WO1998016540A1 - Improved coupling activators for oligonucleotide synthesis - Google Patents

Abstract

A method for coupling phosphoramidite monomers with nucleophiles, for example, the 5'-hydroxyl group on the growing oligonucleotide chain, using a coupling activator that is less acidic than and at least as nucleophilic as tetrazole and that provides comparable or better coupling efficiency than tetrazole. The pKa of the coupling activator is between 5.0 and 6.0, preferably between 5.0 and 5.5, and, more preferably, between 5.1 and 5.3. Suitable coupling activators include 4,5-dicyanoimidazole (DCI), 4-alkylthioimidazole, 2-alkylthioimidazole, 2-nitroimidazole, 4-nitroimidazole, 4,5-dihaloimidazole, 4-haloimidazole, 2-haloimidazole and 5-alkoxytetrazole. DCI is the most preferred coupling activator. Alternatively, a combination of an acidic coupling activator and a suitable buffer, such as a tertiary amine, can be employed. The tertiary amine can be a tertiary amine with three alkyl groups or a heterocyclic compound containing one or more tertiary amines. Preferably the tertiary amine is less nucleophilic than DMAP, which is known to cause side reactions at the 6-position oxygen of guanosines due to its relatively high nucleophilicity. N-methylimidazole (NMI) is the preferred tertiary amine.

Description

Improved Coupling Activators for Oligonucleotide Synthesis

Field of the Invention

This invention is in the field of methodology for the synthesis of oligonucleotides.

Background of the Invention

Oligonucleotides have been proposed for use as therapeutics, such as ribozymes, antisense oligonucleotides, and compounds that bind to or interact with various target molecules. Antisense oligonucleotides can bind certain coding regions in an organism to prevent the expression of proteins or to block various cell functions. A process known as the SELEX process, or Systematic Evolution of Ligands for Exponential Enrichment, allows one to identify and produce oligonucleotides that selectively bind to or interact with target molecules. The SELEX process is described in United States Patent No. 5,270,163, entitled "Methods for Identifying Nucleic Acid Ligands," the contents of which are hereby incorporated by reference.

A limitation to using oligonucleotides as pharmaceuticals is that nucleases may rapidly degrade certain of these compounds in vivo. One approach to minimizing the in vivo degradation has been to modify the nucleotides to impart in vivo and in vitro stability to endo and exonucleases, and/or to provide differences in the three dimensional structure of the resulting oligonucleotides. For example, nuclease stability has been demonstrated by incorporating 2'-modifιed nucleotides, such as 2'-amino- and 2'-fluoro-2'-deoxypyrimidines, into oligonucleotides. (Pieken et al. (1991) Science 253:314-317; Paolella et al. (1992) EMBO J. 11:1913-1919).

Another limitation to using oligonucleotides commercially as therapeutic agents is that they are difficult to synthesize on a commercial scale. Oligonucleotide synthesis is typically performed using the phosphoramidite method, shown below in Scheme 1. (Dahl et al. (1987) Nucleic Acids Res. 15:1729-1743; Beaucage and Iyer (1992) Tetrahedron 48:2223-2311; Zon and Geiser (1991) Anti-Cancer Drug Design 6:539-568; Matteucci and Caruthers (1981) J. Am. Chem. Soc. 103:3185-3191; and Scaringe et al. (1990) Nucleic Acids Res. 18:5433-5441, the contents of which are hereby incorporated by reference). Activation of a phosphoramidite monomer for coupling of the phosphoramidite monomer to a nucleotide or oligonucleotide in automated solid phase oligonucleotide synthesis is usually achieved by addition of tetrazole. In the proposed mechanism, the first step in activation is the fast protonation of the trivalent phosphorous by tetrazole, followed by the slow displacement of the N,N-diisopropylamine with tetrazolide. The latter intermediate rapidly reacts with a nucleophile, such as the 5'-hydroxyl group of a protected, resin-bound oligonucleotide (HOR) to yield the phosphite triester product. Thus, tetrazole acts both as an acid and as a nucleophilic catalyst. Oligoribonucleotide syntheses have also been reported. (Scaringe et al. (1990) Nucleic Acids Res. 18:5433-5441, the contents of which are hereby incorporated by reference). These syntheses also are typically performed using the phosphoramidite method.

Scheme 1. Mechanism of tetrazole catalyzed phosphoramidite coupling

CNEO = cyanoethanol

While tetrazole is the standard activator for coupling of deoxynucleoside phosphoramidites, alternatives are often sought for the coupling of more sterically hindered nucleoside phosphoramidite monomers. For the addition of 2'-O-methylnucleoside 3'- phosphoramidites to an oligonucleotide by solid phase synthesis, 5-(4-nitrophenyl)-lH- tetrazole has been suggested (Sproat et al. (1989) Nucleic Acids Res. 17:3373-3386). Similarly, the coupling of 2'-tert-butyldimethylsilyl protected ribonucleoside 3'- phosphoramidites was shown to be accelerated by activation with 5-ethylthio-lH-tetrazole (Wincott et al. (1995) Nucleic Acids Res. 23:2677-2684). Recently, the condensation of otherwise unreactive phosphoramidite analogs with benzimidazolium triflate was demonstrated (Hayakawa et al. (1996) J. Org. Chem. 61:7996-7997). The phosphoramidite method, using tetrazole as a coupling activator, appears to work well for preparing small scale batches of DNA oligonucleotides with a large excess of phosphoramidite monomer. However, problems are observed when the chemistry is scaled- up to a multi-mmole level and/or a large excess of phosphoramidite monomer is not used. At increasing scales, for example, 10 μmoles or more, and/or a minimized monomer excess (i.e., less than a four-fold excess), coupling times are typically dramatically increased from the 45 second reaction time employed at the 1 μmole scale in research laboratories. These increased reaction times lead to undesired side reactions and result in a decreased overall yield. The 5'-hydroxyl group on the growing oligonucleotide chain is protected at various stages during oligonucleotide synthesis. One of the preferred protecting groups is a trityl ether. An undesired side reaction when scaling up phosphoramidite coupling using tetrazole as a coupling activator is detritylation of the protected 5 '-hydroxyl group. When reaction times are relatively fast for the phosphoramidite coupling step, detritylation does not compete significantly with the desired coupling chemistry. However, when reaction times increase, detritylation becomes a significant side reaction.

Scheme 2 depicts the tetrazole-mediated detritylation of 5'-dimethoxytrityl protected nucleosides, which occurs under the conditions typically employed to couple 5'- dimethoxytrityl protected nucleoside 3 '-phosphoramidite monomers to the hydroxyl group on a growing oligonucleotide chain.

Scheme 2. Detritylation of 5'-DMT Nucleosides by Tetrazoles.

Detritylation is an undesired side reaction because it results in unwanted side reactions and corresponding lower overall yields. One of the major side reactions involves the coupling of detritylated monomers to other nucleoside phosphoramidite monomers in solution. This can lead to unwanted by-products that contain additional nucleotides which are difficult to separate from the desired product. Detritylation is even more of a problem with oligoribonucleotide synthesis since oligoribonucleotide syntheses require longer reaction times than oligodeoxyribonucleotide syntheses. Detritylation also becomes limiting at larger scales, where process economics dictate performing coupling reactions at close to stoichiometric concentrations.

It is believed that the acidic nature of the tetrazole causes the undesirable detritylation side reaction. Acetic acid is commonly used to detritylate 5'- dimethoxytritylether functionalities on nucleosides and oligonucleotides. The pKa of tetrazole (4.76) is similar to the pKa of acetic acid. Therefore, it is not surprising that exposing the reactants to tetrazole causes detritylation. Rates of detritylation are increased as the acidity of the coupling activator is increased.

