WO2015171603A1

WO2015171603A1 - Methods for producing plants with enhanced resistance to oomycete pathogens

Info

Publication number: WO2015171603A1
Application number: PCT/US2015/029230
Authority: WO
Inventors: Sophien KAMOUN; Mireille Van Damme
Original assignee: Two Blades Foundation
Priority date: 2014-05-06
Filing date: 2015-05-05
Publication date: 2015-11-12

Abstract

Methods and compositions for enhancing the resistance of plants to oomycete plant pathogens are provided. The methods involve decreasing the expression level and/or activity of Crinkle 8 Kinase Like (CKL), which is upregulated in the host plant in response to an infection by one or more oomycete plant pathogens. Compositions comprise non-transgenic and transgenic plants and plant cells with reduced expression levels and/or activity of CKL in the plant or part thereof when compared to a control plant. Additionally provided are methods for using the plants in agriculture to limit diseases caused by oomycete plant pathogens.

Description

METHODS FOR PRODUCING PLANTS WITH ENHANCED RESISTANCE TO

OOMYCETE PATHOGENS

CROSS-REFERENCE TO RELATED APPLICATION

This application claims the benefit of U.S. Provisional Application No. 61/989, 192, filed May 6, 2014, which is hereby incorporated herein in its entirety by reference. REFERENCE TO A SEQUENCE LISTING SUBMITTED

AS A TEXT FILE VIA EFS WEB

The official copy of the sequence listing is submitted electronically via EFS-Web as an ASCII formatted sequence listing with a file named 070294-0082SEQLIST.TXT, created on May 2, 2015, and having a size of 507 kilobytes, and is filed concurrently with the specification. The sequence listing contained in this ASCII formatted document is part of the specification and is herein incorporated by reference in its entirety.

FIELD OF THE INVENTION

The present invention relates to the field of plant improvement, particularly to methods for making and using plants with enhanced resistance to oomycete pathogens.

BACKGROUND OF THE INVENTION

Effector molecules produced by infectious microbes are known to suppress plant defenses, alter plant metabolism or manipulate host development in favor of pathogen growth (Hogenhout, S. A., et al, 2009, Mol. Plant Microbe Interact. 22(2): 115-122). Although the effector is encoded in the pathogen genome, it traffics into the host to function inside the plant cellular environment (Whisson, S. C, et ah, 2001 , Nature. 450(7166): 1 15-118; Schornack, S., et al, 2010, Proc Natl Acad Sci USA. 107(40): 17421-17426). Effectors that mimic specific plant processes have been observed for several pathogen systems. Some pathogens secrete effectors that are analogs or mimics of plant hormones (Hogenhout, S. A., et ah, 2009, Mol. Plant Microbe Interact. 22(2): 1 15-122). Others, such as the bacterial ubiquitin ligase AvrPtoB, mimic plant enzymes (Abramovitch, R. B., et ah, 2006, Proc Natl Acad Sci USA 103(8): 2851-2856).

Oomycetes, such as Phytophthora infestans, secrete an arsenal of effector proteins that modulate plant innate immunity to enable infection (Schornack, S., et ah, 2010, Proc Natl Acad Sci USA. 107(40): 17421-17426). Phytophthora infestans is the causal agent of late blight on potato and tomato. Most of the host-translocated (cytoplasmic) effectors from P. infestans lack similarity to known proteins and have uncharacterized biochemical activities. One exception is the effector AVR3b from Phytophthora sojae. The C-terminus of AVR3b contains a Nudix hydrolase motif and this motif might mimic plant Nudix hydrolases, which are known to act as negative regulators of plant immunity (Dong, S., et ah, 2011, PLoS Pathog. 7(1 1): el002353).

New strategies for producing crop plants with enhanced resistance to P. infestans and other oomycete pathogens may result from gaining a better understanding of the host- pathogen interactions. Therefore studying the interaction of pathogen effectors with the host plant should provide useful insights and possibly lead to new strategies for enhancing the resistance of host plants to oomycete pathogens.

BRIEF SUMMARY OF THE INVENTION

Methods are provided for enhancing the resistance of plants to oomycete pathogens such as, for example, the economically devastating plant pathogen, Phytophthora infestans. The methods involve decreasing the expression level and/or activity of Crinkle 8 Kinase Like (CKL) in the plant or part thereof. The expression level and/or activity of CKL can be decreased in the host plant or part thereof by, for example, introducing into at least one plant cell a disruption of the Ckl gene or by introducing into at least one plant cell a polynucleotide construct comprising a transcribed region encoding a modified CKL protein or a transcribed region designed to produce a transcript capable of reducing the level of CKL in the plant cell. Such methods can comprise, for example, a disruption of Ckl by introducing a DNA insertion, by introducing a DNA deletion or by introducing a transcribed region comprising a nucleotide sequence that is designed for post-transcriptional gene silencing or antisense- mediated gene silencing, such as, for example, an miRNA, an siR A, an hpR A or a dsR A. If desired, the plant can be regenerated into a transgenic plant.

Methods are also provided for producing plants with enhanced resistance to one or more oomycete plant pathogens. Such methods comprise, for example, introducing a DNA insertion, substitution, or a deletion into the Ckl gene or stably incorporating in the genome of at least one plant cell a polynucleotide construct comprising a promoter that is expressible in a plant cell operably linked to a transcribed region wherein the transcribed region encodes a modified CKL protein or the transcribed region is designed to produce a transcript for gene silencing of a plant Ckl gene.

Further provided are non-trans genie and transgenic plants and plant cells and methods of using such plants in agricultural crop production to limit diseases caused by oomycete pathogens.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 depicts a Phylogenetic tree of the kinase domains of Phytophthora infestans CRN8 and the CKL plant homologs based on amino acid sequences. The amino acid sequences that are taken into account are presented as an alignment in Figure 2.

Figure 2A and B shows alignment of z^'_CRN8 and plant CKL kinase domain homologs. The kinase domains of P. infestans and the different plant CKL homologs were aligned; the RD site is indicated below and included in the box. Previously identified phosphorylated sites in the z^'_CRN8 sequence are indicated by the asterisks below the sequence, the amino acid site is indicated by the number.

Figure 3 demonstrates that tomato CKL is upregulated during biotrophic phase of the Phytophthora infestans infection. (A) Time course of tomato leaves infected with

Phytophthora infestans. The gel electrophoresis image shows Sl_Ckl transcripts from tomato leaves, 1 and 4 days post mock inoculation and 1, 2, 3 and 4 days post Phytophthora infestans infection. (B) The gel electrophoresis image shows Sl_Gph transcripts from tomato leaves, 1 and 4 days post mock inoculation and 1, 2, 3 and 4 days post Phytophthora infestans infection. Sl_Gph transcripts are used as a loading control and show that all samples contain RNA.

Figure 4 shows Arabidopsis Ckl is required for oomycete pathogenicity. (A) The Arabidopsis Ckl gene (AT5G51800) encodes four exons, indicated as black boxes. Four different alleles are indicated, ckll-1, ckl 1-2, ckll-3 and ckl 1-4, all four contain a T-DNA insertion (gray boxes) that is located in the 5'UTR, exonl, exon 2 and intron 2, respectively. (B) Quantification of Hyaloperonospora arabidopsidis spores isolate Waco9 on Col-0, Ler, and the four independent ckl mutant alleles. Five plants per line were tested and spores were quantified 5 days post infection.

Figure 5 demonstrates overexpression of At_Ckl increases oomycete growth.

Quantification oi Hyaloperonospora arabidopsidis spores isolate Waco9 on Col-0 and three independent At_Ckl overexpressing transgenic lines. Five plants per line were tested and spores were quantified 5 days post infection.

Figure 6 shows Phytophthora infestans CRN8 associates with Arabidopsis CKL. (A) Overview of the different combinations of Agrobacterium-mediated co-expressed proteins in N. benthamiana leaves. (B) Western blot of GFP:^?_CKL protein from GFP immuno- purified protein samples probed with GFP antibody. (C) Western blot of FLAG:CRN8 Pto- 3HAF protein inputs probed with FLAG antibody. (D) Co-immunoprecipitation of

FLAG: z^'_CRN8 in GFP immuno-purified protein samples on a Western blot probed with FLAG antibody. (E) Coomassie stain indicating equal loading of protein on Western blot in Fig. 6D.

Figure 7 demonstrates overexpression of Phytophthora infestans CR]\[g^R469AD470A decreases oomycete pathogenicity. Quantification of Hyaloperonospora arabidopsidis spores isolate Waco9 on Col edsl-2, and two independent /_CR 8^R469AD470A overexpressing transgenic lines. Five plants per line were tested and spores were quantified 5 days post infection.

Figure 8 shows Phytophthora infestans CR 8^D470N, CRN8^R469AD470A, CR 8^5xStoA destabilize Arabidopsis CKL. (A) Overview of the different combinations oi Agrobacterium- mediated co-expressed proteins in N. benthamiana leaves. (B) Western blot of GFP:^?_CKL from crude protein extracts probed with GFP antibody. (C) Coomassie stain indicating equal loading of protein on Western blot depicted in figure 8B. (D) Western blot of

FLAG: i_CRN8, FLAG: _CR 8^D470N, FLAG: _CR 8^R469AD470A, FLAG: _CR 8^3xStoA and FLAG: _CRN8^5xStoA from crude protein extracts probed with FLAG antibody. (E) Coomassie stain indicating equal loading of protein on Western blot depicted in figure 8D.

SEQUENCE LISTING

The nucleotide and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three-letter code for amino acids. The nucleotide sequences follow the standard convention of beginning at the 5' end of the sequence and proceeding forward (i.e., from left to right in each line) to the 3' end. Only one strand of each nucleotide sequence is shown, but the complementary strand is understood to be included by any reference to the displayed strand. The amino acid sequences follow the standard convention of beginning at the amino terminus of the sequence and proceeding forward (i.e., from left to right in each line) to the carboxy terminus.

SEQ ID NO: 1 sets forth the amino acid sequence of the kinase domain of CKL from

Ricinus communis (Rc, castor bean).

SEQ ID NO:2 sets forth the amino acid sequence of the kinase domain of CKL from Populus trichocarpa (Pt, black cottonwood).

SEQ ID NO:3 sets forth the amino acid sequence of the kinase domain of CKL from Vitis vinifera (Vv, grapevine).

SEQ ID NO:4 sets forth the amino acid sequence of the kinase domain of CKL from Solatium lycopersicum (SI, tomato).

SEQ ID NO:5 sets forth the amino acid sequence of the kinase domain of CKL from Glycine max (Gm, soybean).

SEQ ID NO:6 sets forth the amino acid sequence of the kinase domain of CKL from

Arabidopsis thaliana (At).

SEQ ID NO:7 sets forth the amino acid sequence of the kinase domain of CKL from Physcomitrella patens (Pp, moss).

SEQ ID NO:8 sets forth the amino acid sequence of the kinase domain of CKL from Seiagineiia moellendorffli (Sm, lycophyte).

SEQ ID NO:9 sets forth the amino acid sequence of the kinase domain of CRN8 from Phytophthora infestans (Pi).

SEQ ID NO: 10 sets forth the nucleotide sequence encoding the wild-type CKL protein from Arabidopsis thaliana.

SEQ ID NO: 11 sets forth the amino acid sequence of the wild-type CKL protein from

Arabidopsis thaliana.

SEQ ID NO: 12 sets forth the nucleotide sequence encoding the wild-type CRN8 protein from Phytophthora infestans.

SEQ ID NO: 13 sets forth the amino acid sequence of the wild-type CRN8 protein from Phytophthora infestans.

SEQ ID NO: 14 sets forth the nucleotide sequence of the mutant ckl\-\ allele (SAIL_740_E05).

SEQ ID NO: 15 sets forth the nucleotide sequence of the mutant ckll-2 allele (SAIL_1 185_H03). SEQ ID NO: 16 sets forth the nucleotide sequence of the mutant ckll-3 allele (SALKJ00819).

SEQ ID NO: 17 sets forth the nucleotide sequence of the mutant ckll-4 allele (SALK_063450).

SEQ ID NO: 18 sets forth the nucleotide sequence of a PCR primer to amplify tomato CKL: Tom_CRN8_SilF_MvD.

SEQ ID NO: 19 sets forth the nucleotide sequence of a PCR primer to amplify tomato CKL: Tom_CRN8_SilRl_MvD.

SEQ ID NO:20 sets forth the nucleotide sequence of a PCR primer to amplify tomato G3P: G3P F TB.

SEQ ID NO:21 sets forth the nucleotide sequence of a PCR primer to amplify tomato G3P: G3P R TB.

SEQ ID NO:22 sets forth the nucleotide sequence of a primer to amplify the full length Arabidopsis At_Ckl amplicons: AT_CRN 8_pENTR_F .

SEQ ID NO:23 sets forth the nucleotide sequence of a primer to amplify the full length Arabidopsis At_Ckl amplicons: AT_CRN8_pENTR_R.

SEQ ID NO:24 sets forth the nucleotide sequence of a CKL homolog from Ricinus communis.

SEQ ID NOS:25 and 26 each set forth a nucleotide sequence of a CKL homolog from Populus trichocarpa.

SEQ ID NO:27 sets forth the nucleotide sequence of a CKL homolog from Vitus vinifera.

SEQ ID NO:28 sets forth the nucleotide sequence of a CKL homolog from Solanum ly coper sicum.

SEQ ID NOS:29 and 30 each set forth a nucleotide sequence of a CKL homolog from Glycine max.

SEQ ID NOS:31, 32, 33 and 34 each set forth a nucleotide sequence of a CKL homolog from Physcomitrella patens.

SEQ ID NOS:35, 36 and 37 each set forth a nucleotide sequence of a CKL homolog from Seiagineiia moellendorffli.

SEQ ID NO:38 sets forth the nucleotide sequence of a CKL homolog from Solanum tuberosum.

SEQ ID NOS:39 and 40 each set forth a nucleotide sequence of a CKL homolog from Cucumis sativus. SEQ ID NO:41 sets forth the nucleotide sequence of a CKL homolog from

Arabidopsis lyrata.

SEQ ID NO:42 sets forth the nucleotide sequence of a CKL homolog from Carica papaya.

SEQ ID NO:43 sets forth the nucleotide sequence of a CKL homolog from Prunus persica.

SEQ ID NO:44 sets forth the nucleotide sequence of a CKL homolog from Manihot esculenta.

SEQ ID NO:45 sets forth the nucleotide sequence of a CKL homolog from Citrus sinensis.

SEQ ID NO:46 sets forth the nucleotide sequence of a CKL homolog from Eutrema salsugineum.

SEQ ID NO:47 sets forth the nucleotide sequence of a CKL homolog from Citrus Clementina.

SEQ ID NO:48 sets forth the nucleotide sequence of a CKL homolog from Capsella rubella.

SEQ ID NO:49 sets forth the nucleotide sequence of a CKL homolog from Aquilegia caerulea.

SEQ ID NOS:50 and 51 each set forth a nucleotide sequence of a CKL homolog from Malus x domestica.

SEQ ID NOS:52 and 53 each set forth a nucleotide sequence of a CKL homolog from Brassica rapa.

SEQ ID NO: 54 sets forth the nucleotide sequence of a CKL homolog from Volvox carteri.

SEQ ID NO:55 and 56 each set forth a nucleotide sequence of a CKL homolog from

Linum usitatissimum.

SEQ ID NO:57 sets forth the nucleotide sequence of a CKL homolog from

Eucalyptus grandis.

SEQ ID NOS:58 and 59 each set forth a nucleotide sequence of a CKL homolog from Gossypium raimondii.

SEQ ID NO:60 sets forth the nucleotide sequence of a CKL homolog from Phaseolus vulgaris.

SEQ ID NO:61 sets forth the nucleotide sequence of a CKL homolog from Fragaria vesca. SEQ ID NO: 62 sets forth the nucleotide sequence of a CKL homolog from

Theobroma cacao.

SEQ ID NOS:63, 64, 65, 66 and 67 each set forth a nucleotide sequence of a CKL homolog from Chlamydomonas reinhardtii.

SEQ ID NO:68 sets forth the amino acid sequence of a CKL homolog from Ricinus communis.

SEQ ID NOS:69 and 70 each set forth a amino acid sequence of a CKL homolog from Populus trichocarpa.

SEQ ID NO:71 sets forth the amino acid sequence of a CKL homolog from Vitus vinifera.

SEQ ID NO:72 sets forth the amino acid sequence of a CKL homolog from Solatium lycopersicum.

SEQ ID NOS:73 and 74 each set forth a amino acid sequence of a CKL homolog from Glycine max.

SEQ ID NOS:75, 76, 77 and 78 each set forth a amino acid sequence of a CKL homolog from Physcomitrella patens.

SEQ ID NOS:79, 80 and 81 each set forth a amino acid sequence of a CKL homolog from Selaginella moellendorffli.

SEQ ID NO:82 sets forth the amino acid sequence of a CKL homolog from Solanum tuberosum.

SEQ ID NOS:83 and 84 each set forth a amino acid sequence of a CKL homolog from Cucumis sativus.

SEQ ID NO:85 sets forth the amino acid sequence of a CKL homolog from

Arabidopsis lyrata.

SEQ ID NO:86 sets forth the amino acid sequence of a CKL homolog from Carica papaya.

SEQ ID NO:87 sets forth the amino acid sequence of a CKL homolog from Prunus persica.

SEQ ID NO:88 sets forth the amino acid sequence of a CKL homolog from Manihot esculenta.

SEQ ID NO:89 sets forth the amino acid sequence of a CKL homolog from Citrus sinensis.

SEQ ID NO:90 sets forth the amino acid sequence of a CKL homolog from Eutrema salsugineum. SEQ ID NO:91 sets forth the amino acid sequence of a CKL homolog from Citrus Clementina.

SEQ ID NO:92 sets forth the amino acid sequence of a CKL homolog from Capsella rubella.

SEQ ID NO:93 sets forth the amino acid sequence of a CKL homolog from Aquilegia caerulea.

SEQ ID NOS:94 and 95 each set forth a amino acid sequence of a CKL homolog from

Malus x domestica.

SEQ ID NOS:96 and 97 each set forth a amino acid sequence of a CKL homolog from Brassica rapa.

SEQ ID NO:98 sets forth the amino acid sequence of a CKL homolog from Volvox carteri.

SEQ ID NO:99 and 100 each set forth a amino acid sequence of a CKL homolog from Linum usitatissimum .

SEQ ID NO: 101 sets forth the amino acid sequence of a CKL homolog from

Eucalyptus grandis.

SEQ ID NOS: 102 and 103 each set forth a amino acid sequence of a CKL homolog from Gossypium raimondii.

SEQ ID NO: 104 sets forth the amino acid sequence of a CKL homolog from

Phaseolus vulgaris.

SEQ ID NO: 105 sets forth the amino acid sequence of a CKL homolog from Fragaria vesca.

SEQ ID NO: 106 sets forth the amino acid sequence of a CKL homolog from

Theobroma cacao.

SEQ ID NOS: 107, 108, 109, 1 10 and 11 1 each set forth a amino acid sequence of a

CKL homolog from Chlamydomonas reinhardtii.

DETAILED DESCRIPTION OF THE INVENTION

The present inventions now will be described more fully hereinafter with reference to the accompanying drawings, in which some, but not all embodiments of the inventions are shown. Indeed, these inventions may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein; rather, these embodiments are provided so that this disclosure will satisfy applicable legal requirements. Like numbers refer to like elements throughout. Many modifications and other embodiments of the inventions set forth herein will come to mind to one skilled in the art to which these inventions pertain having the benefit of the teachings presented in the foregoing descriptions and the associated drawings. Therefore, it is to be understood that the inventions are not to be limited to the specific embodiments disclosed and that modifications and other embodiments are intended to be included within the scope of the appended claims. Although specific terms are employed herein, they are used in a generic and descriptive sense only and not for purposes of limitation.

Provided herein is the identification of a plant gene, Crinkle 8 kinase like (Ckl) that enhances oomycete pathogenicity. The Ckl gene encodes a serine/threonine RD kinase that carries a homologous domain of the Phytophthora infestans (P. infestans) CRN 8 effector protein. CRN8 is also a serine/threonine RD kinase that is translocated from the pathogen into the host plant cell and it enhances the virulence of P. infestans (Van Damme, M., et al, 2012, PLoS Pathog. 8(8): el002875). Homologs from the kinase domain of CR 8 and CKL are present in multiple plant species. Provided herein is the discovery that infection with the oomycete P. infestans induces the expression of the Ckl gene in the infected plant and that the CKL protein associates with the CRN8 effector protein from P. infestans. The inventors discovered that CKL is an important factor contributing to the pathogenicity of oomycete pathogens.

The present invention provides methods for enhancing the resistance of a plant to an oomycete plant pathogen. The methods comprise decreasing the expression level and/or activity of CKL in the plant or part thereof.

