thus requiring only a fraction of the systemic dose. Any suitable technique known to one of skill in the art may be used.

[0478] The genetically engineered bacteria of the invention may be administered and formulated as neutral or salt forms. Pharmaceutically acceptable salts include those formed with anions such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with cations such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine, procaine, etc.

[0479] The ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water- free concentrate in a hermetically sealed container such as an ampoule or sachet indicating the quantity of active agent. If the mode of administration is by injection, an ampoule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration.

[0480] In some embodiments, the disclosure provides pharmaceutically acceptable compositions in single dosage forms. Single dosage forms may be in a liquid or a solid form. Single dosage forms may be administered directly to a patient without modification or may be diluted or reconstituted prior to administration. In certain embodiments, a single dosage form may be administered in bolus form, e.g., single injection, single oral dose, including an oral dose that comprises multiple tablets, capsule, pills, etc. In alternate embodiments, a single dosage form may be administered over a period of time, e.g., by infusion.

[0481] Single dosage forms of the pharmaceutical composition of the disclosure may be prepared by portioning the pharmaceutical composition into smaller aliquots, single dose containers, single dose liquid forms, or single dose solid forms, such as tablets, granulates, nanoparticles, nanocapsules, microcapsules, microtablets, pellets, or powders, which may be enterically coated or uncoated. A single dose in a solid form may be reconstituted by adding liquid, typically sterile water or saline solution, prior to administration to a patient.

[0482] Dosage regimens may be adjusted to provide a therapeutic response. Dosing can depend on several factors, including severity and responsiveness of the disease, route of administration, time course of treatment (days to months to years), and time to amelioration of the disease. For example, a single bolus may be administered at one time, several divided doses may be administered over a predetermined period of time, or the dose may be reduced or increased as indicated by the therapeutic situation. The specification for the dosage is dictated by the unique characteristics of the active compound and the particular therapeutic effect to be achieved. Dosage values may vary with the type and severity of the condition to be alleviated. For any particular subject, specific dosage regimens may be adjusted over time according to the individual need and the professional judgment of the treating clinician. Toxicity and therapeutic efficacy of compounds provided herein can be determined by standard pharmaceutical procedures in cell culture or animal models. For example, LD50, ED50, EC50, and IC50 may be determined, and the dose ratio between toxic and therapeutic effects (LD50/ED50) may be calculated as the therapeutic index. Compositions that exhibit toxic side effects may be used, with careful modifications to minimize potential damage to reduce side effects. Dosing may be estimated initially from cell culture assays and animal models. The data obtained from in vitro and in vivo assays and animal studies can be used in formulating a range of dosage for use in humans. The ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water-free concentrate in a hermetically sealed container such as an ampoule or sachet indicating the quantity of active agent. If the mode of administration is by injection, an ampoule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration.

[0483] The pharmaceutical compositions of the invention may be packaged in a hermetically sealed container such as an ampoule or sachet indicating the quantity of the agent. In one embodiment, one or more of the pharmaceutical compositions of the invention is supplied as a dry sterilized lyophilized powder or water-free concentrate in a hermetically sealed container and can be reconstituted (e.g., with water or saline) to the appropriate concentration for administration to a subject. In an embodiment, one or more of the prophylactic or therapeutic agents or pharmaceutical compositions of the invention is supplied as a dry sterile lyophilized powder in a hermetically sealed container stored between 2° C and 8° C and administered within 1 hour, within 3 hours, within 5 hours, within 6 hours, within 12 hours, within 24 hours, within 48 hours, within 72 hours, or within one week after being reconstituted. Cryoprotectants can be included for a lyophilized dosage form, principally 0-10% sucrose (optimally 0.5-1.0%). Other suitable cryoprotectants include trehalose and lactose. Other suitable bulking agents include glycine and arginine, either of which can be included at a concentration of 0-0.05%, and polysorbate-80 (optimally included at a concentration of 0.005-0.01%). Additional surfactants include but are not limited to polysorbate 20 and BRIJ surfactants. The pharmaceutical composition may be prepared as an injectable solution and can further comprise an agent useful as an adjuvant, such as those used to increase absorption or dispersion, e.g., hyaluronidase.

In Vivo Methods

[0484] The recombinant bacteria of the disclosure may be evaluated in vivo, e.g., in an animal model. Any suitable animal model of a disease or condition may be used. The recombinant bacterial cells of the disclosure may be administered to the animal, e.g., by oral gavage, and treatment efficacy is determined after treatment. The animal may be sacrificed, and tissue samples may be collected and analyzed.

[0485] For example, a suitable animal model of a disease or condition associated with gut inflammation and/or compromised gut barrier function may be used (see, e.g., Mizoguchi 2012). In some embodiments, the animal model is a mouse model of IBD. In certain embodiments, the IBD is induced by treatment with dextran sodium sulfate. In some embodiments, the recombinant bacterial cells of the disclosure is administered to the animal, e.g., by oral gavage, and treatment efficacy is determined, e.g., by endoscopy, colon translucency, fibrin attachment, mucosal and vascular pathology, and/or stool characteristics. In some embodiments, the animal is sacrificed, and tissue samples are collected and analyzed, e.g., colonic sections are fixed and scored for inflammation and ulceration, and/or

homogenized and analyzed for myeloperoxidase activity and cytokine levels (e.g., IL-Ιβ, TNF-a, IL-6, IFN-γ and IL-10).

[0486] As another example, a suitable animal model of a disease or condition associated with catabolism of a branched chain amino acid may be used (see, e.g., Skvorak, J. Inherit. Metab. Dis., 2009, 32:229-246 and Homanics et al., BMC Med. Genet., 2006, 7(33): 1-13). In some embodiments, the animal model is a mouse model of Maple Syrup Urine Disease. In one embodiment, the mouse model of MSUD is a branched-chain amino transferase knockout mouse (Wu et al., J. Clin. Invest, 113:434-440, 2004 or She et al., Cell Metabol., 6: 181-194, 2007). In another embodiment, the mouse model of MSUD is a dihydrolipoamine dehydrogenase (E3) subunit knock-out mouse (Johnson et al., Proc. Natl. Acad. Sci. U.S.A., 94: 14512-14517, 1997). In another embodiment, the mouse model of classic MSUD is a deletion of exon 5 and part of exon 4 of the E2 subunit of the branched- chain alpha-keto acid dehydrogenase (Homanics et al., BMC Med. Genet., 7:33, 2006) or the mouse model of intermediate MSUD (Homanics et al., BMC Med. Genet., 7:33, 2006). In another embodiment, the model is a Polled Shorthorn calf model of disease or a Polled Hereford calf model of disease (Harper et al., Aus. Vet. J., 66(2):46-49, 1988). In another embodiment, the animal model is a mouse model of PKU. In certain embodiments, the mouse model of PKU is an Enu2 PAH mutant BTBR mouse (BTBR-Pahenu2, Jackson Laboratories).

Methods of Treatment

[0487] Another aspect of the disclosure provides methods of treating a disease in a subject using the pharmaceutical compositions comprising the recombinant bacteria of the disclosure. The method may comprise preparing a pharmaceutical composition with at least one genetically engineered species, strain, or subtype of bacteria described herein, and administering the pharmaceutical composition to a subject in a therapeutically effective amount. In some embodiments, the bacterial cells of the disclosure are administered orally, e.g., in a liquid suspension. In some embodiments, the bacterial cells of the disclosure are lyophilized in a gel cap and administered orally. In some embodiments, the bacterial cells of the disclosure are administered via a feeding tube or gastric shunt. In some embodiments, the bacterial cells of the disclosure are administered rectally, e.g., by enema.

[0488] In some embodiments, the method of treating the disorder allows one or more symptoms of the condition or disorder to improve by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more. In some embodiments, the method of treating the disorder allows one or more symptoms of the condition or disorder to improve by at least about two-fold, three-fold, four-fold, five-fold, six-fold, seven-fold, eight-fold, nine-fold, or ten-fold.

[0489] In some embodiments, the recombinant bacterial cells of the disclosure produce the at least one heterologous gene which reduces disease symptoms at least about 1.5-fold, at least about 2-fold, at least about 10-fold, at least about 15-fold, at least about 20- fold, at least about 30-fold, at least about 50-fold, at least about 100-fold, at least about 200- fold, at least about 300-fold, at least about 400-fold, at least about 500-fold, at least about 600-fold, at least about 700-fold, at least about 800-fold, at least about 900-fold, at least about 1,000-fold, or at least about 1,500-fold as compared to unmodified bacteria of the same subtype under the same conditions. Disease symptoms, such as inflammation, may be measured by methods known in the art, e.g., counting disease lesions using endoscopy;

detecting T regulatory cell differentiation in peripheral blood, e.g., by fluorescence activated sorting; measuring T regulatory cell levels; measuring cytokine levels; measuring areas of mucosal damage; assaying inflammatory biomarkers, e.g., by qPCR; PCR arrays;

transcription factor phosphorylation assays; immunoassays; and/or cytokine assay kits (Meso scale, Cayman Chemical, Qiagen).

[0490] In certain embodiments, the recombinant bacteria are E. coli Nissle. The recombinant bacteria may be destroyed, e.g., by defense factors in the gut or blood serum (Sonnenborn et al., 2009) or by activation of a kill switch, several hours or days after administration. Thus, the pharmaceutical composition comprising the recombinant bacteria may be re- administered at a therapeutically effective dose and frequency. In alternate embodiments, the recombinant bacteria are not destroyed within hours or days after administration and may propagate and colonize the gut.

[0491] In one embodiments, the bacterial cells of the disclosure are administered to a subject once daily. In another embodiment, the bacterial cells of the disclosure are administered to a subject twice daily. In another embodiment, the bacterial cells of the disclosure are administered to a subject in combination with a meal. In another embodiment, the bacterial cells of the disclosure are administered to a subject prior to a meal. In another embodiment, the bacterial cells of the disclosure are administered to a subject after a meal. The dosage of the pharmaceutical composition and the frequency of administration may be selected based on the severity of the symptoms and the progression of the disease. The appropriate therapeutically effective dose and/or frequency of administration can be selected by a treating clinician.

[0492] The methods of the disclosure may comprise administration of a composition of the disclosure alone or in combination with one or more additional therapies. An important consideration in the selection of the one or more additional therapeutic agents is that the agent(s) should be compatible with the bacteria of the disclosure, e.g., the agent(s) must not interfere with or kill the bacteria.

[0493] In one embodiment, the disease or disorder is an inflammatory disease or disorder. In one embodiment, the inflammatory disease or disorder is inflammatory bowel disease (IBD). In one embodiment, the inflammatory disease is ulcerative colitis. In another embodiment, the inflammatory disease is Crohn's disease.

[0494] In one embodiment, the disease or disorder is type I diabetes. In one embodiment, the disease or disorder is type II diabetes. In one embodiment, the disease or disorder is obesity. In one embodiment, the disease or disorder is metabolic syndrome. In one embodiment, the disease or disorder is lysosomal storage disease. In one embodiment, the disease or disorder is NASH. In one embodiment, the disease or disorder is obesity. In one embodiment, the disease or disorder is hepatic encephalopathy. In one embodiment, the disease or disorder is a disease related excess bile salt. In one embodiment, the disease or disorder is cancer.

[0495] In another embodiment, the disease or disorder is a metabolic disease or disorder. In one embodiment, the metabolic disease is phenylketonuria (PKU). In one embodiment, the metabolic disease is urea cycle disorder (UCD). In one embodiment, the disorder involving the catabolism of a branched chain amino acid is a metabolic disorder involving the abnormal catabolism of a branched chain amino acid. In one embodiment, the metabolic disorder involving the abnormal catabolism of a branched chain amino acid is maple syrup urine disease (MSUD), isovaleric acidemia, propionic acidemia, methylmalonic acidemia, or diabetes ketoacidosis. In one embodiment, the MSUD is selected from the group consisting of classic MSUD, intermediate MSUD, intermittent MSUD, E3-deficient MSUD, and thiamine-responsive MSUD. In another embodiment, the subject has isovaleric acidemia. In another embodiment, the subject has propionic acidemia. In another embodiment, the subject has methylmalonic acidemia. In another embodiment, the subject has diabetes ketoacidosis.