Attempts have been made to decrease reaction times in the phosphoramidite coupling reaction in order to decrease detritylation and other side-reactions. These approaches involved increasing the acidity of the coupling activator relative to tetrazole. One such attempt was to employ a coupling agent, 5-ethylthio-lH-tetrazole (pKa 4.28) (Wright et al. (1993) Tetrahedron Lett. 34:3373-3376). A limitation of using this coupling activator is that the detritylation reaction is more pronounced than when tetrazole is used. Another attempt has been to employ a mixture of the more acidic 5-(4-nitrophenyl)tetrazole and the nucleophilic catalyst dimethylaminopyridine (DMAP). (Pon (1987) Tetrahedron Lett. 28:3643-3646; Yamada et al. (1968) Bull. Chem. Soc. Japan 41:1237). However, a major limitation of this chemistry is that DMAP is known to cause modifications at the 6- position oxygen of guanosine residues. (Eadie and Davidson (1987) Nucleic Acids Res. 20:8333-8349). Interestingly, recent activator design has focused mainly on accelerating the protonation step, rather than accelerating the nucleophilic displacement step.

It would be advantageous to perform phosphoramidite coupling with a coupling activator that offers a high coupling efficiency and a minimum amount of undesirable side reactions, i.e. detritylation. It would also be advantageous to perform efficient coupling reactions at a relatively large scale using a minimal excess of phosphoramidite monomers. The present invention provides improved methods for coupling phosphoramidite monomers to nucleotides and oligonucleotides in oligonucleotide syntheses. One embodiment of the present invention involves using a coupling activator that is less acidic and at least as nucleophilic as tetrazole and still provides a coupling efficiency that is as effective as tetrazole. Another embodiment of the present invention involves using a combination of a coupling activator and a suitable buffer.

Summary of the Invention

The present invention provides improved methods for coupling phosphoramidite monomers with nucleophiles, preferably for oligonucleotide syntheses. One embodiment of the present invention involves using coupling activators that are less acidic and at least as nucleophilic as tetrazole and still provide a coupling efficiency that is at least as effective as tetrazole. The pKa of the coupling activators of the present invention is between 5.0 and 6.0, preferably between 5.0 and 5.5, and, more preferably, between 5.1 and 5.3.

Any coupling activator can be used that has a pKa between 5.0 and 6.0 and that is at least as nucleophilic as tetrazole. Means for determining the pKa and nucleophilicity of a coupling activator are well known to those of skill in the art. Suitable coupling activators for use in the present invention include, but are not limited to, 4,5-dicyanoimidazole (DCI), 4-alkylthioimidazole, 2-alkylthioimidazole, 2-nitroimidazole, 4-nitroimidazole, 4,5- dihaloimidazole, 4-haloimidazole, 2-haloimidazole and 5-alkoxytetrazole. DCI, the most preferred coupling activator, is less acidic than tetrazole (pKa = 5.2). Using DCI in the phosphoramidite oligonucleotide synthesis rather than tetrazole increases product yield at larger scales and increases the rate of the coupling reaction. DCI is highly soluble in acetonitrile, a preferred solvent for phosphoramidite coupling. While commercially available technical grade DCI is effective in providing an improved coupling efficiency between a phosphoramidite monomer and a nucleophile, it was discovered that an even greater coupling efficiency is obtained by using a purified form of DCI.

In another embodiment of the present invention, an improved coupling method is provided wherein detritylation is minimized by employing a combination of a coupling activator and a suitable buffer. In this embodiment, either the coupling activators of the present invention or more acidic coupling activators, such as tetrazole, may be used. Preferred buffers of the present invention include, but are not limited to, tertiary amines, including both tertiary amines with three alkyl groups, and heterocyclic compounds in which one or more of the amines are tertiary amines. Preferably the tertiary amine is less nucleophilic than DMAP, which is known to cause side reactions at the 6-position oxygen of guanosines due to its relatively high nucleophilicity. N-methylimidazole (NMI) is the preferred tertiary amine.

Tertiary amines such as NMI can be added to coupling activator solutions to increase the coupling efficiency. The basicity of NMI decreases the rate of the competing monomer detritylation. Coupling reactions performed with coupling activator/NMI mixtures, such as tetrazole/NMI, proceed at the same rate as is observed with the coupling activator alone. However, the increase in reaction rate that is observed with the more nucleophilic, less acidic coupling activators such as DCI is not observed in this embodiment. Accordingly, the preferred method for performing phosphoramidite coupling chemistry according to the present invention is to use the less acidic coupling activators described above.

Brief Description of the Figures

Figure 1 is a graph from which the second order rate constants for detritylation of 5'-DMT-2',3'-isopropylidineuridine with tetrazole (dashed line) and 5-ethylthiotetrazole (solid line) are derived.

Figure 2 is an anion exchange chromatogram of the crude deprotected oligonucleotide NX288c05 prepared as described in Example 3 using tetrazole as the coupling activator.

Figure 3 is an anion exchange chromatogram of the deprotected oligonucleotide prepared as described in Example 6 using tetrazole as the coupling activator. Figure 4 is an anion exchange chromatogram of the deprotected oligonucleotide prepared as described in Example 6 using tetrazole and 0.1 M N-methylimidazole as the coupling activator.

Figure 5 is an anion exchange chromatogram of the deprotected oligonucleotide prepared as described in Example 6 using DCI as the coupling activator.

Figure 6 is an overlay of the anion exchange chromatograms of the deprotected oligonucleotide NX 11702 prepared as described in Example 7 using tetrazole and tetrazole/NMI as the coupling activators.

Figure 7 is an anion exchange chromatogram of the oligonucleotide NX11702 as prepared in Example 7 using 1.0 M DCI as the coupling activator.

Figure 8 is an anion exchange chromatogram of the crude product, following cleavage from the support, of an oligonucleotide prepared as described in Example 8 using DCI as the coupling activator.

Figure 9 is an anion exchange chromatogram of the crude product, following cleavage from the support, of an oligonucleotide prepared as described in Example 8 using tetrazole as the coupling activator.

Figure 10 is an anion exchange chromatogram of the crude product, following cleavage from the support, of oligonucleotide NX28604 prepared as described in Example 9 using DCI as the coupling activator. Figure 11 is a graph showing the optical density at 495 nm versus the trityl fraction for the synthesis of the RNA 41-mer in Example 10 using 0.5 M DCI as the coupling activator.

Figure 12 is a graph showing the optical density at 495 nm versus the trityl fraction for the synthesis of the RNA 41-mer in Example 10 using 1.0 M DCI as the coupling activator.

Figure 13 is an anion exchange chromatogram of the deprotected RNA 41-mer described in Example 10, synthesized using 0.5 M DCI as the coupling activator.

Figure 14 is an anion exchange chromatogram of the deprotected RNA 41-mer described in Example 10, synthesized using 1.0 M DCI as the coupling activator. Figure 15 is a graph showing the optical density at 495 nm versus the trityl fraction for the synthesis of DNA 29-mers described in Example 10 using 1.0 M DCI as the coupling activator.

Figure 16 is a graph showing the optical density at 495 nm versus the trityl fraction for the synthesis of DNA 29-mers described in Example 10 using 0.5 M DCI as the coupling activator.

Figure 17 is an anion exchange chromatogram of the crude product, following deprotection and cleavage from the support, of the DNA 29-mer prepared as described in Example 10 using 1.0 M DCI as the coupling activator. Figure 18 is an anion exchange chromatogram of the crude product, following deprotection and cleavage from the support, of the DNA 29-mer prepared as described in Example 10 using 0.5 M DCI as the coupling activator.

Figure 19 is an anion exchange chromatogram of the starting trimer described in Example 11. Figure 20 is an anion exchange chromatogram of the tetramer prepared in solution phase as described in Example 11 , using 1.13 equivalents of DCI as the coupling activator.

Figure 21 is an overlay of the anion exchange chromatograms shown in Figures 19 and 20.

Detailed Description of the Invention

The present invention provides improved methods for preparing oligonucleotides by coupling phosphoramidite monomers to a nucleoside, preferably the 5'-hydroxyl group of a nucleotide or oligonucleotide. In one embodiment, the coupling chemistry is performed using a coupling activator that is less acidic and at least as nucleophilic as tetrazole and still provides a coupling efficiency that is at least as effective as tetrazole. In another embodiment, the coupling chemistry is performed using a coupling activator that can be as acidic as or even more acidic than tetrazole, in combination with a suitable buffer, wherein the buffer is less nucleophilic than DMAP. Definitions

The term "coupling activator," as used herein, is defined as a compound that effectively couples a phosphoramidite monomer and the 5'-OH group on a nucleotide, preferably according to the mechanism shown in Scheme 1. The coupling chemistry is also intended to encompass the reaction of phosphoramidite monomers with other nucleophiles.