The methods provided herein do not depend on a particular method for decreasing the expression level and/or activity of CKL in the host plant or part thereof. Any method or methods of decreasing the expression level and/or activity of a protein in a plant or plant cell that are known in the art or otherwise disclosed herein can be used in the methods of the present invention. Such methods include, for example, gene disruption, targeted

mutagenesis, homologous recombination, mutation breeding, transgenic expression of a gene silencing element, and post-transcriptional gene silencing.

In one embodiment, the method of decreasing the expression level and/or activity of CKL in a plant or part thereof comprises introducing into at least one plant cell a disruption of the Ckl gene. Such a disruption decreases the expression level and/or activity of CKL in the plant cell as compared to a corresponding control plant cell lacking the disruption of the Ckl gene. As used herein, by "disrupt", "disrupted" or "disruption" is meant any disruption of a gene such that the disrupted gene is incapable of directing the efficient expression of a full- length fully functional gene product. The term "disrupt", "disrupted" or "disruption" also encompasses that the disrupted gene or one of its products can be functionally inhibited or inactivated such that a gene is either not expressed or is incapable of efficiently expressing a full-length and/or fully functional gene product. Functional inhibition or inactivation can result from a structural disruption and/or interruption of expression at either the level of transcription or translation. Disruption can be achieved, for example, by at least one mutation or structural alteration, genomic disruptions (e.g. DNA insertion, DNA deletion, transposons, tilling, homologous recombination, etc.), gene silencing elements, RNA interference, RNA silencing elements or antisense constructs. The decrease of expression and/or activity can be measured by determining the presence and/or amount of transcript (e.g. by Northern blotting or RT-PCR techniques), by determining the presence and/or amount of full-length or truncated polypeptide encoded by the disrupted gene (e.g. by ELISA or Western blotting), or by determining the presence and/or amount of CKL activity (e.g. by kinase activity assay or by determining oomycete pathogenicity) in the plant or part thereof with the disrupted Ckl gene as compared to a control plant lacking the disrupted Ckl gene. As used herein, it is also to be understood that "disruption" also encompasses a disruption which is effective only in a part of a plant, in a particular cell type or tissue. A disruption may be achieved by interacting with or affecting within a coding region, within a non-coding region, and/or within a regulatory region, for example, a promoter region.

In one embodiment the disruption of Ckl comprises a DNA insertion of at least one base pair. In some cases, the DNA insertion can be in the Ckl gene. The DNA insertion can comprise insertion of any size DNA fragment into the genome. The inserted DNA can be 1 nucleotide (nt) in length, 1 -5 nt in length, 5- 10 nt in length, 10-15 nt in length, 15-20 nt in length, 20-30 nt in length, 30-50 nt in length, 50-100 nt in length, 100-200 nt in length, 200- 300 nt in length, 300-400 nt in length, 400-500 nt in length, 500-600 nt in length, 600-700 nt in length, 700-800 nt in length, 800-900 nt in length, 900- 1000 nt in length, 1000- 1500 nt in length or more such that the inserted DNA decreases the expression level and/or activity of CKL. The DNA can be inserted within any region of the Ckl gene, including for example, exons, introns, promoter, 3'UTR or 5'UTR as long as the inserted DNA decreases the expression level and/or activity of CKL. In some embodiments the DNA can be inserted in the 5' UTR of the Ckl gene, in an exon of the Ckl gene or in an intron of the Ckl gene. In specific embodiments, the DNA insertion can be in exon 1 of the Ckl gene, in exon 2 of the Ckl gene, or in intron 2 of the Ckl gene. The DNA to be inserted can be introduced to a plant cell by any method known in the art, for example, by using Agrobacterium-mQdiatQd recombination or biolistics. In a specific embodiment, the DNA insertion comprises a T-DNA insertion. Methods of making T-DNA insertion mutants are well known in the art.

In specific embodiments the Ckl gene comprising the DNA insertion comprises the nucleotide sequence set forth in SEQ ID NO: 14, the nucleotide sequence set forth in SEQ ID NO: 15, the nucleotide sequence set forth in SEQ ID NO: 16, the nucleotide sequence set forth in SEQ ID NO: 17 or a nucleotide sequence having at least 90% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 or SEQ ID NO: 17. In another embodiment, the Ckl gene comprising inserted DNA comprises a nucleotide sequence having at least 95% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 or SEQ ID NO: 17.

The disruption of the Ckl gene can also comprise a deletion in the Ckl gene. As used herein, a "deletion" is meant the removal of one or more nucleotides or base pairs from the DNA. Provided herein, a deletion in the Ckl gene can be the removal of at least 1, at least 20, at least 50, at least 100, at least 500, at least 1000, at least 5000 or more base pairs or nucleotides such that the deletion decreases the expression level and/or activity of CKL. In some cases, the entire gene can be deleted. In one embodiment, a disruption in the Ckl gene comprises deletion of at least one base pair from the Ckl gene. The DNA deletion can be within any region of the Ckl gene, including, for example, exons, introns, promoter, 3' UTR or 5'UTR as long as the deletion decreases the expression level and/or activity of CKL. The DNA deletion can be by any method known in the art, for example, by genome editing techniques as described elsewhere herein.

In other embodments, the disruption of the Ckl gene can comprise a substition in the Ckl gene. As used herein, a "substitution" is meant the replacement of one or more nucleotides or base pairs from the DNA with non-identical nucleotides or base pairs. When the substitution comprises two or more nucleotides, the two or more nucleotides can be contiguous or non-contiguous within the Ckl gene. Provided herein, a substitution in the Ckl gene can be the replacement of at least 1, at least 20, at least 50, at least 100, at least 500, at least 1000, at least 5000 or more base pairs or nucleotides such that the substition decreases the expression level and/or activity of CKL. In one embodiment, a substitution in the Ckl gene comprises replacement of at least one base pair from the Ckl gene with a non-identical base pair. The DNA substitution can be within any region of the Ckl gene, including, for example, exons, introns, promoter, 3' UTR or 5'UTR as long as the substitution decreases the expression level and/or activity of CKL. The DNA substitution can be by any method known in the art, for example, by genome editing techniques as described elsewhere herein. In some cases, the disruption of the Ckl gene is a homozygous disruption. By

"homozygous" is meant that the disruption is in both copies of the Ckl gene. In other cases, the disruption of the Ckl gene is heterozygous, that is, the disruption is only in one copy of the Ckl gene.

In another embodiment, decreasing the expression level and/or activity of CKL in a plant or part thereof comprises introducing a polynucleotide construct comprising a nucleotide sequence encoding a modified CKL protein into at least one plant cell such that when expressed, the modified CKL enhances the resistance of the plant or part thereof to an oomycete plant pathogen. In such methods, the polynucleotide comprises a promoter operably linked to a transcribed region, wherein the promoter is expressible in a plant cell and the transcribed region encodes a modified CKL protein. The modified CKL can comprise any modification in the nucleotide sequence encoding CKL such that the modification results in a decrease in the expression level and/or activity of CKL in the plant or plant part. For example, modifications can be introduced in the kinase domain of CKL such that the kinase activity of the CKL protein is decreased or inhibited. In other instances, the modified CKL protein has a decreased ability to associate with plant pathogen effector proteins, thereby enhancing the resistance of the plant or part thereof to an oomycete plant pathogen. In one embodiment, the modified CKL has a decreased ability to associate with a CRN8 effector. In a specific embodiment, the CRN8 effector is from P. infestans.

In yet another embodiment, decreasing the expression level or activity of CKL in a plant or part thereof comprises introducing a polynucleotide construct into at least one plant cell. The polynucleotide construct can comprise a promoter expressible in a plant cell operably linked to a transcribed region. The transcribed region comprises a nucleotide sequence that is designed to produce a transcript for the post-transcriptional gene silencing or antisense mediated gene silencing of CKL, when the transcribed region is expressed in a plant cell. Such a transcribed region for the post-transcriptional gene silencing or antisense mediated gene silencing of CKL is designed using any of the methods known in the art or described herein below. In general, the transcribed region will be sufficiently identical to all or to one or more fragments of the transcript of CKL and/or to the complement of the transcript produced in the plant or plant cell. While it is recognized that the degree of identity between the transcribed region and the CKL transcript or a fragment or fragments of the CKL transcript will vary depending on a number of factors such as, for example, the particular post-transcriptional gene silencing method utilized, the base composition of the nucleotide sequence of the CKL construct, and the length (i.e., number of nucleotides) of the transcribed region, a transcribed region that is sufficiently identical to all or to one or more fragments of the CKL transcript and/or complement(s) thereof will have at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to all or to one or more fragments of the CKL transcript and/or complement(s) thereof.

Post-transcriptional gene silencing is the silencing or suppression of the expression of a gene that results from the mRNA of a particular gene being degraded or blocked. The degradation of the mRNA prevents translation to form an active gene product, typically a protein. The blocking of the gene occurs through the activity of silencers, which bind to repressor regions. Any method for the post-transcriptional gene silencing that is known in the art can be used in the methods of the present invention to decrease the level of CKL in a plant or part thereof. Some methods of post-transcriptional gene silencing are further described herein below including, for example, antisense suppression, sense suppression (also known as cosuppression), double-stranded RNA (dsRNA) interference, hairpin RNA

(hpRNA) interference or intron-containing hairpin RNA (ihpRNA) interference, micro RNA (miRNA) interference, small interfering RNA (siRNA) interference. In specific

embodiments, the method for post-transcriptional gene silencing comprises an miRNA, an siRNA, an hpRNA or a dsRNA.

Any methods known in the art for modifying DNA in the genome of a plant can be used to alter or disrupt the coding sequences of the Ckl gene in planta. Such methods include genome editing techniques, such as, for example, methods involving targeted mutagenesis, homologous recombination, and mutation breeding. Targeted mutagenesis or similar techniques are disclosed in U.S. Patent Nos. 5,565,350; 5,731, 181 ; 5,756,325; 5,760,012; 5,795,972 and 5,871,984; all of which are herein incorporated in their entirety by reference. Methods for gene modification or gene replacement involving homologous recombination can involve inducing double breaks in DNA using zinc-finger nucleases (ZFN), TAL (transcription activator-like) effector nucleases (TALEN), Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR-associated nuclease (CRISPR/Cas nuclease), or homing endonucleases that have been engineered endonucleases to make double-strand breaks at specific recognition sequences in the genome of a plant, other organism, or host cell. See, for example, Durai et al, (2005) Nucleic Acids Res 33:5978-90; Mani et al. (2005) Biochem Biophys Res Comm 335:447-57; U.S. Pat. Nos. 7,163,824, 7,001,768, and 6,453,242;

Arnould et al (2006) JMol Biol 355:443-58; Ashworth et al, (2006) Nature 441 :656-9; Doyon et al. (2006) J Am Chem Soc 128:2477-84; Rosen et al, (2006) Nucleic Acids Res 34:4791-800; and Smith et al, (2006) Nucleic Acids Res 34:el49; U.S. Pat.App. Pub. No. 2009/0133152; and U.S. Pat. App. Pub. No. 2007/0117128; all of which are herein incorporated in their entirety by reference.

TAL effector nucleases (TALENs) can be used to make double-strand breaks at specific recognition sequences in the genome of a plant for gene modification or gene replacement through homologous recombination. TAL effector nucleases are a class of sequence-specific nucleases that can be used to make double-strand breaks at specific target sequences in the genome of a plant or other organism. TAL effector nucleases are created by fusing a native or engineered transcription activator-like (TAL) effector, or functional part thereof, to the catalytic domain of an endonuclease, such as, for example, Fokl. The unique, modular TAL effector DNA binding domain allows for the design of proteins with potentially any given DNA recognition specificity. Thus, the DNA binding domains of the TAL effector nucleases can be engineered to recognize specific DNA target sites and thus, used to make double-strand breaks at desired target sequences. See, WO 2010/079430; Morbitzer et al. (2010) PNAS 10.1073/pnas.l013133107; Scholze & Boch (2010) Virulence 1 :428-432; Christian et al. Genetics (2010) 186:757-761; Li et al. (2010) Nuc. Acids Res. (2010) doi: 10.1093/nar/gkq704; and Miller et al. (2011) Nature Biotechnology 29: 143-148; all of which are herein incorporated by reference.

The CRISPR/Cas nuclease system can also be used to make double-strand breaks at specific recognition sequences in the genome of a plant for gene modification or gene replacement through homologous recombination. The CRISPR/Cas nuclease is an RNA- guided (simple guide RNA, sgRNA in short) DNA endonuclease system performing sequence-specific double-stranded breaks in a DNA segment homologous to the designed RNA. It is possible to design the specificity of the sequence (Cho S.W. et al, Nat.

Biotechnol. 31:230-232, 2013; Cong L. et al, Science 339:819-823, 2013; Mali P. et al., Science 339:823-826, 2013; Feng Z. et al, Cell Research: 1-4, 2013).

In addition, a ZFN can be used to make double-strand breaks at specific recognition sequences in the genome of a plant for gene modification or gene replacement through homologous recombination. The Zinc Finger Nuclease (ZFN) is a fusion protein comprising the part of the Fokl restriction endonuclease protein responsible for DNA cleavage and a zinc finger protein which recognizes specific, designed genomic sequences and cleaves the double-stranded DNA at those sequences, thereby producing free DNA ends (Urnov F.D. et al, Nat Rev Genet. 11:636-46, 2010; Carroll D., Genetics. 188:773-82, 2011). Breaking DNA using site specific nucleases, such as, for example, those described herein above, can increase the rate of homologous recombination in the region of the breakage. Thus, coupling of such effectors as described above with nucleases enables the generation of targeted changes in genomes which include additions, deletions and other modifications.

Mutation breeding can also be used in the methods and compositions provided herein. Mutation breeding methods can involve, for example, exposing the plants or seeds to a mutagen, particularly a chemical mutagen such as, for example, ethyl methanesulfonate (EMS) and selecting for plants that possess a desired modification in the Ckl gene. However, other mutagens can be used in the methods disclosed herein including, but not limited to, radiation, such as X-rays, Gamma rays (e.g., cobalt 60 or cesium 137), neutrons, (e.g., product of nuclear fission by uranium 235 in an atomic reactor), Beta radiation (e.g., emitted from radioisotopes such as phosphorus 32 or carbon 14), and ultraviolet radiation (preferably from 2500 to 2900 nm), and chemical mutagens such as base analogues (e.g., 5-bromo- uracil), related compounds (e.g., 8-ethoxy caffeine), antibiotics (e.g., streptonigrin), alkylating agents (e.g., sulfur mustards, nitrogen mustards, epoxides, ethylenamines, sulfates, sulfonates, sulfones, lactones), azide, hydroxylamine, nitrous acid, or acridines. Further details of mutation breeding can be found in "Principals of Cultivar Development" Fehr, 1993 Macmillan Publishing Company the disclosure of which is incorporated herein by reference.

The methods for making modified CKL proteins that enhance resistance of a plant or plant part to an oomycete pathogen can comprise altering the coding sequence of the CKL protein, whereby the altered coding sequence encodes an amino acid sequence that comprises at least one amino acid substitution when compared to the amino acid sequence of the unmodified CKL protein. The coding sequence can be altered, for example, by making a targeted change in one or more nucleotides in the coding sequence (i.e., site directed mutagenesis) or by random mutagenesis. If desired, the altered coding sequences can then be used in assays for determining if the protein encoded thereby enhances the resistance of a plant or plant part to an oomycete pathogen. Similarly, the altered coding sequences can then be used in assays for determining if the protein encoded thereby enhances the resistance of a plant or plant part to an oomycete pathogen. The present invention does not depend on particular methods of determining whether the proteins encoded by the altered coding sequences are capable of enhancing the resistance of a plant or plant part to an oomycete pathogen. Various assays for determining resistance of a plant or plant part to an oomycete pathogen are known in the art and non-limiting examples of such assays are provided in the Example section elsewhere herein.

The methods of the present invention can comprise decreasing the expression level and/or activity of an endogenous or native Ckl gene in a plant or cell thereof using any method disclosed herein or otherwise known in the art. Such methods of decreasing the expression level and/or activity of a gene include, for example, in vivo targeted mutagenesis, homologous recombination, and mutation breeding. In one embodiment of the methods of the present invention, the expression of an endogenous or native Ckl gene is eliminated in a plant by the replacement of the endogenous or native Ckl gene or part thereof with a polynucleotide encoding a modified CKL protein or part thereof through a method involving homologous recombination as described elsewhere herein. In such an embodiment, the methods can further comprise selfing a heterozygous plant comprising one copy of the polynucleotide and one copy of the endogenous or native Ckl gene and selecting for a progeny plant that is homozygous for the polynucleotide.

Depending on the desired outcome, the polynucleotide constructs of the invention can be stably incorporated into the genome of the plant cell or not stably incorporated into genome of the plant cell. If, for example, the desired outcome is to produce a stably transformed plant with enhanced resistance to one or more oomycete pathogens, then the polynucleotide construct can be, for example, fused into a plant transformation vector suitable for the stable incorporation of the polynucleotide construct into the genome of the plant cell. Typically, the stably transformed plant cell will be regenerated into a transformed plant that comprises in its genome the polynucleotide construct. Such a stably transformed plant is capable of transmitting the polynucleotide construct to progeny plants in subsequent generations via sexual and/or asexual reproduction. Plant transformation vectors, methods for stably transforming plants with an introduced polynucleotide construct and methods for plant regeneration from transformed plant cells and tissues are generally known in the art for both monocotyledonous and dicotyledonous plants or described elsewhere herein.

In other embodiments of the invention in which it is not desired to stably incorporate the polynucleotide construct in the genome of the plant, transient transformation methods can be utilized to introduce the polynucleotide construct into one or more plant cells of a plant. Such transient transformation methods include, for example, viral-based methods which involve the use of viral particles or at least viral nucleic acids. Generally, such viral-based methods involve constructing a modified viral nucleic acid comprising the a polynucleotide construct of the invention operably linked to the viral nucleic acid and then contacting the plant either with a modified virus comprising the modified viral nucleic acid or with the viral nucleic acid or with the modified viral nucleic acid itself. The modified virus and/or modified viral nucleic acids can be applied to the plant or part thereof, for example, in accordance with conventional methods used in agriculture, for example, by spraying, irrigation, dusting, or the like. The modified virus and/or modified viral nucleic acids can be applied in the form of directly sprayable solutions, powders, suspensions or dispersions, emulsions, oil dispersions, pastes, dustable products, materials for spreading, or granules, by means of spraying, atomizing, dusting, spreading or pouring. It is recognized that it may be desirable to prepare formulations comprising the modified virus and/or modified viral nucleic acids before applying to the plant or part or parts thereof. Methods for making pesticidal formulations are generally known in the art or described elsewhere herein.

Methods are also provided for enhancing the resistance of a plant or part thereof to an oomycete pathogen by decreasing expression of an endogenous Ckl gene (for example, SEQ ID NOS: 10 or 24-67) in a plant by topical application of a polynucleotide molecule to the plant or part thereof. In such methods, the expression of an endogenous or native Ckl gene may be reduced by the introduction of ssDNA, dsDNA, ssRNA, dsRNA or RNA/DNA hybrids essentially identical to, or essentially complementary to, a sequence of 18 or more contiguous nucleotides in either the endogenous or native Ckl gene or messenger RNA transcribed from the Ckl gene through direct application with an effective amount of a transferring agent, such as, for example, an organosilicone surfactant, as described in U.S.

Patent Application Publication No. 201 1/0296556, hereby incorporated by reference herein in its entirety.

The methods of the present invention involve decreasing the level of CKL in the host plant or part thereof. While it may be desirable to decrease the level of CKL in the entire plant, typically it will be preferred to decrease the level of CKL in a part or parts of the plant that are under attack or infected by the oomycete pathogen or that are likely to be infected by the oomycete pathogen. Such parts include, but are not limited to, one or more of the following parts of a plant or cell thereof: leaves, stems, shoots, roots, tubers, fruits, flowers, buds, and a cell or cells within any of these plant parts. In certain embodiments of the invention involving the use of a polynucleotide construct comprising a promoter expressible in plant operably linked to a transcribed region, the timing and location of the decrease in the level of CKL will be determined by the selection of the promoter. Promoters that are useful in the methods and plants disclosed herein include, but are not limited to, constitutive, tissue- preferred (e.g. leaf-preferred, root-preferred), pathogen-inducible, wound- inducible, and chemical-regulated promoters. Preferably, the promoters are pathogen-inducible and leaf- preferred promoters. More preferably, the promoters are pathogen-inducible promoters that induce gene expression in response to oomycete pathogens. Even more preferably, the promoters are pathogen-inducible promoters that induce gene expression in response to one or more oomycete pathogens in plant cells, which are at or in the vicinity of the oomycete pathogen. Most preferably, the promoters are pathogen-inducible promoters that induce gene expression beginning early in the response to infection of the plant by an oomycete pathogen, and in plant cells, which are at or in the vicinity of the oomycete pathogen. Such expression early in the response to infection of the plant will preferably be within about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 18, 24 hours after infection of the plant or cell thereof with the oomycete pathogen.