[0496] In another embodiment, the disorder involving the catabolism of a branched chain amino acid is a disorder caused by the activation of mTor. In one embodiment, the disorder caused by the activation of mTor is cancer, obesity, type 2 diabetes,

neurodegeneration, autism, Alzheimer's disease, Lymphangio leiomyomatosis (LAM), transplant rejection, glycogen storage disease, obesity, tuberous sclerosis, hypertension, cardiovascular disease, hypothalamic activation, musculoskeletal disease, Parkinson's disease, Huntington's disease, psoriasis, rheumatoid arthritis, lupus, multiple sclerosis, Leigh' s syndrome, or Friedrich' s ataxia.

Examples

[0497] The present disclosure is further illustrated by the following examples which should not be construed as limiting in any way. The contents of all cited references, including literature references, issued patents, and published patent applications, as cited throughout this application are hereby expressly incorporated herein by reference. It should further be understood that the contents of all the figures and tables attached hereto are also expressly incorporated herein by reference. Example 1. Construction of Plasmids Encoding One or More Kill-Switch Components

[0498] Bacteria are engineered to comprise a gene, genes, or gene cassette(s) encoding one or more biomolecule(s) of interest, e.g., therapeutic molecule(s), for example, using the methods provided herein.

[0499] In addition, a gene encoding at least one recombinase, such as Bxbl, PhiC31, TP901, Bxbl, PhiC31, TP901, HK022, HP1, R4, Intl, Int2, Int3, Int4, Int5, Int6, Int7, Int8, Int9, IntlO, Intl l, Intl2, Intl3, Intl4, Intl5, Intl6, Intl7, Intl8, Intl9, Int20, Int21, Int22, Int23, Int24, Int25, Int26, Int27, Int28, Int29, Int30, Int31, Int32, Int33, and Int34, or a biologically active fragment thereof, is synthesized and cloned into either the same vector containing the gene, genes, or gene cassette(s) encoding the biomolecule(s) of interest, or a different vector, such as pBR322. The recombinase gene(s) are each placed under the control of an inducible promoter, such as any of the inducible promoters provided herein, such as an FNR responsive promoter, an RNS responsive regulatory region, an ROS responsive regulatory region, or an arabinose-inducible promoter. One recombinase gene may be used, or several serial recombinase genes may be used. For example, a gene encoding a recombinase is synthesized and cloned into a vector under the control of an inducible promoter. Additionally, at least one additional recombinase gene is synthesized and cloned into a vector in an inverted orientation under the control of a constitutive promoter, such as the lac promoter or the tet promoter. Optionally, at least two additional recombinase genes are synthesized and cloned into the vector in inverted orientations and each under the control of their own constitutive promoter, such as the lac promoter or the tet promoter.

[0500] The bacterial cell may further comprise a gene encoding an anti-toxin, such as an anti-lysin, Sok, RNAII, IstR, RdlD, Kis, SymR, MazE, FlmB, Sib, ptaRNAl, yafQ, CcdA, MazE, ParD, yafN, Epsilon, Hie A, relE, prlF, yefM, chpBI, hipB, MccE, MccECTD, MccF, Cai, IrnmEl, Cki, Cni, Cui, Cbi, Iia, Imm, Cfi, ImlO, Csi, Cyi, Im2, Im7, Im8, Im9, Im3, Im4, ImmE6, cloacin immunity protein (Cim), ImmE5, ImmD, and Cmi, or a biologically active fragment thereof, under the control of an inducible promoter, such as an FNR responsive promoter, an RNS responsive regulatory region, an ROS responsive regulatory region, or an arabinose-inducible promoter. The gene encoding the anti-toxin is synthesized and cloned into either the same vector as the heterologous gene, the same vector as the recombinase, or a different vector, such as pBR322. The anti-toxin is placed under the control of an inducible promoter. [0501] The bacterial cell may further comprise gene encoding a toxin, such as a lysin, Hok, Fst, TisB, LdrD, Kid, SymE, MazF, FlmA, lbs, XCV2162, dinJ, CcdB, MazF, ParE, YafO, Zeta, hicB, relB, yhaV, yoeB, chpBK, hipA, microcin B, microcin B 17, microcin C, microcin C7-C51, microcin J25, microcin ColV, microcin 24, microcin L, microcin D93, microcin L, microcin E492, microcin H47, microcin 147, microcin M, colicin A, colicin El, colicin K, colicin N, colicin U, colicin B, colicin la, colicin lb, colicin 5, colicin 10, colicin S4, colicin Y, colicin E2, colicin E7, colicin E8, colicin E9, colicin E3, colicin E4, colicin E6; colicin E5, colicin D, colicin M, and cloacin DF13, or a biologically active fragment thereof, in an inverted position. The toxin gene may be synthesized in an inverted orientation and cloned into either the same vector as the heterologous gene, the same vector as the

recombinase, the same vector as the anti-toxin, or a different vector, such as pBR322. The inverted toxin gene is placed next to a constitutive promoter, such as the lac promoter or the tet promoter, so that when the recombinase acts to flip the toxin, the constitutive promoter will control expression of the toxin. However, when the toxin gene is an inverted orientation, it is not expressed.

[0502] The bacterial cell may further comprise at least one gene encoding an excision enzyme, such as Xisl, Xis2, a biologically active mutant thereof, or a biologically active fragment thereof, in an inverted position. The excision enzyme gene may be synthesized in an inverted orientation and cloned into either the same vector as the heterologous gene, the same vector as the recombinase, the same vector as the anti-toxin, the same vector as a toxin, or a different vector, such as pBR322. The inverted excision enzyme gene is placed next to a constitutive promoter, such as the lac promoter or the tet promoter, so that when the recombinase acts to flip the excision enzyme, the constitutive promoter will control expression of the excision enzyme. However, when the excision enzyme gene is in an inverted orientation, it is not expressed.

Example 2. Generation of a Recombinant Bacterial Cell of the Disclosure

[0503] Each plasmid, or combination of plasmids, discussed above is transformed into E. coli Nissle or E. coli DH5a. All tubes, solutions, and cuvettes are pre-chilled to 4° C. An overnight culture of E. coli Nissle or E. coli DH5a is diluted 1: 100 in 5 mL of lysogeny broth (LB) and grown until it reached an OD600 of 0.4-0.6. The cell culture medium will contain a selection marker, e.g., ampicillin, that is suitable for the plasmid. The E. coli cells are then centrifuged at 2,000 rpm for 5 min. at 4° C, the supernatant is removed, and the cells are resuspended in 1 niL of 4° C water. The E. coli are again centrifuged at 2,000 rpm for 5 min. at 4° C, the supernatant is removed, and the cells are resuspended in 0.5 mL of 4° C water. The E. coli are again centrifuged at 2,000 rpm for 5 min. at 4° C, the supernatant is removed, and the cells are finally resuspended in 0.1 mL of 4° C water. The electroporator is set to 2.5 kV. 0.5 μg of one of the above plasmids is added to the cells, mixed by pipetting, and pipetted into a sterile, chilled cuvette. The dry cuvette is placed into the sample chamber, and the electric pulse is applied. One mL of room-temperature SOC media is immediately added, and the mixture is transferred to a culture tube and incubated at 37° C for 1 hr. The cells are spread out on an LB plate containing ampicillin and incubated overnight.

[0504] In alternate embodiments, the gene(s) of interest, e.g., encoding a therapeutic molecule, the recombinase, the toxin gene, the anti-toxin gene, and/or the excision enzyme gene, can be inserted into the Nissle genome through homologous recombination (Genewiz, Cambridge, MA). To create a vector capable of integrating the synthesized constructs into the chromosome, Gibson assembly can be first used to add lOOObp sequences of DNA homologous to the Nissle lacZ locus into the R6K origin plasmid pKD3. This targets DNA cloned between these homology arms to be integrated into the lacZ locus in the Nissle genome. Gibson assembly will be used to clone the fragment between these arms. PCR is used to amplify the region from this plasmid containing the entire sequence of the homology arms, as well as the gene cassette between them. This PCR fragment will be used to transform electrocompetent Nissle-pKD46, a strain that contains a temperature- sensitive plasmid encoding the lambda red recombinase genes. After transformation, cells are grown out for 2 hours before plating on chloramphenicol at 20ug/mL at 37oC. Growth at 37oC will also cure the pKD46 plasmid. Transformants containing cassette were chloramphenicol resistant and lac-minus (lac-).

Example 3. Production of the Gene of Interest in the Recombinant Bacterial Cell

[0505] Production of a gene of interest, such as one or more genes encoding enzymes that synthesize a therapeutic molecule, can be assessed in E. coli Nissle strains containing the gene cassettes described above in order to determine the effect of the exogenous

environmental signal, e.g., oxygen, on the production of the therapeutic molecule. All incubations are performed at 37° C. Cultures of E. coli strains DH5a and Nissle transformed with the gene, genes, or gene cassette(s) are grown overnight in LB and then diluted 1:200 into 4 mL of M9 minimal medium containing 0.5% glucose. The cells are grown with shaking (250 rpm) for 4-6 h and incubated aerobically or anaerobically in a Coy anaerobic chamber (supplying 90% N2, 5% C02, 5%H2). One mL culture aliquots are prepared in 1.5 mL capped tubes and incubated in a stationary incubator to limit culture aeration. One tube is removed at each time point (0, 1, 2, 4, and 20 hours) and analyzed for therapeutic molecule concentration by LC-MS (or other appropriate method) to confirm that production in these recombinant strains is achieved in a low-oxygen environment.

Example 4. Efficacy of Heterologous Gene Expression in a Mouse Model of Disease

[0506] The efficacy of heterologous gene expression may be tested in a mouse model of disease. For example a mouse model of Inflammatory Bowel Disease (IBD) may be used to determine the efficacy of butyrate expression using the recombinant bacterial cells of the disclosure. Bacteria harboring the butyrate cassettes described above are grown overnight in LB . Bacteria are then diluted 1: 100 into LB containing a suitable selection marker, e.g., ampicillin, and grown to an optical density of 0.4-0.5 and then pelleted by centrifugation. Bacteria are resuspended in phosphate buffered saline and 100 microliters is administered by oral gavage to mice. IBD is induced in mice by supplementing drinking water with 3% dextran sodium sulfate for 7 days prior to bacterial gavage. Mice are treated daily for 1 week and bacteria in stool samples are detected by plating stool homogenate on agar plates supplemented with a suitable selection marker, e.g., ampicillin. After 5 days of bacterial treatment, colitis is scored in live mice using endoscopy. Endoscopic damage score is determined by assessing colon translucency, fibrin attachment, mucosal and vascular pathology, and/or stool characteristics. Mice are sacrificed and colonic tissues are isolated. Distal colonic sections are fixed and scored for inflammation and ulceration. Colonic tissue is homogenized and measurements are made for myeloperoxidase activity using an enzymatic assay kit and for cytokine levels (IL-Ιβ, TNF-a, IL-6, IFN-γ and IL-10). In order to confirm that the recombinant bacterial cells of the disclosure are effectively expressing the

recombinase enzyme and that the flipping of the toxin gene or excision enzyme gene is occurring to result in the non- viability of the recombinant bacterial cells of the disclosure which were administered to the mice, stool samples may be plated on agar plates

supplemented with a suitable selection marker, such as ampicillin. Example 5. Bacterial Strains Engineered to Metabolize Ammonia

[0507] Ammonia is highly toxic and generated during metabolism in all organs (Walker, 2012). In mammals, the healthy liver protects the body from ammonia by converting ammonia to non-toxic molecules, e.g., urea or glutamine, and preventing excess amounts of ammonia from entering the systemic circulation. Hyperammonemia is characterized by the decreased detoxification and/or increased production of ammonia. In mammals, the urea cycle detoxifies ammonia by enzymatically converting ammonia into urea, which is then removed in the urine. Ammonia is also a source of nitrogen for amino acids, which are synthesized by various biosynthesis pathways. For example, arginine biosynthesis converts glutamate, which comprises one nitrogen atom, to arginine, which comprises four nitrogen atoms. Intermediate metabolites formed in the arginine biosynthesis pathway, such as citrulline, also incorporate nitrogen. Thus, enhancement of arginine biosynthesis may be used to incorporate excess nitrogen in the body into non-toxic molecules in order to modulate or treat conditions associated with hyperammonemia.

[0508] Bacteria are engineered that are capable of reducing excess ammonia and converting ammonia and/or nitrogen into alternate byproducts. The "arginine biosynthesis regulon" or "arg regulon" refers to the collection of operons in a given bacterial species that comprise the genes encoding the enzymes responsible for converting glutamate to arginine and/or intermediate metabolites, e.g., citrulline, in the arginine biosynthesis pathway. The arginine regulon includes, but is not limited to, the operons encoding the arginine

biosynthesis enzymes N-acetylglutamate synthetase, N-acetylglutamate kinase, N- acetylglutamylphosphate reductase, acetylornithine aminotransferase, N-acetylornithinase, ornithine transcarbamylase, arginino succinate synthase, arginino succinate lyase,

carbamoylphosphate synthase, operators thereof, promoters thereof, ARG boxes thereof, and/or regulatory regions thereof.