The term "acidic coupling activator," as used herein, is defined as a coupling activator with a pKa of less than 4.85. Tetrazole is one example of an acidic coupling activator.

The term "alkyl" as used herein is defined as a C_{M 8} straight, branched, or cyclic alkyl group. Preferred alkyl groups are methyl, ethyl, propyl, isopropyl and n-butyl.

The term "alkoxy" as used herein is defined as a C_M8 alkoxy group.

The term "halo" as used herein is defined as chloride, bromide, iodide or fluoride.

The term "nucleotide" as used herein is defined as a modified or naturally occurring deoxyribonucleotide or ribonucleotide. Nucleotides typically include purines and pyrimidines, which include thymidine, cytidine, guanosine, adenine and uridine.

The term "oligonucleotide" as used herein is defined as an oligomer of the nucleotides defined above.

The term "phosphoramidite monomer" as used herein is defined as a nucleotide with a protected 5'-hydroxy group, in which the 3'-hydroxy group is coupled to a trivalent phosphorous atom, which in turn is bonded to a suitable leaving group such as a cyanoethanol (CNEO) group and a suitable dialkylamine, such as diisopropylamine. Any nucleoside phosphoramidite monomer that can be used in solid or liquid phase oligonucleotide synthesis can be used in the present invention, including protected dimer and trimer phosphoramidite monomers. Suitable phosphoramidite monomers that can be coupled with the coupling activators of the present invention include, but are not limited to, protected 2'-deoxynucleoside 3'-phosphoramidites, protected 2'-tert- butyldimethylsiloxynucleoside 3'-phosphoramidites, protected 2'-deoxy-2'- trifiuoroacetamidonucleoside 3 '-phosphoramidites, protected 2'-deoxy-2'-fluoronucleoside 3'-phosphoramidites, and protected 2'-alkoxynucleoside 3 '-phosphoramidites. Other suitable nucleoside phosphoramidite monomers include those that are described in or can be prepared from nucleosides described in United States Patent No. 5,428,149, issued on June 27, 1995, entitled "Methods for Palladium Catalyzed Carbon-Carbon Coupling and Products"; co-pending United States Patent Application Serial No. 08/430,709, filed April 27, 1995, entitled "High Affinity Nucleic Acid Ligands Containing Modified Nucleotides"; United States Patent Application Serial No 08/264,029, filed June 22, 1994, entitled "Novel Method of Preparation of Known and Novel 2'-Modified Nucleosides by Intramolecular Nucleophilic Displacement"; United States Patent Application Serial No. 08/347,600, filed December 1 , 1994, entitled "Purine Nucleoside Modifications by Palladium Catalyzed Methods," now issued as United States Patent No. 5,580,972; United States Patent Application Serial No. 08/458,421, filed June 2, 1995, entitled "Palladium Catalyzed Nucleoside Modifications Methods using Nucleophiles and Carbon Monoxide"; 5 '-protected phosphoramidites as described in PCT Publication No. WO 97/14706, published April 24, 1997, designating the United States, entitled "Method for Solution Phase Synthesis of Oligonucleotides"; and diene- and dienophile-modified phosphoramidites described in copending United States Patent Application Serial No. 60/034,651, filed January 8, 1997, entitled "Bioconjugation by Diels- Alder Cycloaddition," the contents of each of which are hereby incorporated by reference. Further, non-nucleoside phosphoramidite monomers such as dialkylglycerol (DAG) phosphoramidites and phosphitylating reagents such as 2- cyanoethyltetraisopropylphosphorodiamidite, which is used in the syntheses of nucleoside phosphoramidites from nucleosides, can also be coupled using the chemistry described herein.

The term "nucleophile," as used herein, is defined as an electron-rich compound that reacts with a phosphoramidite monomer. Suitable nucleophiles for use in the present invention include, but are not limited to, hydroxyl groups, primary or secondary amines, halogens, carboxylate anions, thiols and other nucleophiles known by those of skill in the art to undergo S_N2 reactions at trivalent phosphorus.

The term "solid support," as used herein, is defined as a solid support which can be covalently coupled to a nucleophile, such as a nucleotide or oligonucleotide, in such a fashion that the nucleophile can be further modified using the chemistry disclosed herein, and subsequently removed from the solid support using conventional chemistry. Suitable solid supports for use in the present invention include, but are not limited to, controlled pore glass of various pore size and loading, polystyrene beads, and polystyrene-polyethylene glycol copolymer support (TentaGel).

The term "coupling efficiency" is defined as the percent coupling of each nucleophile, such as a nucleotide or oligonucleotide, with a phosphoramidite monomer. When the coupling is performed using a solid phase support, the first step typically involves coupling a nucleotide or oligonucleotide having a trityl-protected hydroxyl group to a solid support, and then detritylating the hydroxyl group. When the coupling is performed without using a solid support, the first step typically involves deprotecting one of the hydroxyl groups on a diprotected nucleotide or oligonucleotide. The subsequent steps, whether or not performed using a solid support, typically involve coupling a phosphoramidite monomer to the nucleotide or oligonucleotide (the coupling and washing steps may be repeated), oxidizing the phosphorus atom with an oxidizing agent (i.e., iodine), and optionally capping unreacted hydroxyl groups with a capping agent (i.e., acetic anhydride). Between each of these steps, excess reagents are washed from the solid support.

Typically, according to the method of the present invention, a range of from 2 to 12 equivalents of the coupling activator to the phosphoramidite monomer is used. The coupling activators of the present invention are typically used in concentrations of between 0.1 and 1.2 M. The oxidizing agent is typically used in a range of from 1.5 to 4 equivalents. In the capping step, between 14 and 28 equivalents of the capping agent (typically acetic anhydride) are used.

Prior art approaches to increasing the reaction rate of phosphoramidite coupling involved increasing the acidity of the coupling activator. However, as discussed above, and described below in Example 1 , the increased acidity also leads to increased by-products due to monomer detritylation.

In contrast, one embodiment of the present invention provides an improved coupling method wherein the reaction rate of the phosphoramidite coupling chemistry is increased by using coupling activators that are less acidic than and at least as nucleophilic as tetrazole. The coupling activators of the present invention increase the overall reaction rate by increasing the rate of the nucleophilic displacement step in the coupling reaction. The previously designed coupling activators utilized in the prior art methods are more acidic than tetrazole and thus increase the rate of the protonation step (see Scheme 1).

Preferably, the phosphoramidite coupling is performed using a single nucleophilic coupling activator bearing an acidic proton in the desired pKa range. The coupling activators used in the syntheses described herein are efficient nucleophilic catalysts and mild acids. The pKa of the coupling activators is higher than that of tetrazole. The coupling activators of the present invention have a pKa between 5.0 and 6.0 and are at least as nucleophilic as tetrazole. Preferably, the pKa of the coupling activators of the present invention is between 5.0 and 5.5, and, more preferably, between 5.1 and 5.3. Means for determining the pKa and nucleophilicity of a coupling activator are well known to those of skill in the art. Suitable coupling activators for use in the present invention include, but are not limited to, 4,5-dicyanoimidazole (DCI), 4-alkylthioimidazole, 2-alkylthioimidazole, 2-nitroimidazole, 4-nitroimidazole, 4,5-dihaloimidazole, 4-haloimidazole, 2-haloimidazole and 5-alkoxytetrazole. DCI is the preferred coupling activator. DCI has a pKa of 5.2 and is highly soluble in acetonitrile, a preferred solvent for phosphoramidite coupling. DCI is less acidic than tetrazole, increases product yield at larger scales and essentially eliminates detritylation of the phosphoramidite monomers, and increases the rate of the coupling reaction relative to when tetrazole is used as the coupling activator.