The methods of the present invention involve decreasing the expression level and/or activity of CKL in a plant or part thereof. As used herein, by "decreasing" or " decreased" is meant a decrease in expression level and/or activity of CKL of at least about 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%,

100% or more relative to a corresponding control plant, plant part, or cell which did not have a disruption in the Ckl gene or a polynucleotide construct of the invention introduced.

Generally, the control plant will be identical or nearly identical to the subject plant (i.e., the plant according one of the methods or compositions disclosed herein) and exposed to the same environmental conditions and pathogen(s) expect that the control plant will not be subjected to the method of the invention. For example, in embodiments of the invention comprising producing a subject plant that is stably transformed with a polynucleotide construct of the invention, a control plant is preferably of the same species and typically genetically identical to the subject plant except that the control plant lacks the polynucleotide construct of the invention or contains a control construct that is designed to be non-functional with respect to enhancing disease resistance. Such a control construct might lack a promoter and/or a transcribed region or comprise a transcribed region that is unrelated to CKL.

The expression level of CKL in the plant or part thereof may be determined using standard assays known in the art, for example, by assaying for the level of CKL in the plant. Methods for determining the level of CKL include, for example, immunological methods including Western blot assays or histochemical techniques. The activity of CKL can be determined by various assays known in the art, for example, by performing a kinase assay or by determining the susceptibility of the plant, plant cell or part thereof to an oomycete pathogen as described in detail in the Example section elsewhere herein. A decrease in the activity of CKL can be determined by, for example, a decrease in the ability of CKL to enhance oomycete pathogenicity, a decrease in kinase activity of CKL, a decrease in the ability of CKL to associate with CRN8, or a decrease in expression of CKL in a plant cell, plant or plant part. Assays to measure oomycete pathogenicity, kinase activity, and association of proteins are known in the art and examples of such assays are provided elsewhere herein.

The invention is drawn to compositions and methods for enhancing the resistance of a plant to plant disease (i.e. infection by an oomycete pathogen). By "disease resistance" is intended that the plants avoid the disease symptoms that are the outcome of plant-pathogen interactions. That is, pathogens are prevented from causing plant diseases and the associated disease symptoms, or alternatively, the disease symptoms caused by the pathogen is minimized or lessened. The methods of the present invention find use in producing plants with enhanced resistance to an oomycete plant pathogen when compared to the resistance of a control plant to the oomycete plant pathogen. By "enhanced" is meant the methods of the present invention will enhance or increase the resistance of the subject plant to at least one oomycete pathogen by at least 25%, 50%, 100%, 150%, 200%, 250%, 500% or more when compared to the resistance of a control plant to same one or more oomycete pathogens.

The present invention further provides methods of producing plants with enhanced resistance to an oomycete plant pathogen. In one embodiment, the methods comprise disrupting in a plant cell a Ckl gene, wherein the disruption in the Ckl gene decreases the expression level and/or activity of CKL in the plant cell when compared to a corresponding plant cell lacking the disruption of the Ckl gene. In another embodiment, the methods comprise stably incorporating in the genome of at least one plant cell a polynucleotide construct of the invention as described above comprising a promoter operably linked to a transcribed region, wherein the promoter is expressible in a plant cell. The transcribed region can encode a modified CKL protein, or the transcribed region can be designed to produce a transcript for post-transcriptional gene silencing or antisense mediated gene silencing of CKL. Plants produced by such methods comprise enhanced resistance to one or more oomycete plant pathogens when compared to a control plant.

As used herein, the term "transgenic" refers to a plant that has incorporated nucleic acid sequences, including but not limited to genes, polynucleotides, DNA, RNA, etc., and/or alterations thereto (e.g. mutations, point mutations or the like), which have been introduced into a plant compared to a non-introduced plant. As used herein, the term "non-transgenic" refers to a plant that does not contain foreign or exogenous nucleic acid sequences incorporated into its genome by recombinant DNA methods. In some embodiments of the invention, a non-transgenic plant comprising a disruption in a Ckl gene is produced by mutation breeding involving, for example, the use of chemical mutagen to cause the disruption in the Ckl gene.

Additionally, the present invention provides plants, seeds, and plant cells produced by the methods of present invention and/or comprising a disrupted Ckl gene and/or a polynucleotide construct of the present invention. Also provided are progeny plants and seeds thereof comprising a disrupted Ckl gene or a polynucleotide construct of the present invention.

The present invention also provides fruits, seeds, tubers, and other plant parts produced by the plants and/or progeny plants of the invention as well as food products and other agricultural products produced from such plant parts that are intended to be consumed or used by humans and other animals including, but not limited to pets (e.g., dogs and cats) and livestock (e.g., pigs, cows, chickens, turkeys, and ducks). Other agricultural products include, for example, smoking products produced from tobacco leaves (e.g., cigarettes, cigars, and pipe and chewing tobacco) and food and industrial starch products produced from potato tubers.

The plants of the present invention find use in agriculture, particularly in methods of limiting disease caused by an oomycete pathogen in agricultural crop production, the method comprising planting a plant of the present invention exposing the plant to conditions favorable for growth and development of the plant. Typically, the plant will be grown outdoors but alternatively can be grown in a greenhouse. The methods can further involve harvesting an agricultural product produced by the plant such as, for example, a potato tuber, a tomato fruit, a pepper fruit, or a tobacco leaf.

The methods for enhancing the resistance of a plant to one or more oomycete plant pathogens find use in increasing or enhancing the resistance of plants, particularly agricultural or crop plants, to plant pathogens. The methods of the invention can be used to enhance the resistance of any plant species including monocots and dicots. Preferred plants of the invention include Solanaceous plants, such as, for example, potato (Solarium tuberosum), tomato (Lycopersicon esculentum), eggplant (Solatium melongena), pepper (Capsicum spp.; e.g., Capsicum annuum, C. baccatum, C. chinense, C frutescens, C.

pubescens, and the like), tobacco (e.g. Nicotiana tabacum, Nicotiana benthamiana ), and petunia (Petunia spp., e.g., Petunia x hybrida ox Petunia hybrida). Preferred plants of the invention also include any plants that known to be infected by an oomycete pathogen including, but not limited to, P. infestans and other plant pathogenic Phytophthora species. Preferred plants of the invention that are known to be infected by an oomycete pathogen include, but are not limited to, pea (Pisum sativum), bean (Phaseolus vulgaris), eggplant (Solatium melongena), petunia (Petunia x hybrida), Physalis sp., woody nightshade (Solatium dulcamara), garden huckleberry (Solatium scabrum), gboma eggplant (Solatium macrocarpon), lettuce (Lactuca sativa), the asteraceous weeds, Ageratum conyzoides and Solanecio biafrae, palms, cocoa (Theobroma cacao), lamb's lettuce (Valerianella locusta), spinach (Spinacia oleracea), melons (including Benincasa sp., Citrullus sp., Cucumis sp., momordica sp.), cucumbers (Cucumis sp., including Cucumis sativus), Brassica sp. (including Brassica rapa), squash (Cucurbita sp.), radish (Raphanus sp.), onions (Allium sp.), cucurbits (Cucurbita sp.), hops (Humulus lupulus), watermelons (Citrullus lanatus), Arabidopsis lyrata, peach (Prunus persica), citrus trees (Citrus spp., including Citrus sinensis and Citrus Clementina), Capsella rubella, Aquilegia caerulea, Malus x domestica, Volvox carteri, Linum usitatissimum, Eucalyptus grandis, cotton (Gossypium barbadense, Gossypium hirsutum, Gossypium raimondii), Fragaria vesca, and Chlamydomonas reinhardtii. In certain embodiments, the preferred plants are all

dicotyledonous plants. In other embodiments, the preferred plants are all Solanaceous plants. In yet other embodiments, the preferred plants are potato, tomato, eggplant, peppers, tobacco and petunia. In yet another embodiment, the preferred plants are potato, tomato, eggplant, pepper, tobacco, petunia spp., lettuce, peas, beans, spinach, melons, cucumbers, squash, Brassica sp., radish, onions, and watermelons. In a further embodiment, the plants can include Arabidopsis spp., soybean (Glycine max), grapevine (Vitis vinifera), castor bean (Ricinus communis), black cottonwood (Populus trichocarpa), lettuce (Lactuca sativa), moss (Physcomitrella patens), lycophyte (Selaginella moellendorffli) or Nicotiana benthamiana.

Oomycete pathogens of the present invention include, but are not limited to,

Phytophthora species, such as, for example, Phytophthora infestans, Phytophthora parasitica, Phytophthora ramorum, Phytophthora ipomoeae, Phytophthora mirabilis, Phytophthora capsici, Phytophthora porri, and Phytophthora phaseoli. In other

embodiments, the oomycete pathogen is Hyaloperonospora arabidopsidis,

Hyaloperonospora parasitica, Bremia lactucae, Peronospora farinosa, Pseudoperonospora cubensis, Pseudoperonospora humuli, Peronospora destructor, Albugo Candida, Albugo occidentalis, or Pythium spp.

The present invention encompasses isolated or substantially purified polynucleotide (also referred to herein as "nucleic acid molecule", "nucleic acid" and the like) or protein (also referred to herein as "polypeptide") compositions. An "isolated" or "purified" polynucleotide or protein, or biologically active portion thereof, is substantially or essentially free from components that normally accompany or interact with the polynucleotide or protein as found in its naturally occurring environment. Thus, an isolated or purified polynucleotide or protein is substantially free of other cellular material or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. Optimally, an "isolated" polynucleotide is free of sequences (optimally protein encoding sequences) that naturally flank the polynucleotide (i.e., sequences located at the 5' and 3' ends of the polynucleotide) in the genomic DNA of the organism from which the polynucleotide is derived. For example, in various embodiments, the isolated polynucleotide can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of nucleotide sequence that naturally flank the polynucleotide in genomic DNA of the cell from which the polynucleotide is derived. A protein that is substantially free of cellular material includes preparations of protein having less than about 30%, 20%, 10%, 5%, or 1% (by dry weight) of contaminating protein. When the protein of the invention or biologically active portion thereof is recombinantly produced, optimally culture medium represents less than about 30%, 20%, 10%, 5%, or 1% (by dry weight) of chemical precursors or non- protein-of-interest chemicals.

Fragments and variants of the disclosed polynucleotides and proteins encoded thereby are also encompassed by the present invention. By "fragment" is intended a portion of the polynucleotide or a portion of the amino acid sequence and hence protein encoded thereby. Fragments of polynucleotides comprising coding sequences may encode protein fragments that retain biological activity of the full-length or native protein and hence retain the ability to enhance oomycete pathogenicity in the presence of an effector protein from an oomycete plant pathogen. Alternatively, fragments of polynucleotides comprising coding sequences may encode protein fragments that do not retain biological activity of the full-length or native protein and hence do not retain the ability to enhance oomycete pathogenicity in the presence of an effector protein from an oomycete plant pathogen. For example, fragments of a polynucleotide that are useful as hybridization probes generally do not encode proteins that retain biological activity or do not retain promoter activity. Thus, fragments of a nucleotide sequence may range from at least about 20 nucleotides, about 50 nucleotides, about 100 nucleotides, and up to the full-length polynucleotide of the invention.

Polynucleotides that are fragments of a CKL polynucleotide comprise at least 16, 18, 20, 50, 75, 100, 125, 150, 175, 200, 250, 300, 350, 400, 450, 500, 550, or 575 contiguous nucleotides, or up to the number of nucleotides present in a full-length CKL polynucleotide disclosed herein (for example, SEQ ID NOS: 10 or 24-67). Fragments of a CKL

polynucleotide useful in decreasing the level of CKL in a plant by the methods disclosed herein generally need not encode a biologically active portion of CKL protein.

"Variants" is intended to mean substantially similar sequences. For polynucleotides, a variant comprises a polynucleotide having deletions (i.e., truncations) at the 5' and/or 3' end; deletion and/or addition of one or more nucleotides at one or more internal sites in the native polynucleotide; and/or substitution of one or more nucleotides at one or more sites in the native polynucleotide. As used herein, a "native" polynucleotide or polypeptide comprises a naturally occurring nucleotide sequence or amino acid sequence, respectively. For polynucleotides, conservative variants include those sequences that, because of the degeneracy of the genetic code, encode the amino acid sequence of one of the CKLs of the invention. Naturally occurring allelic variants such as these can be identified with the use of well-known molecular biology techniques, as, for example, with polymerase chain reaction (PCR) and hybridization techniques as outlined below. Variant polynucleotides also include synthetically derived polynucleotides, such as those generated, for example, by using site- directed mutagenesis but which still encode a CKL of the invention or can be used in decreasing the level of a CKL in a plant by the methods disclosed herein. Generally, variants of a particular polynucleotide of the invention will have at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to that particular polynucleotide as determined by sequence alignment programs and parameters as described elsewhere herein.

Variants of a particular polynucleotide of the invention (i.e., the reference polynucleotide) can also be evaluated by comparison of the percent sequence identity between the polypeptide encoded by a variant polynucleotide and the polypeptide encoded by the reference polynucleotide. Thus, for example, a polynucleotide that encodes a polypeptide with a given percent sequence identity to the polypeptide of SEQ ID NO: 1 1 are disclosed. Percent sequence identity between any two polypeptides can be calculated using sequence alignment programs and parameters described elsewhere herein. Where any given pair of polynucleotides of the invention is evaluated by comparison of the percent sequence identity shared by the two polypeptides they encode, the percent sequence identity between the two encoded polypeptides is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity.

"Variant" protein is intended to mean a protein derived from the native protein by deletion (so-called truncation) of one or more amino acids at the N-terminal and/or C- terminal end of the native protein; deletion and/or addition of one or more amino acids at one or more internal sites in the native protein; or substitution of one or more amino acids at one or more sites in the native protein. Such variants may result from, for example, genetic polymorphism or from human manipulation. Biologically active variants of CKL will have at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the amino acid sequence for the native protein as determined by sequence alignment programs and parameters described elsewhere herein. A biologically active variant of a protein of the invention may differ from that protein by as few as 1-15 amino acid residues, as few as 1-10, such as 6-10, as few as 5, as few as 4, 3, 2, or even 1 amino acid residue.

The proteins of the invention may be altered in various ways including amino acid substitutions, deletions, truncations, and insertions. Methods for such manipulations are generally known in the art. Methods for mutagenesis and polynucleotide alterations are well known in the art. See, for example, Kunkel (1985) Proc. Natl. Acad. Sci. USA 82:488-492; Kunkel et al. (1987) Methods in Enzymol. 154:367-382; U.S. Patent No. 4,873,192; Walker and Gaastra, eds. (1983) Techniques in Molecular Biology (MacMillan Publishing Company, New York) and the references cited therein. Guidance as to appropriate amino acid substitutions that do not affect biological activity of the protein of interest may be found in the model of Dayhoff et al. (191%) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, D.C.), herein incorporated by reference. Conservative

substitutions, such as exchanging one amino acid with another having similar properties, may be optimal.

Thus, the genes and polynucleotides of the invention include both the naturally occurring sequences as well as mutant and other variant forms. Likewise, the proteins of the invention encompass both naturally occurring proteins as well as variations and modified forms thereof. Such variants will continue to possess the desired biological activity, particularly the ability to decrease the level and/or activity of an endogenous or native CKL in a host plant. Obviously, the mutations that will be made in the DNA encoding the variant must not place the sequence out of reading frame and optimally will not create

complementary regions that could produce secondary mRNA structure. See, EP Patent Application Publication No. 75,444.

The deletions, insertions, and substitutions of the protein sequences encompassed herein are not expected to produce radical changes in the characteristics of the protein.

However, when it is difficult to predict the exact effect of the substitution, deletion, or insertion in advance of doing so, one skilled in the art will appreciate that the effect will be evaluated by routine screening assays. That is, the activity can be evaluated by assays that are disclosed herein below.

Variant polynucleotides and proteins also encompass sequences and proteins derived from a mutagenic and recombinogenic procedure such as DNA shuffling. Strategies for such DNA shuffling are known in the art. See, for example, Stemmer (1994) Proc. Natl. Acad. Sci. USA 91 : 10747-10751; Stemmer (1994) Nature 370:389-391; Crameri ei a/. (1997) Nature Biotech. 15:436-438; Moore et al. (1997) J. Mol. Biol. 272:336-347; Zhang et al. (1997) Proc. Natl. Acad. Sci. USA 94:4504-4509; Crameri et al. (1998) Nature 391 :288-291; and U.S. Patent Nos. 5,605,793 and 5,837,458.

The polynucleotides of the invention can be used to isolate corresponding sequences from other organisms, particularly other plants. In this manner, methods such as PCR, hybridization, and the like can be used to identify such sequences based on their sequence homology to the sequences set forth herein. Sequences isolated based on their sequence identity to the entire sequences set forth herein or to variants and fragments thereof are encompassed by the present invention. Such sequences include sequences that are orthologs of the disclosed sequences. "Orthologs" is intended to mean genes derived from a common ancestral gene and which are found in different species as a result of speciation. Genes found in different species are considered orthologs when their nucleotide sequences and/or their encoded protein sequences share at least 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or greater sequence identity. Functions of orthologs are often highly conserved among species. Thus, isolated polynucleotides that encode CKLs and which hybridize under stringent conditions to at least one of the CKL polynucleotides disclosed herein or otherwise known in the art, or to variants or fragments thereof, are encompassed by the present invention.

In a PCR approach, oligonucleotide primers can be designed for use in PCR reactions to amplify corresponding DNA sequences from cDNA or genomic DNA extracted from any plant of interest. Methods for designing PCR primers and PCR cloning are generally known in the art and are disclosed in Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, New York). See also Innis et al., eds. (1990) PCR Protocols: A Guide to Methods and Applications (Academic Press, New York); Innis and Gelfand, eds. (1995) PCR Strategies (Academic Press, New York); and Innis and Gelfand, eds. (1999) PCR Methods Manual (Academic Press, New York). Known methods of PCR include, but are not limited to, methods using paired primers, nested primers, single specific primers, degenerate primers, gene-specific primers, vector-specific primers, partially-mismatched primers, and the like.

In hybridization techniques, all or part of a known polynucleotide is used as a probe that selectively hybridizes to other corresponding polynucleotides present in a population of cloned genomic DNA fragments or cDNA fragments (i.e., genomic or cDNA libraries) from a chosen organism. The hybridization probes may be genomic DNA fragments, cDNA fragments, RNA fragments, or other oligonucleotides, and may be labeled with a detectable group such as ³²P, or any other detectable marker. Thus, for example, probes for

hybridization can be made by labeling synthetic oligonucleotides based on the

polynucleotides of the invention. Methods for preparation of probes for hybridization and for construction of cDNA and genomic libraries are generally known in the art and are disclosed in Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, New York).

For example, an entire polynucleotide disclosed herein, or one or more portions thereof, may be used as a probe capable of specifically hybridizing to corresponding polynucleotide and messenger RNAs. To achieve specific hybridization under a variety of conditions, such probes include sequences that are unique among the sequence of the gene or cDNA of interest sequences and are optimally at least about 10 nucleotides in length, and most optimally at least about 20 nucleotides in length. Such probes may be used to amplify corresponding polynucleotides for the particular gene of interest from a chosen plant by PCR. This technique may be used to isolate additional coding sequences from a desired plant or as a diagnostic assay to determine the presence of coding sequences in a plant. Hybridization techniques include hybridization screening of plated DNA libraries (either plaques or colonies; see, for example, Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, New York).

Hybridization of such sequences may be carried out under stringent conditions. By "stringent conditions" or "stringent hybridization conditions" is intended conditions under which a probe will hybridize to its target sequence to a detectably greater degree than to other sequences (e.g., at least 2-fold over background). Stringent conditions are sequence- dependent and will be different in different circumstances. By controlling the stringency of the hybridization and/or washing conditions, target sequences that are 100% complementary to the probe can be identified (homologous probing). Alternatively, stringency conditions can be adjusted to allow some mismatching in sequences so that lower degrees of similarity are detected (heterologous probing). Generally, a probe is less than about 1000 nucleotides in length, optimally less than 500 nucleotides in length.

Typically, stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes (e.g., 10 to 50 nucleotides) and at least about 60°C for long probes (e.g., greater than 50 nucleotides).

Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at 37°C, and a wash in IX to 2X SSC (20X SSC = 3.0 M NaCl/0.3 M trisodium citrate) at 50 to 55°C. Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1.0 M NaCl, 1% SDS at 37°C, and a wash in 0.5X to IX SSC at 55 to 60°C. Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in 0. IX SSC at 60 to 65°C. Optionally, wash buffers may comprise about 0.1% to about 1% SDS. Duration of hybridization is generally less than about 24 hours, usually about 4 to about 12 hours. The duration of the wash time will be at least a length of time sufficient to reach equilibrium.