[0509] Bacteria having a mutant arginine regulon have been engineered. The bacteria comprise an arginine regulon having one or more nucleic acid mutations that reduce or eliminate arginine- mediated repression of each of the operons that encode the enzymes responsible for converting glutamate to arginine and/or an intermediate byproduct, e.g., citrulline, in the arginine biosynthesis pathway, such that the mutant arginine regulon produces more arginine and/or intermediate byproduct than an unmodified regulon from the same bacterial subtype under the same conditions. For example, in some embodiments, the genetically engineered bacteria comprise an arginine feedback resistant N-acetylglutamate synthase mutant, e.g., argAfbr, and a mutant arginine regulon in which mutant arginine repressor comprising one or more nucleic acid mutations such that arginine repressor function is decreased or inactive, or the genetically engineered bacteria do not have an arginine repressor (e.g., the arginine repressor gene has been deleted), resulting in derepression of the regulon and enhancement of arginine and/or intermediate byproduct biosynthesis.

Example 6. Bacterial strains having Arginine feedback resistant N-acetylglutamate synthetase (argA ^br) and ArgR deletion

A. Deleting ArgR

[0510] Lambda red recombination is used to make chromosomal modifications, e.g., ArgR mutations. Lambda red is a procedure using recombination enzymes from a

bacteriophage lambda to insert a piece of custom DNA into the chromosome of E. coli. A pKD46 plasmid is transformed into the E. coli Nissle host strain. E. coli Nissle cells are grown overnight in LB media. The overnight culture is diluted 1: 100 in 5 mL of LB media and grown until it reaches an OD600 of 0.4-0.6. All tubes, solutions, and cuvettes are pre- chilled to 4° C. The E. coli cells are centrifuged at 2,000 rpm for 5 min. at 4° C, the supernatant is removed, and the cells are resuspended in 1 mL of 4° C water. The E. coli are centrifuged at 2,000 rpm for 5 min. at 4° C, the supernatant is removed, and the cells are resuspended in 0.5 mL of 4° C water. The E. coli are centrifuged at 2,000 rpm for 5 min. at 4° C, the supernatant is removed, and the cells are resuspended in 0.1 mL of 4° C water. The electroporator is set to 2.5 kV. 1 ng of pKD46 plasmid DNA is added to the E. coli cells, mixed by pipetting, and pipetted into a sterile, chilled cuvette. The dry cuvette is placed into the sample chamber, and the electric pulse is applied. 1 mL of room-temperature SOC media is immediately added, and the mixture is transferred to a culture tube and incubated at 30° C for 1 hr. The cells are spread out on a selective media plate and incubated overnight at 30° C.

[0511] Approximately 50 bases of homology upstream and downstream of the ArgR gene are added by PCR to the kanamycin resistance gene in the pKD4 plasmid to generate the following KanR construct: (-50 bases upstream of ArgR) (terminator) (kanR gene flanked by FRT sites from pKD4) (DNA downstream of argR).

[0512] The lambda enzymes are used to insert this construct into the genome of E. coli Nissle through homologous recombination. The construct is inserted into a specific site in the genome of E. coli Nissle based on its DNA sequence. To insert the construct into a specific site, the homologous DNA sequence flanking the construct is identified. The homologous sequence of DNA includes approximately 50 bases on either side of the mutated sequence. The homologous sequences are ordered as part of the synthesized gene.

Alternatively, the homologous sequences may be added by PCR. The construct is used to replace the natural sequence upstream of argA in the E. coli Nissle genome. The construct includes an antibiotic resistance marker that may be removed by recombination. The resulting mutant argR construct comprises approximately 50 bases of homology upstream of argR, a kanamycin resistance marker that can be removed by recombination, and

approximately 50 bases of homology to argR.

i. Transforming E. coli Nissle

[0513] The mutated argR construct is transformed into E. coli Nissle comprising pKD46. All tubes, solutions, and cuvettes are pre-chilled to 4° C. An overnight culture is diluted 1 : 100 in 5 mL of LB media containing ampicillin and grown until it reaches an OD₆oo of 0.1. 0.05 mL of 100X L-arabinose stock solution is added to induce pKD46 lambda red expression. The culture is grown until it reaches an OD₆oo of 0.4-0.6. The E. coli cells are centrifuged at 2,000 rpm for 5 min. at 4° C, the supernatant is removed, and the cells are resuspended in 1 mL of 4° C water. The E. coli are centrifuged at 2,000 rpm for 5 min. at 4° C, the supernatant is removed, and the cells are resuspended in 0.5 mL of 4° C water. The E. coli are centrifuged at 2,000 rpm for 5 min. at 4° C, the supernatant is removed, and the cells are resuspended in 0.1 mL of 4° C water. The electroporator is set to 2.5 kV. 0.5 μg of the mutated argR construct is added to the cells, mixed by pipetting, and pipetted into a sterile, chilled cuvette. The dry cuvette is placed into the sample chamber, and the electric pulse is applied. 1 mL of room-temperature SOC media is immediately added, and the mixture is transferred to a culture tube and incubated at 37° C for 1 hr. The cells are spread out on an LB plate containing kanamycin and incubated overnight.

ii. Verifying mutants

[0514] The presence of the mutation is verified by colony PCR. Colonies are picked with a pipette tip and resuspended in 20 μΐ of cold ddH₂0 by pipetting up and down. 3

of the suspension is pipetted onto an index plate with appropriate antibiotic for use later. The index plate is grown at 37° C overnight. A PCR master mix is made using 5

of 10X PCR buffer, 0.6 μΐ of 10 mM dNTPs, 0.4 μΐ, of 50 mM Mg₂S0₄, 6.0 μΐ, of 10X enhancer, and 3.0 μϊ_^ of ddH₂0 (15 μΐ_^ of master mix per PCR reaction). A 10 μΜ primer mix is made by mixing 2 μϊ_^ of primers unique to the argA mutant construct (100 μΜ stock) into 16 μΐ_^ of ddH₂0. For each 20 μΐ_^ reaction, 15μί of the PCR master mix, 2.0 μΐ_^ of the colony suspension (template), 2.0 μΐ_^ of the primer mix, and 1.0 μΐ_^ of Pfx Platinum DNA Pol are mixed in a PCR tube. The PCR thermocycler is programmed as follows, with steps 2-4 repeating 34 times: 1) 94° C at 5:00 min., 2) 94° C at 0: 15 min., 3) 55° C at 0:30 min., 4) 68° C at 2:00 min., 5) 68° C at 7:00 min., and then cooled to 4° C. The PCR products are analyzed by gel electrophoresis using 10 μΐ_^ of each amplicon and 2.5 μΐ_^ 5X dye. The PCR product only forms if the mutation has inserted into the genome.

iii. Removing selection marker

[0515] The antibiotic resistance gene is removed with pCP20. Each strain with the mutated ARG boxes is grown in LB media containing antibiotics at 37° C until it reaches an OD₆oo of 0.4-0.6. All tubes, solutions, and cuvettes are pre-chilled to 4° C. The cells are centrifuged at 2,000 rpm for 5 min. at 4° C, the supernatant is removed, and the cells are resuspended in 1 mL of 4° C water. The E. coli are centrifuged at 2,000 rpm for 5 min. at 4° C, the supernatant is removed, and the cells are resuspended in 0.5 mL of 4° C water. The E. coli are centrifuged at 2,000 rpm for 5 min. at 4° C, the supernatant is removed, and the cells are resuspended in 0.1 mL of 4° C water. The electroporator is set to 2.5 kV. 1 ng of pCP20 plasmid DNA is added to the cells, mixed by pipetting, and pipetted into a sterile, chilled cuvette. The dry cuvette was placed into the sample chamber, and the electric pulse was applied. 1 mL of room-temperature SOC media is immediately added, and the mixture is transferred to a culture tube and incubated at 30° C for 1-3 hrs. The cells are spread out on an LB plate containing kanamycin and incubated overnight. Colonies that do not grow to a sufficient OD₆oo overnight are further incubated for an additional 24 hrs. 200 μΐ_^ of cells are spread on ampicillin plates, 200 μΐ_^ of cells are spread on kanamycin plates, and both are grown at 37° C overnight. The ampicillin plate contains cells with pCP20. The kanamycin plate provides an indication of how many cells survived the electroporation. Transformants from the ampicillin plate are purified no n- selectively at 43° C and allowed to grow overnight.

iv. Verifying transformants

[0516] The purified transformants are tested for sensitivity to ampicillin and kanamycin. A colony from the plate grown at 43° C is picked and and resuspended in 10 μΐ_^ of LB media. 3 μΐ_^ of the cell suspension is pipetted onto each of three plates: 1) an LB plate with kanamycin incubated at 37° C, which tests for the presence or absence of the kanR gene in the genome of the host strain; 2) an LB plate with ampicillin incubated at 30° C, which tests for the presence or absence of the ampR gene from the pCP20 plasmid; and 3) an LB plate without antibiotic incubated at 37° C. If no growth is observed on the kanamycin or ampicillin plates for a particular colony, then both the katiR gene and the pCP20 plasmid were lost, and the colony is saved for further analysis. The saved colonies are restreaked onto an LB plate to obtain single colonies and grown overnight at 37° C. The presence of the mutated genomic argR is confirmed by sequencing.

B. Arginine feedback resistant N-acetylglutamate synthetase (argA ^br)

[0517] In addition to the ArgR deletion described above, the E. Coli Nissle bacteria further comprise an arginine feedback resistant N-acetylglutamate synthetase (argAfbr) gene expressed under the control of each of the following promoters: tetracycline-inducible promoter, FNR promoter selected from SEQ ID NOs: 1-17. As discussed herein, other promoters may be used.

[0518] The argAfbr gene can be expressed on a high-copy plasmid, a low-copy plasmid, or a chromosome. For example, several bacterial strains were made in which ArgR is deleted (AArgR): SYN-UCD201, SYN-UCD202, and SYN-UCD203. SYN-UCD201 further comprises wild-type argA, but lacks inducible argAfbr. SYN-UCD202 comprises AArgR and argAfbr expressed under the control of a tetracycline-inducible promoter on a high-copy plasmid. SYN-UCD203 comprises AArgR and argAfbr expressed under the control of a tetracycline-inducible promoter on a low-copy plasmid. SYN-UCD204 comprises AArgR and argAfbr expressed under the control of a tetracycline-inducible promoter on a low-copy plasmid. SYN-UCD205 comprises AArgR and argAfbr expressed under the control of a FNR- inducible promoter (fnrS2) on a low-copy plasmid.

[0519] The argAfbr gene is inserted into the bacterial genome at one or more of the following insertion sites in E. coli Nissle: malE/K, araC/BAD, lacZ, thyA, malP/T. Any suitable insertion site may be used, see, e.g., Fig. 14. The insertion site may be anywhere in the genome, e.g., in a gene required for survival and/or growth, such as thyA (to create an auxotroph); in an active area of the genome, such as near the site of genome replication; and/or in between divergent promoters in order to reduce the risk of unintended transcription, such as between AraB and AraC of the arabinose operon. At the site of insertion, DNA primers that are homologous to the site of insertion and to the argAfbr construct are designed. A linear DNA fragment containing the construct with homology to the target site is generated by PCR, and lambda red recombination is performed as described above. The resulting E. coli Nissle bacteria have deleted ArgR and inserted feedback resistant N-acetylglutamate synthetase, thereby increasing arginine or citrulline biosynthesis.

Example 7. Generation of AThyA

[0520] An auxotrophic mutation causes bacteria to die in the absence of an exogenously added nutrient essential for survival or growth because they lack the gene(s) necessary to produce that essential nutrient. In order to generate genetically engineered bacteria with an auxotrophic modification, the thyA, a gene essential for oligonucleotide synthesis was deleted. Deletion of the thyA gene in E. coli Nissle yields a strain that cannot form a colony on LB plates unless they are supplemented with thymidine.

[0521] A thyA::cam PCR fragment was amplified using 3 rounds of PCR as follows. Sequences of the primers used at a lOOum concentration are found in Table 13.