DCI is significantly more soluble in acetonitrile than tetrazole. With DCI, a 1.1 M solution in acetonitrile is easily prepared and remains a liquid at room temperature. This high concentration of coupling activator allows for a higher effective concentration of activated phosphoramidite monomers during the coupling step. This increased activated phosphoramidite monomer concentration in turn leads to increased reaction efficiency at decreased phosphoramidite monomer excess. Using a higher effective phosphoramidite monomer concentration reduces the number of equivalents of phosphoramidite monomer needed and significantly improves process efficiency. Improving the process efficiency becomes increasingly important as the process scale increases.

The activation of phosphoramidite monomers towards coupling with the 5 '-hydroxyl group of a growing oligonucleotide chain by coupling activators such as DCI not only proceeds with consistently high yields, it also proceeds significantly faster than with conventionally employed tetrazole or tetrazole derivatives as activators. The ability to increase the coupling reaction rate is particularly important when coupling involves using more sterically hindered nucleoside 3 '-phosphoramidite monomers which have bulky substituents such as a TBDMS protecting group on the adjacent 2' carbon. These phosphoramidite monomers, which are commonly used in oligonucleotide preparation, couple at a much slower rate due to the sterically demanding sustitutent on the 2' carbon. In an alternative embodiment, the coupling efficiency is improved by minimizing detritylation of the phosphoramidite monomers. This is achieved by increasing the pH of the reaction medium by introducing a buffer component. The coupling efficiency may increase if this buffer component also is able to function as nucleophilic catalyst, thus speeding up the slow nucleophilic step. The buffer is preferably a tertiary amine, including tertiary amines containing three alkyl groups, and heterocyclic compounds containing one or more tertiary amines. Suitable trialkylamines include, but are not limited to, N- alkylimidazoles, N-alkyltriazoles, N-alkyltetrazoles, and dialkylaminopyridines. Preferably the tertiary amine is less nucleophilic than DMAP, which is known to cause side reactions at the 6-position oxygen of guanosines due to its relatively high nucleophilicity. N- methylimidazole (NMI) is the preferred tertiary amine.

The buffer is added to the coupling activator solutions to increase the coupling efficiency. For example, a solution of 0.5 M tetrazole and 0.5 M NMI in acetonitrile gives consistently high coupling efficiencies with the same wide variety of nucleoside phosphoramidite monomers described above. The basicity of NMI also decreases the rate of monomer detritylation. Coupling reactions performed with this tetrazole/NMI mixture proceed at the same rate as is observed with tetrazole alone. Thus, the increase in the reaction rate of the coupling chemistry that is observed with the more nucleophilic, less acidic coupling activators such as DCI is not observed in this embodiment.

In addition to activation of nucleoside phosphoramidites during coupling to oligonucleotides, the activation with DCI is also useful in the phosphitvlation of nucleosides with 2-cyanoethyltetraisopropylphosphorodiamidite. In a mechanism analogous to that proposed in the coupling of a nucleoside phosphoramidite with a nucleophile, this phosphitylating reagent is protonated by DCI, followed by displacement of the N,N- diisopropylamine with the 4,5-dicyanotetrazolide. This intermediate reacts with the 3'- hydroxyl group of the nucleoside to yield the nucleoside 3 '-phosphoramidite (Scheme 3).

Scheme 3

DCI was also evaluated against triazole for the conversion of 2'-fluoro-2'- deoxyuridine to 2'-fluoro-2'-deoxy cytidine (Scheme 4). A uridine derivative was converted to cytidine using either triazole and DCI following a reported procedure (Divaker and Reese (1982) J. Chem. Soc. Perkin Trans. 1, 179-183) and the kinetics and yields of the two reactions were found to be comparable. Scheme 4

8b: R - { II

The invention will be more clearly understood with reference to the following non-limiting examples.

Materials and Methods.

Technical grade 4,5-dicyanoimidazole and N-methylimidazole were obtained from Aldrich Chemical Co. The 2',3'-O-isopropylidineuridine was obtained from Sigma Chemical Co. and converted to the 5'-DMT derivative by standard methods. Deoxynucleoside phosphoramidites and oligonucleotide synthesis reagents were obtained from Applied Biosystems, Cruachem Inc., Glen Research, or PerSeptive Biosystems. N- tert-butylphenoxyacetyl protected 2'-TBDMS protected ribonucleoside phosphoramidites were obtained from PerSeptive Biosystems. The 2'-fluoropyrimidine phosphoramidites (Pieken et al. (1991) Science 253:314-317) and the 2^l-trifluoroacetylaminopyrimidine phosphoramidites (McGee et al. (1996) J. Org. Chem. 61:781-785) were prepared as previously described. Beaucage reagent was obtained from Glen Research. Derivatized controlled pore glass solid support was obtained from Prime Synthesis. Polystyrene support was obtained from Pharmacia Biotech. Example 1. Recrystallization of technical grade 4,5-dicyanoimidazole.

Technical grade 4,5-dicyanoimidazole (100 g, 847 mmol) was slowly dissolved in boiling water (800 mL), decolorized with activated charcoal and the hot solution was filtered through a celite bed. Slow cooling of this solution produced white needle-like crystals of DCI. The product was filtered, washed with water and dried in a vacuum oven at 80-90°C for 24 hours to yield 85 g of pure DCI (mp 174.5-175°C, lit. 174°C moisture by Karl Fischer titration: 0.11 %). Moisture can further be reduced by treatment of dissolved DCI with molecular sieves.

Example 2: Detritylation of 5'-dimethoxytrityl-2',3'-O-isopropylidineuridine by tetrazole and 5-ethylthio-l-H-tetrazole.

A model study was conducted to establish the rate of detritylation of 5'- dimethoxytritylnucleosides by tetrazole and 5-ethylthiotetrazole in acetonitrile. A stock solution of 0.2 M 5'-DMT-2',3'-isopropylidineuridine was prepared in dry acetonitrile. To this solution was added an acetonitrile solution of the coupling activator solution at time zero. The final concentration of the reaction mixture was adjusted to 0.1 M 5'-DMT-2',3'- isopropylidineuridine. An aliquot was removed at several time points and analyzed by reversed phase HPLC. Rates were determined at three coupling activator concentrations (0.1 M, 0.2 M, 0.5 M). Figure 1 shows the second order rate constants for detritylation by tetrazole and 5-ethylthiotetrazole. The rate constants correlate to the acidity of the tetrazoles. Thus, as the coupling times and the acidity of the coupling activators increases, detritylation and by-products associated with detritylation also increase.

Example 3. Preparation of NX288c05, a 51mer DNA, using tetrazole buffered with NMI as the activator.

A 51mer oligodeoxynucleotide of sequence 5'-TAG-CCA-AGG-TAA-CCA-GTA- CAA-GGT-GCT-AAA-CGT-AAT-GGC-TTC-GGC-TTA-C[3'-3'T]T-3' (NX288c05) (SEQ ID NO:l), where [3'-3'] stands for a 3',3'-internucleotidic linkage, was prepared at the 0.35 mmol scale on a Millipore 8800 automated synthesizer using standard deoxynucleoside phosphoramidites and using tetrazole buffered with NMI as the activator. The synthesis was carried out using controlled pore glass (CPG) support of 1000 A pore size, loaded at 35 mmol/g with 3'-succinylthymidine. The synthesis cycle is shown in Table 1. The oligonucleotide was cleaved from the support and deprotected by reaction in concentrated ammonia at 55°C for 18 hours. The solution was then cooled, filtered and the filtrate was concentrated to dryness. NX288c05 was obtained in 41% yield. This corresponds to an average stepwise coupling efficiency of 98.3 %. Figure 2 shows the anion exchange HPLC chromatogram of crude NX288c05. The chromatogram was obtained on a 4.6 x 100 mm Gen-Pak Fax column (Waters) at 80°C eluting from 90% trizma ethylenediamine tetraacetate (pH 7.5, buffer A) : 10% trizma ethylenediamine tetraacetate + 1 M NaCl (pH 7.5, buffer B) to 90% buffer B over 30 minutes at 0.75 mL/min.

At larger scales, particularly in column reactors, chromatographic separation of the NMI from the tetrazole and the nucleoside phosphoramidite limits the utility of this activation system (data not shown).

Example 4. Solid phase synthesis of (aU)₁₀T oligonucleotides on a polystyrene support using tetrazole and tetrazole buffered with NMI.