Specificity is typically the function of post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution. For DNA-DNA hybrids, the T_m can be approximated from the equation of Meinkoth and Wahl (1984) Anal. Biochem. 138:267-284: T_m = 81.5°C + 16.6 (log M) + 0.41 (%GC) - 0.61 (% form) - 500/L; where M is the molarity of monovalent cations, %GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs. The T_m is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. T_m is reduced by about 1°C for each 1% of mismatching; thus, T_m, hybridization, and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with >90% identity are sought, the T_m can be decreased 10°C. Generally, stringent conditions are selected to be about 5°C lower than the thermal melting point (T_m) for the specific sequence and its complement at a defined ionic strength and pH. However, severely stringent conditions can utilize a hybridization and/or wash at 1, 2, 3, or 4°C lower than the thermal melting point (T_m); moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9, or 10°C lower than the thermal melting point (T_m); low stringency conditions can utilize a hybridization and/or wash at 11, 12, 13, 14, 15, or 20°C lower than the thermal melting point (T_m). Using the equation, hybridization and wash compositions, and desired T_m, those of ordinary skill will understand that variations in the stringency of hybridization and/or wash solutions are inherently described. If the desired degree of mismatching results in a T_m of less than 45°C (aqueous solution) or 32°C

(formamide solution), it is optimal to increase the SSC concentration so that a higher temperature can be used. An extensive guide to the hybridization of nucleic acids is found in Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology—

Hybridization with Nucleic Acid Probes, Part I, Chapter 2 (Elsevier, New York); and Ausubel et al, eds. (1995) Current Protocols in Molecular Biology , Chapter 2 (Greene Publishing and Wiley-Interscience, New York). See Sambrook et al. (1989) Molecular Cloning: A

Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, New York).

To determine the percent identity of two amino acid sequences or of two nucleic acids, the sequences are aligned for optimal comparison purposes. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., percent identity = number of identical positions/total number of positions (e.g., overlapping positions) x 100). In one embodiment, the two sequences are the same length. The percent identity between two sequences can be determined using techniques similar to those described below, with or without allowing gaps. In calculating percent identity, typically exact matches are counted.

The determination of percent identity between two sequences can be accomplished using a mathematical algorithm. A preferred, nonlimiting example of a mathematical algorithm utilized for the comparison of two sequences is the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264, modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877. Such an algorithm is incorporated into the NBLAST and XBLAST programs of Altschul et al. (1990) J. Mol. Biol. 215:403. BLAST nucleotide searches can be performed with the NBLAST program, score = 100, wordlength = 12, to obtain nucleotide sequences homologous to the polynucleotide molecules of the invention. BLAST protein searches can be performed with the XBLAST program, score = 50, wordlength = 3, to obtain amino acid sequences homologous to protein molecules of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al. (1997) Nucleic Acids Res. 25:3389. Alternatively, PSI- Blast can be used to perform an iterated search that detects distant relationships between molecules. See Altschul et al. (1997) supra. When utilizing BLAST, Gapped BLAST, and PSI-Blast programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used. See http://www.ncbi.nlm.nih.gov. Another preferred, non-limiting example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Myers and Miller (1988) CABIOS 4: 11-17. Such an algorithm is incorporated into the ALIGN program (version 2.0), which is part of the GCG sequence alignment software package. When utilizing the ALIGN program for comparing amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used. Alignment may also be performed manually by inspection.

Unless otherwise stated, sequence identity/similarity values provided herein refer to the value obtained using the full-length sequences of the invention and using multiple alignment by mean of the algorithm Clustal W (Larkin, M. A., et ah, 2007, Bioinformatic . 23(21): 2947-2948) using the program BOXSHADE using the default parameters; or any equivalent program thereof. By "equivalent program" is intended any sequence comparison program that, for any two sequences in question, generates an alignment having identical nucleotide or amino acid residue matches and an identical percent sequence identity when compared to the corresponding alignment generated by CLUSTALW (Version 1.83) using default parameters (available at the European Bioinformatics Institute website:

www.ebi.ac.uk/Tools/clustalw/index.html).

The use of the term "polynucleotide" is not intended to limit the present invention to polynucleotides comprising DNA. Those of ordinary skill in the art will recognize that polynucleotides, can comprise ribonucleotides and combinations of ribonucleotides and deoxyribonucleotides. Such deoxyribonucleotides and ribonucleotides include both naturally occurring molecules and synthetic analogues. The polynucleotides of the invention also encompass all forms of sequences including, but not limited to, single-stranded forms, double-stranded forms, hairpins, stem-and-loop structures, and the like.

The polynucleotide constructs comprising transcribed regions can be provided in expression cassettes for expression in the plant or other organism or non-human host cell of interest. The cassette will include 5' and 3' regulatory sequences operably linked to the transcribed region. "Operably linked" is intended to mean a functional linkage between two or more elements. For example, an operable linkage between a polynucleotide or gene of interest and a regulatory sequence (i.e., a promoter) is functional link that allows for expression of the polynucleotide of interest. Operably linked elements may be contiguous or non-contiguous. When used to refer to the joining of two protein coding regions, by operably linked is intended that the coding regions are in the same reading frame. The cassette may additionally contain at least one additional gene to be cotransformed into the organism. Alternatively, the additional gene(s) can be provided on multiple expression cassettes. Such an expression cassette is provided with a plurality of restriction sites and/or recombination sites for insertion of the transcribed region to be under the transcriptional regulation of the regulatory regions. The expression cassette may additionally contain selectable marker genes.

The expression cassette will include in the 5'-3' direction of transcription, a transcriptional and translational initiation region (i.e., a promoter), a transcribed region of the invention, and a transcriptional and translational termination region (i.e., termination region) functional in plants or other organism or non-human host cell. The regulatory regions (i.e., promoters, transcriptional regulatory regions, and translational termination regions) and/or the transcribed region or of the invention may be native/analogous to the host cell or to each other. Alternatively, the regulatory regions and/or the transcribed region of the invention may be heterologous to the host cell or to each other. As used herein, "heterologous" in reference to a sequence is a sequence that originates from a foreign species, or, if from the same species, is substantially modified from its native form in composition and/or genomic locus by deliberate human intervention. For example, a promoter operably linked to a heterologous polynucleotide is from a species different from the species from which the polynucleotide was derived, or, if from the same/analogous species, one or both are substantially modified from their original form and/or genomic locus, or the promoter is not the native promoter for the operably linked polynucleotide. Such heterologous

polynucleotides include, for example, any nucleic acid molecules or polynucleotides that are introduced into the genome of a plant as disclosed herein and further include native or endogenous genes that are modified in vivo or in planta as disclosed herein by methods known in the art such as, for example, gene disruption, targeted mutagenesis, homologous recombination, and mutation breeding. As used herein, a chimeric gene comprises a coding sequence operably linked to a transcription initiation region that is heterologous to the coding sequence.

While it may be optimal to express the transcribed region using heterologous promoters, the native promoter of the corresponding Ckl gene may be used.

The termination region may be native with the transcriptional initiation region, may be native with the operably linked transcribed region of interest, may be native with the plant host, or may be derived from another source (i.e., foreign or heterologous) to the promoter, the transcribed region of interest, the plant host, or any combination thereof. Convenient termination regions are available from the Ti-plasmid of A. tumefaciens, such as the octopine synthase and nopaline synthase termination regions. See also Guerineau et al. (1991) Mol. Gen. Genet. 262: 141-144; Proudfoot (1991) Cell 64:671-674; Sanfacon et al. (1991) Genes Dev. 5: 141-149; Mogen et al. (1990) Plant Cell 2: 1261-1272; Munroe et al. (1990) Gene 91 : 151-158; Ballas t al. (1989) Nucleic Acids Res. 17:7891-7903; and Joshi et al. (1987) Nucleic Acids Res. 15:9627-9639.

Where appropriate, the polynucleotides may be optimized for increased expression in the transformed plant. That is, the polynucleotides can be synthesized using plant-preferred codons for improved expression. See, for example, Campbell and Gowri (1990) Plant Physiol. 92: 1-11 for a discussion of host-preferred codon usage. Methods are available in the art for synthesizing plant-preferred genes. See, for example, U.S. Patent Nos. 5,380,831, and 5,436,391, and Murray et al. (1989) Nucleic Acids Res. 17:477-498, herein incorporated by reference.

Additional sequence modifications are known to enhance gene expression in a cellular host. These include elimination of sequences encoding spurious polyadenylation signals, exon-intron splice site signals, transposon-like repeats, and other such well-characterized sequences that may be deleterious to gene expression. The G-C content of the sequence may be adjusted to levels average for a given cellular host, as calculated by reference to known genes expressed in the host cell. When possible, the sequence is modified to avoid predicted hairpin secondary mRNA structures.

The expression cassettes may additionally contain 5' leader sequences. Such leader sequences can act to enhance translation. Translation leaders are known in the art and include: picornavirus leaders, for example, EMCV leader (Encephalomyocarditis 5' noncoding region) (Elroy-Stein et al. (1989) Proc. Natl. Acad. Sci. USA 86:6126-6130); potyvirus leaders, for example, TEV leader (Tobacco Etch Virus) (Gallie et al. (1995) Gene 165(2):233-238), MDMV leader (Maize Dwarf Mosaic Virus) (Virology 154:9-20), and human immunoglobulin heavy-chain binding protein (BiP) (Macejak et al. (1991) Nature 353 :90-94); untranslated leader from the coat protein mRNA of alfalfa mosaic virus (AMV RNA 4) (Jobling et al. (1987) Nature 325:622-625); tobacco mosaic virus leader (TMV) (Gallie et al. (1989) in Molecular Biology of RNA, ed. Cech (Liss, New York), pp. 237-256); and maize chlorotic mottle virus leader (MCMV) (Lommel et al. (1991) Virology

81 :382-385). See also, Della-Cioppa et al. (1987) Plant Physiol. 84:965-968.

In preparing the expression cassette, the various DNA fragments may be manipulated, so as to provide for the DNA sequences in the proper orientation and, as appropriate, in the proper reading frame. Toward this end, adapters or linkers may be employed to join the DNA fragments or other manipulations may be involved to provide for convenient restriction sites, removal of superfluous DNA, removal of restriction sites, or the like. For this purpose, in vitro mutagenesis, primer repair, restriction, annealing, resubstitutions, e.g., transitions and transversions, may be involved.

A number of promoters can be used in the practice of the invention. The promoters can be selected based on the desired outcome. The nucleic acids can be combined with constitutive, tissue-preferred, or other promoters for expression in plants. Such constitutive promoters include, for example, the core CaMV 35S promoter (Odell et al. (1985) Nature 313 :810-812); rice actin (McElroy et al. (1990) Plant Cell 2: 163-171); ubiquitin (Christensen et al. (1989) Plant Mol. Biol. 12:619-632 and Christensen et al. (1992) Plant Mol. Biol.

18:675-689); pEMU (Last et al. (1991) Theor. Appl. Genet. 81 :581-588); MAS (Velten et al. (1984) EMBO J. 3 :2723-2730); ALS promoter (U.S. Patent No. 5,659,026), and the like. Other constitutive promoters include, for example, U.S. Patent Nos. 5,608, 149; 5,608, 144; 5,604, 121; 5,569,597; 5,466,785; 5,399,680; 5,268,463; 5,608,142; and 6, 177,611.

Tissue-preferred promoters can be utilized to target enhanced expression of the transcribed regions within a particular plant tissue. Such tissue-preferred promoters include, but are not limited to, leaf-preferred promoters, root-preferred promoters, seed-preferred promoters, and stem-preferred promoters. Tissue-preferred promoters include Yamamoto et al. (1997) Plant J. 12(2):255-265; Kawamata et al. (1997) Plant Cell Physiol. 38(7):792-803; Hansen et al. (1997) Mol. Gen Genet. 254(3):337-343; Russell et al. (1997) Transgenic Res. 6(2): 157-168; Rinehart et al. (1996) Plant Physiol. 1 12(3): 1331-1341; Van Camp et al. (1996) Plant Physiol. 1 12(2):525-535; Canevascini et al. (1996) Plant Physiol. 1 12(2):513- 524; Yamamoto et al. (1994) Plant Cell Physiol. 35(5):773-778; Lam (1994) Results Probl. Cell Differ. 20: 181-196; Orozco et al. (1993) Plant Mol Biol. 23(6): 1129-1138; Matsuoka e/ al. (1993) Proc. Natl. Acad. Sci. USA 90(20):9586-9590; and Guevara-Garcia et al. (1993) Plant J. 4(3):495-505. Such promoters can be modified, if necessary, for weak expression.

Generally, it will be beneficial to express the gene from an inducible promoter, particularly from a pathogen-inducible promoter. Such promoters include those from pathogenesis-related proteins (PR proteins), which are induced following infection by a pathogen; e.g., PR proteins, SAR proteins, beta-l,3-glucanase, chitinase, etc. See, for example, Redolfi et al. (1983) Neth. J. Plant Pathol. 89:245-254; Uknes et al. (1992) Plant Cell 4: 645-656; and Van Loon (1985) Plant Mol. Virol. 4: 1 11-116. See also WO 99/43819, herein incorporated by reference. Of interest are promoters that are expressed locally at or near the site of pathogen infection. See, for example, Marineau et al. (1987) Plant Mol. Biol. 9:335-342; Matton et al. (1989) Molecular Plant-Microbe Interactions 2:325-331; Somsisch et al. (1986) Proc. Natl. Acad. Sci. USA 83:2427-2430; Somsisch et al. (1988) Mol. Gen. Genet. 2:93-98; and Yang (1996) Proc. Natl. Acad. Sci. USA 93: 14972-14977. See also, Chen et al. (1996) Plant J. 10:955-966; Zhang et al. (1994) Proc. Natl. Acad. Sci. USA 91 :2507-251 1 ; Warner et al. (1993) Plant J. 3: 191-201; Siebertz et al. (1989) Plant Cell 1 :961-968; U.S. Patent No. 5,750,386 (nematode-inducible); and the references cited therein. Of particular interest is the inducible promoter for the maize PRms gene, whose expression is induced by the pathogen Fusarium moniliforme (see, for example, Cordero et al. (1992) Physiol. Mol. Plant Path. 41 : 189-200).

Additionally, as pathogens find entry into plants through wounds or insect damage, a wound- inducible promoter may be used in the constructions of the invention. Such wound- inducible promoters include potato proteinase inhibitor (pin II) gene (Ryan (1990) Ann. Rev. Phytopath. 28:425-449; Duan et al. (1996) Nature Biotechnology 14:494-498); wunl and wun2, U.S. Patent No. 5,428,148; winl and win2 (Stanford et al. (1989) Mol. Gen. Genet. 215:200-208); systemin (McGurl et al. (1992) Science 225: 1570-1573); WIP1 (Rohmeier et al. (1993) Plant Mol. Biol. 22:783-792; Eckelkamp et al. (1993) FEB S Letters 323 :73-76); MPI gene (Corderok et al. (1994) Plant J. 6(2): 141-150); and the like, herein incorporated by reference.

Chemical-regulated promoters can be used to modulate the expression of a gene in a plant through the application of an exogenous chemical regulator. Depending upon the objective, the promoter may be a chemical-inducible promoter, where application of the chemical induces gene expression, or a chemical-repressible promoter, where application of the chemical represses gene expression. Chemical-inducible promoters are known in the art and include, but are not limited to, the maize In2-2 promoter, which is activated by benzenesulfonamide herbicide safeners, the maize GST promoter, which is activated by hydrophobic electrophilic compounds that are used as pre-emergent herbicides, and the tobacco PR- 1 a promoter, which is activated by salicylic acid. Other chemical-regulated promoters of interest include steroid-responsive promoters (see, for example, the

glucocorticoid-inducible promoter in Schena et al. (1991) Proc. Natl. Acad. Sci. USA 88: 10421-10425 and McNellis et al. (1998) Plant J. 14(2):247-257) and tetracycline- inducible and tetracycline-repressible promoters (see, for example, Gatz et al. (1991) Mol. Gen. Genet. 227:229-237, and U.S. Patent Nos. 5,814,618 and 5,789, 156), herein

incorporated by reference.

The expression cassette can also comprise a selectable marker gene for the selection of transformed cells. Selectable marker genes are utilized for the selection of transformed cells or tissues. Marker genes include genes encoding antibiotic resistance, such as those encoding neomycin phosphotransferase II ( EO) and hygromycin phosphotransferase (HPT), as well as genes conferring resistance to herbicidal compounds, such as glufosinate ammonium, bromoxynil, imidazolinones, and 2,4-dichlorophenoxyacetate (2,4-D). Additional selectable markers include phenotypic markers such as β-galactosidase and fluorescent proteins such as green fluorescent protein (GFP) (Su et al. (2004) Biotechnol Bioeng 55:610-9 and Fetter et al. (2004) Plant Cell 76:215-28), cyan florescent protein (CYP) (Bolte et al. (2004) J. Cell Science 777:943-54 and Kato et al. (2002) Plant Physiol 729:913-42), and yellow florescent protein (PhiYFP™ from Evrogen, see, Bolte et al. (2004) J. Cell Science 777:943-54). For additional selectable markers, see generally, Yarranton (1992) Curr. Opin. Biotech. 3:506-511; Christopherson et al. (1992) Proc. Natl. Acad. Sci. USA 89:6314-6318; Yao et al. (1992) Cell 71 :63-72; Reznikoff (1992) Mo/. Microbiol. 6:2419-2422; Barkley et al. (1980) in The Operon, pp. 177-220; Hu et al. (1987) Cell 48:555-566; Brown et al. (1987) Cell 49:603-612; Figge et al. (1988) Cell 52:713-722; Deuschle et al. (1989) Proc. Natl. Acad. Act USA 86:5400-5404; Fuerst et al. (1989) Proc. Natl. Acad. Sci. USA 86:2549-2553; Deuschle et al. (1990) Science 248:480-483; Gossen (1993) Ph.D. Thesis, University of Heidelberg; Reines et al. (1993) Proc. Natl. Acad. Sci. USA 90: 1917-1921; Labow et al. (1990) Mo/. Cell. Biol. 10:3343-3356;

Zambretti et al. (1992) Proc. Natl. Acad. Sci. USA 89:3952-3956; Bairn et al. (1991) Proc. Natl. Acad. Sci. USA 88:5072-5076; Wyborski et al. (1991) Nucleic Acids Res. 19:4647-4653;

Hillenand-Wissman (1989) Topics Mol. Struc. Biol. 10: 143-162; Degenkolb et al. (1991) Antimicrob. Agents Chemother. 35: 1591-1595; Kleinschnidt et al. (1988) Biochemistry 27: 1094- 1104; Bonin (1993) Ph.D. Thesis, University of Heidelberg; Gossen et al. (1992) Proc. Natl. Acad. Sci. USA 89:5547-5551; Oliva ei a/. (1992) Antimicrob. Agents Chemother. 36:913-919; Hlavka et al. (1985) Handbook of Experimental Pharmacology, Vol. 78 ( Springer- Verlag, Berlin); Gill et al. (1988) Nature 334:721-724. Such disclosures are herein incorporated by reference.

The above list of selectable marker genes is not intended to be limiting. Any selectable marker gene can be used in the present invention. Numerous plant transformation vectors and methods for transforming plants are available. See, for example, An, G. et al. (1986) Plant Pysiol. , 81 :301-305; Fry, J., et al. ( i) Plant Cell Rep. 6:321-325; Block, M. (1988) Theor. Appl Gewe/.76:767-774; Hinchee, et al. (1990) Stadler. Genet. Symp.203212. 03-212; Cousins, et al. (1991) Aust. J. Plant Physiol. 18:481-494; Chee, P. P. and Slightom, J. L. (1992) Gene.118:255-260; Christou, et al. (1992) Trends. Biotechnol. 10:239-246; D'Halluin, et al. (1992) Bio/Technol. 10:309-314; Dhir, et al. (1992) Plant Physiol. 99:81-88; Casas et al. (l993) Proc. Nat. Acad Sci. USA 90: 1 1212-1 1216; Christou, P. (1993) In Vitro Cell. Dev. Biol.-Plant; 29P: 1 19-124; Davies, et al. (1993) Plant Cell Rep. 12: 180-183; Dong, J. A. and Mchughen, A. (1993) Plant Sci. 91 : 139-148; Franklin, C. I. and Trieu, T. N. (1993) Plant. Physiol. 102: 167; Golovkin, et al.