Table 13. Primer Sequences

[0522] For the first PCR round, 4x50ul PCR reactions containing lng pKD3 as template, 25ul 2xphusion, 0.2ul primer SR36 and SR38, and either 0, 0.2, 0.4 or 0.6ul DMSO were brought up to 50 ul volume with nuclease free water and amplified under the following cycle conditions:

stepl: 98c for 30s

step2: 98c for 10s step3: 55c for 15s

step4: 72c for 20s

repeat step 2-4 for 30 cycles

step5: 72c for 5min

[0523] Subsequently, 5ul of each PCR reaction was run on an agarose gel to confirm PCR product of the appropriate size. The PCR product was purified from the remaining PCR reaction using a Zymoclean gel DNA recovery kit according to the manufacturer's instructions and eluted in 30ul nuclease free water.

[0524] For the second round of PCR, lul purified PCR product from round 1 was used as template, in 4x50ul PCR reactions as described above except with 0.2ul of primers SR33 and SR34. Cycle conditions were the same as noted above for the first PCR reaction. The PCR product run on an agarose gel to verify amplification, purified, and eluted in 30ul as described above.

[0525] For the third round of PCR, lul of purified PCR product from round 2 was used as template in 4x50ul PCR reactions as described except with primer SR43 and SR44. Cycle conditions were the same as described for rounds 1 and 2. Amplification was verified, the PCR product purified, and eluted as described above. The concentration and purity was measured using a spectrophotometer. The resulting linear DNA fragment, which contains 92 bp homologous to upstream of thyA, the chloramphenicol cassette flanked by frt sites, and 98 bp homologous to downstream of the thyA gene, was transformed into a E. coli Nissle 1917 strain containing pKD46 grown for recombineering. Following electroporation, 1ml SOC medium containing 3mM thymidine was added, and cells were allowed to recover at 37 C for 2h with shaking. Cells were then pelleted at 10,000xg for 1 minute, the supernatant was discarded, and the cell pellet was resuspended in lOOul LB containing 3mM thymidine and spread on LB agar plates containing 3mM thy and 20ug/ml chloramphenicol. Cells were incubated at 37 C overnight. Colonies that appeared on LB plates were restreaked. + cam 20ug/ml + or - thy 3mM. (thyA auxotrophs will only grow in media supplemented with thy 3mM).

[0526] Next, the antibiotic resistance was removed with pCP20 transformation.

pCP20 has the yeast Flp recombinase gene, FLP, chloramphenicol and ampicillin resistant genes, and temperature sensitive replication. Bacteria were grown in LB media containing the selecting antibiotic at 37°C until OD600 = 0.4 - 0.6. lmL of cells were washed as follows: cells were pelleted at 16,000xg for 1 minute. The supernatant was discarded and the pellet was resuspended in lmL ice-cold 10% glycerol. This wash step was repeated 3x times. The final pellet was resuspended in 70ul ice-cold 10% glycerol. Next, cells were electroporated with lng pCP20 plasmid DNA, and lmL SOC supplemented with 3mM thymidine was immediately added to the cuvette. Cells were resuspended and transferred to a culture tube and grown at 30°C for lhours. Cells were then pelleted at 10,000xg for 1 minute, the supernatant was discarded, and the cell pellet was resuspended in lOOul LB containing 3mM thymidine and spread on LB agar plates containing 3mM thy and lOOug/ml carbeniciUin and grown at 30°C for 16-24 hours. Next, transformants were colony purified no n- selectively (no antibiotics) at 42°C.

[0527] To test the colony-purified transformants, a colony was picked from the 42°C plate with a pipette tip and resuspended in

of the cell suspension was pipetted onto a set of 3 plates: Cam, (37°C; tests for the presence/absence of CamR gene in the genome of the host strain), Amp, (30°C, tests for the presence/absence of AmpR from the pCP20 plasmid) and LB only (desired cells that have lost the chloramphenicol cassette and the pCP20 plasmid), 37°C. Colonies were considered cured if there is no growth in neither the Cam or Amp plate, picked, and re-streaked on an LB plate to get single colonies, and grown overnight at 37°C.

Example 8. Quantifying ammonia

[0528] The genetically engineered bacteria described above were grown overnight in 5 mL LB. The next day, cells were pelleted and washed in M9 + glucose, pelleted, and resuspended in 3 mL M9 + glucose. Cell cultures were incubated with shaking (250 rpm) for 4 hrs and incubated aerobically or anaerobically in a Coy anaerobic chamber (supplying 90% N2, 5% C02, 5%H2) at 37° C. At baseline (t=0), 2 hours, and 4 hours, the OD600 of each cell culture was measured in order to determine the relative abundance of each cell.

[0529] At t=0, 2 hrs, and 4 hrs, a 1 mL aliquot of each cell culture was analyzed on the Nova Biomedical Bioprofile Analyzer 300 in order to determine the concentration of ammonia in the media. Both SYN-UCD101 and SYN-UCD102 were capable of consuming ammonia in vitro. Example 9. Bacterial Strain that Matabolizes Ammonia and Contains a Kill-Switch

[0530] E. Coli Nissle having AArgR, in which the toxin insertion is in the thyA locus, meaning that these strains are thymidine auxotrophs. The Recombinase (Int8) is in the MalEK locus. The following E. Coli Nissle bacterial strains were made: (1) Syn626: E. coli Nissle 1917 AArgR thyA::kan-kidOFF(RBS l); thymidine auxotroph (this control strain has an unflipped kid toxin gene and no recombinase); and (2) Syn642: E. coli Nissle 1917 AArgR thyA::kan-kidOFF(RBS l) MalEK: :Cm TetR-Int8(10K RBS); DAS; thymidine auxotroph (this kill-switch strain has an unflipped kid toxin gene and an aTc-inducible Int8

recombinase).

[0531] Overnight cultures were diluted 1: 100 into LB supplemented with thymidine (10 mM) in duplicate and grown at 37C with shaking. After 2 hr of growth, one of the duplicate cultures for each strain was induced with the addition of aTc (214 nM) while the other received no additions. Cells were returned to the 37C. Cell viability was measured over 2 hours (0.5h, l.Oh, 2.0h) by serially diluting and plating strains on LB agar supplemented with thymidine (10 mM). Colonies were enumerated to determine the number of viable cells at each time point.

Table 14.

tattgatatcgatggtgatttccggttcgttctgtttctgggtaacctcatatttttccagatcgaagcgtttca gataattgtaaaaaactttaatcacttctttttctttgatgtacaccggtttcagattcggggtaactttacagt tgttgcagtagtactgtttcacaaagatatagccgctattgcttttctttttatggctattcagggtcaggcgt gcattacaaaccggacaaaccagtttgccacgaaaaatgctggtatgacgaacttttttggtgttcacgc gttcattcaggcgatctttaactttctcatacatctcatcggtgatgatcggttcatggttattttcaatatgca caccaccccaatcaaaatgaccacgggtaaacggattacgcagggcatgggtaatggtacgaccctg ccactgggtattattcggaggcggaatatcgctattattcagtttgcgtgcaattgcttttgcgctctgacc tttcattgcttcgtcatatgcccacagaataacgtctttgtatttgttcggcacaaacttattatccacacggt cataataaaacggaggggtggtcagcataatacctttacgcagtgctgccagtttacccatctgggtac gttcacgaatggtttcacgttcccattctgccattgcaccaaccagggtaacaaacagacgacccattg cggtggtggtatcataaacttcggtggcgctacgaaagctcacatcatttttttcaaagatttccagcagg tccagcagatcacgaacattacgggtcagacgatccagtttatacaccagcaccagatcaaatttgtta atatcattcatcagacgctgcagttccggacgatcacgttttgcaccgctataacctgcatcgatataggt atcatacacggtccaatcattaatatcgcagaagcttttcagtttacgctcttgttcttcaatgctatgacca tgttctttctgttccagggtgctaacacgacaataaacggcaactttcatAACTCTTTGACTT

AGATGGGTGGGGATTCTGGGGTttcacttttctctatcactgatagggagtggtaaa ataactctatcaatgatagagtgtcaacaaaaattaggaattaatgatgtctagattagataaaagtaaag tgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgccc agaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgcct tagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagatttt ttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggt acacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttc actagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaag agcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaa gctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcgg attagaaaaacaacttaaatgtgaaagtgggtcttaagctagccctgcagggtgcacGCCATGG

TCCATATGAATATCCTCCTTAGTTCCTATTCCGAAGTTCCTAT

TCTCTAGAAAGTATAGGAACTTCGGCGCGCCTACCTGTGACG

GAAGATCACTTCGCAGAATAAATAAATCCTGGTGTCCCTGTT

GATACCGGGAAGCCCTGGGCCAACTTTTGGCGAAAATGAGAC

GTTGATCGGCACGTAAGAGGTTCCAACTTTCACCATAATGAA

ATAAGATCACTACCGGGCGTATTTTTTGAGTTGTCGAGATTTT

CAGGAGCTAAGGAAGCTAAAATGGAGAAAAAAATCACTGGA

TATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACAT

TTTGAGGCATTTCAGTCAGTTGCTCAATGTACCTATAACCAGA

CCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGA

AAAATAAGCACAAGTTTTATCCGGCCTTTATTCACATTCTTGC

CCGCCTGATGAATGCTCATCCGGAATTACGTATGGCAATGAA

AGACGGTGAGCTGGTGATATGGGATAGTGTTCACCCTTGTTA

CACCGTTTTCCATGAGCAAACTGAAACGTTTTCATCGCTCTGG

AGTGAATACCACGACGATTTCCGGCAGTTTCTACACATATATT

CGCAAGATGTGGCGTGTTACGGTGAAAACCTGGCCTATTTCC

CTAAAGGGTTTATTGAGAATATGTTTTTCGTCTCAGCCAATCC

CTGGGTGAGTTTCACCAGTTTTGATTTAAACGTGGCCAATATG

GACAACTTCTTCGCCCCCGTTTTCACCATGGGCAAATATTATA

CGCAAGGCGACAAGGTGCTGATGCCGCTGGCGATTCAGGTTC

ATCATGCCGTTTGTGATGGCTTCCATGTCGGCAGATGCTTAAT

GAATACAACAGTACTGCGATGAGTGGCAGGGCGGGGCGTAA

GGCGCGCCATTTAAATGAAGTTCCTATTCCGAAGTTCCTATTC TCTAGAAAGTATAGGAACTTCGAAGCAGCTCCAGCCTACACA

ATCGCTCAAGACGTGTAATGCTGCAATCTGCATGCAAGCTTG

GCACTGGCCACGCAAAAAGGCCATCCGTCAGGATGGCCTTCT

GCTTAATTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCG

CCACCCTCCGGGCCGTTGCTTCGCAACGTTCAAATCCGCTCCC

GGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAA

CAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGT

TTTATTTG

Sequence of attagatagccaccggcgctttaatgcccggatgtggatcgtatccttcaatcgacgtcccatggctcga construct shown in gCATGCGAGAGTAGGGAACTGCCAGGCATCAAATAAAACGA Fig. 9C SEQ ID AAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTT NO: 30 TGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGGGAG

CGGATTTGAACGTTGCGAAGCAACGGCCCGGAGGGTGGCGG

GCAGGACGCCCGCCATAAACTGCCAGGCATCAAATTAAGCAG

AAGGCCATCCTGACGGATGGCCTTTTTGCGTGGCCAGTGCCA

AGCTTGCATGCAGATTGCAGCATTACACGTCTTGAGCGATTG

TGTAGGCTGGAGCTGCTTCgaagttcctatactttctagagaataggaacttcggaata ggaacttcaagatcccctcacgctgccgcaagcactcagggcgcaagggctgctaaaggaagcgg aacacgtagaaagccagtccgcagaaacggtgctgaccccggatgaatgtcagctactgggctatct ggacaagggaaaacgcaagcgcaaagagaaagcaggtagcttgcagtgggcttacatggcgatag ctagactgggcggttttatggacagcaagcgaaccggaattgccagctggggcgccctctggtaagg ttgggaagccctgcaaagtaaactggatggctttcttgccgccaaggatctgatggcgcaggggatca agatctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttct ccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatg ccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgcc ctgaatgaactgcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgca gctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcag gatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgc atacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtact cggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagcc gaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgacccatggcgat gcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtg tggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgg gctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttct tgacgagttcttctgagcgggactctggggttcgaaatgaccgaccaagcgacgcccaacctgccat cacgagatttcgattccaccgccgccttctatgaaaggttgggcttcggaatcgttttccgggacgccg gctggatgatcctccagcgcggggatctcatgctggagttcttcgcccaccccagcttcaaaagcgct ctgaagttcctatactttctagagaataggaacttcGGAATAGGAACTAAGGAGGA