A 2'-aminouridine oligonucleotide 5'-(aU)_I0T-3' (SEQ ID NO:2) was prepared at a 0.1 mmol scale on a Pharmacia OligoPilot II™ automated synthesizer using polystyrene support loaded at 26 mmol/g with 3'-succinylthymidine and using tetrazole or tetrazole buffered with NMI as the activator. The activator formulation used is shown in Table 2. The 2'-aminouridine phosphoramidites were coupled in two aliquots of three equivalents. The synthesis cycle is shown in Table 2. The oligonucleotide was cleaved from support and deprotected by reaction in concentrated ammonia at 55 °C for 18 hours. The solution was then cooled, filtered and the filtrate was concentrated to dryness. As shown in Table 3, by adding 0.1 M NMI to 0.5 M tetrazole (8 eq) the stepwise average coupling efficiency for the preparation of a (aU)₁₀-T oligonucleotide was increased from 96.4 % to 98.0 %. Adding more than 0.1 M of NMI resulted in decreased product yield, presumably due to the basicity of the medium. Example 5: ³¹P NMR experiments demonstrating faster coupling rates in DCI reactions.

Kinetic studies were performed on different sterically hindered 2'- modified and unmodified RNA monomers, using tetrazole and DCI as coupling activators. All experiments were conducted under approximately the same reaction conditions.

Phosphoramidite (0.01 mmol), 2',3'-O-isopropylidene uridine (0.011 mmol), and a coupling activator (0.08 mmol) were dissolved in CD₃CN (0.7 mL) and reaction rate was followed by ¹P NMR using D,PO₄ as an external standard. The results are shown in Table 4. In Table 4, NPh* stands for pthalimide protected, U stands for uridine, G stands for guanosine, TFA stands for trifluoroacetamide, and OMe stands for methoxy. As seen from Table 4, the reaction rate of the coupling chemistry is higher in all cases when DCI, rather than tetrazole, is used as the coupling activator.

Example 6: Solid phase synthesis of an oligonucleotide on polystyrene support using tetrazole, tetrazole buffered with NMI and DCI.

Homopolymers of 2'-modified DNA were synthesized using tetrazole, tetrazole buffered with N-methylimidazole (NMI) and 4,5-dicyanoimidazole (DCI) as the coupling activators. i. Oligodeoxynucleotide synthesis with 0.5 M tetrazole as the coupling activator. The sequence synthesized in this example was 5'- aCaCaCaCaCaCaCaCaCdT-3'

(SEQ ID NO:3) where aC stands for 2'-aminocytidine and dT stands for thymidine. The synthesis was performed using a Pharmacia OligoPilot II™ automated oligonucleotide synthesizer using a 12 mL axial flow Pharmacia column filled with 4 grams of Pharmacia polystyrene with 26 mmol dT/gram support and using 0.5 M tetrazole as the coupling activator. The reagents used, equivalents used, and the exposure time for each step of the synthesis is described below in Table 5.

After the synthesis was complete, the oligonucleotide was cleaved from the support and deprotected by reaction with concentrated aqueous ammonia at 80°C for 2 hours. The purity of the final product as determined by anion exchange chromatography was 85.9%. The average coupling efficiency was 98.3%. An anion exchange chromatogram of the deprotected product is shown in Figure 3.

ii. Oligodeoxynucleotide synthesis with 0.5 M tetrazole and 0.1 M N-methylimidazole as the coupling activator.

The sequence synthesized in this example was 5'- aCaCaCaCaCaCaCaCaCdT-3¹ (SEQ ID NO:3) where aC stands for 2'-aminocytidine and dT stands for thymidine. The synthesis was performed in a Pharmacia OligoPilot II™ using a 12 mL axial flow Pharmacia column filled with 4 grams of Pharmacia polystyrene with 26 mmol dT/gram support. The reagents used, equivalents used, and the exposure time for each step of the synthesis is the same as shown in Table 5. After the synthesis was complete, the oligonucleotide was cleaved from the support and deprotected by reaction with concentrated aqueous ammonia at 80°C for 2 hours. The purity of the final product as determined by anion exchange chromatography was 83.3%. The average coupling efficiency was 98.0%. An anion exchange chromatogram of the deprotected product is shown in Figure 4.

iii. Oligodeoxynucleotide synthesis with 4,5-dicyanoimidazole as the coupling activator.

The sequence synthesized in this example was (5'- aCaCaCaCaCaCaCaCaCdT-3') (SEQ ID NO:3) where aC stands for 2'-aminocytidine and dT stands for thymidine. The synthesis was performed in a Pharmacia OligoPilot II™ using a 48 mL axial flow Pharmacia column filled with 16 grams of Pharmacia polystyrene with 25 mmol dT/gram support. The reagents used, equivalents used, and the exposure time for each step of the synthesis is described below in Table 6. After the synthesis was complete, the oligonucleotide was cleaved from the support and deprotected by reaction with concentrated aqueous ammonia at 80°C for 2 hours. The purity of the final product as determined by anion exchange chromatography was 89.9%. The average coupling efficiency was 98.8%. An anion exchange chromatogram of the deprotected product is shown in Figure 5. As the coupling efficiency approaches 99%, the yield and purity of the final product increases substantially relative to when the coupling efficiency is around 98%.

Example 7. Preparation of NX11702 with tetrazole, tetrazole buffered with NMI, and with DCI.

This example illustrates the effect of addition of NMI to the activator solution by the preparation of a 34mer 2'-fluoropyrimidine-ribopurine oligonucleotide. The syntheses were performed at a 1 mmol scale with a 2-fold excess of phosphoramidite per coupling and a 20 minute or 30 minute coupling time for the 2'-fluoiOpyrimidine phosphoramidites or ribopurine phosphoramidites, respectively. The sequence prepared was 2'-fluoropyrimidine- ribopurine oligonucleotide of sequence 5'-rGrG-rArGfU-fCfUfU-rArGrG-fCrArG-fCrGfC- rGfUfU-fUfUfC-rGrArG-fCfUrA-fCfUfC-fC[3'-3'T]-3' (NX11702) (SEQ ID NO:4) where rG and rA stands for guanosine and adenosine respectively and fC and fU stands for 2'- deoxy-2'-fluorocytidine and 2'-fluorouridine, respectively, and [3'-3'] stands for a 3', 3'- internucleotidic linkage. The synthesis was carried out at a 1 mmol scale on a Millipore 8800 automated synthesizer using 5'-DMT-2'-O-TBDMS-N²-tert-butyl- phenoxyacetylguanosine and 5'-DMT-2'-O-TBDMS-N⁶-tert-butylphenoxyacetyl-adenosine 3'-N,N-diisopropyl-(2-cyanoethyl) phosphoramidites and 2'-deoxy-2'-fluoro-5'-DMT-N'^t- acetylcytidine and 2'-deoxy-2'-fluoro-5'-DMT-uridine 3'-N,N-diisopropyl-(2-cyanoethyl)- phosphoramidites. The syntheses were carried out using CPG support of 600 A pore size, 80 - 120 mesh, and 60 - 70 μmol/g loading with 5'-succinylthymidine. The synthesis cycle is shown in Table 7. Under these stringent synthesis conditions, no product was observed by anion exchange HPLC chromatography after complete deprotection for the tetrazole activated synthesis (Figure 6). In contrast, 13% of the desired product was observed when 0.1 M NMI was added to the tetrazole (Figure 6). With only two equivalents of phosphoramidite per monomer addition and using 1.0 M DCI as the activator, NX11702 was prepared in 54% yield after complete deprotection (Figure 7). Example 8: Syntheses of an oligonucleotide comparing tetrazole and DCI.

Coupling activators DCI and tetrazole were compared by performing two syntheses under identical conditions at a 0.088 mmol scale. The sequence synthesized for this comparison was 5'-[Ta]GGTAATGCAAATCGTGGAACATGACC[3'-3'T]-3' (SEQ ID NO:5) where Ta stands for 5-(hexylaminopropenamide)uridine, A stands for adenosine, T stands for thymine, C stands for cytidine, G stands for guanine, and [3'-3'T] stands for a thymidine, connected to the adjacent 5'-terminal base through a 3',3'-phosphodiester linkage.