(1993) Plant Sci. 90:41-52; Guo Chin Sci. Bull. 38:2072-2078; Asano, et al. (1994) Plant Cell Rep. 13; Ayeres N. M. and Park, W. D. (1994) Crit. Rev. Plant. Sci. 13:219-239;

Barcelo, et al. (1994) Plant. J. 5:583-592; Becker, et al. (1994) Plant. J. 5:299-307;

Borkowska et al. (1994) ^icto. Physiol Plant. 16:225-230; Christou, P. (1994) Agro. Food. Ind. Hi Tech. 5: 17-27; Eapen et al. (1994) Plant Cell Rep. 13 :582-586; Hartman, et al.

(1994) Bio-Technology 12: 919923; Ritala, et al. (1994) Plant. Mol. Biol. 24:317-325; and Wan, Y. C. and Lemaux, P. G. (1994) Plant Physiol. 104:3748.

The methods of the invention involve introducing a polynucleotide construct into a plant. By "introducing" is intended presenting to the plant the polynucleotide construct in such a manner that the construct gains access to the interior of a cell of the plant. The methods of the invention do not depend on a particular method for introducing a

polynucleotide construct to a plant, only that the polynucleotide construct gains access to the interior of at least one cell of the plant. Methods for introducing polynucleotide constructs into plants are known in the art including, but not limited to, stable transformation methods, transient transformation methods, and virus-mediated methods.

By "stable transformation" is intended that the polynucleotide construct introduced into a plant integrates into the genome of the plant and is capable of being inherited by progeny thereof. By "transient transformation" is intended that a polynucleotide construct introduced into a plant does not integrate into the genome of the plant.

For the transformation of plants and plant cells, the nucleotide sequences of the invention are inserted using standard techniques into any vector known in the art that is suitable for expression of the nucleotide sequences in a plant or plant cell. The selection of the vector depends on the preferred transformation technique and the target plant species to be transformed. Methodologies for constructing plant expression cassettes and introducing foreign nucleic acids into plants are generally known in the art and have been previously described. For example, foreign DNA can be introduced into plants, using tumor-inducing (Ti) plasmid vectors. Other methods utilized for foreign DNA delivery involve the use of PEG mediated protoplast transformation, electroporation, microinjection whiskers, and biolistics or microprojectile bombardment for direct DNA uptake. Such methods are known in the art. (U.S. Pat. No. 5,405,765 to Vasil et al; Bilang et al (1991) Gene 100: 247-250; Scheid et al, (1991) Mol Gen. Genet., 228: 104-1 12; Guerche et al, (1987) Plant Science 52: 1 1 1-116; Neuhause et al, (1987) Theor. Appl Genet. 75: 30-36; Klein et al, (1987) Nature 327: 70-73; Howell et al, (1980) Science 208: 1265; Horsch e/ a/., (1985) Science 227: 1229-1231 ;

DeBlock et al, (1989) Plant Physiology 91 : 694-701 ; Methods for Plant Molecular Biology (Weissbach and Weissbach, eds.) Academic Press, Inc. (1988) and Methods in Plant Molecular Biology (Schuler and Zielinski, eds.) Academic Press, Inc. (1989). The method of transformation depends upon the plant cell to be transformed, stability of vectors used, expression level of gene products and other parameters.

Other suitable methods of introducing nucleotide sequences into plant cells and subsequent insertion into the plant genome include microinjection as described by Crossway et al. (1986) Biotechniques 4:320-334, electroporation as described by Riggs et al. (1986) Proc. Natl. Acad. Sci. USA 83 :5602-5606, Agrobacterium-mediated transformation as described by Townsend et al, U.S. Patent No. 5,563,055, Zhao et al, U.S. Patent No.

5,981,840, direct gene transfer as described by Paszkowski et al. (1984) EMBO J.

3 :2717-2722, and ballistic particle acceleration as described in, for example, Sanford et al, U.S. Patent No. 4,945,050; Tomes et al, U.S. Patent No. 5,879,918; Tomes et al, U.S. Patent No. 5,886,244; Bidney et al, U.S. Patent No. 5,932,782; Tomes et al. (1995) "Direct DNA Transfer into Intact Plant Cells via Microprojectile Bombardment," in Plant Cell, Tissue, and Organ Culture: Fundamental Methods, ed. Gamborg and Phillips (Springer-Verlag, Berlin); McCabe et al. (1988) Biotechnology 6:923-926); and Lecl transformation (WO 00/28058). Also see, Weissinger et al. (1988) Ann. Rev. Genet. 22:421-477; Sanford et al. (1987) Particulate Science and Technology 5:27-37 (onion); Christou et al. (1988) Plant Physiol. 87:671-674 (soybean); McCabe et al. (1988) Bio/Technology 6:923-926 (soybean); Finer and McMullen (1991) In Vitro Cell Dev. Biol. 27P: 175-182 (soybean); Singh et al. (1998) Theor. Appl. Genet. 96:319-324 (soybean); Datta et al. (1990) Biotechnology 8:736-740 (rice); Klein et al. (1988) Proc. Natl. Acad. Sci. USA 85:4305-4309 (maize); Klein et al. (1988)

Biotechnology 6:559-563 (maize); Tomes, U.S. Patent No. 5,240,855; Buising et al, U.S. Patent Nos. 5,322,783 and 5,324,646; Tomes et al. (1995) "Direct DNA Transfer into Intact Plant Cells via Microprojectile Bombardment," in Plant Cell, Tissue, and Organ Culture: Fundamental Methods, ed. Gamborg (Springer-Verlag, Berlin) (maize); Klein et al. (1988) Plant Physiol. 91 :440-444 (maize); Fromm et al. (1990) Biotechnology 8:833-839 (maize); Hooykaas-Van Slogteren et al. (\9M) Nature (London) 31 1 :763-764; Bowen et al, U.S. Patent No. 5,736,369 (cereals); Bytebier et al. (1987) Proc. Natl. Acad. Sci. USA 84:5345- 5349 (Liliaceae); De Wet et al. (1985) in The Experimental Manipulation of Ovule Tissues, ed. Chapman et al. (Longman, New York), pp. 197-209 (pollen); Kaeppler et al. (1990) Plant Cell Reports 9:415-418 and Kaeppler et al. (1992) Theor. Appl. Genet. 84:560-566 (whisker- mediated transformation); D'Halluin et al. (1992) Plant Cell 4: 1495-1505 (electroporation); Li et al. (1993) Plant Cell Reports 12:250-255 and Christou and Ford (1995) Annals of Botany 75:407-413 (rice); Osjoda et al. (1996) Nature Biotechnology 14:745-750 (maize via Agrobacterium tumefaciens); all of which are herein incorporated by reference.

The polynucleotides of the invention may be introduced into plants by contacting plants with a virus or viral nucleic acids. Generally, such methods involve incorporating a polynucleotide construct of the invention within a viral DNA or RNA molecule. Further, it is recognized that promoters of the invention also encompass promoters utilized for transcription by viral RNA polymerases. Methods for introducing polynucleotide constructs into plants and expressing a protein encoded therein, involving viral DNA or RNA molecules, are known in the art. See, for example, U.S. Patent Nos. 5,889,191, 5,889, 190, 5,866,785, 5,589,367 and 5,316,931; herein incorporated by reference.

If desired, the modified viruses or modified viral nucleic acids can be prepared in formulations. Such formulations are prepared in a known manner (see e.g. for review US 3,060,084, EP-A 707 445 (for liquid concentrates), Browning, "Agglomeration", Chemical Engineering, Dec. 4, 1967, 147-48, Perry's Chemical Engineer's Handbook, 4th Ed.,

McGraw-Hill, New York, 1963, pages 8-57 and et seq. WO 91/13546, US 4, 172,714, US 4,144,050, US 3,920,442, US 5, 180,587, US 5,232,701, US 5,208,030, GB 2,095,558, US 3,299,566, Klingman, Weed Control as a Science, John Wiley and Sons, Inc., New York, 1961, Hance et al. Weed Control Handbook, 8th Ed., Blackwell Scientific Publications, Oxford, 1989 and Mollet, H., Grubemann, A., Formulation technology, Wiley VCH Verlag GmbH, Weinheim (Germany), 2001, 2. D. A. Knowles, Chemistry and Technology of Agrochemical Formulations, Kluwer Academic Publishers, Dordrecht, 1998 (ISBN 0-7514- 0443-8), for example by extending the active compound with auxiliaries suitable for the formulation of agrochemicals, such as solvents and/or carriers, if desired emulsifiers, surfactants and dispersants, preservatives, antifoaming agents, anti-freezing agents, for seed treatment formulation also optionally colorants and/or binders and/or gelling agents.

In specific embodiments, the polynucleotide constructs and expression cassettes of the invention can be provided to a plant using a variety of transient transformation methods known in the art. Such methods include, for example, microinjection or particle

bombardment. See, for example, Crossway et al. (1986) Mol Gen. Genet. 202: 179-185; Nomura et al. (1986) Plant Sci. 44:53-58; Hepler et al. (1994) PNAS Sci. 91 : 2176-2180 and Hush et al. (1994) J. Cell Science 107:775-784, all of which are herein incorporated by reference. Alternatively, the polynucleotide can be transiently transformed into the plant using techniques known in the art. Such techniques include viral vector system and

Agrobacterium tumefaciens-mediated transient expression as described elsewhere herein.

The cells that have been transformed may be grown into plants in accordance with conventional ways. See, for example, McCormick et al. (1986) Plant Cell Reports 5:81-84. These plants may then be grown, and either pollinated with the same transformed strain or different strains, and the resulting hybrid having constitutive expression of the desired phenotypic characteristic identified. Two or more generations may be grown to ensure that expression of the desired phenotypic characteristic is stably maintained and inherited and then seeds harvested to ensure expression of the desired phenotypic characteristic has been achieved. In this manner, the present invention provides transformed seed (also referred to as "transgenic seed") having a polynucleotide construct of the invention, for example, an expression cassette of the invention, stably incorporated into their genome.

The present invention may be used for transformation of any plant species, including, but not limited to, monocots and dicots. Examples of plant species of interest include, but are not limited to, peppers (Capsicum spp; e.g., Capsicum annuum, C. baccatum, C. chinense, C. frutescens, C. pubescens, and the like), tomatoes (Lycopersicon esculentum), tobacco

(Nicotiana tabacum), eggplant (Solanum melongena), petunia (Petunia spp., e.g., Petunia x hybrida or Petunia hybrida), pea (Pisum sativum), bean (Phaseolus vulgaris), corn or maize (Zea mays), Brassica sp. (e.g., B. napus, B. rapa, B. juncea), particularly those Brassica species useful as sources of seed oil, alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cereale), sorghum (Sorghum bicolor, Sorghum vulgare), millet (e.g., pearl millet (Pennisetum glaucum), proso millet (Panicum miliaceum), foxtail millet (Setaria italica), finger millet (Eleusine coracanaj), sunflower (Helianthus annuus), safflower (Carthamus tinctorius), wheat (Triticum aestivum), soybean (Glycine max), potato (Solanum tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium barbadense, Gossypium hirsutum, Gossypium raimondii), sweet potato (Ipomoea batatus), cassava (Manihot esculenta), coffee (Coffea spp.), coconut (Cocos nucifera), pineapple (Ananas comosus), citrus trees (Citrus spp., including Citrus sinensis and Citrus Clementina), cocoa (Theobroma cacao), tea (Camellia sinensis), banana (Musa spp.), avocado (Persea americana), fig (Ficus casica), guava (Psidium guajava), mango (Mangifera indica), olive (Olea europaea), papaya (Carica papaya), cashew (Anacardium occidentale), macadamia (Macadamia integrifolia), almond (Prunus amygdalus), sugar beets (Beta vulgaris), sugarcane (Saccharum spp.), Arabidopsis spp. (e.g. Arabidopsis thaliana, Arabidopsis lyrata,

Arabidopsis rhizogenes), Peach (Prunus persica), grapevine (Vitis vinifera), castor bean (Ricinus communis), black cottonwood (Populus trichocarpa), moss (e.g. Physcomitrella patens), lycophyte (e.g. Selaginella moellendorffli), Nicotiana benthamiana, spinach

(Spinacia oleracea), lettuce (Lactuca sativa), melons (including Benincasa spp., Citrullus spp., Cucumis spp., momordica spp.), cucumbers (Cucumis sp.), Brassica spp., squash (Cucurbita spp.), radish (Raphanus spp.), onions (Allium spp.), cucurbits (Cucurbita spp.), hops (Humulus lupulus), watermelons (Citrullus lanatus), Capsella rubella, Aquilegia caerulea, Malus x domestica, Volvox carteri, Linum usitatissimum, Eucalyptus grandis,

Fragaria vesca, Chlamydomonas reinhardtii, palms, oats, barley, vegetables, ornamentals, and conifers.

As used herein, the term plant includes plant cells, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps, and plant cells that are intact in plants or parts of plants such as embryos, pollen, ovules, seeds, tubers, propagules, leaves, flowers, branches, fruits, roots, root tips, anthers, and the like. Progeny, variants, and mutants of the regenerated plants are also included within the scope of the invention, provided that these parts comprise the introduced polynucleotides or the introduced genomic disruption of the Ckl gene. As used herein, "progeny" and "progeny plant" comprise any subsequent generation of a plant whether resulting from sexual reproduction and/or asexual propagation, unless it is expressly stated otherwise or is apparent from the context of usage.

In some embodiments of the present invention, a plant cell is transformed with a polynucleotide construct that is capable of expressing a polynucleotide that decreases the expression and/or activity of a CKL. The term "expression" or "expression level" as used herein refers to the biosynthesis of a gene product, including the transcription and/or translation of said gene product. For example, for the purposes of the present invention, polynucleotide construct capable of expressing a transcribed region that decreases the expression and/or activity of CKL in a host plant of interest is a polynucleotide construct capable of producing an RNA molecule that inhibits the transcription and/or translation of CKL in the host plant. The "expression" or "production" of a protein or polypeptide from a DNA molecule refers to the transcription and translation of the coding sequence to produce the protein or polypeptide, while the "expression" or "production" of a protein or polypeptide from an RNA molecule refers to the translation of the RNA coding sequence to produce the protein or polypeptide. Examples of polynucleotides that decrease the expression of a CKL are provided below.

In some embodiments of the invention, a decrease in the expression of a CKL may be obtained by sense suppression or cosuppression. For cosuppression, an expression cassette is designed to express an RNA molecule corresponding to all or part of a messenger RNA encoding a CKL in the "sense" orientation. Overexpression of the RNA molecule can result in reduced expression of the native gene. Accordingly, multiple plant lines transformed with the cosuppression expression cassette are screened to identify those that show the greatest decrease of CKL expression.

The polynucleotide used for cosuppression may correspond to all or part of the sequence encoding the CKL, all or part of the 5' and/or 3' untranslated region of a CKL transcript, or all or part of both the coding sequence and the untranslated regions of a transcript encoding a CKL. In some embodiments where the polynucleotide comprises all or part of the coding region for the CKL, the expression cassette is designed to eliminate the start codon of the polynucleotide so that no protein product will be transcribed.

Cosuppression may be used to decrease the expression of plant genes to produce plants having undetectable protein levels for the proteins encoded by these genes. See, for example, Broin et al. (2002) Plant Cell 14: 1417-1432. Cosuppression may also be used to decrease the expression of multiple proteins in the same plant. See, for example, U.S. Patent No. 5,942,657. Methods for using cosuppression to decrease the expression of endogenous genes in plants are described in Flavell et al. (1994) Proc. Natl. Acad. Set USA 91 :3490- 3496; Jorgensen et al. (1996) Plant Mol. Biol. 31 :957-973; Johansen and Carrington (2001) Plant Physiol. 126:930-938; Broin et al. (2002) Plant Cell 14: 1417-1432; Stoutjesdijk et al (2002) Plant Physiol. 129: 1723-1731 ; Yu et al. (2003) Phytochemistry 63:753-763; and U.S. Patent Nos. 5,034,323, 5,283, 184, and 5,942,657; each of which is herein incorporated by reference. The efficiency of cosuppression may be increased by including a poly-dT region in the expression cassette at a position 3' to the sense sequence and 5' of the polyadenylation signal. See, U.S. Patent Publication No. 20020048814, herein incorporated by reference. Typically, such a nucleotide sequence has substantial sequence identity to the sequence of the transcript of the endogenous gene, optimally greater than about 65% sequence identity, more optimally greater than about 85% sequence identity, most optimally greater than about 95% sequence identity. See, U.S. Patent Nos. 5,283, 184 and 5,034,323; herein incorporated by reference.

In some embodiments of the invention, a decrease in the expression of the CKL may be obtained by antisense suppression. For antisense suppression, the expression cassette is designed to express an RNA molecule complementary to all or part of a messenger RNA encoding the CKL. Overexpression of the antisense RNA molecule can result in reduced expression of the native gene. Accordingly, multiple plant lines transformed with the antisense suppression expression cassette are screened to identify those that show the greatest decrease of CKL expression.

The polynucleotide for use in antisense suppression may correspond to all or part of the complement of the sequence encoding the CKL, all or part of the complement of the 5' and/or 3' untranslated region of the CKL transcript, or all or part of the complement of both the coding sequence and the untranslated regions of a transcript encoding the CKL. In addition, the antisense polynucleotide may be fully complementary (i.e., 100% identical to the complement of the target sequence) or partially complementary (i.e., less than 100% identical to the complement of the target sequence) to the target sequence. Antisense suppression may be used to decrease the expression of multiple proteins in the same plant. See, for example, U.S. Patent No. 5,942,657. Furthermore, portions of the antisense nucleotides may be used to disrupt the expression of the target gene. Generally, sequences of at least 50 nucleotides, 100 nucleotides, 200 nucleotides, 300, 400, 450, 500, 550, or greater may be used. Methods for using antisense suppression to decrease the expression of endogenous genes in plants are described, for example, in Liu et al (2002) Plant Physiol. 129: 1732-1743 and U.S. Patent Nos. 5,759,829 and 5,942,657, each of which is herein incorporated by reference. Efficiency of antisense suppression may be increased by including a poly-dT region in the expression cassette at a position 3' to the antisense sequence and 5' of the polyadenylation signal. See, U.S. Patent Publication No. 20020048814, herein incorporated by reference.

In certain embodiments of the invention, a full-length CKL transcript is used for antisense and sense suppression. In other embodiments, the specificity of silencing can be achieved by designing antisense constructs based on non-conserved sequence regions of a CKL nucleotide sequence. Alternatively, longer antisense constructs can be used that would preferentially form an RNA duplex with the closest endogenous RNA. In some embodiments of the invention, a decrease in the expression of a CKL may be obtained by double-stranded RNA (dsRNA) interference. For dsRNA interference, a sense RNA molecule like that described above for cosuppression and an antisense RNA molecule that is fully or partially complementary to the sense RNA molecule are expressed in the same cell, resulting in a decrease in the expression of the corresponding endogenous messenger RNA.

Expression of the sense and antisense molecules can be accomplished by designing the expression cassette to comprise both a sense sequence and an antisense sequence.

Alternatively, separate expression cassettes may be used for the sense and antisense sequences. Multiple plant lines transformed with the dsRNA interference expression cassette or expression cassettes are then screened to identify plant lines that show the greatest decrease in CKL expression. Methods for using dsRNA interference to decrease the expression of endogenous plant genes are described in Waterhouse et al. (1998) Proc. Natl. Acad. Sci. USA 95: 13959-13964, Liu et al. (2002) Plant Physiol. 129: 1732-1743, and WO 99/49029, WO 99/53050, WO 99/61631, and WO 00/49035; each of which is herein incorporated by reference.

In some embodiments of the invention, a decrease in the expression of CKL may be obtained by hairpin RNA (hpRNA) interference or intron-containing hairpin RNA (ihpRNA) interference. These methods are highly efficient at inhibiting the expression of endogenous genes. See, Waterhouse and Helliwell (2003) Nat. Rev. Genet. 4:29-38 and the references cited therein.

For hpRNA interference, the expression cassette is designed to express an RNA molecule that hybridizes with itself to form a hairpin structure that comprises a single- stranded loop region and a base-paired stem. The base-paired stem region comprises a sense sequence corresponding to all or part of the endogenous messenger RNA encoding the gene whose expression is to be inhibited, and an antisense sequence that is fully or partially complementary to the sense sequence. Thus, the base-paired stem region of the molecule generally determines the specificity of the RNA interference. hpRNA molecules are highly efficient at inhibiting the expression of endogenous genes, and the RNA interference they induce is inherited by subsequent generations of plants. See, for example, Chuang and

Meyerowitz (2000) Proc. Natl. Acad. Sci. USA 97:4985-4990; Stoutjesdijk ei a/. (2002) Plant Physiol. 129: 1723-1731; and Waterhouse and Helliwell (2003) Nat. Rev. Genet. 4:29-38. Methods for using hpRNA interference to inhibit or silence the expression of genes are described, for example, in Chuang and Meyerowitz (2000) Proc. Natl. Acad. Sci. USA 97:4985-4990; Stoutjesdijk et al. (2002) Plant Physiol 129: 1723-1731; Waterhouse and Helliwell (2003) Nat. Rev. Genet. 4:29-38; Pandolfini et al. BMC Biotechnology 3 :7, and U.S. Patent Publication No. 20030175965; each of which is herein incorporated by reference. A transient assay for the efficiency of hpRNA constructs to silence gene expression in vivo has been described by Panstruga et al. (2003) Mol. Biol. Rep. 30: 135-140, herein

incorporated by reference.