TATTCATATGGACCATGGCggaaacacagAAAAAAGCCCGCACCT

GACAGTGCGGGCTTTTTTTTTcgaccaaaggCCCACACttaataaactatgg aagtatgtacagtcttgcaatgttgagtgaacaaacttccataataaaatatcggaaacataggtgAT

GGAAAGAGGGGAAATCTGGCTTGTCTCGCTTGATCCTACCGC

AGGTCATGAGCAGCAGGGAACGCGGCCGGTGCTGATTGTCAC

ACCGGCGGCCTTTAATCGCGTGACCCGCCTGCCTGTTGTTGTG

CCCGTAACCAGCGGAGGCAATTTTGCCCGCACTGCCGGCTTT

GCGGTGTCGTTGGATGGTGTTGGCATACGTACCACAGGTGTT

GTACGTTGCGATCAACCCCGGACAATTGATATGAAAGCACGG

GGCGGAAAACGACTCGAACGGGTTCCGGAGACTATCATGAA

CGAAGTTCTTGGCCGCCTGTCCACTATTCTGACTTGAacgagtactt tagacgggatacaaccgtggttaatgcacgtgccgccatagttatctgatgattggttatcgctctcatcg aactTCCACACATTATAcctataggttagactttaAGTCAATACTCTTTTTtca atcaatcagtcgacgcatgcatcgatgtgtgccttcgtcgagcactttttgcatcagttctaaatactgtttc at

[0532] The results are shown in Figs 10A and 10B. Strains with partial kill switch (unflipped kid toxin gene, no recombinase) or complete kill switch (unflipped kid toxin gene, aTc-inducible recombinase) were grown in LB for 2 hr and each strain was either induced or left uninduced. In the strain with the partial kill switch, the induced strain (black triangle) grows at the same rate as the uninduced strain (black circle) because the strain lacks the recombinase to flip the toxin gene and kill the strain. In the strain with the complete kill switch, inducing the strain (black triangle) results in >90% cell death within 30 minutes as evidenced by a decrease in cell number relative to the starting cell count. In the absence of inducer (black circles), the strain shows similar growth to the partial kill switch strain which suggests that harboring the kill switch in an uninduced state does not cause a significant physiological burden.

Example 10. In vivo testing of Bacterial Strain containg a Kill-Switch

[0533] Mice are treated with approximately 109 CFU Streptomycin-resistant Nissle (no kill- switch) or the Nissle strains in Example 9 having kill- switch circuitry via oral gavage without antibiotic pre-treatment, and at each timepoint, animals (n=4) were euthanized, and intestine, cecum, and colon were removed. The small intestine was cut into three sections, and the large intestine and colon each into two sections. Intestinal effluents gathered and CFUs in each compartment were determined by serial dilution plating.

[0534] Alternatively, mice treated as above, and fecal pellets from six total mice are collected post-administration to determine the amount of administered Nissle still residing within the mouse gastrointestinal tract. The numbers of wild type Nissle and the strain having the kill switch recovered from the fecal samples each day for 10 consecutive days are determined.

Example 11. Bacterial Strains Engineered to Metabolize Phenylalanine

[0535] Phenylalanine is an essential amino acid primarily found in dietary protein. Typically, a small amount is utilized for protein synthesis, and the remainder is hydroxylated to tyrosine in an enzymatic pathway that requires phenylalanine hydroxylase (PAH) and the cofactor tetrahydrobiopterin. Hyperphenylalaninemia is a group of diseases associated with excess levels of phenylalanine, which can be toxic and cause brain damage. Primary hyperphenylalaninemia is caused by deficiencies in PAH activity that result from mutations in the PAH gene and/or a block in cofactor metabolism.

[0536] Phenylketonuria (PKU) is a severe form of hyperphenylalaninemia caused by mutations in the PAH gene.

[0537] The enzyme phenylalanine ammonia lyase (PAL) is capable of metabolizing phenylalanine to non-toxic levels of ammonia and transcinnamic acid. Unlike PAH, PAL does not require THB cofactor activity in order to metabolize phenylalanine. L-amino acid deaminase (LAAD) catalyzes oxidative deamination of phenylalanine to generate

phenylpyruvate, and trace amounts of ammonia and hydrogen peroxide.

[0538] Genetically engineered bacteria that encode and express a phenylalanine metabolizing enzyme (PME), such as PAL and/or LAAD can be used to treat PKU.

Genetically engineered bacteria that encode and express phenylalanine ammonia lyase and/or phenylalanine hydroxylase and/or L-aminoacid deaminase are capable of reducing

hyperphenylalaninemia.

Example 12. Construction of PAL plasmids

[0539] To facilitate inducible production of PAL in Escherichia coli Nissle, the PAL gene of Anabaena variabilis ("PALI") or Photorhabdus luminescens ("PAL3"), as well as transcriptional and translational elements, were synthesized (Gen9, Cambridge, MA) and cloned into vector pBR322. The PAL gene was placed under the control of an inducible promoter. Low-copy and high-copy plasmids were generated for each of PALI and PAL3 under the control of an inducible FNR promoter or a Tet promoter. However, as noted above, other promoters may be used to drive expression of the PAL gene, other PAL genes may be used, and other phenylalanine metabolism-regulating genes may be used.

i. Transforming E. coli

[0540] Each of the plasmids described herein was transformed into E. coli Nissle for the studies described herein according to the following steps. All tubes, solutions, and cuvettes were pre-chilled to 4 °C. An overnight culture of E. coli Nissle was diluted 1: 100 in 5 mL of lysogeny broth (LB) containing ampicillin and grown until it reached an OD600 of 0.4-0.6. The E. coli cells were then centrifuged at 2,000 rpm for 5 min at 4 °C, the supernatant was removed, and the cells were resuspended in 1 mL of 4 °C water. The E. coli were again centrifuged at 2,000 rpm for 5 min at 4 °C, the supernatant was removed, and the cells were resuspended in 0.5 mL of 4 °C water. The E. coli were again centrifuged at 2,000 rpm for 5 min at 4 °C, the supernatant was removed, and the cells were finally resuspended in 0.1 mL of 4 °C water. The electroporator was set to 2.5 kV. Plasmid (0.5 μg) was added to the cells, mixed by pipetting, and pipetted into a sterile, chilled cuvette. The dry cuvette was placed into the sample chamber, and the electric pulse was applied. One mL of room- temperature SOC media was added immediately, and the mixture was transferred to a culture tube and incubated at 37 °C for 1 hr. The cells were spread out on an LB plate containing ampicillin and incubated overnight.

[0541] Example 13. Phenylalanine transporter - Integration of PheP into the bacterial chromosome

[0542] In some embodiments, it may be advantageous to increase phenylalanine transport into the cell, thereby enhancing phenylalanine metabolism. Therefore, a second copy of the native high affinity phenylalanine transporter, PheP, driven by an inducible promoter, was inserted into the Nissle genome through homologous recombination. The pheP gene was placed downstream of the Ptet promoter, and the tetracycline repressor, TetR, was divergently transcribed. This sequence was synthesized by Genewiz (Cambridge, MA). To create a vector capable of integrating the synthesized TetR-PheP construct into the chromosome, Gibson assembly was first used to add 1000 bp sequences of DNA homologous to the Nissle lacZ locus into the R6K origin plasmid pKD3. This targets DNA cloned between these homology arms to be integrated into the lacZ locus in the Nissle genome. Gibson assembly was used to clone the TetR-PheP fragment between these arms. PCR was used to amplify the region from this plasmid containing the entire sequence of the homology arms, as well as the pheP sequence between them. This PCR fragment was used to transform electrocompetent Nissle-pKD46, a strain that contains a temperature- sensitive plasmid encoding the lambda red recombinase genes. After transformation, cells were grown for 2 hrs before plating on chloramphenicol at 20 μg/mL at 37 °C. Growth at 37 °C cures the pKD46 plasmid. Transformants containing anhydrous tetracycline (ATC)-inducible pheP were lac-minus (lac-) and chloramphenicol resistant. Example 14. Effect of the Phenylalanine transporter on phenylalanine degradation

[0543] To determine the effect of the phenylalanine transporter on phenylalanine degradation,

[0544] phenylalanine degradation and trans-cinnamate accumulation achieved by genetically engineered bacteria expressing PALI or PAL3 on low-copy (LC) or high-copy (HC) plasmids in the presence or absence of a copy of pheP driven by the Tet promoter integrated into the chromosome was assessed.

[0545] For in vitro studies, all incubations were performed at 37 °C. Cultures of E. coli Nissle transformed with a plasmid comprising the PAL gene driven by the Tet promoter were grown overnight and then diluted 1: 100 in LB. The cells were grown with shaking (200 rpm) to early log phase. Anhydrous tetracycline (ATC) was added to cultures at a concentration of 100 ng/mL to induce expression of PAL, and bacteria were grown for another 2 hrs. Bacteria were then pelleted, washed, and resuspended in minimal media, and supplemented with 4 mM phenylalanine. Aliquots were removed at 0 hrs, 2 hrs, and 4 hrs for phenylalanine quantification and at 2 hrs and 4 hrs for cinnamate quantification, by mass spectrometry. Expression of pheP in conjunction with PAL significantly enhances the degradation of phenylalanine as compared to PAL alone or pheP alone. Notably, the additional copy of pheP permitted the complete degradation of phenylalanine (4 mM) in 4 hrs.

Example 15. Production of PAL from FNR promoter in recombinant E. coli

[0546] Cultures of E. coli Nissle transformed with a plasmid comprising the PAL gene driven by any of the exemplary FNR promoters were grown overnight and then diluted 1:200 in LB. The bacterial cells may further comprise the pheP gene driven by the Tet promoter and incorporated into the chromosome. ATC was added to cultures at a

concentration of 100 ng/mL to induce expression of pheP, and the cells were grown with shaking at 250 rpm either aerobically or anaerobically in a Coy anaerobic chamber supplied with 90% N2, 5% C02, and 5% H2. After 4 hrs of incubation, cells were pelleted down, washed, and resuspended in M9 minimal medium supplemented with 0.5% glucose and 4 mM phenylalanine. Aliquots were collected at 0 hrs, 2 hrs, 4 hrs, and 24 hrs for

phenylalanine quantification. The genetically engineered bacteria expressing PAL3 driven by the FNR promoter are more efficient at removing phenylalanine from culture medium under anaerobic conditions, compared to aerobic conditions. The expression of pheP in conjunction with PAL3 further decreased levels of phenylalanine.

Example 16. Activity of Strains with single and multiple chromosomal PAL3 insertions

[0547] To assess the effect of insertion site and number of insertions on the activity of the genetically engineered bacteria, in vitro activity of strains with different single insertions of PAL3 at various chromosomal locations and with multiple PAL3 insertions was measured.

[0548] Cells were grown overnight in LB and diluted 1: 100. After 1.5 hrs of growth, cultures were placed in Coy anaerobic chamber supplying 90% N2, 5% C02, and 5% H2. After 4 hrs of induction, bacteria were resuspended in assay buffer containing 50 mM phenylalanine. Aliquots were removed from cell assays every 20 min for 1.5 hrs for trans- cinnamate quantification by absorbance at 290 nm. Activity of various strains comprising a single PAL3 chromosomal insertion at various sites.

Example 17. Activity of a Strain expressing LAAD

[0549] To assess whether LAAD expression can be used as an alternative, additional or complementary phenylalanine degradation means to PAL3, the ability of genetically engineered strain SYN-PKU401, which contains a high copy plasmid expressing LAAD driven by a Tet-inducible promoter, was measured at various cell concentrations and at varying oxygen levels.

[0550] Overnight cultures of SYN-PKU401 were diluted 1: 100 and grown to early log phase before induction with ATC (100 ng/ml) for 2 hours. Cells were spun down and incubated as follows. [0551] Cells (1 ml) were incubated aerobically in a 14 ml culture tube, shaking at 250 rpm For microaerobic conditions, cells (1 ml) were incubated in a 1.7 ml conical tube without shaking. Cells were incubated anaerobically in a Coy anaerobic chamber supplying 90% N2, 5% C02, and 5% H2. Aliquots were removed from cell assays every 30 min for 2 hrs for phenylalanine quantification by mass spectrometry.