A Pharmacia 6 mL axial flow column was filled with 1.66 grams of controlled pore glass support, that was derivatized with 5'-dimethoxytritylthymidine at a loading of 53 μmole/gram. This column was connected to a Pharmacia OligoPilot II™ synthesizer and the instrument was programmed to deliver reagents per cycle as given in Table 8. Before adding the first nucleoside phosphoramidite, the resin was detritylated using 168 equivalents of 3% dichloroacetic acid in dichloromethane. The [3'-p3'T] and [Ta] monomers used a double coupling and coupling wash cycle prior to the oxidation step. The detritylation step was not performed in the last cycle. After the synthesis was completed, a sample of the product oligonucleotide was cleaved from the support and deprotected by reaction with concentrated aqueous ammonia at 70°C for 3 hours. Analytical results of the deprotected product are shown in Table 9. The capillary electrophoresis chromatography provided baseline resolution, and is a more accurate technique for determining the purity of the final product than anion exchange chromatography. Anion exchange chromatograms of the deprotected products are shown in Figures 8 and 9 for DCI and tetrazole, respectively.

Example 9. Preparation of NX28604, a 35mer oligonucleotide, with DCI. This example demonstrates that activation with DCI proved to be the most efficient way to assemble oligonucleotides containing 2'-deoxy-2'-aminopyrimidines. The 35mer sequence synthesized was a 2'-aminopyrimidine oligonucleotide having the sequence 5'- TsTsTsTsmGmGaUrGaUrGaUrGrGmArArGmAaCrArGaCmGmGmGaUmGmGaUaUaCT sTsTsTsT-3' (NX28604) (SEQ ID NO: 6) where aU and aC stand for 2'-aminouridine and 2'-aminocytidine, mG and mA stand for 2'-O-methylguanosine and 2'-O-methyladenosine, rG and rA stand for guanosine and adenosine, T stands for thymidine, and s stands for a phosphorothioate internucleotide linkage. This sequence was prepared at a 0.4 mmol scale on a Pharmacia OligoPilot II™ automated synthesizer using polystyrene support loaded at 26 mmol/g with 3'-succinylthymidine. The synthesis cycle is shown in Table 10. The oligonucleotide was cleaved from the resin and the base and phosphate protecting groups were removed by reaction with ammonia saturated ethanol at room temperature for 72 hours. The mixture was filtered and the supernatant was evaporated to dryness. The crude material was then subjected to 1 M TBAF in THF for 24 hours at room temperature. At that point the reaction was quenched with an equal volume of 1 M Tris*HCl (pH 7.5). The organic solvent was evaporated and the crude oligonucleotide was isolated by ethanol precipitation. Figure 10 shows the anion exchange HPLC chromatogram of crude NX28604. The chromatogram was obtained on a 4.6 x 100 mm Gen-Pak Fax column (Waters) at 80°C eluting from 90% trizma ethylenediamine tetraacetate (pH 7.5, buffer A) : 10% trizma ethylenediamine tetraacetate + 1 M NaCl (pH 7.5 , buffer B) to 90% buffer B over 30 minutes at 0.75 mL/min.

Synthesis of this oligonucleotide by activation with tetrazole did not give satisfactory yields (data not shown).

Example 10: Effect of DCI concentration on coupling efficiency.

This example shows that increased DCI concentration (in acetonitrile) can be used to decrease phosphoramidite equivalents during solid phase oligonucleotide synthesis. Two RNA syntheses and two DNA syntheses were performed using DCI as the coupling activator, but at different concentrations (0.5 M and 1.0 M). As the concentration of DCI was increased, the effective concentration of the phosphoramidite also increased (due to the decrease in the total volume of solvent used). Increased effective reagent concentrations tends to increase reaction rates for solid phase reactions.

The two RNA syntheses were 41-mers with mixed 2'-fluoro and 2'-TBDMS-O with a C⁵ amino-modified dT on the 5' end. Figures 11 and 12 reflect the coupling efficiency of these syntheses as calculated from the ratio of the first and last acidified DMT cation fraction raised to the 40^th root (or the number of coupling cycles). The analytical HPLC chromatograms shown in Figures 13 and 14 are anion exchange analyses of the crude product, following deprotection and cleavage from the support (as well as subsequent desilylation of the 2' protecting groups).

The two DNA syntheses were 29-mers of mixed deoxy-ACGT with a C5-amino- modified dT on the 5' end. For comparative purposes one synthesis used 2 equivalents of phosphoramidite monomers and 1.0 M DCI, and the other used 2 equivalents of phosphoramidite monomers and 0.5 M DCI. The graphs shown in Figures 15 and 16 reflect the coupling efficiency of these syntheses as calculated from acidified DMT

(dimethoxytrityl) cation fractions collected at the beginning of each coupling cycle. The analytical HPLC chromatograms shown in Figures 17 and 18 are anion exchange analyses of the crude product after deprotection and cleavage from the support.

Example 11. Coupling a phosphoramidite monomer to an oligonucleotide using 1.13 equivalents of DCI.

This example demonstrates that with just a slight excess (1.13 equivalents) of DCI, a 5'-DMT protected, 3 '-phosphoramidite can be effectively activated and coupled to a free 5'- alcohol of an oligonucleotide in solution. A coupling and oxidation was performed with a 5'-DMT-thymidine-3'-(2-cyanoethyl)-diisopropylphosphoramidite (DMT-dT-OCEPA) and a 5'-HO-dG-T-3'-3'-T-5^*-OtBDPS trimer (5'-GTT trimer, tert-butyldiphenylsilyl protected) (SEQ ID NO:7), using 4,5-dicyanoimidazole (DCI) as the activator.

A 0.2 M solution of the trimer (2:1 ACN:DCM) was prepared in a septum-sealed vial and stored over 4 A sieves over night. To 1.95 mL (0.39 mmols) of this solution, 0.44 mL (0.44 mmols) of a 1.0 M DCI solution was added. To this solution, 1.74 mL (0.47 mmols) of a 0.2 M DMT-T amidite solution in ACN was added. After reacting for 25 minnutes and checking for completion by TLC (12 % MeOH/DCM w/ 1 % TEA), the tetramer oligonucleotide was oxidized with tetrabutylammonium periodate (TBA(IO₄)) (1.88 mmols). The reaction conditions for this experiment are summarized in Table 11. After reaction proceeded for 20 minutes, a sample was scanned on a Hitachi Spectrophotomer (220 nm to 320 nm) and run on reversed phase HPLC analysis. Figure 19 shows the HPLC chromatogram for the starting trimer, Figure 20 shows the HPLC chromatogram for the coupled/oxidized tetramer, and Figure 21 shows an overlay of the HPLC chromatograms from Figures 19 and 20.

Example 12. 5'-O-(4,4'-dimethoxytrityI)-2'-deoxythymidine 3'-O-(2-cyanoethyl N,N- diisopropylphosphoramidite).

A 1 M solution of 4,5-dicyanoimidazole in acetonitrile (1.8 mL, 1.8 mmol) was added to a stirred suspension of protected thymidine nucleoside (1.4 g, 2.57 mmol) in 15 mL dry dichloromethane. 2-Cyanoethyl tetraisopropylphosphorodiamidite (0.98 mL, 3.08 mmol) was then added dropwise via syringe over 4 minutes. The cloudy reaction was allowed to stir under argon for 3 hours, and then was diluted with 10 mL dichloromethane and partitioned twice with 5% sodium bicarbonate. The organic layer was dried with magnesium sulfate, filtered and concentrated to yield 1.94 g of a white foam. The foam was dissolved in toluene and added dropwise to rapidly vortexing hexane. A white precipitate was allowed to settle and the supernatant decanted. The precipitation was repeated to give 1.43 g white solid in 75% yield. The analysis agreed with that of an authentic sample.

Example 13. Conversion of 3',5'-O-diacetyl-2'-fluoro-2'-deoxyuridine to 2'-fluoro-2'- deoxycytidine by 4,5-dicyanoimidazole.