For ihpRNA, the interfering molecules have the same general structure as for hpRNA, but the RNA molecule additionally comprises an intron that is capable of being spliced in the cell in which the ihpRNA is expressed. The use of an intron minimizes the size of the loop in the hairpin RNA molecule following splicing, and this increases the efficiency of interference. See, for example, Smith et al. (2000) Nature 407:319-320. In fact, Smith et al. show 100% suppression of endogenous gene expression using ihpRNA-mediated

interference. Methods for using ihpRNA interference to decrease the expression of endogenous plant genes are described, for example, in Smith et al. (2000) Nature 407:319- 320; Wesley et al. (2001) Plant J. 27:581-590; Wang and Waterhouse (2001) Curr. Opin. Plant Biol. 5: 146-150; Waterhouse and Helliwell (2003) Nat. Rev. Genet. 4:29-38; Helliwell and Waterhouse (2003) Methods 30:289-295, and U.S. Patent Publication No. 20030180945, each of which is herein incorporated by reference.

The expression cassette for hpRNA interference may also be designed such that the sense sequence and the antisense sequence do not correspond to an endogenous RNA. In this embodiment, the sense and antisense sequence flank a loop sequence that comprises a nucleotide sequence corresponding to all or part of the endogenous messenger RNA of the target gene. Thus, it is the loop region that determines the specificity of the RNA

interference. See, for example, WO 02/00904, herein incorporated by reference.

Transcriptional gene silencing (TGS) may be accomplished through use of hpRNA constructs wherein the inverted repeat of the hairpin shares sequence identity with the promoter region of a gene to be silenced. Processing of the hpRNA into short RNAs which can interact with the homologous promoter region may trigger degradation or methylation to result in silencing (Aufsatz et al. (2002) PNAS 99 (Suppl. 4): 16499-16506; Mette et al.

(2000) £M5O J 19(19):5194-5201).

Amplicon expression cassettes comprise a plant virus-derived sequence that contains all or part of the target gene but generally not all of the genes of the native virus. The viral sequences present in the transcription product of the expression cassette allow the transcription product to direct its own replication. The transcripts produced by the amplicon may be either sense or antisense relative to the target sequence (i.e., the messenger RNA for a CKL). Methods of using amplicons to inhibit the expression of endogenous plant genes are described, for example, in Angell and Baulcombe (1997) EMBO J. 16:3675-3684, Angell and Baulcombe (1999) Plant J. 20:357-362, and U.S. Patent No. 6,646,805, each of which is herein incorporated by reference.

In some embodiments, the polynucleotide expressed by the expression cassette of the invention is catalytic RNA or has ribozyme activity specific for the messenger RNA of a CKL. Thus, the polynucleotide causes the degradation of the endogenous messenger RNA, resulting in reduced expression of the CKL. This method is described, for example, in U.S. Patent No. 4,987,071, herein incorporated by reference.

In some embodiments of the invention, a decrease in the expression of CKL may be obtained by RNA interference by expression of a gene encoding a micro RNA (miRNA). miRNAs are regulatory agents consisting of about 22 ribonucleotides. miRNA are highly efficient at decreasing the expression of endogenous genes. See, for example Javier et al. (2003) Nature 425: 257-263, herein incorporated by reference.

For miRNA interference, the expression cassette is designed to express an RNA molecule that is modeled on an endogenous miRNA gene. The miRNA gene encodes an RNA that forms a hairpin structure containing a 22-nucleotide sequence that is

complementary to another endogenous gene (target sequence). For suppression of CKL expression, the 22-nucleotide sequence is selected from a CKL transcript sequence and contains 22 nucleotides of said sequence in sense orientation and 21 nucleotides of a corresponding antisense sequence that is complementary to the sense sequence. miRNA molecules are highly efficient at decreasing the expression of endogenous genes, and the RNA interference they induce is inherited by subsequent generations of plants.

Embodiments of the invention include, but are not limited to, the following

embodiments:

1. A method for enhancing the resistance of a plant or part thereof to an oomycete plant pathogen, the method comprising decreasing the expression level or activity of Crinkle 8 Kinase Like (CKL) in the plant or part thereof.

2. The method of embodiment 1, wherein decreasing the expression level or activity of CKL in a plant or part thereof comprises introducing into at least one plant cell a disruption of the Ckl gene, wherein said disruption decreases the expression level or activity of CKL in said plant cell compared to a corresponding control plant cell lacking disruption of the Ckl gene.

3. The method of embodiment 2, wherein said disruption of the Ckl gene comprises at least one member selected from the group consisting of a DNA insertion, a DNA deletion, and a DNA substitution of at least one base pair in the Ckl gene.

4. The method of embodiment 2 or 3, wherein introducing into at least one plant cell a disruption of the Ckl gene, comprises targeted mutagenesis, homologous recombination, or mutation breeding.

5. The method of embodiment 3 or 4, wherein the DNA insertion comprises (a) a DNA insertion in the 5'UTR of the Ckl gene; (b) a DNA insertion in an exon of the Ckl gene; or (c) a DNA insertion in an intron of the Ckl gene.

6. The method of embodiment 3 or 4, wherein the DNA insertion comprises (a) a DNA insertion in the 5' UTR of the Ckl gene; (b) a DNA insertion in exon 1 of the Ckl gene; (c) a DNA insertion in exon 2 of the Ckl gene; (d) a DNA insertion in exon 3 of the Ckl gene; (e) a DNA insertion in exon 4 of the Ckl gene; (f) a DNA insertion in intron 1 of the Ckl gene; (g) a DNA insertion in intron 2 of the Ckl gene; or (h) a DNA insertion in intron 3 of the Ckl gene.

7. The method of embodiment 6, wherein the Ckl gene comprising the DNA insertion comprises: (a) the nucleotide sequence set forth in SEQ ID NO: 14; (b) the nucleotide sequence set forth in SEQ ID NO: 15; (c) the nucleotide sequence set forth in SEQ ID NO: 16; (d) the nucleotide sequence set forth in SEQ ID NO: 17; or (e) a nucleotide sequence having at least 90% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 or SEQ ID NO: 17.

8. The method of embodiment 2 or 3, wherein said disruption of the Ckl gene comprises a deletion of at least one base pair in the Ckl gene.

9. The method of any one of embodiments 2-8, wherein the disruption of the Ckl gene is a homozygous disruption.

10. The method of any one of embodiments 2-9, wherein the plant cell is regenerated into a plant comprising in its genome the disrupted Ckl gene.

1 1. The method of embodiment 1, wherein decreasing the activity or expression level of

CKL in the plant or plant part thereof comprises introducing a polynucleotide construct into at least one plant cell, the polynucleotide comprising a promoter operably linked to a transcribed region, wherein the promoter is expressible in a plant cell, wherein the transcribed region encodes a modified CKL protein, and wherein the modified CKL protein enhances resistance of the plant or plant part thereof to an oomycete plant pathogen.

12. The method of embodiment 11, wherein said modified CKL protein is not able to associate with plant pathogen effectors.

13. The method of embodiment 12, wherein said plant pathogen effector comprises CRN8.

14. The method of embodiment 13, wherein said CRN8 comprises the CR 8 from Phytophthora infestans.

15. The method of embodiment 1, wherein decreasing the expression level or activity of CKL in the plant or part thereof comprises introducing a polynucleotide construct into at least one plant cell, the polynucleotide comprising a promoter operably linked to a transcribed region, wherein the promoter is expressible in a plant cell, and wherein the transcribed region is designed to produce a transcript for post-transcriptional gene silencing or antisense mediated gene silencing of CKL.

16. The method of embodiment 15, wherein the transcript for post-transcriptional gene silencing comprises an miRNA, an siRNA, an hpRNA or a dsRNA.

17. The method of any one of embodiments 11-16, wherein the polynucleotide construct is stably incorporated into the genome of the plant cell.

18. The method of any one of embodiments 1 1- 17, wherein the plant cell is regenerated into a plant comprising in its genome the polynucleotide construct.

19. The method of any one of embodiments 11-16, wherein the polynucleotide construct is not stably incorporated into the genome of the plant cell.

20. The method of any one of embodiments 1 1- 19, wherein the promoter is selected from the group consisting of pathogen-inducible, constitutive, tissue-preferred, wound- inducible, and chemical-regulated promoters.

21. The method of any one of embodiments 1 -20, wherein the part thereof is selected from the group consisting of a leaf, a stem, a tuber, and a fruit.

22. The method of any of one of embodiments 1-20, wherein the part thereof is a plant cell.

23. The method of any one of embodiments 1-22, wherein the plant is a Solanaceous plant.

24. The method of embodiment 23, wherein the Solanaceous plant is selected from the group consisting of potato, tomato, eggplant, pepper, tobacco, and petunia. 25. The method of any one of embodiments 1-24, wherein the plant is selected from the group consisting of Arabidopsis spp., soybean, grape, castor bean, black cottonwood, Physcomitrella patens, Selaginella moellendorffii, potato, tomato, eggplant, pepper, tobacco, petunia spp., lettuce, pea, bean, spinach, melon, cucumber, squash, Brassica spp., radish, onion, and watermelon.

26. The method of any one of embodiments 1-25, wherein the expression level or activity of the CKL in the plant or the part thereof is decreased when compared to the expression level or activity of CKL in a control plant or the corresponding part of the control plant.

27. The method of any one of embodiments 1-26, wherein the plant comprises enhanced resistance to the oomycete plant pathogen when compared to the resistance of a control plant to the oomycete plant pathogen.

28. The method of any one of embodiments 1-27, wherein the oomycete plant pathogen is a Phytophthora species.

29. The method of embodiment 28, wherein the Phytophthora species is selected from the group consisting of Phytophthora infestans, Phytophthora ramorum, Phytophthora parasitica, Phytophthora ipomoeae, Phytophthora mirabilis, Phytophthora capsici,

Phytophthora porri, and Phytophthora phaseoli.

30. The method of any one of embodiments 1-27, wherein the oomycete plant pathogen is selected from the group consisting of Phytophthora infestans, Phytophthora ipomoeae,

Phytophthora mirabilis, Phytophthora phaseoli, Phytophthora capsici, Phytophthora porri, Phytophthora parasitica, Phytophthora ipomoeae, Phytophthora mirabilis,

Hyaloperonospora arabidopsidis, Peronospora farinosa, Pseudoperonospora cubensis, Hyaloperonospora parasitica, Peronospora destructor, Bremia lactucae, Pseudoperonospora cubensis, Pseudoperonospora humuli, Peronospora destructor, Albugo Candida, Albugo occidentalis, and Pythium spp.

31. A method of producing a plant with enhanced resistance to an oomycete plant pathogen, the method comprising disrupting in a plant cell a Ckl gene, wherein said disruption decreases the expression level or activity of CKL in said plant cell compared to a corresponding control plant cell lacking disruption of the Ckl gene.

32. The method of embodiment 31, wherein said disruption of the Ckl gene comprises at least one member selected from the group consisting of a DNA insertion, a DNA deletion, and a DNA substitution of at least one base pair in the Ckl gene. 33. The method of embodiment 31 or 32, wherein disrupting in a plant cell a Ckl gene, comprises targeted mutagenesis, homologous recombination, or mutation breeding.

34. The method of embodiment 32 or 33, wherein the DNA insertion comprises (a) a DNA insertion in the 5'UTR of the Ckl gene; (b) a DNA insertion in an exon of the Ckl gene; or (c) a DNA insertion in an intron of the Ckl gene.

35. The method of embodiment 32 or 33, wherein the DNA insertion comprises (a) a DNA insertion in the 5' UTR of the Ckl gene; (b) a DNA insertion in exon 1 of the Ckl gene; (c) a DNA insertion in exon 2 of the Ckl gene; (d) a DNA insertion in exon 3 of the Ckl gene; (e) a DNA insertion in exon 4 of the Ckl gene; (f) a DNA insertion in intron 1 of the Ckl gene; (g) a DNA insertion in intron 2 of the Ckl gene; or (h) a DNA insertion in intron 3 of the Ckl gene.

36. The method of embodiment 35, wherein the Ckl gene comprising the DNA insertion comprises: (a) the nucleotide sequence set forth in SEQ ID NO: 14; (b) the nucleotide sequence set forth in SEQ ID NO: 15; (c) the nucleotide sequence set forth in SEQ ID NO: 16; (d) the nucleotide sequence set forth in SEQ ID NO: 17; or (e) a nucleotide sequence having at least 90% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 or SEQ ID NO: 17.

37. The method of embodiment 31, wherein said disruption of the Ckl gene comprises a deletion of at least one base pair in the Ckl gene.

38. The method of any one of embodiments 31-37, wherein the disruption of the Ckl gene is a homozygous disruption.

39. A plant or plant cell produced by the method of any one of embodiments 31-38.

40. A progeny plant of the plant of embodiment 39, wherein the progeny plant comprises the disrupted Ckl gene.

41. The plant or plant cell of embodiment 39 or the progeny plant of embodiment 40, wherein the disruption comprises a non-naturally occurring mutation.

42. The plant or plant cell of embodiment 39 or 41 or the progeny plant of embodiment 40 or 41, wherein the plant, plant cell, or progeny plant is non-trans genie or transgenic.

43. A method of producing a plant with enhanced resistance to an oomycete plant pathogen, the method comprising stably incorporating in the genome of at least one plant cell a polynucleotide construct comprising a promoter operably linked to a transcribed region, wherein the promoter is expressible in a plant cell, and wherein the transcribed region is designed to produce a transcript for post-transcriptional gene silencing or antisense-mediated gene silencing of CKL, wherein the expression of the transcribed region decreases the expression level or activity of CKL in the plant or part thereof.

44. The method of embodiment 43, wherein the transcript for post-transcriptional gene silencing comprises an miRNA, an siR A, an hpR A or a dsRNA.

45. The method of embodiment 43 or 44, wherein the plant cell is regenerated into a plant comprising in its genome the polynucleotide construct.

46. The method of any one of embodiments 31-38 and 43-45, wherein the expression level or activity of the CKL in the plant or part thereof is decreased when compared to the expression level or activity of the CKL in a control plant or the corresponding part of the control plant.

47. The method of any one of embodiments 31-38 and 43-46, wherein the plant comprises enhanced resistance to the oomycete plant pathogen when compared to the resistance of a control plant to the oomycete plant pathogen.

48. The method of embodiment 46 or 47, wherein the part thereof is selected from the group consisting of a leaf, a stem, a tuber, and a fruit.

49. The method of embodiment 46 or 47, wherein the part thereof is a plant cell.

50. The method of any one of embodiments 43-49, wherein the promoter is selected from the group consisting of pathogen-inducible, constitutive, tissue-preferred, wound- inducible, and chemical-regulated promoters.

51. The method of any one of embodiments 31-38 and 43-50, wherein the plant is a

Solanaceous plant.

52. The method of embodiment 51, wherein the Solanaceous plant is selected from the group consisting of potato, tomato, eggplant, pepper, tobacco, and petunia.

53. The method of any one of embodiments 31-38 and 43-50, wherein the plant is selected from the group consisting of Arabidopsis spp., soybean, grape, castor bean, black cottonwood, Physcomitrella patens, Seiagineiia moellendorffli, potato, tomato, eggplant, pepper, tobacco, petunia spp., lettuce, pea, bean, spinach, melon, cucumber, squash, Brassica spp., radish, onion, and watermelon.

54. The method of any one of embodiments 31-38 and 43-53, wherein the oomycete plant pathogen is a Phytophthora species.

55. The method of embodiment 54, wherein the oomycete plant pathogen is selected from the group consisting of Phytophthora infestans, Phytophthora ramorum, Phytophthora parasitica, Phytophthora ipomoeae, Phytophthora mirabiiis, Phytophthora capsici, Phytophthora porri, and Phytophthora phaseoii. 56. The method of any one of embodiments 31-38 and 43-53, wherein the oomycete plant pathogen is selected from the group consisting of Phytophthora infestans, Phytophthora ipomoeae, Phytophthora mirabilis, Phytophthora phaseoli, Phytophthora capsici,

Phytophthora porri, Phytophthora parasitica, Phytophthora ipomoeae, Phytophthora mirabilis, Hyaloperonospora arabidopsidis, Peronospora farinosa, Pseudoperonospora cubensis, Hyaloperonospora parasitica, Peronospora destructor, Bremia lactucae,

Pseudoperonospora cubensis, Pseudoperonospora humuli, Peronospora destructor, Albugo Candida, Albugo occidentalis, and Pythium spp.

57. A plant or plant cell produced by the method of any one of embodiments 1-18, 20- 38 and 43-56.

58. A progeny plant of the plant of embodiment 57, wherein the disruption comprises a non-naturally occurring mutation and/or wherein the progeny plant comprises the polynucleotide construct.

59. A plant comprising in its genome a disruption of the Ckl gene, wherein the expression level or activity of the plant CKL is decreased in the plant, and wherein said plant has enhanced resistance to an oomycete plant pathogen.

60. The plant of embodiment 59, at least one member selected from the group consisting of a DNA insertion, a DNA deletion, and a DNA substitution of at least one base pair in the Ckl gene.

61. The plant of embodiment 60, wherein the DNA insertion comprises (a) a DNA insertion in the 5'UTR of the Ckl gene; (b) a DNA insertion in an exon of the Ckl gene; or (c) a DNA insertion in an intron of the Ckl gene.

62. The plant of embodiment 60, wherein the DNA insertion comprises (a) a DNA insertion in the 5' UTR of the Ckl gene; (b) a DNA insertion in exon 1 of the Ckl gene; (c) a DNA insertion in exon 2 of the Ckl gene; (d) a DNA insertion in exon 3 of the Ckl gene; (e) a DNA insertion in exon 4 of the Ckl gene; (f) a DNA insertion in intron 1 of the Ckl gene; (g) a DNA insertion in intron 2 of the Ckl gene; or (h) a DNA insertion in intron 3 of the Ckl gene.

63. The plant of embodiment 62, wherein the Ckl gene comprising the DNA insertion comprises: (a) the nucleotide sequence set forth in SEQ ID NO: 14; (b) the nucleotide sequence set forth in SEQ ID NO: 15; (c) the nucleotide sequence set forth in SEQ ID NO: 16; (d) the nucleotide sequence set forth in SEQ ID NO: 17; or (e) a nucleotide sequence having at least 90% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 or SEQ ID NO: 17. 64. The plant of embodiment 59, wherein said disruption of the Ckl gene comprises a deletion of at least one base pair in the Ckl gene.

65. The plant of any one of embodiments 59-64, wherein the plant is a seed or a tuber comprising the disrupted Ckl gene.

66. The plant of any one of embodiments 59-65, wherein the disruption of the Ckl gene is a homozygous disruption.

67. The plant of any one of embodiments 59-66, wherein the disruption comprises a non-naturally occurring mutation.

68. The plant of any one of embodiments 59-67, wherein the plant is non-transgenic or transgenic.

69. The plant of any one of embodiments 59-68, wherein the plant is a seed.

70. A transgenic plant comprising stably incorporated in its genome a polynucleotide construct comprising a promoter operably linked to a transcribed region, wherein the promoter is expressible in a plant cell, wherein the transcribed region is designed to produce a transcript for post-transcriptional gene silencing or antisense-mediated gene silencing of

CKL, and wherein the expression of the transcribed region decreases the expression level or activity of CKL in the plant cell, thereby enhancing the resistance of the plant to an oomycete plant pathogen.

71. The transgenic plant of embodiment 70, wherein the transcript for post- transcriptional gene silencing comprises an miR A, an siRNA, an hpRNA or a dsR A.

72. The plant of embodiment 59- 71, wherein the expression level or activity of the CKL in the plant or part thereof is decreased when compared to the expression level or activity of the CKL in a control plant or the corresponding part of the control plant.

73. The plant of any one of embodiments 59-72, wherein the plant comprises enhanced resistance to the oomycete plant pathogen when compared to the resistance of a control plant to the oomycete plant pathogen.

74. The plant of any one of embodiments 59-73, wherein the part thereof is selected from the group consisting of a leaf, a stem, a tuber, and a fruit.

75. The plant of any one of embodiments 59-73, wherein the part thereof is a plant cell. 76. The transgenic plant of any one of embodiments 70-75, wherein the promoter is selected from the group consisting of pathogen-inducible, constitutive, tissue-preferred, wound-inducible, and chemical-regulated promoters.