Example 18. Efficacy of PAL-expressing bacteria in a mouse model of PKU

[0552] For in vivo studies, BTBR-Pahenu2 mice were obtained from Jackson

Laboratory and bred to homozygosity for use as a model of PKU. Bacteria harboring a low- copy pSClOl origin plasmid expressing PAL3 from the Tet promoter, as well as a copy of pheP driven by the Tet promoter integrated into the genome (SYN-PKU302), were grown. SYN-PKU1 was induced by ATC for 2 hrs prior to administration. Bacteria were

resuspended in phosphate buffered saline (PBS) and 109 ATC-induced SYN-PKU302 or control Nissle bacteria were administered to mice by oral gavage.

[0553] At the beginning of the study, mice were given water that was supplemented with 100 micrograms/mL ATC and 5% sucrose. Mice were fasted by removing chow overnight (10 hrs), and blood samples were collected by mandibular bleeding the next morning in order to determine baseline phenylalanine levels. Blood samples were collected in heparinized tubes and spun at 2G for 20 min to produce plasma, which was then removed and stored at -80° C. Mice were given chow again, and were gavaged after 1 hr. with 100 μΐ_^ (5x109 CFU) of bacteria that had previously been induced for 2 hrs with ATC. Mice were put back on chow for 2 hrs. Plasma samples were prepared as described above.

[0554] PKU mice treated with SYN-PKU1 exhibit a significantly reduced post- feeding rise in serum phenylalanine levels compared to controls.

Example 19. Phenylalanine degradation activity in vivo (PAL)

[0555] To compare the correlation between in vivo and in vitro phenylalanine activity, SYN-PKU304(containing a low copy plasmin expressing PAL3 with a chromosomal insertion of PfnrS-pheP at the LacZ locus, was compared to SYN-PKU901, a control Nissle strain with streptomycin resistance in vivo).

[0556] Beginning at least 3 days prior to the study (i.e., Days -6 to -3), homozygous BTBR-Pahenu2 mice (approx. 6-12 weeks of age) were maintained on phenylalanine- free chow and water that was supplemented with 0.5 grams/L phenylalanine. On Day 1, mice were randomized into treatment groups and blood samples were collected by sub-mandibular skin puncture to determine baseline phenylalanine levels. Mice were also weighed to determine the average weight for each group. Mice were then administered single dose of phenylalanine by subcutaneous injection at 0.1 mg per gram body weight, according to the average group weight. At 30 and 90 min post-injection, the bacteria were administered to mice by oral gavage.

[0557] To prepare the cells, cells were diluted 1: 100 in LB (2 L), grown for 1.5 h aerobically, then shifted to the anaerobe chamber for 4 hours. Prior to administration, cells were concentrated 200X and frozen (15% glycerol, 2 g/L glucose, in PBS). Cells were thawed on ice, and 4el0 cfu/mL and mixed 9: 1 in 1M bicarbonate. Each mouse gavaged 800uL total, or 2.9el0 cfu/mouse.

[0558] Blood samples were collected at 2 hrs and 4 hrs following phenylalanine challenge, and phenylalanine levels in the blood were measured using mass spectrometry, and the change in Phenylalanine concentration per hour was calculated. The total metabolic activity measured was 81.2 umol/hr. and the total reduction in change in phenylalanine was 45% (P<0.05). These same cells showed an in vitro activity of 2.8 umol/hr./le9 cells.

Example 20. Phenylalanine degradation activity in vivo (PAL)

[0559] SYN-PKU517 (comprising 2 chromosomal insertions of PAL (2XfnrS-PAL (malEK, malPT)), and a chromosomal insertion of pheP (fnrS-pheP (lacZ)), thyA auxotrophy (kan/cm)) was compared to SYN-PKU901.

[0560] Mice were maintained, fed, and administered phenylalanine as described above. To prepare the bacterial cells for gavage, cells were diluted 1: 100 in LB (2 L), grown for 1.5 h aerobically, then shifted to the anaerobe chamber for 4 hours. Prior to

administration, cells were concentrated 200X and frozen (15% glycerol, 2 g/L glucose, in PBS). Cells were thawed on ice, and 4el0 cfu/mL was mixed 9: 1 in 1M bicarbonate. Each mouse gavaged 800uL total, or 3.6el0 cfu/mouse.

[0561] As described above, blood samples were collected, and the change in phenylalanine concentration as compared to baseline was calculated. The total metabolic activity measured was 39.6 umol/hr. and the total reduction in change in phenylalanine was 17% (P<0.05). These same cells showed an in vitro activity of 1.1 umol/hr./le9 cells. Example 21. Phenylalanine degradation activity in vivo (PAL)

[0562] SYN-PKU705 (comprising 3 chromosomal insertions of PAL (3XfnrS-PAL (malEK, malPT, yicS/nepl)), and 2 chromosomal insertions of pheP (2XfnrS-pheP (lacZ, agal/rsml)), and LAAD (driven by the ParaBAD promoter integrated within the endogenous arabinose operon) was compared to SYN-PKU901.

[0563] Mice were maintained, fed, and administered phenylalanine as described above. To prepare the bacterial cells for gavage, cells were diluted 1: 100 in LB (2 L), grown for 1.5 h aerobically, then shifted to the anaerobe chamber for 4 hours. Prior to

administration, cells were concentrated 200X and frozen (15% glycerol, 2 g/L glucose, in PBS). Cells were thawed on ice, and 5el0 cfu/mL was mixed 9: 1 in 1M bicarbonate. Each mouse gavaged 800uL total, or 3.6el0 cfu/mouse. Note: Though this strain contains the LAAD gene, it was not induced in this study

[0564] As described above, blood samples were collected, and the change in phenylalanine concentration as compared to baseline was calculated. The total metabolic activity measured was 133.2 umol/hr. and the total reduction in change in phenylalanine was 30% (P<0.05). These same cells showed an in vitro activity of 3.7umol/hr./le9 cells.

Example 22. Phenylalanine degradation activity in vivo (PAL) LAAD

[0565] The suitability of P. proteus LAAD for phenylalanine degradation by the genetically engineered bacteria is further assessed in vivo. Bacterial strain SYN-PKU401 (comprising a high copy plasmid comprising LAAD driven by a Tet-inducible promoter is compared to SYN-PKU901.

[0566] Mice are maintained, fed, and administered phenylalanine as described above. To prepare the bacterial cells for gavage, cells are diluted 1: 100 in LB (2 L), grown for 1.5 h aerobically, then ATC is added and the cells are grown for another 2 hours. Prior to administration, cells are concentrated 200X and frozen for storage. Cells are thawed on ice, and resuspended. Cells are mixed 9: 1 in 1M bicarbonate. Each mouse is gavaged four times with 800uL total volume, or with a total of bacteria ranging from 2 X109 to 1X1010. Blood samples are collected from the mice described in the previous examples and are analyzed for phenylalanine, phenylpyruvate, phenyllactate, trans-cinnamic acid, and hippuric acid levels. Total reduction in phenylalanine and total metabolic activity are calculated. Example 23. Bacterial Strain that Matabolizes Phenylalanine and Contains a Kill- Switch

[0567] E. Coli Nissle bacterial strains comprising gene sequence encoding one or more copies of PAL and/or L-AAD and the kill-switch shown in Fig. 11 are made. For example, any of sytrains SYNPKU520, 521, 517, 518, 705, and 901 can be engineered to have kill-switch circuitry, for example by inserting the following sequences: (1) sequence for araC under the control of the ParaC promoter; (2) sequence for tetR (tet repressor) under the control of the ParaBAD promoter; (3) sequence for MazE antitoxin under the control of the paraBAD promoter; and (4) sequence for the MazF toxin under the control of the Ptet promoter. Alternatively, the antitoxin can be under the control of a constitutive promoter.

[0568] Overnight cultures were diluted 1: 100 into LB in duplicate and grown at 37C with shaking. After 2 hr of growth, one of the duplicate cultures for each strain was induced with the addition of arabinose while the other received no addition of arabinose. Cells were returned to the 37C. Cell viability was measured over 2 hours (0.5h, l.Oh, 2. Oh) by serially diluting and plating strains on LB agar. Colonies were enumerated to determine the number of viable cells at each time point.

[0569] Strains induced with arabinose do not produce the toxin (the tetRepressor is made and respresses the expression of the toxin) and remain viable. Strains that are grown in the absence of arabinose do not express the Tet repressor and the toxin is made, thereby killing the bacterial cells.

[0570] In another embodiment, E. Coli Nissle bacterial strains SYNPKU520, 521, 517, 518, 705, and 901 can be made into a ThyA auxotroph and engineered to have kill- switch circuitry comprising: (1) sequence for araC under the control of the ParaC promoter; and (2) sequence encoding thymidine under the control of the ParaBAD promoter.

[0571] Overnight cultures were diluted 1: 100 into LB in duplicate and grown at 37C with shaking. After 2 hr of growth, one of the duplicate cultures for each strain was induced with the addition of arabinose while the other received no addition of arabinose. Cells were returned to the 37C. Cell viability was measured over 2 hours (0.5h, l.Oh, 2. Oh) by serially diluting and plating strains on LB agar. Colonies were enumerated to determine the number of viable cells at each time point. Strains induced with arabinose produce the essential gene (Thymidine) and remain viable. Strains that are grown in the absence of arabinose do not express the thymidine gene and the bacterial cells are not viable. Example 24. In vivo testing of Bacterial Strain containg a Kill-Switch

[0572] Mice are treated with approximately 109 CFU Streptomycin-resistant Nissle (no kill-switch) or the Nissle strains in Examples 16-23 and having kill-switch circuitry described in Example 23 via oral gavage without antibiotic pre-treatment, and at each timepoint, animals (n=4) were euthanized, and intestine, cecum, and colon were removed. The small intestine was cut into three sections, and the large intestine and colon each into two sections. Intestinal effluents gathered and CFUs in each compartment were determined by serial dilution plating.

[0573] Alternatively, mice treated as above, and fecal pellets from six total mice are collected post-administration to determine the amount of administered Nissle still residing within the mouse gastrointestinal tract. The numbers of wild type Nissle and the strain having the kill switch recovered from the fecal samples each day for 10 consecutive days are determined.

Claims

1. A bacterial cell comprising:

at least one heterologous therapeutic gene operably linked to a directly or indirectly first inducible promoter that is not associated with the therapeutic gene in nature, a heterologous gene encoding a first recombinase operably linked to the first inducible promoter,

a heterologous gene encoding a toxin, wherein the gene encoding the toxin is present in the reverse orientation and wherein the gene is operably linked to a constitutive promoter,

wherein the first inducible promoter is directly or indirectly induced by exogenous environmental conditions found in the mammalian gut.

2. The bacterial cell of claim 1, wherein the first inducible promoter is directly or indirectly induced under low-oxygen or anaerobic conditions.

3. The bacterial cell of claim 2, wherein the first inducible promoter is selected from the group consisting of an FNR-responsive promoter, an ANR-responsive promoter, and a DNR-responsive promoter.

4. The bacterial cell of claim 3, wherein the first inducible promoter is an FNRS promoter.

5. The bacterial cell of claim 1, wherein the first inducible promoter is regulated by a reactive nitrogen species (RNS).

6. The bacterial cell of claim 1, wherein the first inducible promoter is regulated by a reactive oxygen species (ROS).

7. The bacterial cell of any of claims 1-6, wherein the bacterial cell further

comprises a heterologous gene encoding an anti-toxin operably linked to the first inducible promoter, wherein the anti-toxin protects the bacterial cell from the toxin.

8. The bacterial cell of any of claims 1-7, wherein the bacterial cell further comprises a heterologous gene encoding a second recombinase, wherein the gene encoding the second recombinase is present in the reverse orientation and wherein the gene is operably linked to a constitutive promoter.

9. A bacterial cell comprising:

at least one heterologous therapeutic gene operably linked to a first inducible promoter,

a heterologous gene encoding an anti-toxin, wherein the anti-toxin protects the bacterial cell from the toxin,

a heterologous gene encoding Ara operably linked to a Parac promoter, a heterologous gene encoding TetR operably linked to a ParaBAD promoter, and a heterologous gene encoding a bacterial toxin operably linked to a PietR promoter.

10. The bacterial cell of claim 9, wherein the heterologous gene encoding the antitoxin is operably linked to the ParaBAD promoter.

11. The bacterial cell of claim 9, wherein the heterologous gene encoding the antitoxin is operably linked to a constitutive promoter.

12. The bacterial cell of any of claims 9-11, wherein the first inducible promoter is directly or indirectly induced by exogenous environmental conditions found in the mammalian gut.

13. The bacterial cell of claim 12, wherein the first inducible promoter is directly or indirectly induced under low-oxygen or anaerobic conditions.