POCl₃ (0.85 mL, 9.1 mmol, 3 eq) was added to an ice cold solution of 4,5- dicyanoimidazole (3.6 g, 30.3 mmol, 10 eq) in dry CH₃CN (10 mL). After stirring for 15 minutes, triethylamine 95.5 mL, 39.4 mmol, 13 eq) was added and the stirring was continued for another 20 minutes. A solution of the 2'-fluorouridine derivative (1.0 g, 3.03 mmol, 1 eq) in dry CH₃CN (25 mL) was then added dropwise and the reaction was allowed to warm to room temperature over 2 hours. The reaction mixture was then concentrated under reduced pressure, redissolved in CH₂C1₂ (50 mL), washed with 5 % NaHCO₃ (2 x 20 mL), water and brine and dried to afford 1.68 g of the crude N⁴-4,5-dicyanoimidazolide derivative. A small amount of this crude product was purified by chromatotron eluting with ethylacetate : hexane (3:1): Η NMR (CDC1₃): δ 2.15 (s, 6H), 4.46-4.47 (m, 2H), 4.5-4.64 (dt, J = 3.1, 9.3 Hz, IH), 4.89-5.02 (ddd, J = 4.35, 9.3 and 21Hz, IH), 5.28-5.48 (dd, J = 4.35, 51 Hz, IH), 6.00 (d, J = 17.2 Hz, IH), 6.98 (d, J = 7.32 Hz, IH), 8.52 (d, J = 7.35 Hz, IH) and 8.65 (s, IH). Anal. Calcd for C₁₈H₁₅N₆O₆F.H₂O: C, 48.24; H, 3.79; N, 18.75. Found: C, 48.63; H, 3.77; N, 18.52. HRMS (M⁺) 430.4.

The crude product from the previous reaction was treated with 50% NH₄OH in THF (17.5 mL) and stirred at room temperature overnight. The mixture was evaporated to dryness and purified by silica gel column chromatography. Elution with 20% CH₃OH in ethyl acetate afforded 55% pure product. Η NMR (DMSO-d₆): δ 3.45-3.9 (m, 3H), 3.9- 3.96 (m, IH), 3.98-4.25 (m, IH), 4.75-4.96 (dd, J = 4.35, 51 Hz, IH), 5.12-5.17 (m, IH, D₂O exchangeable), 5.55 (d, J = 6 Hz, IH, D₂O exchangeable), 5.7 (d, J = 7.5 Hz, IH), 5.87 (d, J = 18 Hz, IH), 7.22 (bd, J = 10 Hz, D₂O exchangeable) and 7.88 (d, J = 7.5 Hz).

Example 14. Conversion of 3',5'-O-diacetyl-2'-fluoro-2'-deoxyuridine to 2'-fluoro-2'- deoxycytidine by triazole.

By following the same procedure, as described in Example 13, 3',5'-O-diacetyl-2'- fluoro-2'-deoxyuridine to 2'-fluoro-2'-deoxycytidine conversion using triazole, afforded 42% of the final product and both products were identical by Η NMR. The invention has been described with respect to its preferred embodiments. It will be readily apparent to those skill in the art that further changes and modifications in the actual implementation of the concepts described herein can easily be made without departing from the spirit and scope of the invention as defined by the following claims. Table 1. Automated synthesis cycle for the preparation of NX28805.

* Equivalents are based on the moles of CPG-bound 3'-terminal nucleoside. ** Activator equivalents are based on moles of nucleoside phosphoramidite.

Table 2. Automated synthesis cycle for the preparation of (aU)₁₀T

*Equivalents are based on the moles of CPG-bound 3'-terminal nucleoside. ** Activator equivalents are based on moles of nucleoside phosphoramidite.

Table 3. Coupling efficiency of aU addition in dependence of activator.

Table 4. Reaction time for phosphoramidite coupling in dependence of activator.

Table 5. Monomer addition cycle.

* Equivalents are in relation to the amount of nucleoside chain initiators anchored to the solid support, unless stated otherwise. Table 6. Monomer addition cycle.

* Equivalents are in relation to the amount of nucleoside chain initiators anchored to the solid support, unless stated otherwise.

Table 7. Automated synthesis cycle for the preparation of NX1 1702.

*Equivalents are based on the moles of CPG-bound 3'-terminal nucleoside. ** Activator equivalents are based on moles of nucleoside phosphoramidite. Table 8. Monomer addition cycle for Preparation of Oligonucleotides.

* Equivalents are in relation to the amount of nucleoside chain initiators anchored to the solid support, unless stated otherwise.

Table 9. Results of anion exchange of oligonucleotide synthesis of deprotected product.

Table 10. Automated Synthesis cycle for the preparation of NX28604.

*Equivalents are based on the moles of CPG-bound 3'-terminal nucleoside. ** Activator equivalents are based on moles of nucleoside phosphoramidite.

Table 11. Reaction conditions for monomer coupling using 1.13 equivalents DCI.

SEQUENCE LISTING

(1) GENERAL INFORMATION

(i) APPLICANT: CHANDRA VARGEESE

WOLFGANG PIEKEN JEFFREY D. CARTER JOHN YEGGE (ii) TITLE OF THE INVENTION: IMPROVED COUPLING ACTIVATORS

FOR OLIGONUCLEOTIDE SYNTHESIS iϋ) NUMBER OF SEQUENCES: 7 iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: Swanson & Bratschun, L.L.C.

(B) STREET: 8400 E. Prentice Avenue, Suite 200

(C) CITY: Englewood

(D) STATE: Colorado

(E) COUNTRY: U.S.

(F) ZIP: 80111

(v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Diskette, 3.5 inch, 1.44 Mb storage

(B) COMPUTER: IBM compatible

(C) OPERATING SYSTEM: MS-DOS

(D) SOFTWARE: WordPerfect 6.0

(vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER: PCT/US97/

(B) FILING DATE:

(C) CLASSIFICATION:

(vii) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER: 08/

(B) FILING DATE: 25-SEPT-1997

(vii) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER: 08/730,556

(B) FILING DATE: 15-OCTOBER-1996

(viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: Rosemary P. Kellogg

(B) REGISTRATION NUMBER: 39,726

(C) REFERENCE/DOCKET NO.: NEX55/PCT

(ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: (303) 793-3333

(B) TELEFAX: (303) 793-3433

(2) INFORMATION FOR SEQUENCE ID NO. 1: (i) SEQUENCE CHARACTERIZATION:

(A) LENGTH: 51 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULAR TYPE: DNA

(ix) FEATURE: Nucleotide number 51 is an inverted orientation (3'3' linkage) phosphorodiester linkage . (xi) SEQUENCE DESCRIPTION: SEQ ID NO. 1: TAGCCAAGGT AACCAGTACA AGGTGCTAAA CGTAATGGCT TCGGCTTACT 50 T 51 (2) INFORMATION FOR SEQUENCE ID NO. 2: (i) SEQUENCE CHARACTERIZATION:

(A) LENGTH: 11 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULAR TYPE: RNA

(ix) FEATURE: U is a 2 ' -Amino uridine (xi) SEQUENCE DESCRIPTION: SEQ ID NO. 2: UUUUUUUUUU T 11

(2) INFORMATION FOR SEQUENCE ID NO. 3 (i) SEQUENCE CHARACTERIZATION:

(A) LENGTH: 10 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULAR TYPE: RNA

(ix) FEATURE: C is 2 ' -Amino cytidine (xi) SEQUENCE DESCRIPTION: SEQ ID NO. 3: CCCCCCCCCT 10

(2) INFORMATION FOR SEQUENCE ID NO. 4: (i) SEQUENCE CHARACTERIZATION:

(A) LENGTH: 34 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULAR TYPE: RNA

(ix) FEATURE: U is 2 ' -fluorouridine; C is 2'- fluorocytidine; nucleotide number 34 is an inverted orientation (3' 3' linkage) phosphorodiester linkage.

(xi) SEQUENCE DESCRIPTION: SEQ ID NO. 4: GGAGUCUUAG GCAGCGCGUU UUCGAGCUAC UCCT 34

(2) INFORMATION FOR SEQUENCE ID NO. 5: (i) SEQUENCE CHARACTERIZATION:

(A) LENGTH: 28 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: circular (ii) MOLECULAR TYPE: DNA

(ix) FEATURE: The N at the 5 ' -terminal end is 5'

(hexylaminopropenamide) uridine; nucleoside number 28 is an inverted orientation (3 '3' linkage) phosphorodiester linkage.