77. The plant of any one of embodiments 59-76, wherein the plant is a Solanaceous plant. 78. The plant of embodiment 77, wherein the Solanaceous plant is selected from the group consisting of potato, tomato, eggplant, pepper, tobacco, and petunia.

79. The plant of any one of embodiments 59-76, wherein the plant is selected from the group consisting of Arabidopsis spp., soybean, grape, castor bean, black cottonwood, Physcomitrella patens, Selaginella moellendorffii, potato, tomato, eggplant, pepper, tobacco, petunia spp., lettuce, pea, bean, spinach, melon, cucumber, squash, Brassica spp., radish, onion, and watermelon.

80. The transgenic plant of any of embodiments 69-78, wherein the transgenic plant is a seed or a tuber comprising the polynucleotide construct.

81. The plant of any one of embodiments 59-80, wherein the oomycete plant pathogen is a Phytophthora species.

82. The plant of embodiment 81, wherein the oomycete plant pathogen is selected from the group consisting of Phytophthora infestans, Phytophthora ipomoeae, Phytophthora mirabilis, Phytophthora phaseoli, Phytophthora capsici, Phytophthora porri, Phytophthora parasitica, Phytophthora ipomoeae, Phytophthora mirabilis, Hyaloperonospora

arabidopsidis, Peronospora farinosa, Pseudoperonospora cubensis, Hyaloperonospora parasitica, Peronospora destructor, Bremia lactucae, Pseudoperonospora cubensis, Pseudoperonospora humuli, Peronospora destructor, Albugo Candida, Albugo occidentalis, and Pythium spp.

83. A fruit, seed, or tuber produced by the plant of any one of embodiments 39-42 and

57-82.

84. A food product produced using the fruit, seed, or tuber of embodiment 83.

85. A method of limiting disease caused by an oomycete pathogen in agricultural crop production, the method comprising planting the plant according to any one of embodiments 39-42 and 57-82 and exposing the plant to conditions favorable for growth and development of the plant.

86. The method of embodiment 85, wherein the plant is grown outdoors or in a greenhouse.

87. The method of embodiment 85 or 86, further comprising harvesting an agricultural product produced by the plant.

88. The method of embodiment 87, wherein the product is a fruit, a leaf, or a tuber.

89. Use of the plant of any one of embodiments 39-42 and 57-82 in agriculture.

90. The use of embodiment 89, wherein the plant is a seed or a tuber. 91. A method for enhancing the resistance of a plant or part thereof to an oomycete pathogen, the method comprising topically applying onto said plant or part thereof a polynucleotide composition comprising at least one polynucleotide having sequence essentially identical to, or essentially complementary to, a sequence of 18 or more contiguous nucleotides in either an endogenous Ckl gene or messenger RNA transcribed from the Ckl gene and an effective amount of a transferring agent to permit said at least one polynucleotide to permeate the interior of said plant or part thereof, wherein said at least one polynucleotide decreases the expression of said endogenous Ckl gene.

92. The method of embodiment 91, wherein the at least one polynucleotide sequence comprises a ssDNA, a dsDNA, a ssRNA, a dsR A, or a R A/DNA hybrid.

93. The method of embodiment 84, wherein the Ckl gene comprises the nucleotide sequence set forth in any one of SEQ ID NOS: 10 and 24-67.

The following examples are offered by way of illustration and not by way of limitation.

EXAMPLES

Example 1

Summary

Cellular plant processes that determine host suitability and are required to establish infection are largely unknown. We identified a plant gene, Crinkle 8 kinase like (Ckl) that is required for pathogenicity. CKL carries a homologous domain of the Phytophthora infestans CRN8 effector. The CRN8 effector from P. infestans is required for full pathogenicity. CKL and CR 8 both encode for Serine/Threonine RD kinases. We also show that the CKL can associate with the CRN8 effector. Oligomerization of kinases could be important for further regulation of downstream processes. Therefore we propose that regulation process of the plant CKL protein is hijacked by the Phytophthora infestans CRN8 effector to cause pathogenicity.

Introduction

Effector molecules produced by infectious microbes are known to suppress plant defenses, alter plant metabolism or manipulate host development in favor of pathogen growth (Hogenhout, S. A., et al, 2009, Mol. Plant Microbe Interact. 22(2): 115-122). This is a fascinating concept because although the effector is encoded in the pathogen genome, it traffics into the host to function inside the plant cellular environment (Whisson, S. C, et al, 2007, Nature. 450(7166): 115-118; Schornack, S., et al, 2010, Proc Natl Acad Sci USA. 107(40): 17421-17426). Effectors that mimic specific plant processes have been observed for several pathogen systems. Some pathogens secrete effectors that are analogs or mimics of plant hormones (Hogenhout, S. A., et al, 2009, Mol. Plant Microbe Interact. 22(2): 1 15- 122). Others, such as the bacterial ubiquitin ligase AvrPtoB, mimic plant enzymes

(Abramovitch, R. B., et al, 2006, Proc Natl Acad Sci USA 103(8): 2851-2856).

It is now established that oomycetes, such as P. infestans, secrete an arsenal of effector proteins that modulate plant innate immunity to enable infection (Schornack, S., et al., 2010, Proc Natl Acad Sci USA. 107(40): 17421-17426). Phytophthora infestans is the causal agent of late blight on potato and tomato. Most of the host-translocated (cytoplasmic) effectors from P. infestans lack similarity to known proteins and have uncharacterized biochemical activities (Hardham, A. R. and D. M. Cahill, 2010, Functional Plant Biology. 37(10): 919-925). One exception is the effector AVR3b from Phytophthora sojae. The C- terminus of AVR3b contains a udix hydrolase motif and this motif might mimic plant Nudix hydrolases, which are known to act as negative regulators of plant immunity (Dong, S., et al., 201 1, PLoS Pathog. 7(11): el002353). Another cytoplasmic effector that has similarity to a known protein domain is CRN8 from P. infestans. The CRN8 effector domain has similarity to plant Serine/Threonine RD kinases (Haas, B. J., et al., 2009, Nature.

461(7262): 393-398). CRN 8 trafficking into the host plant requires a functional LFLAK motif located at the N-terminus of the CRN8 protein (Schornack, S., et al, 2010, Proc Natl Acad Sci USA. 107(40): 17421-17426). Recently it was shown that the CRN8 C-terminus has kinase activity in the plant and that this domain enhances P. infestans virulence (Van Damme, M., et al, 2012, PLoS Pathog. 8(8): el002875).

The finding that CRN8 is an active kinase raises the possibility that this effector might mimic a specific class of plant enzymes. Which plant processes does the effector CRN8 mimic or 'hijack' to interfere with plant immunity? And more specifically, how does the secreted P. infestans CRN8 kinase effector perturb the complex kinase signaling network that modulates plant immunity? Remarkably, similarity searches to databases revealed that plants have genes with significant similarity to the kinase domain of CRN8. In this study, we undertook the logical step to determine the extent to which this plant family of kinase-like proteins are involved in plant-pathogen interactions. Plant factors that are required for pathogen growth have been identified using plant mutant screens and are typically termed loss of susceptibility mutants. The best known mutant is the recessive mlo from Barley. The Mlo locus confers broad spectrum resistance to the fungal powdery mildew pathogen, Erysiphe graminis f. sp. hordei (Buschges, R., K., et al., 1997, Cell. 88(5): 695-705). In Arabidopsis multiple susceptibility mutants have been identified for several pathogens, such as viruses (loss-of-susceptibility to potyviruses, hp), Erysiphe cichoracearum fungus (powdery mildew resistance, pmr), and the oomycete Hyaloperonospora arabidopsidis (downy mildew resistance, dmr) (Vogel, J. and S.

Somerville, 2000, Proc. Natl. Acad. Sci. USA. 97(4): 1897-1902; Lellis, A. D., et al, 2002, Curr. Biol. 12(12): 1046-1051 ; Van Damme, M., et al, 2005, Mol. Plant Microbe Interact. 18(6): 583-592). These loss of susceptibility (or enhanced resistance) mutations potentially occur in genes that encode for proteins that are utilized by the pathogen to colonize the host, for instance by being utilized or targeted by effectors. Interestingly, the encoding proteins of the known susceptibility genes turned out to encode a diversity of functions. MLO and PMR2 (AT1G1 1310) are plasma membrane proteins with seven transmembrane domains; LSP1

(AT5G35620) is a translation factor eIF(iso)4E, PMR4 (AT4G03550) is a 1,3-beta-D-glucan synthase, PMR5 (AT5G58600) is a protein of unknown function, PMR6 (AT3G54920) is a pectate lyase-like protein, DMR1 (AT2G17265) a homoserine kinase, DMR6 (AT5g24530) a putative 20G-Fe(II) oxygenase, RSP1 (At5gl4060) an aspartate kinase 2, and RSP2 dihydrodipicolinate synthase 2 (At2g45440) (Devoto, A., et al, 1999, J. Biol. Chem. 274(49): 34993-35004; Lellis, A. D., et al, 2002, Curr. Biol. 12(12): 1046-1051; Vogel, J. P., et al, 2002, Plant Cell. 14(9): 2095-2106; Nishimura, M. T., et al, 2003, Science. 301(5635): 969- 972; Vogel, J. P., et al, 2004, Plant J. 40(6): 968-978; Consonni, C, et al, 2006, Nat. Genet. 38(6): 716-720; Van Damme, M., et al, 2008, Plant J. 54(5): 785-793; Van Damme, M., et al, 2009, Plant Cell. 21(7): 2179-2189; Stuttmann, J., et al, 201 1, Plant Cell. 23(7): 2788- 2803). In some cases, the underlying cellular process is known to some extent. For example, in the dmrl and the rarl suppressor (rsp) mutations, resistance to H. arabidopsidis is probably caused by disorders within the plant amino acid homeostasis, e.g. the accumulation of homoserine (dmrl and in minor levels in rsp) or threonine (rsp) (Van Damme, M., et al, 2009, Plant Cell. 21(7): 2179-2189; Stuttmann, J., et al, 201 1, Plant Cell. 23(7): 2788-2803).

In this study, we link our previous work on the host-translocated effector CRN8 to a host susceptibility factor, a homologous plant kinase-like protein. We show that the CKL plant protein encodes a serine/threonine kinase (AT5G51800) and that its expression enhances pathogenicity. We also observed that the CKL protein associates with CRN8 in planta, suggesting that the CRN8 effector may have evolved to mimic the plant CKL to facilitate P. infestans infection. Given that CKL orthologs are present in all higher plants this work points to agricultural applications, e.g. using CKL loss-of-function mutants to engineer enhanced resistance to oomycete diseases.

Example 2: The CRN8 effector from Phytophthora infestans has high sequence similarity to a serine/threonine kinase from plants.

The C-terminal effector domain, the D2 domain of CR 8 has similarity to plant Serine/Threonine RD kinases (Haas, B. J., et al, 2009, Nature. 461(7262): 393-398; Van Damme, M., et al, 2012, PLoS Pathog. 8(8): el002875). We performed a BLAST search by using the kinase domain of CRN8 and identified CRN8 homologs in numerous plant species. To illustrate the level of similarity to plant homologs we performed a multiple sequence alignment of the amino acid sequences of CRN8 and CKL from arabidopsis, Glycine max (Gm, soybean), Solanum lycopersicum (SI, tomato), Vitis vinifera (Vv, grapevine), Ricinus communis (Rc, castor bean), Populus trichocarpa (Pt, black cottonwood), Physcomitrella patens (Pp, moss), and Selaginella moellendorffii (Sm, lycophyte) (Fig. 2). The CKL proteins of moss and lycophyte share 33% and 32% identity to z^'_CRN8, respectively. The shared amino acid sequence identity of the other plant species with the P. infestans CRN8 kinase varies from 28% to 41%, for Arabidopsis and Soybean respectively. The RD site is indicated in Figure 2 below the z^'_CRN8 sequence and the asterisks depict the phosphorylated serines (Van Damme, M., et al., 2012, PLoS Pathog. 8(8): el002875). From our BLAST search we can conclude that homologs of the kinase domain from the z^'_CRN8 effector are present in multiple plant species and mosses. The catalytic RD site is conserved in all, but the previously identified phosphorylated serines are not. From the phylogenetic analysis including the plant species, the moss and the lycophyte CRN8 kinase amino acid sequence (Fig. 1) we can conclude that the moss and the lycophyte are more related to the z^'_CRN8 kinase sequence. The presence of CRN8 homologs in these eight different species points to a conserved gene that may perform an important function in plants. Example 3: Tomato Ckl gene expression is induced during infection by P. infestans

To assess the expression level of the tomato Ckl (Sl_Ckl) gene during pathogenicity we isolated RNA from tomato leaves at different time points following inoculation with P. infestans and performed reverse transcriptase-PCR assays. The tomato Ckl amplified transcripts from the various tomato cDNA samples were shown by agarose gel electrophoresis (Fig. 3 A). The presence of cDNA template in all samples was verified and confirmed by the detection of tomato glyceraldehyde 3 -phosphate dehydrogenase (Sl_Gph) transcript in all tested samples (Fig. 3B). The Ckl tomato transcript was only detectable two days post infection with P. infestans indicating that Sl_Ckl expression is strongly induced during the biotrophic phase of tomato infection by P. infestans.

Example 4: Arabidopsis CKL is required for susceptibility to the oomycete downy mildew H. arabidopsidis

To determine if Arabidopsis Ckl (AT5G51800) plays a role in interaction with an oomycete pathogen, we identified Arabidopsis T-DNA insertion mutants within the Ckl gene, and performed pathogenicity assays with the downy mildew pathogen Hyaloperonospora arabidopsidis. Arabidopsis homozygous T-DNA lines were generated for four different T- DNA insertion allelic mutants (Fig. 4A). The location of the T-DNA insertions for the four alleles, ckll-1 (SAIL_740_E05), ckll-2 (SAIL_1185_H03), ckll-3 (SALKJ00819) and ckll-4 (SALK_063450) that were tested are indicated in Fig. 4A. H. arabidopsidis virulence (Waco-9 isolate) was compared to Col-0 the wild type parental background. Landsberg-er (Ler) was used as a negative control for the Col-0 accession-specific Waco-9 isolate of H. arabidopsidis. All four allelic T-DNA insertion mutants showed reduced H. arabidopsidis sporulation (Fig. 4B). We conclude that the Arabidopsis Ckl gene is required for full susceptibility to H. arabidopsidis.

In addition we generated overexpression lines of Arabidopsis Ckl gene. Three independent lines were generated and assayed (Fig. 5). All three lines increased susceptibility to H. arabidopsidis, compared to the parental Col-0 line. The Arabidopsis Ckl gene can therefore be defined as a susceptibility gene to the Arabidopsis downy mildew pathogen.

Example 5: Phytophthora infestans CRN8 effector associates with Arabidopsis CKL

We previously showed that CRN8 from P. infestans forms a dimer in planta (Van Damme, M., et al, 2012, PLoS Pathog. 8(8): el002875). To determine if CRN8 associates with CKL we co-expressed FLAG-tagged CRN8 and GFP-tagged Arabidopsis CKL fusion proteins in planta and performed co-immunoprecipitation experiments. Fig. 6A illustrates the CRN8 and CKL co-expressed protein combination. As a negative control, Pto-3HAF (containing HA and FLAG tags) (Mucyn, T. S., et al, 2006, Plant Cell. 18(10): 2792-2806) was co-expressed with GFP-tagged Arabidopsis CKL. Protein expression of all constructs was verified by Western blot prior to immunoprecipitation for FLAG tagged proteins and post immunoprecipitation for GFP tagged proteins (Fig. 6B, C). After immunoprecipitation with a-GFP sera, we observed that the GFP:CKL fusion protein pulled down FLAG:CRN8 indicating that CKL associates with CRN8 in planta. The Pto-3HAF FLAG tagged protein was not co-immunoprecipitated by GFP: CKL. From this co-immunoprecipitation we conclude that Arabidopsis CKL associates with the P. infestans CRN8 effector protein, possibly resulting in the formation of a heterodimer.

Example 6: Heterologous expression of the Phytophthora infestans CRN8 kinase dead mutant, CR] 8^R469A;D470A ₉ ^m Arabidopsis enhances resistance to H. arabidopsidis

Previously we showed that transient expression of cj¾y[g^R469A;D470A _m plants reduced

P. infestans virulence. To determine whether this also applies to the Arabidopsis-H.

arabidopsidis pathosystem, we generated Arabidopsis lines over-expressing GFP tagged CRN8^R469A'^D470A and assayed two independent lines with H. arabidopsidis. Both lines were generated in the Col-0 edsl-2 mutant background, which is highly susceptible to H.

arabidopsidis. The high level of H. arabidopsidis growth in the edsl-2 mutant background should facilitate the detection of increased resistance phenotypes. The graph in Fig. 7 shows that the two independent Arabidopsis lines that express CR 8^R469A;D470A, E3232 and E3253, show a reduction in H. arabidopsidis spore production compared to the parental Col-0 edsl-2 background. We conclude that heterologous expression of CRN8^R469A;D470A causes increased H. arabidopsidis resistance.

Example 7: P. infestans CRN8 mutants destabilize Arabidopsis CKL protein

Previously we showed that the CR]\[g^R469A>D470A kinase dead mutant destabilizes the wild type CR 8 effector protein when the two are co-expressed in planta (Van Damme, M., et al, 2012, PLoS Pathog. 8(8): el002875). Here we tested if the protein levels of

Arabidopsis CKL were affected in the presence of CRN8^R469A;D470A and other CRN 8 mutants. Five combinations of Agrobacterium tumefaciens strains containing, FLAG:CRN8,

FLAG:CRN8^D470N, FLAG:CRN8 ^R469A;D470A FLAG:CRN8^3xStoA, or FLAG:CRN8^5xStoA, with GFP:CKL constructs were co-infiltrated into Nicotiana benthamiana leaves and proteins were extracted two days post infiltration. Protein levels were examined by Western blotting (Fig. 8A, C). Loading controls were visualized by Coomassie stain (Fig. 8B, D) and indicated equal loading of all protein samples. We observed that FLAG:CRN8^D470N, FLAG:CRN8 R469A;D47OA _{and FL}AG:CRN8^5xSt°^A reduced the levels of GFP: CKL protein compared to the wild-type FLAG:CRN8 and to FLAG:CRN8^3xStoA. We conclude that CRN8 ^R469A;D470A and other mutants of CRN8 destabilize Arabidopsis CKL in planta and could explain the observed enhanced resistance to H. arabidopsidis (Fig. 7).

Discussion

Prior to this work we described the CRN8 protein, a host-translocated kinase effector of the Irish potato famine pathogen Phytophthora infestans (Van Damme, M., et al, 2012, PLoS Pathog. 8(8): el002875). The D2 kinase domain of CRN8 effector was required for full virulence of P. infestans (Van Damme, M., et al., 2012, PLoS Pathog. 8(8): el002875).The D2 kinase domain of CR 8 effector has similarity to a serine/threonine RD kinase domain (Haas, B. J., et al, 2009, Nature. 461(7262): 393-398; Van Damme, M., et al, 2012, PLoS Pathog. 8(8): el002875). We have termed the plant homologs of the D2 CRN8 kinase domain CRN8 Kinase Like (CKL). The presence of CKL in already the eight of the different plant species tested indicates that the CKL kinases may be important for general plant processes. Initially, we showed that the tomato Ckl gene expression is up-regulated during the interaction in the biotrophic phase of the tomato-Phytophthora infestans interaction (Fig. 3). Secondly, we found that a functional Arabidopsis Ckl gene is required for full

Hyaloperonospora arabidopsidis pathogenicity (Fig. 4B). In addition, given that kinases, including the P. infestans CRN8 effector, often form dimers and heterodimers (Pelech, S., 2006, J. Biol. 5(5): 12; Van Damme, M., et al, 2012, PLoS Pathog. 8(8): el002875), we could show that P. infestans CRN8 effector heterodimerizes with its Arabidopsis CKL homolog (Fig. 6). Previously we showed that the CRN8 kinase dead protein,

CRN8^R469A;D470A, destabilized the P. infestans CRN8 protein (Van Damme, M., et al, 2012, PLoS Pathog. 8(8): el002875). And here we show that the _CR 8^R469A;D470A also destabilizes the Arabidopsis CKL protein (Fig.8). In planta over expression of the FLAG tagged CR]\[g^R469A;D470A reduced H. arabidopsidis pathogenicity in Arabidopsis (Fig. 7).