14. The bacterial cell of claim 13, wherein the first inducible promoter is selected from the group consisting of an FNR-responsive promoter, an ANR-responsive promoter, and a DNR-responsive promoter.

15. The bacterial cell of claim 14, wherein the first inducible promoter is an FNRS promoter.

16. The bacterial cell of any of claims 9-11, wherein the first inducible promoter is regulated by a reactive nitrogen species (RNS).

17. The bacterial cell of any of claims 9-11, wherein the first inducible promoter is regulated by a reactive oxygen species (ROS).

18. A bacterial cell comprising:

a heterologous gene encoding an essential gene that the bacteria does not naturally produce or that the bacteria has been engineered not to produce, wherein the essential gene is operably linked to a ParaBAD promoter, and

a heterologous gene encoding Ara operably linked to a Parac promoter.

19. The bacterial cell of claim 18, wherein the first inducible promoter is directly or indirectly induced under low-oxygen or anaerobic conditions.

20. The bacterial cell of claim 19, wherein the first inducible promoter is selected from the group consisting of an FNR-responsive promoter, an ANR-responsive promoter, and a DNR-responsive promoter.

21. The bacterial cell of claim 20, wherein the first inducible promoter is an FNRS promoter.

22. The bacterial cell of claim 18, wherein the first inducible promoter is regulated by a reactive nitrogen species (RNS).

23. The bacterial cell of claim 18, wherein the first inducible promoter is regulated by a reactive oxygen species (ROS).

24. The bacterial cell of any of claims 1-17, wherein the toxin is selected from Hok, Fst, TisB, LdrD, Kid, SymE, MazF, FlmA, lbs, XCV2162, dinJ, CcdB, ParE, YafO, Zeta, hicB, relB, yhaV, yoeB, chpBK, VapC, Doc, hip A, Rv0301, RelK, FitB, Tsel, VbhtT, Epsilon, ToxN, SpollSA, PezT, ldrD, symE, ibsC, txnA, srnB, pndA, shoB, bsrG, cbtA, ghoT, MosT, YeeV, PasB, ζ, dinJ, rnlA, mqsR, ygiM, yafW, yeeU, VapD, GinA, GinB, GinC, GinD, EndoA, HigB, Paml, RatA, CbtA, Ykfl, YpjF, GnsA, YjhX, and YdaS.

25. The bacterial cell of claim 24, wherein the toxin is selected from from MazF, CcdB, ParE, relB, VapC, Doc, hip A, and Kid.

26. The bacterial cell of any of claims 7-17, wherein the anti-toxin protects the bacterial cell from a toxin selected from Hok, Fst, TisB, LdrD, Kid, SymE, MazF, FlmA, lbs, XCV2162, dinJ, CcdB, ParE, YafO, Zeta, hicB, relB, yhaV, yoeB, chpBK, VapC, Doc, hipA, Rv0301, RelK, FitB, Tsel, VbhtT, Epsilon, ToxN, SpollSA, PezT, ldrD, symE, ibsC, txnA, srnB, pndA, shoB, bsrG, cbtA, ghoT, MosT, YeeV, PasB, ζ, dinJ, rnlA, mqsR, ygiM, yafW, yeeU, VapD, GinA, GinB, GinC, GinD, EndoA, HigB, Paml, RatA, CbtA, Ykfl, YpjF, GnsA, YjhX, and YdaS.

27. The bacterial cell of claims 26, wherein the anti-toxin is selected from Sok, RNAII, IstR, RdlD, Kis, SymR, MazE, FlmB, Sib, ptaRNAl, yafQ, CcdA, ParD, yafN, Epsilon, HicA, relE, prlF, yefM, chpBI, VapB, PhD, hipB, RV0300, Relj, FitA, Tsil, VbhA, Zeta, Toxl, SpollSB, PezA, rdlD, symR, sibC, ratA, srnC, pndB, ohsC, SR4, cbeA, ghoS, MosA, YeeU, PasC, ε, yafQ, rnlB, mqsA, ygiN, ykfl, yeeV, YdcD, HigA, pemK, YfjF, YeeU, YafW, YfjZ, YmcE, YjhQ, and YdaT.

28. The bacterial cell of claims 27, wherein the anti-toxin is selected from MazE, CcdA, ParD, relE, VapB, PhD, hipB, and Kis.

29. A recombinant bacterial cell comprising:

a heterologous gene encoding an anti-toxin, a heterologous gene encoding a recombinase, and

a nucleic acid comprising a second promoter, a forward recombinase recognition sequence, a heterologous gene encoding a bacterial toxin, and a reverse recombinase recognition sequence, wherein the heterologous gene encoding the bacterial toxin is in an inverted orientation relative to the second promoter.

30. The recombinant bacterial cell of claim 29, wherein the heterologous gene encoding the toxin is a heterologous gene encoding a lysin, or a biologically active fragment thereof, and the heterologous gene encoding the anti-toxin is a heterologous gene encoding an anti- lysin, or a biologically active fragment thereof.

31. The recombinant bacterial cell of claim 29, wherein the heterologous gene encoding the toxin is a heterologous gene encoding Kid, or a biologically active fragment thereof, and the heterologous gene encoding the anti-toxin is a heterologous gene encoding Kis, or a biologically active fragment thereof.

32. The recombinant bacterial cell of claim 29, wherein the heterologous gene encoding the toxin is a heterologous gene encoding MazF, or a biologically active fragment thereof, and the heterologous gene encoding the anti-toxin is a heterologous gene encoding MazE, or a biologically active fragment thereof.

33. The recombinant bacterial cell of claim 29, wherein the heterologous gene encoding the toxin is a heterologous gene encoding CcdB, or a biologically active fragment thereof, and the heterologous gene encoding the anti-toxin is a heterologous gene encoding CcdA, or a biologically active fragment thereof.

34. The recombinant bacterial cell of claim 29, wherein the heterologous gene encoding the toxin is a heterologous gene encoding ParE, or a biologically active fragment thereof, and the heterologous gene encoding the anti-toxin is a heterologous gene encoding ParD, or a biologically active fragment thereof.

35. The bacterial cell of any of claims 1-34, wherein the at least one heterologous therapeutic gene is located on a plasmid in the bacterial cell.

36. The bacterial cell of any of claims 1-34, wherein the at least one heterologous therapeutic gene is located on a chromosome in the bacterial cell.

37. The bacterial cell of any of claims 7-17 and 24-36, wherein the heterologous gene encoding the anti-toxin is located on a plasmid in the bacterial cell.

38. The bacterial cell of any of claims 7-17 and 24-36, wherein the heterologous gene encoding the anti- toxin is located on a chromosome in the bacterial cell.

39. The bacterial cell of any of claims 1-8 and 29-38, wherein the heterologous gene encoding the recombinase is located on a plasmid in the bacterial cell.

40. The bacterial cell of any of claims 1-8 and 29-38, wherein the heterologous gene encoding the recombinase is located on a chromosome in the bacterial cell.

41. The recombinant bacterial cell of any of claims 29-40, wherein the

heterologous gene encoding the anti-toxin is operably linked to the first inducible promoter.

42. The recombinant bacterial cell of any of claims 29-41, wherein the

heterologous gene encoding the recombinase is operably linked to the first inducible promoter.

43. The recombinant bacterial cell of any of claims 29-42, wherein the

heterologous gene encoding Ara is located on a plasmid in the bacterial cell or in a chromosome in the bacterial cell.

44. The recombinant bacterial cell of any of claims 29-43, wherein the

heterologous gene encoding TetR is located on a plasmid in the bacterial cell or in a chromosome in the bacterial cell.

45. The recombinant bacterial cell of any of claims 29-44, wherein the at least one heterologous therapeutic gene, the heterologous gene encoding the anti-toxin, and the heterologous gene encoding the recombinase are all operably linked to the first promoter.

46. The recombinant bacterial cell of any of claims 29-45, wherein the first

promoter is an inducible promoter.

47. The recombinant bacterial cell of any of claims 29-40 and 46, wherein the heterologous gene encoding the anti-toxin is operably linked to a third promoter.

48. The recombinant bacterial cell of claim 47, wherein the third promoter is an inducible promoter.

49. The recombinant bacterial cell of any of claims 29-41 and 47-48, wherein the heterologous gene encoding the recombinase is operably linked to a third promoter.

50. The recombinant bacterial cell of claim 49, wherein the third promoter is an inducible promoter.

51. The recombinant bacterial cell of any of claims 29-50, wherein the second promoter is a constitutive promoter.

52. The recombinant bacterial cell of claim 29, wherein the heterologous gene encoding the anti-toxin is linked to a third promoter, and the heterologous gene encoding the recombinase is operably linked to a fourth promoter.

53. The recombinant bacterial cell of claim 52, wherein the third promoter is an inducible promoter.

54. The recombinant bacterial cell of claim 52, wherein the fourth promoter is an inducible promoter.

55. The recombinant bacterial cell of any of claims 29-50 and 52-54, wherein the first promoter, the third promoter, and the fourth promoter are each directly or indirectly induced by environmental conditions.

56. The recombinant bacterial cell of claim 55, wherein the first promoter, the third promoter, and the fourth promoter are each directly or indirectly induced by environmental conditions specific to the gut of a mammal.

57. The recombinant bacterial cell of claim 56, wherein the first promoter, the third promoter, and the fourth promoter are each directly or indirectly induced by low- oxygen or anaerobic conditions.

58. The recombinant bacterial cell of claim 57, wherein the first promoter; the third promoter; the fourth promoter; the first promoter and the third promoter; the first promoter and the fourth promoter; or the first promoter, the third promoter, and the fourth promoter; are each an FNR responsive promoter.

59. The recombinant bacterial cell of claim 57, wherein the first promoter; the third promoter; the fourth promoter; the first promoter and the third promoter; the first promoter and the fourth promoter; or the first promoter, the third promoter, and the fourth promoter; are each regulated by a reactive nitrogen species (RNS).

60. The recombinant bacterial cell of claim 57, wherein the first promoter; the third promoter; the fourth promoter; the first promoter and the third promoter; the first promoter and the fourth promoter; or the first promoter, the third promoter, and the fourth promoter; are each regulated by a reactive oxygen species (ROS).

61. The recombinant bacterial cell of any one of claims 1-60, wherein the

recombinant bacterial cell is a recombinant probiotic bacterial cell.

The recombinant bacterial cell of any one of claims 1-60, wherein the recombinant bacterial cell is a member of a genus selected from the group consisting of Bacteroides, Bifidobacterium, Clostridium, Escherichia, Lactobacillus and Lactococcus.

63. The recombinant bacterial cell of claim 62, wherein the recombinant bacterial cell is of the genus Escherichia.

64. The recombinant bacterial cell of claim 63, wherein the recombinant bacterial cell is of the species Escherichia coli strain Nissle.

65. The recombinant bacterial cell of any of claims 1-64, wherein the at least one

heterologous therapeutic gene encodes a therapeutic protein.

66. The recombinant bacterial cell of claim 65, wherein the therapeutic protein is IL-10.

67. The recombinant bacterial cell of claim 65, wherein the therapeutic protein is GLP2.

68. The recombinant bacterial cell of claim 65, wherein the therapeutic protein is IL-22.

69. The recombinant bacterial cell of claim 65, wherein the therapeutic protein is GLP1.

70. The recombinant bacterial cell of claim 65, wherein the therapeutic protein is TGFp.

71. The recombinant bacterial cell of claim 65, wherein the therapeutic protein is kynureninase.

72. The recombinant bacterial cell of claim 65, wherein the therapeutic protein is bile salt hydrolase.

73. The recombinant bacterial cell of any of claims 1-64, wherein the at least one heterologous therapeutic gene encodes an enzyme or enzymes which synthesize a therapeutic molecule.

74. The recombinant bacterial cell of claim 73, wherein the therapeutic molecule is butyrate.

75. The recombinant bacterial cell of claim 73, wherein the therapeutic molecule is propionate.

76. The recombinant bacterial cell of any of claims 1-64, wherein the at least one heterologous therapeutic gene encodes an enzyme which processes and reduces levels of an exogenous molecule.

77. The recombinant bacterial cell of claim 76, wherein the exogenous molecule is ammonia.

78. The recombinant bacterial cell of claim 76, wherein the enzyme is a branched chain amino acid catabolism enzyme, and wherein the exogenous molecule is a branched chain amino acid.

79. The recombinant bacterial cell of claim 78, wherein the branched chain amino acid catabolism enzyme is an alpha-ketoisovalerate decarboxylate.