(xi) SEQUENCE DESCRIPTION: SEQ ID NO. 5: NGGTAATGCA AATCGTGGAA CATGACCT 28

(2) INFORMATION FOR SEQUENCE ID NO. 6: (i) SEQUENCE CHARACTERIZATION:

(A) LENGTH: 35 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULAR TYPE: DNA (ix) FEATURE: U is 2 ' -aminouridine; C is 2 ' -aminocytidine;

G is 2 ' -O-methylguanosine; A is 2 ' -O- methyladenosine; nucleotide numbers 1-5 and 31-35 are bound by a phosphorothioate linkage .

(xi) SEQUENCE DESCRIPTION: SEQ ID NO. 6: TTTTGGUGUG UGGAAGACAG CGGGUGGUUC TTTTT 35

(2) INFORMATION FOR SEQUENCE ID NO. 7: (i) SEQUENCE CHARACTERIZATION:

(A) LENGTH: 3 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULAR TYPE: DNA

(ix) FEATURE: G is a 5 ' -O-tert-butyldiphenylsilyl protected guanosine . (xi) SEQUENCE DESCRIPTION: SEQ ID NO. 7: GTT 3

Claims

We claim:

I . A method for coupling phosphoramidite monomers with nucleophiles comprising reacting a phosphoramidite monomer and a suitable nucleophile in the presence of an effective amount of a coupling activator that is less acidic than and at least as nucleophilic as tetrazole.

2. The method of claim 1 , wherein the phosphoramidite monomer to be coupled with the coupling activator is selected from the group consisting of protected 2'- deoxynucleoside-3'-phosphoramidites, protected 2'-tert-butyldimethylsiloxynucleoside 3'- phosphoramidites, protected 2'-deoxy-2'-trifluoroacetamidonucleoside 3'-phosphoramidites, protected 2'-deoxy-2'-fluoronucleoside 3 '-phosphoramidites, and protected 2'- alkoxynucleoside 3'-phosphoramidites.

3. The method of claim 1, wherein the phosphoramidite monomer comprises a non- nucleoside phosphoramidite monomer.

4. The method of claim 3, wherein the phosphoramidite monomer comprises a dialkylglycerol (DAG) phosphoramidite.

5. The method of claim 3, wherein the phosphoramidite monomer comprises a phosphitylating agent.

6. The method of claim 5, wherein the phosphitylating agent comprises 2- cyanoethyl tetraisopropylphosphorodiamidite .

7. The method of claim 1, wherein the nucleophile is selected from the group consisting of hydroxyl group, primary amines and secondary amines.

8. The method of claim 7, wherein the hydroxyl group comprises the 5 '-hydroxyl group on a nucleotide or an oligonucleotide.

9. The method of claim 1, wherein the nucleophile is bound to a solid support.

10. The method of claim 9, wherein the solid support is selected from the group consisting of controlled pore glass, polystyrene beads, and polystyrene-polyethylene glycol copolymer support.

I I . The method of claim 1, wherein the coupling activator has a pKa between 5.0 and 6.0.

12. The method of claim 1, wherein the coupling activator has a pKa between 5.0 and 5.5.

13. The method of claim 1, wherein the coupling activator has a pKa between 5.1 and 5.3.

14. The method of claim 1, wherein the coupling activator is selected from the group consisting of 4,5-dicyanoimidazole (DCI), 4-alkylthioimidazole, 2- alkylthioimidazole, 2-nitroimidazole, 4-nitroimidazole, 4,5-dihaloimidazole, 4- haloimidazole, 2-haloimidazole and 5-alkoxytetrazole.

15. The method of claim 1, wherein the coupling activator is DCI.

16. The method of claim 13, wherein the DCI is dissolved in acetonitrile.

17. The method of claim 14, wherein the concentration of DCI in acetonitrile is between 0.1 and 1.2 M.

18. The method of claim 1, wherein the coupling is performed in the liquid phase.

19. A method for coupling phosphoramidite monomers with nucleophiles comprising reacting a phosphoramidite monomer and a suitable nucleophile in the presence of an effective amount of a combination of a coupling activator and a suitable buffer.

20. The method of claim 19, wherein the monomer to be coupled with the coupling activator is selected from the group consisting of protected 2'-deoxynucleoside-3'- phosphoramidites, protected 2'-tert-butyldimethylsiloxynucleoside 3 '-phosphoramidites, protected 2'-deoxy-2'-trifluoroacetamidonucleoside 3 '-phosphoramidites, protected 2'- deoxy-2'-fluoronucleoside 3 '-phosphoramidites, and protected 2'-alkoxynucleoside 3'- phosphoramidites.

21. The method of claim 19, wherein the phosphoramidite monomer comprises a non-nucleoside phosphoramidite monomer.

22. The method of claim 21, wherein the phosphoramidite monomer comprises a dialkylglycerol (DAG) phosphoramidite.

23. The method of claim 21, wherein the phosphitylating agent comprises 2- cyanoethyl tetraisopropylphosphorodiamidite.

24. The method of claim 19, wherein the nucleophile is selected from the group consisting of hydroxyl group, primary amines and secondary amines.

25. The method of claim 24, wherein the hydroxyl group comprises the 5'-hydroxyl group on a nucleotide or an oligonucleotide.

26. The method of claim 19, wherein the nucleophile is bound to a solid support.

27. The method of claim 26, wherein the solid support is selected from the group consisting of controlled pore glass, polystyrene beads, and polystyrene-polyethylene glycol copolymer support.

28. The method of claim 19, wherein the buffer comprises a tertiary amine that is less nucleophilic than DMAP.

29. The method of claim 28, wherein the tertiary amine comprises N- methylimidazole.

30. The method of claim 19, wherein the coupling activator is tetrazole, 5-(p- nitrophenyl)tetrazole or 5-alkylthiotetrazole.

31. The method of claim 19, wherein the coupling is performed in the liquid phase.

32. An improved method for preparing oligonucleotides by coupling phosphoramidite monomers with nucleotides using phosphoramidite coupling chemistry, comprising using a coupling activator that is less acidic than and at least as nucleophilic as tetrazole.

33. The method of claim 32, wherein the phosphoramidite monomers are selected from the group consisting of protected 2'-deoxynucleoside-3 '-phosphoramidites, protected 2'-tert-butyldimethylsiloxynucleoside 3 '-phosphoramidites, protected 2'-deoxy-2'- trifluoroacetamidonucleoside 3 '-phosphoramidites, protected 2'-deoxy-2'-fluoronucleoside 3 '-phosphoramidites, and protected 2'-alkoxynucleoside 3'-phosphoramidites.

34. The method of claim 32, wherein the coupling activator has a pKa between 5.0 and 6.0.

35. The method of claim 32, wherein the coupling activator has a pKa between 5.0 and 5.5.

36. The method of claim 32, wherein the coupling activator has a pKa between 5.1 and 5.3.

37. The method of claim 32, wherein the coupling activator is selected from the group consisting of 4,5-dicyanoimidazole (DCI), 4-alkylthioimidazole, 2- alkylthioimidazole, 2-nitroimidazole, 4-nitroimidazole, 4,5-dihaloimidazole, 4- haloimidazole, 2-haloimidazole and 5 -alkoxy tetrazole.

38. The method of claim 32, wherein the coupling activator comprises DCI.

39. The method of claim 38, wherein the DCI is dissolved in acetonitrile.

40. The method of claim 35, wherein the concentration of DCI in acetonitrile is between 0.1 and 1.2 M.

41. The method of claim 32, wherein the nucleotide is bound to a solid support.

42. The method of claim 41, wherein the solid support is selected from the group consisting of controlled pore glass, polystyrene beads, and polystyrene -polyethylene glycol copolymer support.

43. The method of claim 32, wherein the phosphoramidite coupling chemistry is performed in the liquid phase.

44. A solution of DCI in acetonitrile, wherein the concentration of DCI is between 0.5 and 1.5 M.