Therefor we can extrapolate that the over expression of CR]\[g^R469A;D470A j_s destabilizing the native CKL protein and as such the proper activation and subsequent cellular activities of the host CKL protein. In the genome sequence of H. arabidopsidis we could not identify a P. infestans CRN8 homolog (Not shown). Still the absence of the Arabidopsis CKL protein causes H. arabidopsidis resistance (Fig. 4B) and overexpression of the Arabidopsis Ckl gene shows enhanced H. arabidopsidis susceptibility (Fig. 5). So H. arabidopsidis could utilize other manners than solely a D2 kinase containing homologous effector to regulate the CKL pathway to facilitate growth. Nonetheless both oomycetes, P. infestans and H. arabidopsidis probably require similar downstream cellular activities depending on a functional CKL protein. Because CKL contains a kinase domain we can envision that the underlying downstream cellular mechanism leading to susceptibility is involving kinase activity. Kinase activity is mostly identified as a prerequisite for a fully functional immune response, resulting in a resistance, and we identified a kinase that is required for susceptibility.

What are susceptibility genes?

The easiest depiction of susceptibility genes is that these are genes that are required for susceptibility. But the term susceptibility genes is actually questionable. Firstly because several mutations within susceptibility genes cause alterations in the plant leading (1) directly or indirectly to up-regulation of defence, e.g. salicylic acid levels for the pmr4 and dmr6 mutant (Nishimura, M. T., et al, 2003, Science. 301(5635): 969-972), (2) inhibition of the pathogen to enter the plant for example the cell-wall composition that is altered in pmr5 and pmr6 (Vogel, J. P., et al, 2002, Plant Cell. 14(9): 2095-2106; Vogel, J. P., et al, 2004, Plant J. 40(6): 968-978) or (3) changes in the plant that are disadvantage to the pathogen dmrl, rpsl and rps2. (Stuttmann, J., et al, 201 1, Plant Cell. 23(7): 2788-2803) and maybe have a certain accumulation of toxic compound that are notable for the pathogen but not causing the typical e.g. PR-1 up-regulated transcript, SA/JA/ET in-/decrease, dwarf phenotype read outs that is nowadays commonly used in plant pathology research. So for many susceptibility genes the cellular processes or putative mechanisms are well studied from the plant side, but thus far the factors that regulate susceptibility genes from the pathogen are unknown. Here we show that the function of the plant CKL protein could be controlled by the CRN 8 effector from P. infestans, to facilitate the pathogens growth.

Is CKL a target of CRN8?

The main function of the plant CKL likely is not being the target of the P. infestans

CRN8 effector, and we assume that CKL has a yet not identified relevant function inside the plant. CKL probably has a function in planta based on the presence of the conserved CRN8 D2 kinase domain, including an intact RD site, in at least eight diverse species. In addition when we immunopurified GFP tagged At_ KL that was transiently expressed in N.

benthamiana we could detect the phosphorylated CKL protein via in gel phosphostain, indicating that the CKL protein is phosphorylated (data not shown) and demonstrating that the CKL is a functional kinase. Nevertheless, CKL is regulated by the pathogen on both the transcript and protein (heterodimerisation) level, and presence of CKL contributes to pathogen growth. Therefore we conclude that CKL could be part of the plant process that is hijacked by the pathogen to interfere with plant immunity.

Materials and Methods

CKL amino acid alignment and phylogenetic analysis: ClustalW was used to generate an alignment (Larkin, M. A., et ah, 2007, Bioinformatic . 23(21): 2947-2948). The alignment was visualised by using BOXSHADE. The phylogenetic tree with branch lengths and bootstrap values was generated using the Phylogeny.fr tool with the one click mode

(Dereeper, A., et al, 2008, Nucleic Acids Res. 36: W465-469).

Reverse transcription PCR: The presence of the tomato CKL transcripts was tested for various infection time points on P. infestans detached tomato leaf assay, as describe in pathogenicity assay below. Leaf material was ground using liquid nitrogen and RNA was isolated using the RNeasy kit (Qiagen) including on the column DNAse treatment, all according manufacturers' proceedings. cDNA was generated from 5 μg of total RNA, using the RevertAid™ H Minus First Strand cDNA Synthesis kit (Fermentas) and the oligo-dT(18) primer, all according manufacturers' proceedings. 1 μΐ of cDNA was used for the PCR to amplify tomato C8L (Tom_CRN8_SilF_MvD: 5'- gcg gga tec gga gat gac tec gaa tac agt tgt gag -3' (SEQ ID NO: 18) and Tom_CRN8_SilRl_MvD: 5'- gcg ggg ccc gaa aga tea tga agt gcg acc aac gc -3') (SEQ ID NO: 19) and tomato G3P (G3P_F_TB: 5'- atg get tct cat gca get tt- 3' (SEQ ID NO: 20) and G3P_R_TB: ate ctg tgg tct tgg gag tg-3') (SEQ ID NO: 21) gene specific fragments. PCRs were carried out in a 25 μΐ volume and 35 cycles or 28 cycles were used for amplification of the Sl-Ckl and G3P fragments, respectively. 5 μΐ of the PCR products were separated on a 2% agarose visualized by ethidium bromide staining.

Cloning procedures and plasmid constructs: The TMV-based expression constructs were generated by amplifying z^'_CRN8 variants with the Pad restriction site and FLAG sequence embedded in the forward primer and the Notl restriction site included in the reverser primer (Van Damme, M., et ah, 2012, PLoS Pathog. 8(8): el002875). These amplicons were then site-directionally cloned into the pTRBO vector (Lindbo, J. A., 2007, Plant Physiol. 145(4): 1232-124). Ligation reactions of pTRBO constructs were directly transformed into A.

tumefaciens GV3101 by electroporation. The GFP fused clones were constructed by cloning the C-terminal CRN8 or the full length Arabidopsis At-Ckl amplicons into the pENTR/D- TOPO (Invitrogen) entry vector followed by Gateway LR recombination (Invitrogen) into pK₇WGF₂ (Karimi, M., et al, 2002, Trends Plant Sci. 7(5): 193-195), resulting in GFP fused Arabidopsis CKL clones. For all z^'_CRN8 generated constructs see van Damme et ah, (2012, PLoS Pathog. 8(8): el002875), and the primers to amplify the full length Arabidopsis At_Ckl amplicons are AT_CRN8 _pENTR_F: caccatgggtgagacaacaaaaggagatgc (SEQ ID NO: 22) and AT_CRN8_pENTR_R: ctaatacgacgatgtactggctgattgaacc (SEQ ID NO: 23). All generated sequences were verified to exclude errors.

Transient in planta protein expression: In planta transient expression by Agro-infiltration (A. tumefaciens T-DNA 35 S promoter based binary constructs) or Agro-infection (TMV- based binary constructs, (Lindbo, J. A., 2007, Plant Physiol. 145(4): 1232-124) was performed. A. tumefaciens GV3101 (Van Larebeke, N., et ah, 1914, Nature. 252(5479): 169- 170) was used to deliver T-DNA constructs into 3-week-old N. benthamiana plants.

Overnight A tumefaciens cultures were harvested by centrifugation at 10,000 g, suspended in infiltration medium [10 mM MgCi₂, 5 mM 2-(N-morpholine)-ethanesulfonic acid (MES), pH 5.3, and 150 mM acetosyringone] to an OD⁶⁰⁰ = 0.3 prior to syringe infiltration into either the entire leaf or leaf sections. For experiments in which co-expression of two constructs was performed in equal ratios, each construct had an OD⁶⁰⁰=0.6.

Protein extractions: Proteins were transiently expressed by A. tumefaciens in N.

benthamiana leaves and harvested two days post infiltration. Immunoblot analyses were performed on protein extracts prepared by grinding leaf samples in liquid nitrogen and extracting in protein extraction buffer [1 gram in 3 ml extraction buffer (150mM Tris-HCl pH 7.5; 150 mM NaCl; 10 % glycerol; 10 mM EDTA; and freshly added 20 mM NaF: 10 mM DTT; 0.5 % (w/v) PVPP; 1 % (v/v) protease inhibitor cocktail (Sigma); 1 % (v/v) NP-40)]. Suspensions were mixed and centrifuged at 5000 rpm for 15 minutes at 4°C. The supernatant was passed through a through 0.45 μιη filter before loading.

Immunoblot Analyses: Protein samples (25 μΐ) were separated by SDS-PAGE (12%) and analyzed by Western blot. PVDF membranes were incubated and washed between different incubation steps with TBS-T (20 mM Tris-HCl, pH 7.5 150mM NaCl + 0.1% Tween).

Monoclonal a-FLAG M2 antibody (Sigma-Aldrich) was used as a primary antibody at 1 :8000 (in 5% milk), and anti-mouse antibody conjugated to horseradish peroxidase (HRP, Sigma-Aldrich) was used as a secondary antibody at a 1 :20,000 dilution. For GFP immunoblots, monoclonal a-GFP (Invitrogen) was used as a primary antibody at 1 :4000, and anti-rabbit polyclonal antibody conjugated to horseradish peroxidase (HRP, Sigma-Aldrich) was used as a secondary antibody (1 : 12,000 dilution). Blots were developed using the Pierce Horseradish Peroxidase detection kit (Thermo Scientific) and exposed for 2 min on

Amersham Hyperfilm ECL (GE Healthcare). Blots were stained with Coomassie (Instant Blue, Expedeon) to visualize protein loading.

Protein purification: Proteins were extracted from plant material as described above and immuno-purified by FLAG or GFP affinity chromatography. For FLAG immuno- purification: 2.0 ml of extracted protein was incubated with 50 μΐ anti-FLAG M2 affinity matrix (Sigma) and rotated for 1.5 hr at 4°C followed by 5x wash (centrifuge 30 seconds at 800x g) with 1 ml 50 mM Tris/HCl. Proteins were eluted with 100 μΐ IP buffer containing 3 μΐ of 3xFLAG peptide (150ng/ μΐ), in 97 μΐ 50 mM Tris/HCl for 30 minutes, shaking gently at 4°C. Samples were centrifuged for 1 minute at 16,000x g and supernatants were saved for either kinase assays or in gel analysis. For the GFP immuno-purification: 1.5 ml of extracted protein were incubated with 20 μΐ GFP affinity matrix (Chromotek) and rotated for 4 hr at 4°C followed by 5x wash (1 ml TBS + 0.5 % NP-40 ) and centrifugation (0.5x g) to pellet beads. 40 μΐ of lx Laemmli sample buffer was added and samples were denatured for 5 minutes at a 95°C boil.

Pathogenicity assays: Phytophthora infestans infection assays were performed on detached tomato leaves. Tomato leaves of accession OH7814, were spray inoculated with water or P. infestans spores (isolate H88069; 100 spores/μΕ). Infected leaves were kept at room temperature under high humidity. Of the infected leaves, three leaves were sampled per time point (1, 2, 3 and 4 days post infection). Of the water sprayed leaves time-point 1 and 4 days post treatment was isolated.

Hyaloperonospora arabidopsidis infection assays were performed according to van Damme et al. (2005, Mol. Plant Microbe Interact. 18(6): 583-592). In brief, inoculations of spore solutions of the Waco-9 isolate (50,000 spores per mL) were sprayed on Arabidopsis seedlings (two weeks old). Spores were quantified 10 days after infection. One mL of water was added to each rosette to release the spores. The re-isolated spores were quantified by counting spore amounts in Ιμΐ_^ drops for five independent drops. The rosettes were dried between tissue paper and fresh weights were determined. The assay was repeated at least three times, and a representative dataset is used.

The article "a" and "an" are used herein to refer to one or more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one or more element.

Throughout the specification the word "comprising," or variations such as

"comprises" or "comprising," will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.

All publications and patent applications mentioned in the specification are indicative of the level of those skilled in the art to which this invention pertains. All publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.

Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be obvious that certain changes and modifications may be practiced within the scope of the appended claims.

Claims

THAT WHICH IS CLAIMED:

2. The method of claim 1, wherein decreasing the expression level or activity of CKL in a plant or part thereof comprises introducing into at least one plant cell a disruption of the Ckl gene, wherein said disruption decreases the expression level or activity of CKL in said plant cell compared to a corresponding control plant cell lacking disruption of the Ckl gene.

3. The method of claim 2, wherein said disruption of the Ckl gene comprises at least one member selected from the group consisting of a DNA insertion, a DNA deletion, and a DNA substitution of at least one base pair in the Ckl gene.

4. The method of claim 2 or 3, wherein introducing into at least one plant cell a disruption of the Ckl gene, comprises targeted mutagenesis, homologous recombination, or mutation breeding.

5. The method of claim 3 or 4, wherein the DNA insertion comprises

(a) a DNA insertion in the 5'UTR of the Ckl gene;

(b) a DNA insertion in an exon of the Ckl gene; or

(c) a DNA insertion in an intron of the Ckl gene.

6. The method of any one of claims 2-5, wherein the disruption of the Ckl gene is a homozygous disruption.

7. The method of any one of claims 2-6, wherein the plant cell is regenerated into a plant comprising in its genome the disrupted Ckl gene.

8. The method of claim 1, wherein decreasing the activity or expression level of CKL in the plant or plant part thereof comprises introducing a polynucleotide construct into at least one plant cell, the polynucleotide comprising a promoter operably linked to a transcribed region, wherein the promoter is expressible in a plant cell, wherein the transcribed region encodes a modified CKL protein, and wherein the modified CKL protein enhances resistance of the plant or plant part thereof to an oomycete plant pathogen.

9. The method of claim 8, wherein said modified CKL protein is not able to associate with plant pathogen effectors.

10. The method of claim 9, wherein said plant pathogen effector comprises CRN8.

1 1. The method of claim 10, wherein said CRN8 comprises the CRN8 from Phytophthora infestans.

12. The method of claim 1, wherein decreasing the expression level or activity of CKL in the plant or part thereof comprises introducing a polynucleotide construct into at least one plant cell, the polynucleotide comprising a promoter operably linked to a transcribed region, wherein the promoter is expressible in a plant cell, and wherein the transcribed region is designed to produce a transcript for post-transcriptional gene silencing or antisense mediated gene silencing of CKL.

13. The method of claim 12, wherein the transcript for post-transcriptional gene silencing comprises an miRNA, an siR A, an hpR A or a dsRNA.

14. The method of any one of claims 8-13, wherein the polynucleotide construct is stably incorporated into the genome of the plant cell.

15. The method of any one of claims 8-14, wherein the plant cell is regenerated into a plant comprising in its genome the polynucleotide construct.

16. The method of any one of claims 8-13, wherein the polynucleotide construct is not stably incorporated into the genome of the plant cell.

17. The method of any one of claims 1-16, wherein the plant is selected from the group consisting of Arabidopsis spp., soybean, grape, castor bean, black cottonwood, Physcomitrella patens, Selaginella moellendorffii, potato, tomato, eggplant, pepper, tobacco, petunia spp., lettuce, pea, bean, spinach, melon, cucumber, squash, Brassica spp., radish, onion, and watermelon.

18. The method of any one of claims 1-17, wherein the expression level or activity of the CKL in the plant or the part thereof is decreased when compared to the expression level or activity of CKL in a control plant or the corresponding part of the control plant.

19. The method of any one of claims 1-18, wherein the plant comprises enhanced resistance to the oomycete plant pathogen when compared to the resistance of a control plant to the oomycete plant pathogen.

20. The method of any one of claims 1-19, wherein the oomycete plant pathogen is a Phytophthora species.

21. The method of any one of claims 1-19, wherein the oomycete plant pathogen is selected from the group consisting of Phytophthora infestans, Phytophthora ipomoeae, Phytophthora mirabilis, Phytophthora phaseoli, Phytophthora capsici, Phytophthora porri, Phytophthora parasitica, Phytophthora ipomoeae, Phytophthora mirabilis,

22. A method of producing a plant with enhanced resistance to an oomycete plant pathogen, the method comprising disrupting in a plant cell a Ckl gene, wherein said disruption decreases the expression level or activity of CKL in said plant cell compared to a corresponding control plant cell lacking disruption of the Ckl gene.

23. The method of claim 22, wherein said disruption of the Ckl gene comprises at least one member selected from the group consisting of a DNA insertion, a DNA deletion, and a DNA substitution of at least one base pair in the Ckl gene.

24. The method of claim 22 or 23, wherein disrupting in a plant cell a Ckl gene, comprises targeted mutagenesis, homologous recombination, or mutation breeding.

25. The method of claim 23 or 24, wherein the DNA insertion comprises

(a) a DNA insertion in the 5'UTR of the Ckl gene;

(b) a DNA insertion in an exon of the Ckl gene; or

(c) a DNA insertion in an intron of the Ckl gene.

26. A plant or plant cell produced by the method of any one of claims 22-25.

27. A progeny plant of the plant of claim 26, wherein the progeny plant comprises the disrupted Ckl gene.

28. The plant or plant cell of claim 26 or the progeny plant of claim 27, wherein the disruption comprises a non-naturally occurring mutation.

29. The plant or plant cell of claim 26 or 28 or the progeny plant of claim 27 or 28, wherein the plant, plant cell, or progeny plant is non-transgenic or transgenic.

30. A method of producing a plant with enhanced resistance to an oomycete plant pathogen, the method comprising stably incorporating in the genome of at least one plant cell a polynucleotide construct comprising a promoter operably linked to a transcribed region, wherein the promoter is expressible in a plant cell, and wherein the transcribed region is designed to produce a transcript for post-transcriptional gene silencing or antisense-mediated gene silencing of CKL, wherein the expression of the transcribed region decreases the expression level or activity of CKL in the plant or part thereof.

31. The method of claim 30, wherein the transcript for post-transcriptional gene silencing comprises an miRNA, an siRNA, an hpRNA or a dsRNA.

32. The method of claim 30 or 31, wherein the plant cell is regenerated into a plant comprising in its genome the polynucleotide construct.

33. The method of any one of claims 22-25 and 30-32, wherein the plant is selected from the group consisting of Arabidopsis spp., soybean, grape, castor bean, black cottonwood, Physcomitrella patens, Selaginella moellendorffli, potato, tomato, eggplant, pepper, tobacco, petunia spp., lettuce, pea, bean, spinach, melon, cucumber, squash, Brassica spp., radish, onion, and watermelon.

34. The method of any one of claims 22-25 and 30-33, wherein the oomycete plant pathogen is a Phytophthora species.

35. The method of any one of claims 22-25 and 30-33, wherein the oomycete plant pathogen is selected from the group consisting of Phytophthora infestans, Phytophthora ipomoeae, Phytophthora mirabilis, Phytophthora phaseoli, Phytophthora capsici,

36. A plant or plant cell produced by the method of any one of claims 1-15, 17-25, and 30-35.

37. A progeny plant of the plant of claim 36, wherein the disruption comprises a non-naturally occurring mutation and/or wherein the progeny plant comprises the

polynucleotide construct.

38. A plant comprising in its genome a disruption of the Ckl gene, wherein the expression level or activity of the plant CKL is decreased in the plant, and wherein said plant has enhanced resistance to an oomycete plant pathogen.

39. The plant of claim 38, wherein said disruption of the Ckl gene comprises at least one member selected from the group consisting of a DNA insertion, a DNA deletion, and a DNA substitution of at least one base pair in the Ckl gene.

40. The plant of claim 38 or 39, wherein the disruption of the Ckl gene is a homozygous disruption.

41. The plant of any one of claims 38-40, wherein the disruption comprises a non- naturally occurring mutation.

42. The plant of any one of claims 38-41, wherein the plant is non-transgenic or transgenic.

43. A transgenic plant comprising stably incorporated in its genome a

polynucleotide construct comprising a promoter operably linked to a transcribed region, wherein the promoter is expressible in a plant cell, wherein the transcribed region is designed to produce a transcript for post-transcriptional gene silencing or antisense-mediated gene silencing of CKL, and wherein the expression of the transcribed region decreases the expression level or activity of CKL in the plant cell, thereby enhancing the resistance of the plant to an oomycete plant pathogen.

44. The transgenic plant of claim 43, wherein the transcript for post- transcriptional gene silencing comprises an miR A, an siR A, an hpR A or a dsR A.

45. The plant of claim 38-44, wherein the plant is a Solanaceous plant.

46. The plant of any one of claims 38-44, wherein the plant is selected from the group consisting of Arabidopsis spp., soybean, grape, castor bean, black cottonwood, Physcomitrella patens, Selaginella moellendorffii, potato, tomato, eggplant, pepper, tobacco, petunia spp., lettuce, pea, bean, spinach, melon, cucumber, squash, Brassica spp., radish, onion, and watermelon.

47. The transgenic plant of any of claims 43-46, wherein the transgenic plant is a seed or a tuber comprising the polynucleotide construct.

A fruit, seed, or tuber produced by the plant of any one of claims 26-29 and

49. A food product produced using the fruit, seed, or tuber of claim 48.

50. A method of limiting disease caused by an oomycete plant pathogen in agricultural crop production, the method comprising planting the plant according to any one of claims 26-29 and 36-47 and exposing the plant to conditions favorable for growth and development of the transgenic plant.

51. The method of claim 50, further comprising harvesting an agricultural product produced by the plant.

52. Use of the plant of any one of claims 26-29 and 36-47 in agriculture.