80. The recombinant bacterial cell of claim 79, wherein the branched chain amino acid catabolism enzyme is a branched chain keto acid dehydrogenase.

81. The recombinant bacterial cell of claim 76, wherein the enzyme is a

phenylalanine ammonia lyase (PAL), and wherein the exogenous molecule is phenylalanine.

82. A recombinant bacterial cell comprising:

at least one heterologous therapeutic gene operably linked to a first inducible promoter, a heterologous gene encoding a first recombinase,

a first nucleic acid comprising a second promoter, a first forward recombinase recognition sequence, a heterologous gene encoding a second recombinase, and a first reverse recombinase recognition sequence, wherein the heterologous gene encoding the second recombinase is in an inverted orientation relative to the second promoter, a second nucleic acid comprising a third promoter, a second forward recombinase recognition sequence, a heterologous gene encoding a bacterial toxin, and a second reverse recombinase recognition sequence, wherein the heterologous gene encoding the bacterial toxin is in an inverted orientation relative to the third promoter.

83. A recombinant bacterial cell comprising:

a heterologous gene encoding a recombinase,

a first nucleic acid comprising a second promoter, a forward recombinase recognition sequence, a heterologous gene encoding a first excision enzyme, and a reverse recombinase recognition sequence, wherein the heterologous gene encoding the first excision enzyme is in an inverted orientation relative to the second promoter, a second nucleic acid comprising an essential gene flanked by sequences specific for the first excision enzyme.

84. A recombinant bacterial cell comprising:

a heterologous gene encoding a recombinase,

a first nucleic acid comprising a second promoter, a first forward recombinase recognition sequence, a heterologous gene encoding a first excision enzyme, and a first reverse recombinase recognition sequence, wherein the heterologous gene encoding the first excision enzyme is in an inverted orientation relative to the second promoter,

a second nucleic acid comprising a third promoter, a second forward recombinase recognition sequence, a heterologous gene encoding a second excision enzyme, and a second reverse recombinase recognition sequence, wherein the heterologous gene encoding the second excision enzyme is in an inverted orientation relative to the third promoter,

a third nucleic acid encoding a first essential gene flanked by sequences specific for the first excision enzyme,

a fourth nucleic acid encoding a second essential gene flanked by sequences specific for the second excision enzyme.

85. The recombinant bacterial cell of claim 83 or claim 84, wherein the first

excision enzyme is Xisl.

86. The recombinant bacterial cell of claim 83 or claim 84, wherein the first

excision enzyme is Xis2.

87. A pharmaceutically acceptable composition comprising the bacterium of any one of claims 1-31; and a pharmaceutically acceptable carrier.

88. A method for treating a disease or disorder in a subject, the method

comprising administering a programmed recombinant bacterial cell to the subject, thereby treating the disease or disorder in the subject,

wherein the programmed recombinant bacterial cell expresses at least one heterologous gene in response to a first exogenous environmental condition in the subject, and

wherein the programmed recombinant bacterial cell is no longer viable after at least one recombination event which is also directly or indirectly induced by a second exogenous environmental condition in the subject.

89. The method of claim 88, wherein the at least one recombination event is

flipping of an inverted heterologous gene encoding a bacterial toxin by a first recombinase.

90. The method of claim 89, wherein the inverted heterologous gene encoding the bacterial toxin is located between a first forward recombinase recognition sequence and a first reverse recombinase recognition sequence.

91. The method of claim 89, wherein the heterologous gene encoding the bacterial toxin is constitutively expressed after it is flipped by the first recombinase.

92. The method of claim 91, wherein constitutive expression of the bacterial toxin kills the programmed recombinant bacterial cell.

93. The method of claim 88, wherein the programmed recombinant bacterial cell further expresses a heterologous gene encoding an anti-toxin in response to the first exogenous environmental condition.

94. The method of claim 93, wherein the at least one recombination event is

95. The method of claim 94, wherein the inverted heterologous gene encoding the bacterial toxin is located between a first forward recombinase recognition sequence and a first reverse recombinase recognition sequence.

96. The method of claim 94, wherein the heterologous gene encoding the bacterial toxin is constitutively expressed after it is flipped by the first recombinase.

97. The method of claim 96, wherein the anti-toxin inhibits the activity of the toxin when the second exogenous environmental condition is present, thereby delaying death of the programmed recombinant bacterial cell.

98. The method of claim 97, wherein the programmed recombinant bacterial cell is killed by the bacterial toxin when the heterologous gene encoding the anti-toxin is no longer expressed when the first exogenous environmental condition is no longer present.

99. The method of claim 88, wherein the at least one recombination event is

flipping of an inverted heterologous gene encoding a second recombinase by a first recombinase, followed by the flipping of an inverted heterologous gene encoding a bacterial toxin by the second recombinase.

100. The method of claim 99, wherein the inverted heterologous gene encoding the second recombinase is located between a first forward recombinase recognition sequence and a first reverse recombinase recognition sequence.

101. The method of claim 99, wherein the inverted heterologous gene encoding the bacterial toxin is located between a second forward recombinase recognition sequence and a second reverse recombinase recognition sequence.

102. The method of claim 99, wherein the heterologous gene encoding the second recombinase is constitutively expressed after it is flipped by the first recombinase.

103. The method of claim 102, wherein the heterologous gene encoding the

bacterial toxin is constitutively expressed after it is flipped by the second

recombinase.

104. The method of claim 103, wherein the programmed recombinant bacterial cell is killed by the bacterial toxin.

105. The method of claim 99, wherein the programmed recombinant bacterial cell further expresses a heterologous gene encoding an anti-toxin in response to the first exogenous environmental condition.

106. The method of claim 105, wherein the anti- toxin inhibits the activity of the toxin when the first exogenous environmental condition is present, thereby delaying death of the programmed recombinant bacterial cell.

107. The method of claim 106, wherein the programmed recombinant bacterial cell is killed by the bacterial toxin when the heterologous gene encoding the anti-toxin is no longer expressed when the first exogenous environmental condition is no longer present.

108. The method of claim 88, wherein the at least one recombination event is flipping of an inverted heterologous gene encoding a second recombinase by a first recombinase, followed by flipping of an inverted heterologous gene encoding a third recombinase by the second recombinase, followed by flipping of an inverted heterologous gene encoding a bacterial toxin by the third recombinase.

109. The method of claim 88, wherein the at least one recombination event is

flipping of an inverted heterologous gene encoding a first excision enzyme by a first recombinase.

110. The method of claim 109, wherein the inverted heterologous gene encoding the first excision enzyme is located between a first forward recombinase recognition sequence and a first reverse recombinase recognition sequence.

111. The method of claim 109, wherein the heterologous gene encoding the first excision enzyme is constitutively expressed after it is flipped by the first recombinase.

112. The method of claim 111, wherein the first excision enzyme excises a first essential gene.

113. The method of claim 112, wherein the programmed recombinant bacterial cell dies when the first essential gene is excised.

114. The method of claim 109, wherein the first recombinase further flips an

inverted heterologous gene encoding a second excision enzyme.

115. The method of claim 114, wherein the wherein the inverted heterologous gene encoding the second excision enzyme is located between a second forward

recombinase recognition sequence and a second reverse recombinase recognition sequence.

116. The method of claim 114, wherein the heterologous gene encoding the second excision enzyme is constitutively expressed after it is flipped by the first recombinase.

117. The method of claim 116, wherein the programmed recombinant bacterial cell dies when the first essential gene and the second essential gene are both excised.

118. The method of claim 116, wherein the programmed recombinant bacterial cell dies when either the first essential gene is excised or the second essential gene is excised by the first recombinase.

119. The method of claim 88, wherein the programmed recombinant bacterial cell dies after the at least one recombination event occurs.

120. A method for treating a disease or disorder in a subject, the method

comprising administering a programmed recombinant bacterial cell to the subject, wherein the programmed recombinant bacterial cell:

i) expresses at least one heterologous gene in response to a first exogenous environmental condition in the subject,

ii) expresses a heterologous gene encoding an anti-toxin, and

iii) expresses a heterologous gene encoding a bacterial toxin when a second exogenous environmental condition is not present in the subject,

wherein the programmed recombinant bacterial cell is no longer viable after expression of the bacterial toxin, thereby treating the disease or disorder in the subject.

121. The method of claim 120, wherein the heterologous gene encoding the antitoxin is constitutively expressed.

122. The method of claim 120, wherein the heterologous gene encoding the antitoxin is expressed in response to the second exogenous environmental condition in the subject.

123. The method of claim 120, wherein when the second exogenous environmental condition is present, the heterologous gene encoding the bacterial toxin is not expressed.

124. The method of claim 120, wherein the bacterial toxin kills the programmed recombinant bacterial cell when levels of the bacterial toxin in the recombinant bacterial cell are equal to or higher than levels of the antitoxin in the recombinant bacterial cell.

125. The method of claim 124, wherein the second exogenous environmental

condition is the presence of arabinose.

126. The method of claim 120, wherein the heterologous gene encoding the toxin is expressed from a PtetR promoter, and wherein the recombinant bacterial cell further comprises:

iv) a heterologous ara gene under the control of a ParaC promoter, and

v) a heterologous tetR gene under the control of a ParaBAD promoter,

wherein the ParaC promoter induces expression of AraC protein,

wherein the AraC protein activates expression of the ParaBAD promoter,

wherein the ParaBAD promoter induces expression of TetR protein, and

wherein the TetR protein induces expression of the heterologous gene encoding the toxin.

127. The method of claim 119, wherein the first exogenous environmental

condition and the second exogenous environmental condition are the same exogenous environmental condition.

128. The method of claim 119 or claim 120, wherein the first exogenous

environmental condition and the second exogenous environmental condition are different exogenous environmental conditions.

129. The method of claim 88 or claim 120, further comprising administering a second recombinant bacterial cell to the subject, wherein the second recombinant bacterial cell comprises a heterologous reporter gene operably linked to an inducible promoter that is directly or indirectly induced by a third exogenous environmental condition.

130. The method of claim 129, wherein the heterologous reporter gene is a fluorescence gene.

131. The method of claim 130, wherein the fluorescence gene encodes a green fluorescence protein (GFP).

132. A method for treating a disease or disorder in a subject, the method

comprising administering a pharmaceutical composition comprising a recombinant bacterial cell to the subject,

wherein an exogenous environmental condition in the subject directly or indirectly induce expression in the recombinant bacterial cell of: a) at least one heterologous therapeutic gene that is effective to treat the disease or disorder in the subject, b) an anti-toxin, and c) at least one recombinase,

wherein the at least one recombinase flips an inverted gene encoding a bacterial toxin so that the bacterial toxin is then constitutively expressed in the recombinant bacterial cell, and

wherein the bacterial toxin kills the recombinant bacterial cell when the exogenous environmental condition is no longer present and the expression of anti-toxin is no longer induced, thereby treating the disease or disorder in the subject.

133. A method for treating a disease or disorder in a subject, the method

wherein an exogenous environmental condition in the subject directly or indirectly induce expression in the recombinant bacterial cell of: a) at least one heterologous therapeutic gene that is effective to treat the disease or disorder in the subject, b) a heterologous gene encoding a first recombinase,

wherein the first recombinase flips an inverted gene encoding a heterologous second recombinase,

wherein the second recombinase is expressed and flips an inverted gene encoding a bacterial toxin, wherein the bacterial toxin kills the recombinant bacterial cell, thereby treating the disease or disorder in the subject.

134. A method for treating a disease or disorder in a subject, the method comprising administering a pharmaceutical composition comprising a recombinant bacterial cell to the subject,

wherein the first recombinase flips an inverted gene encoding a heterologous first excision enzyme,

wherein the first excision enzyme is expressed and excises an essential gene, wherein the lack of expression of the essential gene in the recombinant bacterial cell kills the recombinant bacterial cell, thereby treating the disease or disorder in the subject.

135. The method of any one of claims 88-134, wherein the disease is inflammatory bowel disease (IBD).

136. The method of any one of claims 88-134, wherein the disease is ulcerative colitis or Crohn's disease.

137. The method of any one of claims 88-134, wherein the disease is type I

diabetes, type II diabetes, obesity, or metabolic syndrome.

138. The method of any one of claims 88-134, wherein the disease is a metabolic disease.

139. The method of claim 138, wherein the metabolic disease is phenylketonuria (PKU) or urea cycle disorder (UCD).

140. The method of claim 138, wherein the metabolic disease is a disease caused by conversion of a branched chain amino acid.

141. The method of claim 138, wherein the disease caused by conversion of a

branched chain amino acid is maple syrup urine disease (MSUD).